CN101633915B - Trypanosoma brucei phenylalanyl-tRNA synthetase preparation method - Google Patents
Trypanosoma brucei phenylalanyl-tRNA synthetase preparation method Download PDFInfo
- Publication number
- CN101633915B CN101633915B CN2009100566865A CN200910056686A CN101633915B CN 101633915 B CN101633915 B CN 101633915B CN 2009100566865 A CN2009100566865 A CN 2009100566865A CN 200910056686 A CN200910056686 A CN 200910056686A CN 101633915 B CN101633915 B CN 101633915B
- Authority
- CN
- China
- Prior art keywords
- phers
- pet21a
- phenylalanyl
- trna synthetase
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to a trypanosoma brucei phenylalanyl-tRNA synthetase preparation method, belonging to the technical field of biology and the preparation method comprises the following specific steps: separately designing primers, amplifying the alpha subunit and beta subunit genes of trypanosoma brucei phenylalanyl-tRNA synthetase; cloning the alpha subunit and beta subunit genes into prokaryotic expression vector pET21a(+), building pET21a(+)-PheRS alpha and pET21a(+)-PheRS beta expression vector; subcloning the operon of alpha subunit into pET21a(+)-PheRS beta, forming recombinant co-expression vector pET21a(+)-PheRS alpha beta; transforming the recombinant co-expression vector pET21a(+)-PheRS alpha beta into colibacillus BL21(DE3)RIPL, inducting expression with IPTG; collecting the supernate of the lysed bacteria solution, purifying proteins and obtaining the trypanosoma brucei phenylalanyl-tRNA synthetase. The invention builds the recombinant plasmid of the trypanosoma brucei phenylalanyl-tRNA synthetase (PheRS), and expresses and purifies trypanosoma brucei phenylalanyl-tRNA synthetase protein, thus laying a foundation for the screening of antiparasitic agent.
Description
Technical field
The present invention relates to a kind of preparation method of enzyme of biological technical field, specifically is a kind of preparation method of Trypanosoma brucei phenylalanyl-tRNA synthetase.
Background technology
Trypanosoma bocagei is a kind of the peculiar parasite in Sub-Saharan Africa area, can cause tsetse fly disease or nona after invading the host, causes 50,000～200,000 death every year.Trypanosome is mainly bitten by tsetse fly and is infected to people and livestock, mainly shows as uncomfortable and erratic heating in early days; If untimely treatment, parasite can be invaded central nervous system, finally causes stupor and causes death.The medicine of Cun Zaiing all exists some defectives in the market, all is the problem that needs solution such as drug toxicity, shortage parenteral management resistance etc.
In recent years, greatly develop along with biochemical, and the cracking successively of trypanosome genome sequence, for seeking new drug target, we provide good basis.Aminoacyl-tRNA synthetase (aaRS) is the class key enzyme in the protein biosynthetic process, in case aaRS be suppressed, its corresponding tRNA just can not in conjunction with, and then influence whole translation process.Albumen is synthetic to be suppressed, and can cause whole cell to be in the growth tranquillization.Therefore, can suppress the compound of aminoacyl-tRNA synthetase can be as the potential anti-infection agent.At present, a kind of aminoacyl-tRNA synthetase inhibitor mupirocin only being arranged---isoleucyl-tRNA synthetic enzyme (IleRS) inhibitor is as the antiseptic-germicide that has gone on the market.Therefore carry out medicinal design and screening with aminoacyl tRNA synthetase, extraordinary prospect is arranged.Phenylalanyl-tRNA synthetase (PheRS) is one of maximum aminoacyl-tRNA synthetase, by α
2β
2The tetramer constitutes, and it is expressed and purifying has very big difficulty.
Find through literature search prior art, Nina Moor has delivered the 260th～267 page of " Protein Expression andPurification " (" protein expression and purifying ") 24 phase in 2002 and has been entitled as " Cloning and Expression of Human Phenylalanyl-tRNA Synthetase inEscherichia coli:Comparative Study of Purified Recombinant Enzymes " (" people's phenylalanyl-tRNA synthetase clonal expression in intestinal bacteria: research is recombinase of purifying relatively "), provided the method for the human phenylalanyl-tRNA synthetase of expression and purification in the article, but the expression and purification complex steps of this method is lower to the expression efficiency of Trypanosoma brucei phenylalanyl-tRNA synthetase.
