CN101603085B - Magnetic DNA fluorescent probe and preparation method thereof - Google Patents
Magnetic DNA fluorescent probe and preparation method thereof Download PDFInfo
- Publication number
- CN101603085B CN101603085B CN2009100696144A CN200910069614A CN101603085B CN 101603085 B CN101603085 B CN 101603085B CN 2009100696144 A CN2009100696144 A CN 2009100696144A CN 200910069614 A CN200910069614 A CN 200910069614A CN 101603085 B CN101603085 B CN 101603085B
- Authority
- CN
- China
- Prior art keywords
- dna
- solution
- mns
- cdte
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a magnetic DNA fluorescent probe and a preparation method thereof. The probe adopts a magnetic core-shell quantum dot CdTe/MNs nano particle as an energy donor for emitting fluorescence, and the CdTe/MNs nano particle is connected with a single chain 3'-NH2-DNA to form CdTe/MNs-DNA; the probe adopts nano nickel oxide as an energy receptor for absorbing fluorescence, and the nano nickel oxide is connected with a single chain 5'-NH2-DNA to form nNiO-DNA; and the single chain 5'-NH2-DNA and the single chain 3'-NH2-DNA are complementary, and the CdTe/MNs-DNA and the nNiO-DNA are hybridized to form the probe. The preparation method comprises the following steps: 1, preparing the magnetic nano particle MNs; 2, preparing CdTe fluorescent quantum dot solution; 3, preparing CdTe/MNs primary solution; 4, preparing CdTe/MNs-DNA solution; 5, purifying the CdTe/MNs-DNA solution; 6, preparing nNiO; 7, preparing nNiO-DNA solution; 8, preparing the DNA fluorescent probe; and 9, purifying the DNA fluorescent probe.
Description
Technical field
The present invention relates to biotechnology, be specially a kind of magnetic DNA fluorescent probe based on the FRET (fluorescence resonance energy transfer) principle and preparation method thereof.This dna probe can be used for detecting in the liquid environment some and has the small molecules living matter of characteristic DNA sequence.
Background technology
Molecular biology fast development in recent years, new technology constantly occurs, use also increasingly extensive, particularly quick, easy, detect the extensive concern that the potential application foreground of gene order in research fields such as clinical medicine ecsomatics, immunology, biology caused international scientific circle exactly.For the detection of the living matter with specific dna sequence, traditional method mainly is to adopt the method for radio-labeling and polymerase chain reaction (PCR).Because its technical sophistication, apparatus expensive makes the DNA detection broad application be subjected to great restriction.Except round pcr updating, detection method and technology that some are new also constantly are developed, biological example sensing technology etc.At present the DNA biosensor is according to DNA hybridization principle, and the conserved dna segmental characteristics of utilizing every kind of biology to have detect with its complementary dna probe by manually designing and synthesizing one section.According to its detection method difference, the DNA biosensor can be divided into the optical dna biosensor, types such as piezoquartz DNA biosensor and electrochemical DNA biosensor.Wherein the optical dna biosensor has nondestructive operational advantage, higher signal produces and reading speed, makes its Application Areas obtain greatly expansion, becomes the most general biosensor of application, has wide application and development prospect.
Optical dna (biology) transmitter mainly contains fluorescence optical fiber DNA transmitter, fluorescent probe DNA transmitter, surface-enhanced Raman DNA transmitter and surface plasma resonance DNA transmitter etc.
Obtained approval in the application of DNA chip in recent years based on fluorescently-labeled detection architecture.Many detection methods can adopt fluorescence to carry out, and confession-acceptor that these detection methods mainly depend on DNA organic fluorescence molecule marker between energy shift.
Advantages such as FRET (fluorescence resonance energy transfer) (FRET) analytical method is simple, highly sensitive owing to its instrument that adopts, and required sample size is few, and analysis speed is fast combine with the chromatographic separation means, have become a kind of effective trace and ultratrace analysis technology.Because FRET adjusts the distance and has susceptibility, energy transfer fluorometric analysis is very suitable for the analysis to aspect complexity such as environment, biomedical science and clinical chemistry, low levels component, and can detect unmarked target dna sequence.Therefore, being widely used in the research of aspects such as biomacromolecule structure, character, reaction mechanism and quantitative analysis based on the analytical procedure of this principle, is a kind of new tool in the genetically engineered.
For the bio-sensing based on FRET (or being called detection) system of a success, primary key influence factor is exactly the selection of energy donor and acceptor (material).
Aspect energy donor, adopt the donor (even do energy acceptor) of organic dye at present mostly as energy.Because the organic fluorescence molecule has good consistency to biology, Parker for example, investigators such as Blaw moral and You Sekasi are that energy confession-acceptor is to studying to organic dye successively, its result of study is published in " clinical microbiology " (Park et al.Clin.Microbio. respectively, 2000,2829-2836), " biotechnology trend " (Brude et al.Trends in Biotechnol., 2002,20,249-256), " analytical chemistry " (Ysourkas et al.Anal.Chem., 2003,75,3697-3703) etc. on the authoritative publication.But adopt this confession-acceptor to still having the following disadvantages: 1. their excitation spectrum is all narrower, is difficult to the simultaneous excitation various ingredients; 2. the organic fluorescence molecular spectrum broad of organic dye, it is asymmetric to distribute, and brings difficulty for the organic fluorescence molecule source of distinguishing the different probe molecule, can't detect various ingredients simultaneously; 3. need certain wavelengths to excite just and can send fluorescence,, just need optical excitation with different wave length if detect multiple disease simultaneously.Will cause the energy in the detection architecture too much like this, be unfavorable for detecting; Overlapping between simultaneously different wave length excites also can make the energy between each energy donor and the acceptor shift and become not obvious, increases the complicacy of data analysis; 4. the most serious defective of organic dye is that photochemical stability is poor, and the fluorescent photon average quantity that photobleaching and photolysis meeting can be sent each probe dye is less, and photolytic product tends to again organism is produced lethal effect.
Inorganic nano-particle has become at the detection of biomolecules and the research focus aspect the mark owing to its unique physical and chemical performance.Quantum dot emission spectrum be symmetrically distributed and width narrow, color tunable (optical excitation of nanocrystalline physical efficiency coverlet one wavelength of different sizes and send the light of different colours), and have higher quantum yield (quantum yields; The sub-productive rate of weighing again) and good chemistry, optical stability, its fluorescence lifetime is more than 100 times of common organic dye molecule, has been widely used in the FRET (fluorescence resonance energy transfer) research as energy donor.At present, existing both at home and abroad about using the report of quantum dot as fluoroscopic examination and fluorescent mark and microbiological sensor research aspect, for example investigator such as waag Neil studies it respectively, characterize, its result of study is published in (Wargnier etal, Nano Lett., 2004 on " nanometer communication " magazine, 78,451-457).But, adopt the organic fluorescence molecule to have above-mentioned many shortcomings to also making probe as the energy confession-acceptor of probe.Investigators such as gold find that the hud typed CdSe/ZnS semiconductor light emitting nanoparticle (being the core-shell type quantum dot) that uses the individual layer Thiovanic acid to coat is energy donor, when using organism DABCYL as energy acceptor (being quencher), the emmission spectrum of its system and absorption spectrum have nearly 90% overlapping, and successfully made up the resonance energy system, this result is published in (Kim et al on " transmitter and driver " magazine, Sensors and Actuators B, 2004,102,315-319).Compare with organic dye, use CdSe/ZnS its fluorescence lifetime to be greatly improved as energy donor.Weak point is, adopts DABCYL as quencher, and resulting useful signal is lower, compares with background signal (noise signal), and its energy transfer efficiency remains further to be improved; Still inevitably there is above-mentioned shortcoming in DABCYL as a kind of organic fluorescent dye simultaneously.
