CN101619335A - Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR - Google Patents
Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR Download PDFInfo
- Publication number
- CN101619335A CN101619335A CN200810132914A CN200810132914A CN101619335A CN 101619335 A CN101619335 A CN 101619335A CN 200810132914 A CN200810132914 A CN 200810132914A CN 200810132914 A CN200810132914 A CN 200810132914A CN 101619335 A CN101619335 A CN 101619335A
- Authority
- CN
- China
- Prior art keywords
- primer
- pcr
- loop
- stem
- single stranded
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biology, and relates to a method for preparing single chain DNA by processes of preparing positive and negative chain products with different lengths, cutting the colloid and recycling by using primer with a stem-loop sample structure through PCR. In the invention, by downstream stem-loop sample structure primer designed regarding different DNA templates, PCR condition is improved, thus proving that PCR products are all expected two chains: a long chain and a short chain, and can be separated and purified easily through modified colloid. The invention has extensive application prospect in related single chain DNA preparation bio-medical research field comprising SELEX.
Description
Invention field:
The present invention relates to a kind of utilization and have the stem-loop sample structure primer and prepare the method for single stranded DNA by PCR, principal character is the use that has the primer molecule of loop-stem structure, comprises the inverted repeats of 5 ' end, GC content and secondary structure; Relate to the PCR reaction conditions; Relate to the primer and the application of PCR in the single stranded DNA preparation of loop-stem structure in the invention.
Background technology:
The same with the RNA molecule, single stranded DNA (ssDNA) structure is variable flexibly, the three-dimensional structure complexity be easy to form and target bonded bag structure, so single strand dna oligonucleotide aglucon (aptamer) has broad prospect of application at molecular recognition, chemical analysis and biomedicine field.Particularly in SELEX (Systematic Evolution of Ligandsby EXponential Enrichment) technical research and application, the preparation of ssDNA is crucial especially.The SELEX technology be by repeatedly strand random dna library and target molecule are hatched, the single stranded DNA of separation and combination, pcr amplification, final obtain high-affinity and the ssDNA sequence target molecule specific combination (aptamer) (Tuerk C, et al.Science1990; 249:505-510).A refabrication that committed step is a single-stranded DNA banks after the enrichment of SELEX screening is removed the minus strand in the double-stranded product of PCR generation, keeps the normal chain with binding ability.Suppose to be mixed with the dsDNA composition in a certain ssDNA library, along with the increase of screening wheel number, the ratio of dsDNA not only can increase in the library so, and can form stable double-spiral structure and do not combine with target molecule, finally cause specific ssDNA aglucon to be lost, SELEX screens failure.Except the SELEX screening, other biomedical sector also usually needs to prepare the DNA of strand.Therefore, effective ssDNA preparation method is with convenient biomedical research.
Current, the method for preparing ssDNA is a lot,, RNA reverse transcription synthetic as: direct chemical, asymmetric PCR, the separation of avidin mark magnetic bead etc.But in actual applications, all there are some problems in these methods, for example: 1, the direct chemical synthesis method is convenient and simple, but the stochastic sequence ssDNA library that utilizes this method can only synthesize known array or design in advance is inapplicable for the unknown nucleotide sequence that obtains through SELEX screening enrichment.Disperse took place in product easily when 2, asymmetric PCR prepared single stranded product, reason may be relevant with PCR system ionic intensity, dNTP concentration etc., particularly, when preparing single stranded product, asymmetric PCR more is prone to diffusing phenomenon again to become dsDNA as template elder generation pcr amplification through the library after the number wheel SELEX screening; In addition, asymmetric PCR all produces double-stranded product usually preceding 10-15 circulation, the strand purity of therefore this method preparation is not high, when existing complementary minus strand interferential drawback 3, avidin mark magnetic bead to separate the preparation single stranded DNA, the minus strand of biotin labeling PCR product, the isolating means of magnetic bead of avidin bag quilt can obtain highly purified positive chain DNA, but this method needs first purified pcr product to remove the interference of biotinylation primer before separating, and organic efficiency often can not satisfy the experiment demand.It also is a factor of restriction experiment that magnetic bead costs an arm and a leg; In addition, if the downstream experiment will be used biotin labeled positive chain DNA, the method that then can't use magnetic bead prepares strand; 4, the RNA reverse transcription prepares the single stranded DNA needs and earlier ssDNA is transcribed into RNA, RNA molecule degraded easily causes losing of aglucon, and transcribes template and need introduce the transcriptase recognition sequence, if these sequences and ssDNA annealing, just may influence screening, so complicated operation is impracticable.