Summary of the invention
The objective of the invention is to overcome the deficiencies in the prior art, a kind of preparation method of Trypanosoma brucei phenylalanyl-tRNA synthetase is provided.The present invention makes up the recombinant plasmid of trypanosoma bocagei phenylalanine tRNA synthetic enzyme (PheRS), and expression and purification goes out trypanosoma bocagei phenylalanine tRNA synthetase albumen.
The present invention realizes by following technical scheme, the present invention relates to a kind of preparation method of Trypanosoma brucei phenylalanyl-tRNA synthetase, comprises the steps:
In the step 1, the primer of amplification α subunit gene is:
Upstream primer: 5 ' ATGAGTACCATGGAGAACACCATTCT;
Downstream primer: 5 ' AAAACGCATTAGCTTTGAGTTCC.
In the step 1, the primer of amplification beta subunit gene is:
Upstream primer: 5 ' ATGCCAACCCTCGCTGTTGTGCGTGAT;
Downstream primer: 5 ' CTGGGCAAACTGAACATTCAGCTC.
In the step 3, the primer sequence of amplification α subunit gene operon is:
Upstream primer: 5 ' GCATTAGGAAGCAGCCCAGTAGTAG;
Downstream primer: 5 ' AGGCAGATCTAGTTATTGCTCAGCG.
In the step 5, described purifying adopts the affinity chromatography method.
In the step 5, during purifying, with the elutriant wash-out affinity column that contains the 1M imidazoles.
Compared with prior art, the present invention has following beneficial effect: the present invention makes up the recombinant plasmid of trypanosoma bocagei phenylalanine tRNA synthetic enzyme (PheRS), and expression and purification goes out trypanosoma bocagei phenylalanine tRNA synthetase albumen; Step of the present invention is simple, and purification effect is good, for the screening of anti-parasite medicine is laid a good foundation.
Among the present invention related bacterial strain bacillus coli DH 5 alpha " Wang Lingling, poplar is collected, yellow really it, Wang Haihong; Intestinal bacteria holo-ACP crosses the synthetic of expression, separation and purification and long-chain acyl ACP, microorganism journal, 2008,48 (7): 963～969 " open in the document.The bacterial strain that the present invention relates to can be obtained by disclosing commercially available commercial channel, as sky, Shanghai root biotech firm, and CompanyAddress: Room 606, No. 1 building, No. 27 boats star commercial affairs building, Shanghai City Cao Xilu 258 lanes.
The e. coli bl21 that the present invention relates to (DE3) RIPL is at " Zhang Meixiang, Zhang Xiaomei, Fan Sanhong, Luo Longhai, Yan Xiaohua, Guo Aiguang; Arabidopis thaliana Alpha-dioxygenase 2 prokaryotic expressions, purifying and Subcellular Localization prediction, Journal of Agricultural Biotechnology, 2007,15 (5): 816～820 " can obtain by openly showing the commercial channel of selling, as buying from U.S. stratagene company, strain number is B0003.
Description of drawings
Fig. 1 is the agarose gel electrophoresis figure of the α subunit β subunit of pcr amplification trypanosoma bocagei PheRS;
Fig. 2 is the design of graphics of reorganization co-expression plasmid pET21a (+)-PheRS α β;
Fig. 3 is that the enzyme of co-expression carrier pET21a (+)-PheRS α β is cut the evaluation collection of illustrative plates;
Fig. 4 analyzes the abduction delivering collection of illustrative plates of recombinant protein for SDS-PAGE;
Fig. 5 induces the purifying collection of illustrative plates for what SDS-PAGE analyzed recombinant protein;
Fig. 6 measures the activity curve of PheRS for radioisotope method.
Embodiment
Further set forth the present invention below in conjunction with specific embodiment.Be interpreted as: these embodiment only are used to the present invention is described and are not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, Sambrook equimolecular clone for example: laboratory manual is seen the condition described in the New York ColdSpring Harbor Laboratory press version in 1989, or the condition of advising according to manufacturer.