Bigger progress is also being arranged aspect the energy acceptor selection.There is the investigator to find that the gold utensil of Nano grade has high optical extinction coefficient, wide absorption spectrum, organic and inorganic fluorescent energy donor is had higher cancellation effect, obtained in fields such as molecular biology, genetic engineering, biological diagnosises using widely.Investigators such as Kai Di have delivered its achievement in research (Cady et al on " molecule and cell detector ", Mol.Cell.Probe., 2007,21,116-124), adopting Iowa Black, Au, DABCYL respectively is energy acceptor (quencher), and the hud typed CdSe/ZnS semi-conductor nano particles that coats with the individual layer Thiovanic acid is an incandescnet particle, to energy donor and acceptor be connected and cancellation mechanism is optimized and is discussed.In the contrast experiment, find, after different energy confession-acceptor systems and the target dna hybridization, fluorescence intensity is different, and order is quantum dot-Iowa Black＞quantum dot-Au＞quantum dot-DABCYL, and this luminous efficiency that shows quantum dot in quantum dot-Au system awaits further improvement.
In recent years there are some researches show, also there is following deficiency in quantum dot-Au sensing system: adopting CdTe, CdS, ZnS or core-shell type quantum points such as CdTe/ZnS, CdTe/CdS is energy donor, when carrying out actual biological detection, often can not get enough fluorescence intensities, seriously limited the sensitivity of sensing system.Also there is similar problem in other relevant researchs, and because there are defective in problem of energy confession-acceptor own and confession-acceptor to design, cause its quantum yield generally lower, and the sensitivity of sensing system is not high.So above-mentioned energy confession-acceptor systems and probe await to improve.Because gold is a noble metal, in the practicability process, is that energy acceptor exists the cost problem of higher with the gold.So it is necessary as energy acceptor (quencher) that a kind of efficient, inexpensive compound is used in research and development.
For the bio-sensing based on FRET (or being called detection) system of a success, an influence factor in addition is exactly the purity problem of the final dna probe that obtains in sensing system preparation process.The purity of dna probe is high more, and the sensitivity of the bio-sensing system of FRET will be high more, and specificity is just good more.Though adopt centrifugation method can partly realize the purpose of purifying, but efficient is very low, time and effort consuming will obtain separating effect preferably, the shortest disengaging time was also wanted about 1 hour.In addition, can adopt electrophoretic method to separate, still, resolving power is low, and practical application effect is very poor, and cost is higher.More than two kinds of methods on industrial application, exist very big difficulty.
So, realize a large amount of practical applications of industrial/household, above-mentioned energy confession-acceptor systems and probe purity all await to improve and improve.
Summary of the invention
At the defective that prior art exists, the technical problem to be solved in the present invention is to design a kind of magnetic DNA fluorescent probe and preparation method thereof.Characteristics such as this probe has magnetic, easily separated purifying, and detectability is low, measurement is highly sensitive, and is good to detected DNA specificity, and practical and cost is low can detect the DNA of a certain particular sequence easy, apace.It is simple that this preparation method has technology, easy and simple to handle, mild condition, characteristics such as handiness height.
The technical scheme that the present invention solves described probe technique problem is: design a kind of magnetic DNA fluorescent probe, it is characterized in that this probe adopts magnetic core-shell type quantum point CdTe/MNs nanoparticle to do the energy donor of emitting fluorescence, and CdTe/MNs nanoparticle and strand 3 '-NH
2-DNA is connected, and constitutes CdTe/MNs-DNA; Adopt nano-nickel oxide to do the energy acceptor that absorbs fluorescence, and nano-nickel oxide and strand 5 '-NH
2-DNA is connected, and constitutes nNiO-DNA; Described strand 5 '-NH
2-DNA and strand 3 '-NH
2-DNA complementation, and CdTe/MNs-DNA and nNiO-DNA hybridization are made.
The technical scheme that the present invention solves described preparation method's technical problem is: design a kind of preparation method of DNA fluorescent probe of the present invention, this preparation method comprises:
At first, preparation CdTe/MNs-DNA comprises 5 steps:
(1) preparation magnetic nano particle MNs
Adopt alcohol-water law to prepare magnetic nano particle MNs: the dose volume ratio is 0.1: 4-1: alcohol/water mixture of 0.4, obtain solution A, and concentration of ordinary dissolution is the Ni of 0.01-2.0mol/L in solution A
2+Salt, obtain solution B; Other gets solution A, and compound concentration is the oxalic acid aqueous solution of 0.01-11mol/L, obtains solution C; Solution C slowly is added drop-wise in the solution B, and stirs fast, when beginning precipitation to occur, control pH value after dropwising, was reacted 10-300 minute between 1-13, obtained containing sedimentary solution D; Then solution D is carried out centrifugation, obtain throw out, with the distilled water washing, behind dry 0.1-24h under 10-150 ℃, be placed in the retort furnace, calcining 0.1-24h gets black powder E under 200-600 ℃; Cleaning black powder E with 1M hydrochloric acid, is colourless until washing lotion, promptly gets the nickel nano particle (MNs) with magnetic, and prepared MNs particle diameter is 5-15nm;
(2) preparation CdTe fluorescent quantum dot solution
Adopt ordinary method to prepare the CdTe fluorescent quantum dot solution;
(3) preparation CdTe/MNs stoste
Preparation CdTe/MNs stoste adopts ordinary method; But the coating materials of described magnetic Ni nanoparticle is salt or the acids that contains the nitrogen element, reaction soln pH is controlled between the 2-13, Ni: CdTe mole proportioning is 0.01: 1-1: between 0.01, temperature of reaction is 20-98 ℃, reaction times is 0.1-24h, and the particle diameter of reaction gained CdTe/MNs is between 10-30nm;
(4) preparation CdTe/MNs-DNA solution
With the CdTe/MNs stoste of 1-10ml and 3 '-NH of 1OD
2-DNA mixes, and adds 3 '-NH
2-DNA amount 1-100 1-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates doubly react 0.1-72h in Tris-HCl solution, promptly obtain CdTe/MNs-DNA solution;
(5) CdTe/MNs-DNA solution purification
Use the permanent magnet of 0.01-0.3T that the CdTe/MNs-DNA with magnetic is finished separations, concentration process in 1-30min, get rid of the single stranded DNA that does not hybridize to particle surface, the effective concentration of CdTe/MNs-DNA is concentrated rise to original 1-20 times simultaneously;
Secondly, preparation nNiO-DNA solution comprises 2 steps:
(6) preparation nNiO
It is basic identical that the preparation method of nNiO and aforementioned (1) are that alcohol-water law prepares the method for magnetic nano particle MNs, difference only is step in the end: after obtaining black powder E, it is distributed in the solution A, concussion makes its homogeneous, is put into then on the 0.01-0.3T magnet, under the action of a magnetic field, the Ni particle attracted to container bottom, and NiO still is suspended in the solution, removes the Ni particle of bottom, and the particle that obtains to be suspended in the solution is nNiO;
(7) preparation nNiO-DNA solution
NNiO solution and 1-5ml with 1-10ml, pH=3-10, the solution of organic compound that contains amino and carboxyl in the time of 0.05-5.0mol/L is by 1: 5-10: 1 volume ratio is mixed, magnetic agitation, react 5-300min under the room temperature, add strand 5 '-NH of 1OD then
2-DNA mixes, and adds strand 5 '-NH
2-DNA amount 1-200 1-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates doubly react 0.1-72h in Tris-HCl solution, promptly obtain nNiO-DNA solution; The described organic compound that contains amino and carboxyl simultaneously is meant aminoacrylic acid, Methionin, tryptophane, phenylalanine, methionine(Met), Threonine, Isoleucine, aspartic acid or L-glutamic acid;
Once more, preparation DNA fluorescent probe
(8) with the CdTe/MNs-DNA solution of described preparation and nNiO-DNA solution by 1: volume ratio (0.1-20) mixes, then mixed solution is joined in the phosphoric acid salt hybridization buffer (PBS) of 1-200ml, hybridized 0.5-24 hour down at 10-90 ℃, promptly obtain the DNA fluorescent probe;
At last, DNA fluorescent probe purifying
(9) use the permanent magnet of 0.01-0.3T in 1-30min, to finish the separation of hybridization back fluorescent probe, concentrate the DNA fluorescent probe that obtains, get rid of the nNiO-DNA that not success is hybridized, control simultaneously concentration time and magneticstrength simultaneously, the effective concentration of fluorescent probe is concentrated rise to original 1-20 doubly.