Kelly P.Williams (Nucleic acids research, 1995,4220-4221) wait and to have introduced a kind of new special primer PCR that utilizes and prepare the method for strand, this antisense primer is made up of three parts, the 5 ' end sequence-terminator-complementary sequence that extends.Complementary sequence and template annealing, the function of performance primer; Terminator is the non-nucleotide material that a Taq enzyme can not pass through, and six ethylene glycols (HEGL) molecule is used to stop the extension of positive-sense strand; 5 ' lengthening sequence is the poly-A tail that 20 dA form, and is used to generate the PCR product of long-chain.Therefore, antisense primer and template annealing also can extend minus strand product of being longer than 20 bases of template of generation under the effect of Taq enzyme, and when sense primer is the template extension with this antisense strand, because the Taq enzyme can not be crossed HEGL, therefore the extension of normal chain stops, so the length of normal chain is the same with template.On the PAGE of sex change gel, two chains can obviously separate and then the separation and purification single stranded DNA.This method has obvious superiority aspect the preparation of single stranded DNA, and for example cheap, PCR one goes on foot acquisition etc., but the restriction of being modified needs HEGL to modify when synthetic primer, and a lot of companies do not possess this ability.The lengthening sequence of strand also may influence amplification efficiency with template region annealing, especially in the in-vitro screening later stage, when the situation of enrichment sequences such as a plurality of dT may be contained in the district at random.
Inspired by above-mentioned thinking, the characteristic that the present invention has utilized the dna profiling of secondary structure to stop the Taq enzyme to extend is dexterously improved antisense primer, does not need special modification can produce the PCR product of different lengths.Antisense primer contains two portions, template complementary sequence except 3 ' end, 5 ' end is introduced one section inverted repeats that can form stem ring secondary structure, because inverted repeats is rich in the GC base, has higher Tm value, (55 ℃-65 ℃) still can keep secondary structure in the temperature range that the Taq enzyme can play a role preferably, thereby stop the extension of normal chain.Therefore, two chain length differences of PCR product differ the length of inverted repeats, and two strands can separate and then separation and purification ssDNA significantly on the PAGE of sex change gel.
The method for preparing ssDNA of the present invention is except can be used for all can being used widely in the SELEX technology in preclinical medicine, medicine and pharmacology.
Summary of the invention:
The object of the invention is to design the primer that has loop-stem structure, utilizes PCR to produce the positive and negative chain product of different lengths, and proposition prepares the method for single stranded DNA by loop-stem structure primer and PCR.
The present invention is achieved through the following technical solutions:
At first design has the downstream primer Pstemloop of loop-stem structure.Its 3 ' end is and 20 bases of template complementary that 5 ' end can produce a segment length complementary stem and circlet structure for being rich in one section inverted repeats of GC base, stops the Taq enzyme to extend, thereby causes the downstream primer extension products long.Upstream primer is and template complementary base sequence.
PCR reaction: sex change program and PCR usually with, annealing conditions decide according to the complementary district of primer sequence base sequence, elongating temperature suitably reduces, and is set between 55 ℃-65 ℃, the appropriateness prolongation of extension time is decided on template length.
Behind the pcr amplification, identify two product chains, cut glue and reclaim the purpose single stranded DNA by sex change glue.
Advantage of the present invention:
1) the present invention has the primer of stable loop-stem structure and optimizes the PCR reaction conditions by design, and primer need not to modify, and reacts the single stranded product that can obtain different lengths by PCR, directly cuts glue and reclaims the purpose single stranded DNA.Therefore, simple to operate, save time, cheapness, the single stranded DNA purity height of acquisition, organic efficiency height.