Embodiment
1, the acquisition of the α subunit gene of PheRS
(1) the complete genome DNA 20 μ g that get trypanosoma bocagei are as template, and by the method amplifying target genes fragment of PCR, the upstream and downstream primer of amplification usefulness all is the primers through the PAGE purifying, wherein,
Upstream (Primer F): 5 ' ATGAGTACCATGGAGAACACCATTCT,
Downstream (Primer R): 5 ' AAAACGCATTAGCTTTGAGTTCC;
(upstream sequence is seen SEQ ID NO:1, and downstream sequence is seen SEQ ID NO:2).
(2) carry out PCR reaction with the Pfu polysaccharase, wherein template is a genomic dna, the primer be Primer F, with Primer R, 98 ℃ of pre-sex change 2min, 95 ℃ of sex change 1min, 55 ℃ of renaturation 1min, 68 ℃ are extended 3min, totally 35 circulations, and last 72 ℃ are extended 10min; Product behind pcr amplification adds 5 * sample-loading buffer, agarose gel electrophoresis with 1% is identified, be found that a band is arranged at the 1.5Kb place, the results are shown in Figure 1, Fig. 1 is the agarose gel electrophoresis figure M:5000bp DNA marker of the α subunit β subunit of pcr amplification trypanosoma bocagei PheRS; The α subunit gene of the PheRS of 1:PCR amplification.
2, the acquisition of the beta subunit gene of PheRS
(1) with the preparation method of the α subunit gene of PheRS, by method amplifying target genes fragment from the complete genome DNA of trypanosoma bocagei of PCR, the upstream and downstream primer sequence of amplification usefulness is as follows equally:
Upstream (Primer F): 5 ' ATGCCAACCCTCGCTGTTGTGCGTGAT,
Downstream (Primer R): 5 ' CTGGGCAAACTGAACATTCAGCTC;
(upstream sequence is seen SEQ ID NO:3, and downstream sequence is seen SEQ ID NO:4).
(2) the PCR reaction conditions is 95 ℃ of sex change 1min, 58 ℃ of renaturation 1min, and 68 ℃ are extended 3min, totally 35 circulations, last 72 ℃ are extended 10min;
(3) product behind the pcr amplification identifies at the 1.8Kb place band is arranged with 1% agarose gel electrophoresis after adding 5 * sample-loading buffer, the results are shown in Figure 1, the beta subunit gene of the PheRS of swimming lane 2:PCR amplification.
Behind the α gene and β gene segment of purifying pcr amplification, react 30min phosphorylation gene segment respectively, and make enzyme deactivation in 70 ℃ of processing 10min with 37 ℃ of PNK enzymes.Use PmeI enzymic digestion expression plasmid pET21a (+)-PmeI simultaneously, react 30min with postdigestive carrier dephosphorylation, and make enzyme deactivation in 85 ℃ of reaction 15min with 37 ℃ of CIAP enzymes.With the T4DNA ligase enzyme respectively goal gene segment α gene, β gene after the phosphorylation are connected into through the PmeI restriction enzyme handle and dephosphorylation after expression vector pET21a (+)-PmeI in, construction expression plasmid pET21a (+)-PheRS α, pET21a (+)-PheRS β.Plasmid transformation escherichia coli DH5 α competent cell (purchasing in sky root biochemical corp), the extracting plasmid DNA is cut through enzyme and to be identified and sequencing analysis is used for the structure of co-expression carrier after correct.
With pET21a (+)-PheRS β is parent, makes up the operon system of genetic expression of the binocular of double-promoter on this basis.The method that makes up is seen shown in Figure 2ly, amplifies T7promoter with the method for PCR from pET21a (+)-PheRS α, and goal gene α is at interior operon; Then its subclone is gone into the promotor front of pET21a (+)-PheRS β, thereby form the plasmid of coexpression.Fig. 2 is the design of graphics of reorganization co-expression plasmid pET21a (+)-PheRS α β, is set out by recombinant expression vector pET21a (+)-PheRS α and group expression vector pET21a (+)-PheRS β, makes up recombinant co-expression plasmid pET21a (+)-PheRS α β;
From pET21a (+)-PheRS α amplification gene α operon, be template with pET21a (+)-PheRS α at first, the method for PCR amplifies and comprises T7promoter, and goal gene α is at interior operon, and wherein related primer is as follows:
Upstream primer F:5 ' GCATTAGGAAGCAGCCCAGTAGTAG,
Downstream primer R:5 ' AGGC
AGATCTAGTTATTGCTCAGCG;
BglII
(upstream sequence is seen SEQ ID NO:5, and downstream sequence is seen SEQ ID NO:6).