The present invention couples together nNiO-DNA and semiconductor light emitting nanoparticle CdTe/MNs-DNA by the DNA hybridization technique, has made up magnetic DNA fluorescent probe.Compared with prior art, fluorescent probe of the present invention adopts semiconductor light emitting nanoparticle CdTe/MNs as energy donor, premium propertiess such as excitation of spectra scope with broad that quantum dot possesses, selective exitation wavelength freely, help guaranteeing the well overlapping of donor emission wavelength and acceptor absorbing wavelength, increase the transfer efficiency of resonance energy; Adopt magnetic MNs to be nuclear preparation CdTe/MNs, make energy have the magnetic response performance for body and synthetic probe, make CdTe/MNs have multifunctionality, can be implemented in and realize under the common magnetic field of magnets effect that CdTe/MNs separates, concentrate and function such as target location, the energy that magnetic resolution reaches after concentrating has higher fluorescence intensity for body CdTe/MNs and CdTe/MNs-DNA, fluorescent probe through isolating CdTe/MNs-DNA of magnetic and final preparation has more high purity, improve the quantity of unit volume internal probe, helped improving the detectability of probe and the specificity of detection.NNiO can carry out effective cancellation to the energy that CdTe/MNs sent as energy acceptor, and detection speed is fast, and can realize multiple labelling, and with low cost, and the industrialization and the family oriented that help product are used.Fluorescent probe of the present invention can access the sensitivity of nM level and can detect a specific precision of base mismatch.This preparation method has (all synthetic at water) easy and simple to handle, technology simple (committed step has only related to self-assembly layer by layer, DNA hybridization and fluoroscopic examination step), mild condition (is carried out in the water of 20-100 degree, magnetic agitation, synthesis under normal pressure), the handiness height (diameter of particle, the luminous intensity of energy donor, DNA length, energy for be subjected to-the right distance of body, energy for the ratio of acceptor-right, energy for acceptor-to all adjustable in the concentration of aqueous phase and luminous intensity etc.) etc. characteristics.
Embodiment
Below in conjunction with embodiment the present invention is described in further detail:
The magnetic DNA fluorescent probe (abbreviation probe) of the present invention's design is characterized in that this probe adopts magnetic core-shell type quantum point CdTe/MNs nanoparticle to do the energy donor of emitting fluorescence, and CdTe/MNs nanoparticle and strand 3 '-NH
2-DNA is connected, and constitutes CdTe/MNs-DNA; Adopt nano-nickel oxide to do the energy acceptor that absorbs fluorescence, and nano-nickel oxide and strand 5 '-NH
2-DNA is connected, and constitutes nNiO-DNA; Described strand 5-NH
2-DNA and strand 3 '-NH
2-DNA complementation, and CdTe/MNs-DNA and nNiO-DNA hybridization are made.
Described single stranded DNA sequence can be according to A-T, and the principle of G-C correspondence draws.
Above-mentioned DNA segment can be following dna encoding sequence:
Dna encoding sequence with Salmonella feature, for example: 5 '-CTGATGCCTCCCTGCCCCACCAGTATTCGCTGATGGCCGGCAGGGAGTG CCAG-3 ' etc.;
Can be dna encoding sequence, for example: 5 '-ATGAAGAAAGGTGATGCGGCTGAACATGCAGAGCACCATATGAAAGACAACGCTGG GTTCCAGGCTGGATGTGTGCTCCACATCCACAGCAGATGC CACTGAACGCACCGATAACCTGGCTGATGCCG CCTGA-3 ' etc. with shiga bacillus feature;
Can be dna encoding sequence, for example: 5 '-GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAD-3 ' with plague bacillus feature; 5 '-AGTAAGCAAGAGAGAGCCGGGGGG-3 ' etc.;
Can be dna encoding sequence, for example: 5 '-ATGGCGGGTATCTTTCGCACGATCTATGACTGGCTCCTGAGATGTTCTG-3 ' with toxoplasma gondii feature; 5 '-GCAGGGCGACAGAGATGGATGTCACCATGATTGGTCTCCAGAATGCAG GA AAGTCTTCGT TGTTGCGCGTGCTTGCGGTA-3 '; 5 '-CAGAACTCAAGTGGCATAGATGTGGAAGAAAAGAGTCTCTTCTTGGAT ATCTGGAGGAACTGGCAAAAGG-3 ' etc.;
Can be dna encoding sequence, for example: 5 '-ATTAGAATGAAGAATCCCTCCATTGTTGGAGTCCTGTGCAAGATTCACA AGGACTTAATCTGGGTTGTA-3 ' with hepatitis virus feature; 5 '-ATAATGCATCCTCAAGTGGTCATCTTAAGCCTCATCCTACATCTGGCAG-3 ' etc.;
Can be dna encoding sequence, for example: 5 '-AGGTGATGACGAATTTATTGAGTAA-3 ' with coronavirus feature; 5 '-ATGATTCAAACTCCAACATCTTTTCTAATAGTGTTAATTCTTCTTTGGTTTAAACT TGTGTTAAGTTGTTTTAAAGAGTGTGTTTTAGCGCTTCTTCAATTAATACAAGTTT TACTCCAAATTATTAATAGTAACTTACAGGCTAGACTT CTGCTTTGGC ACAGTCTAGA CTAA-3 ' etc.;
Can be dna encoding sequence, for example: 5 '-ATGTGTCCTCAGAAGCTAACCATCTCCTGGTTTGCCATCGTTTTGCTGGT GTCTCCACTCATGGCCATGT GGGAGCTGGA GAAAGACG-3 ' with streptococcus pneumoniae feature; 5 '-AATACTTGTACCAGTGTTTACACAAAAGATAGAACTGCTAGTGTAAAAT TCCAGCCTTAGACCTTCTGATTAAG-3 '; 5 '-ATTGAGATGA AGCGATATGC TGTGCCCTTA G-3 ' etc.;
Can be dna encoding sequence, for example: 5 '-ATGAAGAAAATGAATCACAAGTCAACTGACAGTCCAAAGGCTCCACAGCTCAGAGG AGGG-3 ' with influenza virus feature; 5 '-ATGAAACGCATTAGCACCACCATTACCACCACCATCACCATACCACAGG TAACGGTGCGGGCTGA-3 ' etc.;
Or has the virus of characteristic DNA encoding sequence, bacterium or microorganism etc.
The present invention has designed the preparation method (abbreviation preparation method) of probe of the present invention simultaneously, and this preparation method is Ni nanoparticle (the magnetic nano-particles of synthesizing magnetic at first; MNs), as magnetic core, pass through the outer wrap one deck CdTe nanoparticle of the method for self-assembly layer by layer then after the process surface modification, form core-shell type quantum dot CdTe/MNs, as the energy donor of FRET (fluorescence resonance energy transfer) at nuclear.The CdTe/MNs that utilizes this method to prepare has stronger fluorescence and higher quantum yield.Secondly, adopt alcohol-water law to prepare magnetic Nano nickel oxide (nNiO), as energy acceptor.Then energy donor, energy acceptor are linked to each other with single stranded DNA respectively, by the synthetic fluorescent probe of DNA hybridization technique.