2) the invention solves bottleneck problem in the single stranded DNA preparation in the traditional SELEX operation, also have a wide range of applications at other biomedical sector that relates to the single stranded DNA preparation, thereby vast market prospect and economic benefit will be arranged.
Description of drawings:
The loop-stem structure that the primer of Fig. 1 the present invention design produces.
The amplification of Fig. 2 loop-stem structure primer PCR produces different lengths extension products schematic diagram.
Fig. 3 different templates single stranded DNA produces the electrophorogram of different lengths single stranded product through the loop-stem structure primer amplification.
1, GP45ssDNA template; 2, GP45ssDNA is through the product of loop-stem structure primer PCR amplification; 3, LG45ssDNA is through the product of loop-stem structure primer PCR amplification; 4, LG45ssDNA template; M, double chain DNA molecule amount standard.
The extension products radioactive automatic developing figure of Fig. 4 primer.
Embodiment:
Describe the present invention in detail below by loop-stem structure downstream primer and the PCR at different single stranded DNA stencil design respectively.
1. at the downstream primer of different single stranded DNA stencil design loop-stem structures:
GP45 template (88nt):
5’-GCAATGGTACGGTACTTCC(45N)CAAAAGTGCACGCTACTTTGCTAA-3’
Primer:
Upstream primer (Plong-1): 5 '-GCAATGGTACGGTACTTCC-3 '
Downstream primer (P11): 5 '-TTAGCAAAGTAGCGTGCACTTTTG-3 '
Loop-stem structure downstream primer (Pstemloop) is (Fig. 1):
5’-
GCTAAGCGGGTGGGACTTCCTAGTCCCACCCGCTTAGCAAAGTAGCGTGCACTTTTG-3’
LG45 template (81nt):
5’-GCCTGTTGTGAGCCTCCT(45N)CGCTTATTCTTGTCTCCC-3’
Primer:
Upstream primer (LGP5): 5 '-GCCTGTTGTGAGCCTCCT
Loop-stem structure downstream primer (LGP3stemloop) is (Fig. 1):
5’-
GCGTCGCGAGGTGCGACTTAATAGTCGCACCTCGCGACGCGGGAGACAAGAATAAGCG-3’
Annotate: the underscore sequence is the loop-stem structure part that contains inverted repeats.
After above-mentioned template and primer sequence were synthesized by Invitrogen company, with the distilled water dissolving, primer is diluted to 50 μ M, deposits for-20 ℃, and was standby respectively.
2. labelled with radioisotope primer:
Utilize T4 Polynucleotide Kinase and [γ-
32P] ATP, carry out radio-labeling by phosphorylation reaction to 5 ' end of synthetic Oligonucleolide primers.Press DNA 5 ' end mark test kit (MEGALABEL Kit, TaKaRaBiotechnology Co., Ltd, D6070) explanation carry out.Contain the 5-10pmole primer in the 10 μ l systems, 50 μ Ci[γ-32P] ATP and 10U T4PNK.37 ℃ of phosphorylation reaction 40min, 70 ℃ of 10min inactivators.The method of ethanol sedimentation remove most of unreacted [γ-
32P] ATP, the primer of purifying mark.
3.PCR amplification:
PCR system: contain 10 μ l10X damping fluids, 0.2mM dNTPs, 0.5 μ M upstream and downstream primer, 10nM template, 2U Taq archaeal dna polymerase in the 100 μ l systems.
PCR condition: 95 ℃ of pre-sex change 5min; 94 ℃ of sex change 1min, 37 ℃ of annealing 30sec, 58 ℃ are extended 40sec, 30 circulations of increasing; Last 58 ℃ are extended 2min eventually.
4. identify:
7M urea 10% denaturing polyacrylamide gel electrophoresis, Goldview dyeing or silver dye evaluation (Fig. 3).Perhaps radioactive automatic developing is analyzed primer extension position (Fig. 4).