The goal gene that amplifies is used the BglII digestion with restriction enzyme after reclaiming purifying, connect into the T4DNA ligase enzyme among pET21a (+)-PheRS β that digests with same restriction endonuclease, makes up co-expression carrier pET21a (+)-PheRS α β.Transformed into escherichia coli DH5 α competent cell then, the extracting plasmid DNA is identified correct recombinant clone through the BglII restriction enzyme, and with the terminal cessation method mensuration of the two deoxidations of Sanger dna sequence dna.Enzyme cut evaluation figure see shown in Figure 3, the co-expression plasmid of reorganization with the BamHI enzymic digestion after, the fragment of 9kb appears being about, after the BglII enzyme was cut digestion, the segment of 1.7kb and 7.2kb size appearred.The enzyme of Fig. 3 co-expression carrier pET21a (+)-PheRS α β is cut the evaluation collection of illustrative plates, among the figure: M:1kb DNAmarker; Segment behind the 1:BamHI digestion with restriction enzyme; Segment behind the 2:BglII digestion with restriction enzyme.
To cut and check order after identifying among correct co-expression carrier pET21a (+)-PheRS α β transformed into escherichia coli expression strain BL21 (DE3) RIPL through enzyme.Contain single colony inoculation of expression bacterium of co-expression carrier to containing in the LB substratum that 2ml contains acillin 100mg/L with above-mentioned through evaluation, 37 ℃ of activation culture of spending the night are the LB substratum that is inoculated into 500ml at 1: 1000 by volume, and 37 ℃ of 150rpm shake bacterium, about 4h treats A
550OD is 0.3～0.8 o'clock, takes out culturing bottle, and after the cooled on ice, adding IPTG is 0.1mmol/L to final concentration, 20 ℃～25 ℃ incubated overnight.Bacterium liquid after collection is not induced and induced respectively carries out 8% SDS-polyacrylamide gel electrophoresis, and abduction delivering the results are shown in Figure 4, among Fig. 4: by swimming lane 1,2, can see and induce back α subunit (55KD) and β subunit (72KD) to locate all to have abduction delivering; Fig. 4 analyzes the abduction delivering collection of illustrative plates M of recombinant protein for SDS-PAGE: standard protein Marker; 1: without inductive bacterium liquid; 2:IPTG induces later bacterium liquid; 3: the supernatant of inducing the back cracking to obtain; 4: the precipitation of inducing the back cracking to obtain;
1, protein purification pre-treatment: get bacterium liquid 4800rpm behind the IPTG abduction delivering, 20min abandons supernatant, collects thalline.Add 10ml pH value and be the resuspended precipitation of 1 * PBS of 7.8 precooling, add N,O-Diacetylmuramidase to final concentration 1mg/mL, proteinase inhibitor PMSF is to final concentration 1mmol/L; The ultrasonication cell, power 200W～400W, ultrasonic 3s stops 6s, and ultrasonic 30min altogether when solution not behind the thickness, adds Triton-100 to final concentration 1% (W/V); 4 ℃, 13000rpm, centrifugal 20min collects supernatant respectively and carries out 8% SDS-polyacrylamide gel electrophoresis with precipitation, the results are shown in Figure swimming lane 3,4 in 4, and the albumen majority after the expression exists with the inclusion body form of indissoluble;
2, the proteic purifying of Trypanosoma brucei phenylalanyl-tRNA synthetase
The recombinant protein His-Bind affinitive layer purification of expressing, the deionized water that in the exchange column that adds column material, adds 3 times of column volumes successively, the exchange buffering liquid of 5 times of column volumes (50mM single nickel salt) carries out the exchange of nickel ion, binding buffer liquid (the 0.5M NaCl of 6 times of column volumes, the 5mM imidazoles, 20mMTris-HCl, PH7.9), supernatant liquor is crossed post, the binding buffer liquid of 10 times of column volumes, the lavation buffer solution of 6 times of column volumes (0.5M NaCl, 60mM imidazoles, 20mM Tris-HCl, PH7.9), 6 times of column volume elution buffers (1M imidazoles, 0.5M NaCl, 20mM Tris-HCl, PH7.9), be in charge of the wash-out target protein, collect target protein, above flow rate control is at 1 column volume/6min.The target protein of collecting is placed dialysis tubing, with 50% (V/V) glycerine, 0.1mg/ml BSA, the 5mmol/L beta-mercaptoethanol, 1 * PBS is behind the dialyzate dialyzed overnight of pH 6.8.Albumen after the dialysis is taken a morsel and carries out the SDS-PAGE electrophoresis, electrophorogram as shown in Figure 5, all the other are in-20 ℃ of preservations.The result shows that the proteic purity that obtains by method purifying provided by the present invention can reach 95%.Fig. 5 induces purifying collection of illustrative plates, M: standard protein Marker for what SDS-PAGE analyzed recombinant protein; 1: without inductive bacterium liquid; 2:IPTG induces later bacterium liquid; 3: the target protein behind the affinitive layer purification.