Preparation method's of the present invention concrete technology may further comprise the steps:
At first, preparation CdTe/MNs-DNA comprises 5 steps:
(1) preparation magnetic nano particle MNs; Adopt alcohol-water law to prepare magnetic nano particle MNs: the dose volume ratio is 0.1: 4-1: alcohol/water mixture of 0.4, obtain solution A, and concentration of ordinary dissolution is the Ni of 0.01-2.0mol/L in solution A
2+Salt, obtain solution B; Other gets solution A, and compound concentration is the oxalic acid aqueous solution of 0.01-11mol/L, obtains solution C; Solution C slowly is added drop-wise in the solution B, and stirs fast, when beginning precipitation to occur, control pH value after dropwising, was reacted 10-300 minute between 1-13, obtained containing sedimentary solution D; Solution D is carried out centrifugation, obtain throw out, with the distilled water washing, behind dry 0.1-24h under 10-150 ℃, be placed in the retort furnace, calcining 0.1-24h gets black powder E under 200-600 ℃; Cleaning black powder E with 1M hydrochloric acid, is colourless until washing lotion, promptly gets the nickel nano particle (MNs) with magnetic, and prepared MNs particle diameter is 5-15nm.
(2) preparation CdTe fluorescent quantum dot solution; The method for preparing the CdTe fluorescent quantum dot solution be prior art (can be superfine with reference to being permitted generation, the synthetic and optical characteristics of finishing CdTe quantum dot, image science and photochemistry, 2009,27,161-167;-document 1);
(3) preparation CdTe/MNs stoste
The method for preparing CdTe/MNs stoste also for prior art (can be superfine with reference to being permitted generation, CdTeFe
3O
4Synthetic and sign, nanotechnology and precision engineering, 2009,2, the 110-114 of magnetic composite nanoparticles;-document 2).But nanoparticle surface modified dose of described magnetic Ni (as the agent that links between the shell of the nuclear of magnetic and the CdTe quantum dot with fluorescent characteristic) is different with above-mentioned prior art, and nanoparticle surface modified dose of magnetic Ni involved in the present invention is for containing the salt or the acids of nitrogen element.Reaction soln pH is controlled between the 2-13, Ni: CdTe mole proportioning is 0.01: 1-1: between 0.01, temperature of reaction is 20-98 ℃, and the reaction times is 0.1-24h, and the particle diameter of reaction gained CdTe/MNs is between 10-30nm;
(4) preparation CdTe/MNs-DNA solution
With the CdTe/MNs stoste of 1-10ml and 3 '-NH of 1OD
2-DNA mixes, and adds 3 '-NH
2-DNA amount 1-100 1-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates doubly react 0.1-72h in Tris-HCl solution, promptly obtain CdTe/MNs-DNA solution;
(5) CdTe/MNs-DNA solution purification
Use the permanent magnet of 0.01-0.3T that the CdTe/MNs-DNA with magnetic is finished separations, concentration process in 1-30min, get rid of the single stranded DNA that does not hybridize to particle surface, the effective concentration of CdTe/MNs-DNA is concentrated rise to original 1-20 times simultaneously;
Secondly, preparation nNiO-DNA solution comprises 2 steps:
(6) preparation nNiO
It is basic identical that the preparation method of nNiO and aforementioned (1) are that alcohol-water law prepares the method for magnetic nano particle MNs, difference only is final step: after promptly obtaining black powder E, it is distributed in the solution A, concussion makes its homogeneous, be put into then on the 0.01-0.3T magnet, because the Ni particle has magnetic, and NiO does not have magnetic, therefore under the action of a magnetic field, Ni particle and NiO particle can be separated, and the Ni particle attracted to container bottom, and the NiO particle still is suspended in the solution, remove the Ni particle of bottom, the particle that obtains to be suspended in the solution is nNiO;
(7) preparation nNiO-DNA solution
NNiO solution and 1-5ml with 1-10ml, pH=3-10, the solution of organic compound that contains amino and carboxyl in the time of 0.05-5.0mol/L is by 1: 5-10: 1 volume ratio is mixed, magnetic agitation, react 5-300min under the room temperature, add strand 5 '-NH of 1OD then
2-DNA mixes, and adds strand 5 '-NH
2-DNA amount 1-200 1-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates doubly react 0.1-72h in Tris-HCl solution, promptly obtain nNiO-DNA solution; The described organic compound that contains amino and carboxyl simultaneously is meant aminoacrylic acid, Methionin, tryptophane, phenylalanine, methionine(Met), Threonine, Isoleucine, aspartic acid or L-glutamic acid;
Described Tris-HCl solution manufacturing method is a prior art.The concrete grammar of embodiment is: the Tris alkali of 0.9-90g is dissolved in the water of 750ml, and uses phosphoric acid or hydrochloric acid that it is adjusted to required pH value promptly;
Once more, (8) preparation DNA fluorescent probe:
With the CdTe/MNs-DNA solution of described preparation and nNiO-DNA solution by 1: volume ratio (0.1-20) mixes, then mixed solution is joined the phosphoric acid salt hybridization buffer (PBS) of 1-200ml, hybridized 0.5-24 hour down at 10-90 ℃, promptly obtain the DNA fluorescent probe;
The preparation method of PBS hybridization buffer of the present invention is a prior art.The concrete grammar that embodiment prepares the PBS hybridization buffer is:
1.. with the Na of 1-100mg
2HPO
412H
2O is dissolved in the 100ml distilled water;
2.. with the NaH of 1-100mg
2PO
412H
2O is dissolved in the 100ml distilled water;
3.. get (1) solution 61ml and (2) solution 39ml mixing promptly.
At last, (9) DNA fluorescent probe purifying
Use the permanent magnet of 0.01-0.3T in 1-30min, to finish the separation of hybridization back fluorescent probe, concentrate the DNA fluorescent probe that obtains, get rid of the nNiO-DNA that not success is hybridized, control simultaneously concentration time and magneticstrength simultaneously, the effective concentration of fluorescent probe is concentrated rise to original 1-20 doubly.
The length (for example the end that at dna sequence dna with CdTe/MNs link to each other add 1-10 base) of preparation method of the present invention by changing the single stranded DNA sequence that is connected on the described CdTe/MNs, promptly can regulate the distance between described CdTe/MNs and the nNiO, thereby obtain the fluorescence of varying strength; Described base can be any one among A, T, G or the C, or the arbitrary combination between them.
The principle of work of probe of the present invention is: when CdTe/MNs and nNiO close mutually, when satisfying the FRET (fluorescence resonance energy transfer) condition, CdTe/MNs (energy donor) and nNiO (energy acceptor) contact, the fluorescence that CdTe/MNs sends is transferred on the nNiO, and distribute with the form of heat energy, cause nNiO that the fluorescent energy of CdTe/MNs is absorbed (or being called cancellation), thus detect less than or very low fluorescent signal only arranged.On having a large amount of and probe in the system during dna sequence dna complementary dna sequence dna, two DNA chains on the probe will separate, then and complementary DNA chain hybridization with it in the system, the distance of described energy donor and energy acceptor is increased, the fluorescence that energy donor sends just can not be by cancellation, and can detect fluorescent signal this moment.According to this reason, probe of the present invention can detect target dna according to the power of fluorescence, thereby is applied to the detection and the analysis of genomic sudden change detection and microbial pathogen gene.
Energy confession-the acceptor of FRET system of the present invention is to having satisfied following prerequisite: (1) confession-acceptor will compare mutually near (1-10nm); (2) absorption spectrum of the emmission spectrum of donor and acceptor is overlapping; (3) the transition dipole moment of confession-acceptor is close to parallel.
Probe of the present invention can be used to detect target dna, utilizes promptly that known characteristic DNA sequence detects target dna in the probe of the present invention.If the single stranded DNA in target dna and the probe is complementary fully, then the fluorescence of system can strengthen, thereby reaches the purpose that detects unknown dna sequence dna.Concrete detection method is for adding target dna in probe solution, 10-90 ℃ was reacted 0.5-24 hour, with the fluorescence intensity (variation of fluorescence intensity) of system behind spectrophotofluorometer difference test probe and the adding target dna, if fluorescence intensity strengthens, just proof has the target dna existence.The excitation wavelength of spectrophotofluorometer is 300-400nm, sweep limit: 200-700nm, scanning speed: 0.1-10nm/s.