5. the purpose strand is cut the glue recovery:
(1) glue after will dyeing is placed on the long-wave ultra violet lamp, opens ultraviolet lamp, observes the DNA electrophoretic band;
(2) under the shield cap protection, sharp knife blade cuts the purpose band, and moves in the 1.5ml centrifuge tube.
(3) add 400 μ l gel elution buffers (1m mol/L EDTA, pH 8.0,7M urea for 0.5mol/L NH4Ac, 0.2%SDS), more than 37 ℃ of wash-out 6hr;
(4) draw elutriant in new 1.5ml centrifuge tube, not with the gel sucking-off;
(5) the 1M MgCl2 of adding 1/100 volume, the 3mol/LNaAc of 1/10 volume (pH5.2), the dehydrated alcohol of 2.5 times of volumes is placed more than the 6hr for-70 ℃;
(6) 4 ℃, 14000r/m, centrifugal 30min;
(7) supernatant discarded, centrifugal behind 70% alcohol flushing of precipitation with 4 ℃ of precoolings with 6;
(8) supernatant discarded is deposited in drying at room temperature;
(9) drying is good DNA is dissolved in an amount of tri-distilled water.-20 ℃ of preservations are standby.
Experimental result:
Utilize the loop-stem structure downstream primer to produce two positive and negative chain products that are uneven in length, on sex change glue, can obviously obtain separating through pcr amplification.
Can obtain conclusion by Fig. 3: the loop-stem structure primer has produced two positive and negative chain products that are uneven in length through pcr amplification, and this structure primer is applicable to different dna profilings.
Can be reached a conclusion by Fig. 4: loop-stem structure downstream primer extension products is a long-chain, has more the sequence of loop-stem structure part than template, thereby moves slow; The upstream primer extension products overwhelming majority is identical with template position, is purpose normal chain, produces long-chain owing to the downstream primer loop-stem structure unwinds on a small quantity.
Claims (5)
1. primer with stem-loop sample structure of a utilization prepares the method for single stranded DNA by the PCR mode.It is characterized in that can producing two positive and negative ssDNA chains that length is different by PCR, two strands can separate and separate significantly on the PAGE of sex change gel.
2. according to method described in the claim 1, the downstream primer 5 ' end of loop-stem structure is to contain one section inverted repeats that is rich in the GC base, has higher Tm value and forms stable loop-stem structure.
3. according to method described in the claim 1, the downstream primer 5 ' end of loop-stem structure still can keep secondary structure in the temperature range that the Taq enzyme can play a role preferably.
4. according to method described in the claim 1, the elongating temperature of PCR can be 55 ℃ of-65 ℃ of arbitrary numbers.
5. the described primer that utilizes loop-stem structure of claim 1 is preparing the single stranded DNA Application for Field by the method that PCR produces the positive and negative chain product of different lengths.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101329148A CN101619335B (en) | 2008-07-01 | 2008-07-01 | Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101329148A CN101619335B (en) | 2008-07-01 | 2008-07-01 | Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101619335A true CN101619335A (en) | 2010-01-06 |
| CN101619335B CN101619335B (en) | 2012-04-18 |
Family
ID=41512747
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101329148A Active CN101619335B (en) | 2008-07-01 | 2008-07-01 | Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101619335B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102108403A (en) * | 2010-12-03 | 2011-06-29 | 陈必成 | Screening of expression difference of microRNAs through stem-loop primer with random sequence |
| CN108588050A (en) * | 2018-05-14 | 2018-09-28 | 北京艾克伦医疗科技有限公司 | Archaeal dna polymerase and nucleic acid detection method and kit |
| CN114752665A (en) * | 2022-05-31 | 2022-07-15 | 深圳市萨米医疗中心 | Detection method and detection kit for small fragment DNA |
| CN117701679A (en) * | 2024-02-06 | 2024-03-15 | 中国医学科学院基础医学研究所 | Single-stranded DNA specific high-throughput sequencing method based on 5' connection |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6117635A (en) * | 1996-07-16 | 2000-09-12 | Intergen Company | Nucleic acid amplification oligonucleotides with molecular energy transfer labels and methods based thereon |