Adopt radioisotope method, the amount that generates [14C]-Phe-tRNA mixture with enzyme catalysis is measured enzyme activity.Reaction solution comprises (all referring to final concentration): 50mmol/L (pH 7.8) HEPES-KOH, 5mmol/LMgCl
2, 45mmol/L KCl, 10 μ mol/L[14C]-Phe (0.1 μ Ci/ μ L), 0.4mg/mL cereuisiae fermentum tRNA, 0.02% (W/V) BSA, 1mmol/L DTT, 10% (V/V) DMSO, phenylalanyl-tRNA synthetase 20 μ L (the enzyme dilution is 1000 times behind the purifying).Behind the above-mentioned substance mixing, add when final concentration is 2mmol/L ATP and react initial, the mixture final volume is 70 μ L.Pick up counting 37 ℃ of constant temperature reactions down from adding ATP.Every interval 10min gets 3 equal portions, 20 μ L reaction solutions and is added drop-wise on the qualitative filter paper respectively in 40min, and puts into washing by soaking among the 5%TCA solution 100mL immediately, repeats 3 times; The filter paper that takes out is put into washing by soaking in 95% alcohol again, repeat 3 times.Filter paper places oven dry under the infrared lamp, and scintillation counter is measured, and obtains enzymic activity curve as shown in Figure 6.As can be seen from the figure the product growing amount was linear and increases along with the time in 40min.
Because when first speed of reaction and enzyme amount are linear, just speed can reflect the content of enzyme, therefore, what obtain in order to guarantee is reaction speed just, final we select following condition when measuring enzyme activity: with above-mentioned enzyme reaction system, but be chosen in growing amount that every interval 5min in the 20min measures product over time.Enzyme amount when the unit of activity 1U of enzyme is defined as under above-mentioned optimum reaction conditions per minute and generates 1nmol product [14C]-Phe-tRNA.Every milliliter of unit of enzyme (U/mL) is 70 in the zymin that the purifying that records according to aforesaid method comes out.