Probe is to the minimum (detectability) that target dna detects, and is meant that institute's synthetic probe in theory can detect the minimum concentration of target dna.Detectability is low more, and the sensitivity of probe is just high more.Detectability is subjected to the influence that fluorescence intensity changes, and fluorescence intensity is subjected to synthesis condition, for example influences such as pH, temperature, return time, Ni/CdTe molar ratio, nNiO-DNA add-on, therefore, be necessary institute's synthetic probe among each embodiment is carried out the mensuration of detectability, so that weigh the sensitivity of probe.Concrete detection method be prior art (can be superfine with reference to being permitted generation, the beacon probe is to the detection of bow-shaped worm dna, SPIE international conference collection of thesis, 7157 volumes, 1571U-71571U-6 (2008); Xu Shichao, YaoCuicui, Wei Shuoming, et al.Detection of Toxoplasma gondii with a DNAmolecular beacon probe, Proceedings of the SPIE, 7157,71571U-71571U-6 (2008);-document 3).
The present invention does not address part and is applicable to prior art.
Below be specific embodiments of the invention.Described embodiment is used for further specifically describing the present invention, rather than limits claim of the present invention.
Embodiment 1
1.DNA sequence
Detect one of plague characteristic DNA sequence:
(note is made S with the single stranded DNA of amino labeled for sequence 1:5 ' end
1),
5’-AGTAAGCAAGAGAGAGCCGGGGGG-(CH
2)
6-NH
2-3’；
Sequence 2:3 ' holds with amido modified single stranded DNA (with S
1Complementation, note is made S
2),
5’-NH
2-(CH
2)
6-CCCCGGCTCTCTCTTGCTTACT-3’；
Sequence 3: target dna is (with S
1Complementation, note is made S
3),
5’-CCCCCCGGCTCTCTCTTGCTTACT-3’。
2. preparation method
At first, preparation CdTe/MNs-DNA (S1); Concrete grammar is:
(1) adopt alcohol-water law to prepare magnetic nano particle MNs, method is as follows:
The dose volume ratio is alcohol/water mixture solution of 0.1: 1, gets solution A; Concentration of ordinary dissolution is the Ni (NO of 0.01mol/L in solution A
3)
2, obtain solution B; Other gets solution A, and compound concentration is the 0.01mol/L oxalic acid aqueous solution, obtains solution C; Solution C slowly is added drop-wise in the solution B, and stirs fast, when beginning precipitation to occur, control pH value, was reacted 15 minutes after dropwising 3, obtained containing sedimentary solution D; Solution D is carried out centrifugation, obtain precipitating, and with the distilled water washing, behind dry 0.1h under 10 ℃, be placed in the retort furnace, calcining 0.1h gets black powder E under 200 ℃; Hydrochloric acid with 1M cleans black powder E, is colourless until washing lotion, promptly gets the nickel nano particle (MNs) with magnetic.Prepared MNs median size is 5nm.
(2) preparation CdTe fluorescent quantum dot solution.Related method is prior art (reference 1);
(3) preparation of CdTe/MNs stoste.The former liquid preparing process of CdTe/MNs is prior art (reference 2), but the coating materials of magnetic nano-particle is a hexanediamine, reaction soln pH is controlled at 2, Ni: CdTe mole proportioning is 0.01: 1, temperature of reaction is 20 ℃, reaction times is 0.1h, and the median size of reaction gained CdTe/MNs is at 10nm;
(4) preparation CdTe/MNs-DNA solution: with the CdTe/MNs stoste of 1-10ml and 3 '-NH of 1OD
2-DNA (S1) mixes, and adds 3 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S1) amount is 1 times react 12h in Tris-HCl solution, can obtain CdTe/MNs-DNA solution;
(5) use the permanent magnet of 0.01T that the CdTe/MNs-DNA with magnetic is separated (finishing in the 5min), concentrates, get rid of the single stranded DNA that does not hybridize to particle surface, the effective concentration with CdTe/MNs-DNA concentrates 1 times of raising simultaneously.
Secondly, preparation nNiO-DNA (S2) solution; Concrete grammar is:
(6) preparation nNiO.It is similar that the preparation method of nNiO and alcohol-water law prepare magnetic nano particle MNs, just in the end one go on foot behind the black powder E, it is distributed to (ie in solution A) in alcohol/water mixture, concussion makes homogeneous, isolate with magnet then and be placed on solution bottom and isolate particle with magnetic, remaining in solution particles suspended be nNiO.
(7) with nNiO solution and the 1ml of 1ml, pH=3, the solution of the aminoacrylic acid of 0.05mol/L mixes, and reacts 5min under the magnetic agitation, room temperature, adds 5 ' of 1OD-NH then
2-DNA (S2) mixes, and adds 5 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S2) amount is 1 times react 0.1h in Tris-HCl solution, promptly obtain nNiO-DNA solution.
Once more, (8) preparation DNA fluorescent probe: the CdTe/MNs-DNA of described preparation is mixed with the volume ratio of nNiO-DNA solution by 1: 0.1, then mixed solution is joined 1ml phosphoric acid salt hybridization buffer (PBS), hybridized 0.5 hour down, promptly obtain the DNA fluorescent probe at 20 ℃.
At last, (9) DNA fluorescent probe purifying: the DNA fluorescent probe that obtains is used the permanent magnet of 0.01T the fluorescent probe of hybridizing the back acquisition is separated (finishing in the 15min), concentrates, get rid of the nNiO-DNA that not success is hybridized, the control concentration time be the magnetic intensity of 10min and magnet at 0.01T, the effective concentration of fluorescent probe concentrates and improves 1 times.
3. target dna detects
The target dna (S of 1OD
3) join in 10ml T=45 ℃, the probe solution of pH=7.5, reaction 1h, recording that fluorescence intensity strengthens by 10 is 25, adds the target dna of different OD numbers under this condition, according to the detection method in the reference 3, measures to detect and is limited to 2.1 * 10
-6M.
Embodiment 2
1.DNA sequence
Detect one of streptococcus pneumoniae characteristic DNA sequence:
(note is made S with the single stranded DNA of amino labeled for sequence 1:5 ' end
1),
5’-ATTGAGATGAAGCGATATGCTGTGCCCTTAG-(CH
2)
6-NH
2-3’；
Sequence 2:3 ' holds with amido modified single stranded DNA (with S
1Complementation, note is made S
2),
5’-NH
2-(CH
2)
6-TTCACAGCATATCGCTTCATCTCTCAAT-3’；
Sequence 3: target dna is (with S
1Complementary fully, note is made S
3),
5’-CTAAGGGCACAGCATATCGCTTCATCTCTCAAT-3’。
2. preparation method
(1) adopt alcohol-water law to prepare magnetic nano particle MNs, method is as follows:
The dose volume ratio is alcohol/water mixture solution A of 0.1: 0.4, and concentration of ordinary dissolution is the Ni (NO of 0.02mol/L therein
3)
2Salt and obtain solution B; Other gets solution A, and compound concentration obtains solution C for the 0.2mol/L oxalic acid aqueous solution.Slowly be added drop-wise to solution C in the solution B and stirring fast, control pH value dropwised afterreaction 30 minutes 4 when beginning precipitation to occur, obtained containing sedimentary solution D.Solution D is carried out centrifugation, obtain precipitating, and with the distilled water washing, be placed in the retort furnace behind the dry 0.4h down at 50 ℃, calcining 4h gets black powder E under 300 ℃.Hydrochloric acid with 1M cleans black powder E, is the colourless nickel nano particle (MNs) with magnetic that promptly gets until washing lotion.Prepared MNs median size is 7nm.
(2) preparation CdTe fluorescent quantum dot solution.Related method is prior art (reference 1).