| CN1456684A (en) * | 2003-03-26 | 2003-11-19 | 中国科学院生态环境研究中心 | Induction design plan for PCR-DGGE research on environment microorgan population |
| WO2007117256A1 (en) * | 2005-05-31 | 2007-10-18 | Applera Corporation | Multiplexed amplification of short nucleic acids |
| CN101082060B (en) * | 2006-06-01 | 2012-09-05 | 苏州吉玛基因药物科技有限公司 | New micro ribonucleic acid quantitative PCR (polymerase chain reaction) detection method |
-
2008
- 2008-07-01 CN CN2008101329148A patent/CN101619335B/en active Active
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102108403A (en) * | 2010-12-03 | 2011-06-29 | 陈必成 | Screening of expression difference of microRNAs through stem-loop primer with random sequence |
| CN108588050A (en) * | 2018-05-14 | 2018-09-28 | 北京艾克伦医疗科技有限公司 | Archaeal dna polymerase and nucleic acid detection method and kit |
| CN114752665A (en) * | 2022-05-31 | 2022-07-15 | 深圳市萨米医疗中心 | Detection method and detection kit for small fragment DNA |
| CN117701679A (en) * | 2024-02-06 | 2024-03-15 | 中国医学科学院基础医学研究所 | Single-stranded DNA specific high-throughput sequencing method based on 5' connection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101619335B (en) | 2012-04-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105506125B (en) | A kind of sequencing approach and a kind of two generation sequencing libraries of DNA | |
| Schmitz et al. | Purification of nucleic acids by selective precipitation with polyethylene glycol 6000 | |
| CN107541516B (en) | Nucleic acid aptamer group for specifically recognizing three marine toxins | |
| CN108103055A (en) | A kind of method of unicellular RNA reverse transcriptions and library construction | |
| CN101619335B (en) | Method for preparing single chain DNA by using primer with stem-loop sample structure through PCR | |
| CN102634586B (en) | Decoding and sequencing method by real-time synthesis of two nucleotides into deoxyribonucleic acid (DNA) | |
| CN105986324A (en) | Construction method and application of cyclic small RNA library | |
| EP1030932A4 (en) | Compositions, methods, kits and apparatus for determining the presence or absence of target molecules | |
| CN112359093B (en) | Method and kit for preparing and expressing and quantifying free miRNA library in blood | |
| CN112680797B (en) | Sequencing library for removing high-abundance RNA and construction method thereof | |
| Marmisollé et al. | RNA-binding protein immunoprecipitation as a tool to investigate plant miRNA processing interference by regulatory proteins of diverse origin | |
| CN114507711B (en) | Single-cell transcriptome sequencing method and application thereof | |
| He et al. | Single-primer-limited amplification: A method to generate random single-stranded DNA sub-library for aptamer selection | |
| Carbonell et al. | Design, synthesis, and functional analysis of highly specific artificial small RNAs with antiviral activity in plants | |
| US20110060135A1 (en) | Selective Purification of Small RNAs from Mixtures | |
| CN104630211A (en) | Method for constructing Small RAN cDNA library | |
| CN101629174B (en) | Simple, efficient and cheap method for purifying forest soil sample DNA | |
| WO2007032817A2 (en) | Pure mirna sample preparation method | |
| Choi et al. | mirRICH, a simple method to enrich the small RNA fraction from over-dried RNA pellets | |
| CN105039501A (en) | Method and device of preparing RNA probe | |
| CN111808994A (en) | RPA primer and detection method for detecting banana streak virus GF isolate | |
| CA2433542C (en) | Ammonium sulfate for neutralization of inhibitory effects | |
| CN103789447B (en) | Method for detecting 5'end tRNA semi-molecules | |
| CN114540344B (en) | Method for screening aptamer | |
| Santos et al. | Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 100850 No. 27 Taiping Road, Beijing, Haidian District Patentee after: Chinese People's Liberation Army Military Medical Research Institute Address before: 100850 No. 27 Taiping Road, Beijing, Haidian District Patentee before: Institute of Basic Medical Sciences |
|
| CP01 | Change in the name or title of a patent holder |