Sequence table
＜110〉Shanghai Communications University
＜120〉preparation method of Trypanosoma brucei phenylalanyl-tRNA synthetase
<160>6
<170>PatentIn?version?3.3
<210>1
<211>26
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>1
atgagtacca?tggagaacac?cattct 26
<210>2
<211>23
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>2
aaaacgcatt?agctttgagt?tcc 23
<210>3
<211>27
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>3
atgccaaccc?tcgctgttgt?gcgtgat 27
<210>4
<211>24
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>4
ctgggcaaac?tgaacattca?gctc 24
<210>5
<211>25
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>5
gcattaggaa?gcagcccagt?agtag 25
<210>6
<211>25
<212>DNA
<213>Artificial
<220>
＜223〉artificial sequence
<400>6
aggcagatct?agttattgct?cagcg 25
Claims (3)
1. the preparation method of a Trypanosoma brucei phenylalanyl-tRNA synthetase is characterized in that, comprises the steps:
Step 1 designs primer respectively, the α subunit and the beta subunit gene of amplification trypanosoma bocagei phenylalanine tRNA synthetic enzyme;
The primer of described amplification α subunit gene is:
Upstream primer: 5 ' ATGAGTACCATGGAGAACACCATTCT;
Downstream primer: 5 ' AAAACGCATTAGCTTTGAGTTCC;
The primer of described amplification beta subunit gene is:
Upstream primer: 5 ' ATGCCAACCCTCGCTGTTGTGCGTGAT;
Downstream primer: 5 ' CTGGGCAAACTGAACATTCAGCTC;
Step 2 is cloned into α subunit and beta subunit gene respectively among the prokaryotic expression carrier pET21a (+), makes up pET21a (+)-PheRS α and pET21a (+)-PheRS β expression vector;
Step 3, the operon of amplification α subunit, afterwards with the operon subclone in pET21a (+)-PheRS β, form recombinant co-expression carrier pET21a (+)-PheRS α β, concrete steps are: with pET21a (+)-PheRS β is parent, make up the operon system of genetic expression of the binocular of double-promoter on this basis, amplify T7promoter with the method for PCR from pET21a (+)-PheRS α, goal gene α is at interior operon; Then its subclone is gone into the promotor front of pET21a (+)-PheRS β, thereby form the plasmid of coexpression, the primer sequence of amplification α subunit gene operon is:
Upstream primer: 5 ' GCATTAGGAAGCAGCCCAGTAGTAG,
Downstream primer: 5 ' AGGCAGATCTAGTTATTGCTCAGCG;
Step 4, in recombinant co-expression carrier pET21a (+)-PheRS α β transformed into escherichia coli BL21 (DE3) RIPL, the IPTG abduction delivering;
Step 5, the bacterium liquid supernatant after the collection cracking, purifying protein gets Trypanosoma brucei phenylalanyl-tRNA synthetase.
2. the preparation method of Trypanosoma brucei phenylalanyl-tRNA synthetase according to claim 1 is characterized in that, in the step 5, described purifying adopts the affinity chromatography method.
3. the preparation method of Trypanosoma brucei phenylalanyl-tRNA synthetase according to claim 2 is characterized in that, in the step 5, uses the elutriant wash-out affinity column that contains the 1M imidazoles during purifying.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100566865A CN101633915B (en) | 2009-08-20 | 2009-08-20 | Trypanosoma brucei phenylalanyl-tRNA synthetase preparation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100566865A CN101633915B (en) | 2009-08-20 | 2009-08-20 | Trypanosoma brucei phenylalanyl-tRNA synthetase preparation method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101633915A CN101633915A (en) | 2010-01-27 |
| CN101633915B true CN101633915B (en) | 2011-06-08 |
Family
ID=41593255
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100566865A Active CN101633915B (en) | 2009-08-20 | 2009-08-20 | Trypanosoma brucei phenylalanyl-tRNA synthetase preparation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101633915B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181516A (en) * | 2011-02-18 | 2011-09-14 | 中国医学科学院医药生物技术研究所 | PheRS enzyme activity determination system and screening method of PheRS inhibitor |
| CN111118048B (en) * | 2019-11-11 | 2022-06-10 | 浙江大学 | Use of chimeric phenylalanyl-tRNA synthetases/tRNAs |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1156180A (en) * | 1995-09-05 | 1997-08-06 | 底古萨股份公司 | Producing tryptophane from colibacillus |
| CN1485434A (en) * | 2002-09-26 | 2004-03-31 | 中国科学院武汉病毒研究所 | Method for manufacturing egg white chip of aminoacyl transfer RNA synthetase identification type |
-
2009
- 2009-08-20 CN CN2009100566865A patent/CN101633915B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1156180A (en) * | 1995-09-05 | 1997-08-06 | 底古萨股份公司 | Producing tryptophane from colibacillus |