(3) preparation of CdTe/MNs stoste.Adopt art methods preparation (reference 2), but the coating materials of magnetic nano-particle is a butanediamine.Reaction soln pH is controlled at 3, Ni: CdTe mole proportioning is 0.01: 0.02, and temperature of reaction is 30 ℃, and the reaction times is 4h.The median size of reaction gained CdTe/MNs is at 10nm.
(4) preparation CdTe/MNs-DNA solution: with the CdTe/MNs stoste of 1-10ml and 3 '-NH of 1OD
2-DNA (S1) mixes, and adds 3 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S1) amount is 4 times react 12h in Tris-HCl solution, can obtain the CdTe/MNs-DNA solution that can send pink fluorescence of dna modification;
(5) use the permanent magnet of 0.01T that the CdTe/MNs-DNA with magnetic is separated (finishing in the 15min), concentrates, get rid of the single stranded DNA that does not hybridize to particle surface, the effective concentration with CdTe/MNs-DNA improves (concentrating) 2 times simultaneously.
Secondly, preparation nNiO-DNA (S2) solution; Concrete grammar is:
(6) preparation nNiO.It is similar that the preparation method of nNiO and alcohol-water law prepare magnetic nano particle MNs, just in the end one go on foot behind the black powder E, it is distributed to (ie in solution A) in alcohol/water mixture, concussion makes homogeneous, isolate with magnet then and be placed on solution bottom and isolate particle with magnetic, remaining in solution particles suspended be nNiO.
(7) with nNiO solution and the 2ml of 1ml, pH=4, the phenylalanine solution of 0.5mol/L mixes, and reacts 50min under the magnetic agitation, room temperature, adds 5 ' of 1OD-NH then
2-DNA (S2) mixes, and adds 5 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S2) amount is 40 times, reaction 16h promptly obtains nNiO-DNA solution in Tris-HCl solution.
Once more, (8) preparation DNA fluorescent probe: the CdTe/MNs-DNA of described preparation is mixed with the volume ratio of nNiO-DNA solution by 1: 1, then mixed solution is joined the phosphoric acid salt hybridization buffer (PBS) of 20ml, hybridized 2 hours down, can obtain the DNA fluorescent probe at 40 ℃.
At last, (9) the DNA fluorescent probe that obtains is used the permanent magnet of 0.1T the fluorescent probe of hybridizing the back acquisition is separated, concentrates (in the period 5min, the magnet magnetic intensity is 0.1T), get rid of the nNiO-DNA that not success is hybridized, the effective concentration of fluorescent probe concentrates and has improved 2 times.
3. target dna detects
The target dna (S of 1OD
3) join in 20ml T=45 ℃, the probe solution of pH=7.5 and react 1h, record fluorescence intensity and strengthen, strengthening by 10 is 35.The target dna that adds different OD numbers under this condition according to the detection method in the reference 3, is measured detection and is limited to 6.5 * 10
-7M.
Embodiment 3
1.DNA sequence
Detect one of coronavirus characteristic DNA sequence:
(note is made S with the single stranded DNA of amino labeled for sequence 1:5 ' end
1).
5’-AGGTGATGACGAATTTATTGAGTAA-(CH
2)
6-NH
2-3’；
Sequence 2:3 ' holds with amido modified single stranded DNA (with S
1Complementation, note is made S
2),
5’-NH
2-(CH
2)
6-AATAAATTCGTCATCACCT-3’；
Sequence 3: target dna is (with S
1Complementary fully, note is made S
3),
5’-TTACTCAATAAATTCGTCATCACCT-3’。
2. preparation method
(1) adopt alcohol-water law to prepare magnetic nano particle MNs, method is as follows:
The dose volume ratio is alcohol/water mixture solution A of 0.5: 2, and concentration of ordinary dissolution is the NiCl of 0.02mol/L therein
2And obtain solution B; Other gets solution A, and compound concentration obtains solution C for the 0.8mol/L oxalic acid aqueous solution.Slowly be added drop-wise to solution C in the solution B and stirring fast, control pH value dropwised afterreaction 50 minutes 5 when beginning precipitation to occur, obtained containing sedimentary solution D.Solution D is carried out centrifugation, obtain precipitating, and with the distilled water washing, be placed in the retort furnace behind the dry 4h down at 60 ℃, calcining 4h gets black powder E under 350 ℃.Hydrochloric acid with 1M cleans black powder E, is the colourless nickel nano particle (MNs) with magnetic that promptly gets until washing lotion.Prepared MNs median size is 8nm.
(2) preparation CdTe fluorescent quantum dot solution.Related method is a prior art (reference 1.
(3) preparation of CdTe/MNs stoste.Adopt prior art for preparing (reference 2), but the coating materials of magnetic nano-particle is a mphenylenediamine.Reaction soln pH is controlled at 5, Ni: CdTe mole proportioning is 0.01: 0.5, and temperature of reaction is 40 ℃, and the reaction times is 6h.The median size of reaction gained CdTe/MNs is at 15nm.
(4) preparation CdTe/MNs-DNA solution: with the CdTe/MNs stoste of 1ml and 3 '-NH of 1OD
2-DNA (S1) mixes, and adds 3 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S1) amount is 10 times react 12h in Tris-HCl solution, can obtain CdTe/MNs-DNA solution;
(5) use the permanent magnet of 0.2T that the CdTe/MNs-DNA with magnetic is separated (finishing in the 2.5min), concentrates, get rid of the single stranded DNA that does not hybridize to particle surface, the effective concentration with CdTe/MNs-DNA concentrates 4 times of raisings simultaneously.
Secondly, preparation nNiO-DNA (S2) solution; Concrete grammar is:
(6) preparation nNiO.It is similar that the preparation method of nNiO and alcohol-water law prepare magnetic nano particle MNs, just in the end one go on foot behind the black powder E, it is distributed to (ie in solution A) in alcohol/water mixture, concussion makes homogeneous, isolate with magnet then and be placed on solution bottom and isolate particle with magnetic, remaining in solution particles suspended be nNiO.
(7) with nNiO solution and the 3ml of 1ml, pH=4, the phenylalanine solution of 0.5mol/L mixes, and reacts 50min under the magnetic agitation, room temperature, adds 5 ' of 1OD-NH then
2-DNA (S2) mixes, and adds 5 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S2) amount is 100 times, reaction 24h promptly obtains nNiO-DNA solution in Tris-HCl solution.
Once more, (8) preparation DNA fluorescent probe: the CdTe/MNs-DNA of described preparation is mixed with the volume ratio of nNiO-DNA solution by 1: 2, then mixed solution is joined the phosphoric acid salt hybridization buffer (PBS) of 20ml, hybridized 4 hours down, can obtain the DNA fluorescent probe at 50 ℃.
At last, (9) the DNA fluorescent probe that obtains is used the permanent magnet of 0.1T the fluorescent probe of hybridizing the back acquisition is separated (in the period 10min, the magnet magnetic intensity is 0.1T), concentrate, get rid of the nNiO-DNA control concentration time of not success hybridization and the magnetic intensity of magnet, the effective concentration of fluorescent probe concentrates and has improved 4 times.
3. target dna detects
The target dna (S of 1OD
3) join in 20ml T=45 ℃, the probe solution of pH=7.5 and react 1h, record fluorescence intensity and strengthen, strengthening by 10 is 50.The target dna that adds different OD numbers under this condition according to the detection method in the reference 3, is measured detection and is limited to 9.5 * 10
-7M.
Embodiment 4
1.DNA sequence
Detect one of hepatitis poison characteristic DNA sequence:
(note is made S with the single stranded DNA of amino labeled for sequence 1:5 ' end
1),
5’-ATAATGCATCCTCAAGTGGTCATCTTAAGCCTCATCCTACATCTGGCA?G-(CH
2)
6-NH
2-3’；
Sequence 2:3 ' holds with amido modified single stranded DNA (with S
1Complementation, note is made S
2),
5’-
NH
2-(CH
2)
6-TGTAGGATGAGGCTTAAGATGACCACTTGAGGATGCATTAT-3’；
Sequence 3: target dna is (with S
1Complementary fully, note is made S
3),
5’-CTGCCAGATGTAGGATGAGGCTTAAGATGACCACTTGAGGATGCATTAT-3’。
2. preparation method
(1) adopt alcohol-water law to prepare magnetic nano particle MNs, method is as follows:
The dose volume ratio is alcohol/water mixture solution A of 0.5: 4, and concentration of ordinary dissolution is the NiCl of 2mol/L therein
2Salt and obtain solution B; Other gets solution A, and compound concentration obtains solution C for the 0.3mol/L oxalic acid aqueous solution.Slowly be added drop-wise to solution C in the solution B and stirring fast, control pH value dropwised afterreaction 50 minutes 5 when beginning precipitation to occur, obtained containing sedimentary solution D.Solution D is carried out centrifugation, obtain precipitating, and with the distilled water washing, be placed in the retort furnace behind the dry 5h down at 60 ℃, calcining 6h gets black powder E under 400 ℃.Hydrochloric acid with 1M cleans black powder E, is the colourless nickel nano particle (MNs) with magnetic that promptly gets until washing lotion.Prepared MNs median size is 8nm.
(2) preparation CdTe fluorescent quantum dot solution.Related method is prior art (reference 1).
(3) preparation of CdTe/MNs stoste.Adopt prior art for preparing (technology reference 2), but the coating materials of magnetic nano-particle is a mphenylenediamine.Reaction soln pH is controlled at 8, Ni: CdTe mole proportioning is 0.5: 0.01, and temperature of reaction is 60 ℃, and the reaction times is 12h.The median size of reaction gained CdTe/MNs is at 20nm.
(4) preparation CdTe/MNs-DNA solution: with the CdTe/MNs stoste of 1ml and 3 '-NH of 1OD
2-DNA (S1) mixes, and adds 3 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S1) amount is 80 times react 48h in Tris-HCl solution, can obtain CdTe/MNs-DNA solution;
(5) use the permanent magnet of 0.3T that the CdTe/MNs-DNA with magnetic is separated (finishing in the 1.5min), concentrates, get rid of the single stranded DNA that does not hybridize to particle surface, the effective concentration with CdTe/MNs-DNA concentrates 4 times of raisings simultaneously.
Secondly, preparation nNiO-DNA (S2) solution; Concrete grammar is:
(6) preparation nNiO.It is similar that the preparation method of nNiO and alcohol-water law prepare magnetic nano particle MNs, just in the end one go on foot behind the black powder E, it is distributed to (ie in solution A) in alcohol/water mixture, concussion makes homogeneous, isolate with magnet then and be placed on solution bottom and isolate particle with magnetic, remaining in solution particles suspended be nNiO.
(7) with nNiO solution and the 3ml of 10ml, pH=4, the glutamic acid solution of 2.5mol/L mixes, and reacts 150min under the magnetic agitation, room temperature, adds 5 ' of 1OD-NH then
2-DNA (S2) mixes, and adds 5 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S2) amount is 80 times, reaction 48h promptly obtains nNiO-DNA solution in Tris-HCl solution.
Once more, (8) preparation DNA fluorescent probe: the CdTe/MNs-DNA of described preparation is mixed with the volume ratio of nNiO-DNA solution by 1: 10, then mixed solution is joined the phosphoric acid salt hybridization buffer (PBS) of 200ml, hybridized 14 hours down, can obtain the DNA fluorescent probe at 80 ℃.
At last, (9) the DNA fluorescent probe that obtains is used the permanent magnet of 0.1T the fluorescent probe of hybridizing the back acquisition is separated (in the period 15min, the magnet magnetic intensity is 0.1T), concentrate, get rid of the nNiO-DNA that not success is hybridized, the magnetic intensity of control concentration time and magnet, the effective concentration of fluorescent probe concentrate and improve 6 times.
3. target dna detects
The target dna (S of 1OD
3) join in 20ml T=45 ℃, the probe solution of pH=7.5 and react 1h, record fluorescence intensity and strengthen that to strengthen by 10 be 65, add the target dna of different OD numbers under this condition, according to the detection method in the reference 3, measure to detect and be limited to 1.5 * 10
-9M.
Embodiment 5
1.DNA sequence
Detect one of toxoplasma gondii characteristic DNA sequence:
(note is made S with the single stranded DNA of amino labeled for sequence 1:5 ' end
1),
5’-ATGGCGGGTATCTTTCGCACGATCTATGACTGGCTCCTGAGATGTTCTG-(CH
2)
6-NH
2-3’；
Sequence 2:3 ' holds with amido modified single stranded DNA (with S
1Complementation, note is made S
2),
5’-NH
2-(CH
2)
6-CAGGAGCCAGTCATAGATCGTGCGAAAGATACCCGCCAT-3’；
Sequence 3: target dna is (with S
1Complementary fully, note is made S
3),
5’-CAGAACATCTCAGGAGCCAGTCATAGATCGTGCGAAAGATACCCGCCAT-3’。
2. preparation method
(1) adopt alcohol-water law to prepare magnetic nano particle MNs, method is as follows:
The dose volume ratio is alcohol/water mixture solution A of 1: 0.4, and concentration of ordinary dissolution is the NiCl of 1mol/L therein
2Salt and obtain solution B; Other gets solution A, and compound concentration obtains solution C for the 5mol/L oxalic acid aqueous solution.Slowly be added drop-wise to solution C in the solution B and stirring fast, control pH value dropwised afterreaction 300 minutes 13 when beginning precipitation to occur, obtained containing sedimentary solution D.Solution D is carried out centrifugation, obtain precipitating, and with the distilled water washing, be placed in the retort furnace behind the dry 24h down at 150 ℃, calcining 24h gets black powder E under 600 ℃.Hydrochloric acid with 1M cleans black powder E, is the colourless nickel nano particle (MNs) with magnetic that promptly gets until washing lotion.Prepared MNs median size is 12nm.
(2) preparation CdTe fluorescent quantum dot solution.Related method is prior art (reference 1).
(3) preparation of CdTe/MNs stoste.Adopt prior art for preparing (technology reference 2), but the coating materials of magnetic nano-particle is an octamethylenediamine.Reaction soln pH is controlled at 13, Ni: CdTe mole proportioning is 1: 0.01, and temperature of reaction is 98 ℃, and the reaction times is 24h.The median size of reaction gained CdTe/MNs is at 25nm.
(4) preparation CdTe/MNs-DNA solution: with the CdTe/MNs stoste of 1ml and 3 '-NH of 1OD
2-DNA (S1) mixes, and adds 3 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S1) amount is 50 times react 72h in Tris-HCl solution, can obtain CdTe/MNs-DNA solution;
(5) use the permanent magnet of 0.01T that the CdTe/MNs-DNA with magnetic is separated (finishing in the 40min), concentrates, get rid of the single stranded DNA that does not hybridize to particle surface, the effective concentration with CdTe/MNs-DNA concentrates 20 times of raisings simultaneously.
Secondly, preparation nNiO-DNA (S2) solution; Concrete grammar is:
(6) preparation nNiO.It is similar that the preparation method of nNiO and alcohol-water law prepare magnetic nano particle MNs, just in the end one go on foot behind the black powder E, it is distributed to (ie in solution A) in alcohol/water mixture, concussion makes homogeneous, isolate with magnet then and be placed on solution bottom and isolate particle with magnetic, remaining in solution particles suspended be nNiO.
(7) with nNiO solution and the 2ml of 8ml, pH=10, the Isoleucine solution of 5mol/L mixes, and reacts 300min under the magnetic agitation, room temperature, adds 5 ' of 1OD-NH then
2-DNA (S2) mixes, and adds 5 '-NH
21-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates that-DNA (S2) amount is 20 times, reaction 72h promptly obtains nNiO-DNA solution in Tris-HCl solution.