| CN1485434A (en) * | 2002-09-26 | 2004-03-31 | 中国科学院武汉病毒研究所 | Method for manufacturing egg white chip of aminoacyl transfer RNA synthetase identification type |
Non-Patent Citations (8)
| Title |
|---|
| 135. |
| 135.;Levin I.Purification, crystallization and preliminary X-ray characterization of a human mitochondrial phenylalanyl-tRNA synthetase.《Acta Cryst》.2007,第63卷(第9期),761− * |
| 267. * |
| 764. |
| 764.;Moor N.Cloning and expression of human phenylalanyl-tRNA synthetase in Escherichia coli: comparative study of purified recombinant enzymes.《Protein Expres Purif》.2002,第24卷(第2期),260− * |
| LevinI.Purification crystallization and preliminary X-ray characterization of a human mitochondrial phenylalanyl-tRNA synthetase.《Acta Cryst》.2007 |
| Moor N.Cloning and expression of human phenylalanyl-tRNA synthetase in Escherichia coli: comparative study of purified recombinant enzymes.《Protein Expres Purif》.2002,第24卷(第2期),260− |
| 姚璎.布氏锥虫苯丙氨酰-tRNA 合成酶在大肠杆菌中的克隆、表达、纯化及活性测定.《生物工程学报》.2010,第26卷(第1期),130− * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101633915A (en) | 2010-01-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105543193A (en) | N-acyle homoserine lactonase and encoding gene and recombinant bacteria thereof | |
| CN107022538A (en) | The deacetylase and its encoding gene of a kind of high-glucosamine-yield | |
| CN105884871B (en) | A kind of bacillus marinus albumen with anti-tumor activity and its preparation and application | |
| CN101633915B (en) | Trypanosoma brucei phenylalanyl-tRNA synthetase preparation method | |
| CN101812459A (en) | Nucleic acid for encoding antimicrobial peptide Lactoferricin B and prokaryotic expression method thereof | |
| CN102586286B (en) | Expression system of bacillus thur ingiens (Bt) insecticidal protein Cry1Ac-a | |
| CN102465134B (en) | Method for preparing recombinant anthropogenic Cu/Zn superoxide dismutase | |
| CN112852794B (en) | Clostridium perfringens bacteriophage lyase and application thereof | |
| CN109402032B (en) | Genetic engineering bacterium for producing resuscitation promoting factor RpfE and application thereof | |
| CN108070599B (en) | High-efficiency expression of recombinant porcine interleukin 22 in escherichia coli and application thereof | |
| CN112322599A (en) | Transaminase UPTA, preparation method and application | |
| CN110591992A (en) | Genetically engineered bacterium capable of efficiently degrading tetracycline antibiotics and construction and application thereof | |
| CN106834328B (en) | S-ribosyl homocysteine lyase gene recombinant expression vector and expression method and application thereof | |
| CN101979572B (en) | Preparation for South China Sea conus striatus toxin S4.3 and application | |
| CN108794613A (en) | It is a kind of with the Hong Kong oyster LysM albumen and its encoding gene of bacteriostatic activity and application | |
| CN108864273B (en) | Simulated human-derived antibacterial peptide and preparation method thereof | |
| Hamdayanty et al. | Expression of recombinant Sugarcane streak mosaic virus coat protein gene in Escherichia coli | |
| CN103509100A (en) | Interleukin-1acceptor antagonist mutant | |
| CN101979589A (en) | Monoamine oxidase C-like (MaoC) dehydratase gene clone, method for preparing protein and application thereof | |
| CN108048475B (en) | Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria | |
| CN101962654B (en) | Overexpression of thymidylate synthase in colon bacillus | |
| CN101565462B (en) | Large yellow croaker BPI-BN protein, primer and applications thereof in preparing antibiotic drugs | |
| CN105087515B (en) | A kind of preparation method and application of purine nucleoside phosphorylase | |
| CN103710328A (en) | Preparation and preservation method for colon bacillus acetohydroxyacid synthase | |
| CN103087189A (en) | Method for obtaining polyclonal antibody of sheep independent growth factor 1B |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: TAIZHOU XINSHENGYUAN BIOTECHNOLOGY PHARMA CO., LTD Free format text: FORMER OWNER: SHANGHAI JIAO TONG UNIVERSITY Effective date: 20130624 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 200240 MINHANG, SHANGHAI TO: 225300 TAIZHOU, JIANGSU PROVINCE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20130624 Address after: 225300 science building, No. 2, medicine road, Taizhou, Jiangsu, China Patentee after: Taizhou Xinshengyuan Biotechnology Pharma Co., Ltd. Address before: 200240 Dongchuan Road, Shanghai, No. 800, No. Patentee before: Shanghai Jiao Tong University |