Once more, (8) preparation DNA fluorescent probe: the CdTe/MNs-DNA of described preparation is mixed with the volume ratio of nNiO-DNA solution by 1: 20, then mixed solution is joined the phosphoric acid salt hybridization buffer (PBS) of 100ml, hybridized 24 hours down, can obtain the DNA fluorescent probe at 90 ℃.
At last, (9) the DNA fluorescent probe that obtains is used the permanent magnet of 0.01T the fluorescent probe of hybridizing the back acquisition is separated (in the period 40min, the magnet magnetic intensity is 0.01T), concentrate, get rid of the nNiO-DNA that not success is hybridized, the magnetic intensity of control concentration time and magnet, the effective concentration of fluorescent probe concentrate and improve 20 times.
3. target dna detects
The target dna (S of 1OD
3) join in 40ml T=45 ℃, the probe solution of pH=7.5 and react 1h, record fluorescence intensity and strengthen that to strengthen by 10 be 200, add the target dna of different OD numbers under this condition, according to the detection method in the reference 3, measure to detect and be limited to 9.8 * 10
-9M.
Embodiment 6
Whether monitoring bio morphs
1.DNA sequence
Sequence 1 is with embodiment 1 identical (S
1).
Sequence 2 is with embodiment 1 identical (S
2).
Sequence 3 is with embodiment 1 identical (S
3).
Sequence 4: the target single stranded DNA (S of a base mismatch is arranged with S3
4),
5’-CCCCCCGGCTCTCTC
ATGCTTACT-3’。
2. preparation method
(1) preparation of CdTe/MNs-DNA (S1) solution, the pH of applied all solution and damping fluid is 5.0, other are identical with embodiment 1.
(2) preparation of nNiO-DNA (S2) solution is identical with embodiment 5.
(3) preparation of DNA fluorescent probe, identical with embodiment 5.
3. target dna detects
(S3 or S4) joins 10ml T=25 ℃ respectively the target dna of 1OD, in the probe solution of pH=5.0, records the system fluorescence intensity that adds S3 and is enhanced to 150 by 10.Record and add S
4The system fluorescence intensity be enhanced to 15 by 10, rangeability is much smaller than the amplitude that adds the S3 system.
Add the fluorescence intensity difference that described S3 and S4 obtain and show that probe of the present invention has good specificity; Simultaneously, utilize probe of the present invention can monitoring bio whether morph (the characteristic DNA encoding sequence changes).
Claims (2)
1. a magnetic DNA fluorescent probe is characterized in that this probe adopts magnetic core-shell type quantum point CdTe/MNs nanoparticle to do the energy donor of emitting fluorescence, and CdTe/MNs nanoparticle and strand 3 '-NH
2-DNA is connected, and constitutes CdTe/MNs-DNA; Adopt nano-nickel oxide to do the energy acceptor that absorbs fluorescence, and nano-nickel oxide and strand 5 '-NH
2-DNA is connected, and constitutes nNiO-DNA; Described strand 5 '-NH
2-DNA and strand 3 '-NH
2-DNA complementation, and CdTe/MNs-DNA and nNiO-DNA hybridization are made.
2. the preparation method of the described DNA fluorescent probe of claim 1, this preparation method comprises:
At first, preparation CdTe/MNs-DNA comprises 5 steps:
(1) preparation magnetic nano particle MNs
Adopt alcohol-water law to prepare magnetic nano particle MNs: the dose volume ratio is 0.1: 4-1: alcohol/water mixture of 0.4, obtain solution A, and concentration of ordinary dissolution is the Ni of 0.01-2.0mol/L in solution A
2+Salt, obtain solution B; Other gets solution A, and compound concentration is the oxalic acid aqueous solution of 0.01-5mol/L, obtains solution C; Solution C slowly is added drop-wise in the solution B, and stirs fast, when beginning precipitation to occur, control pH value after dropwising, was reacted 10-300 minute between 1-13, obtained containing sedimentary solution D; Then solution D is carried out centrifugation, obtain throw out, with the distilled water washing, behind dry 0.1-24h under 10-150 ℃, be placed in the retort furnace, calcining 0.1-24h gets black powder E under 200-600 ℃; Cleaning black powder E with 1M hydrochloric acid, is colourless until washing lotion, promptly gets the nickel nano particle (MNs) with magnetic, and prepared MNs particle diameter is 5-15nm;
(2) preparation CdTe fluorescent quantum dot solution
Adopt ordinary method to prepare the CdTe fluorescent quantum dot solution;
(3) preparation CdTe/MNs stoste
Preparation CdTe/MNs stoste adopts ordinary method; But the coating materials of described magnetic Ni nanoparticle is hexanediamine, butanediamine, mphenylenediamine or octamethylenediamine, reaction soln pH is controlled between the 2-13, Ni: CdTe mole proportioning is 0.01: 1-1: between 0.01, temperature of reaction is 20-98 ℃, reaction times is 0.1-24h, and the particle diameter of reaction gained CdTe/MNs is between 10-30nm;
(4) preparation CdTe/MNs-DNA solution
With the CdTe/MNs stoste of 1-10ml and 3 '-NH of 1OD
2-DNA mixes, and adds 3 '-NH
2-DNA amount 1-100 1-ethyl-3-(3-dimethyl aminopropyl) carbon two imide salt hydrochlorates doubly react 0.1-72h in Tris-HCl solution, promptly obtain CdTe/MNs-DNA solution;
(5) CdTe/MNs-DN A solution purification
Use the permanent magnet of 0.01-0.3T that the CdTe/MNs-DNA with magnetic is finished separations, concentration process in 1-30min, get rid of the single stranded DNA that does not hybridize to particle surface, the effective concentration of CdTe/MNs-DNA is concentrated rise to original 1-20 times simultaneously;
Secondly, preparation nNiO-DNA solution comprises 2 steps:
(6) preparation nNiO
It is basic identical that the preparation method of nNiO and aforementioned (1) are that alcohol-water law prepares the method for magnetic nano particle MNs, difference only is step in the end: after obtaining black powder E, it is distributed in the solution A, concussion makes its homogeneous, is put into then on the 0.01-0.3T magnet, under the action of a magnetic field, the Ni particle attracted to container bottom, and NiO still is suspended in the solution, removes the Ni particle of bottom, and the particle that obtains to be suspended in the solution is nNiO;
(7) preparation nNiO-DNA solution
NNiO solution and 1-5ml with 1-10ml, pH=3-10, the solution of organic compound that contains amino and carboxyl in the time of 0.05-5.0mol/L is by 1: 5-10: 1 volume ratio is mixed, magnetic agitation, react 5-300min under the room temperature, add strand 5 '-NH of 1OD then
2-DNA mixes, and adds strand 5 '-NH
2-DNA amount 1-100 1 ethyl-3-(3-dimethyl aminopropyl) carbon, two imide salt hydrochlorates doubly react 0.1-72h in Tris-HCl solution, promptly obtain nNiO-DNA solution; The described organic compound that contains amino and carboxyl simultaneously is meant aminoacrylic acid, Methionin, tryptophane, phenylalanine, methionine(Met), Threonine, Isoleucine, aspartic acid or L-glutamic acid;
Once more, (8) preparation DNA fluorescent probe
With the CdTe/MNs-DNA solution of described preparation and nNiO-DNA solution by 1: volume ratio (0.1-20) mixes, then mixed solution is joined in the phosphoric acid salt hybridization buffer (PBS) of 1-200ml, hybridized 0.5-24 hour down at 10-90 ℃, promptly obtain the DNA fluorescent probe;
At last, (9) DNA fluorescent probe purifying
Use the permanent magnet of 0.01-0.3T in 1-30min, to finish the separation of hybridization back fluorescent probe, concentrate the DNA fluorescent probe that obtains, get rid of the nNiO-DNA that not success is hybridized, control concentration time and magneticstrength simultaneously, the effective concentration of fluorescent probe is concentrated rise to original 1-20 doubly.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100696144A CN101603085B (en) | 2009-07-07 | 2009-07-07 | Magnetic DNA fluorescent probe and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100696144A CN101603085B (en) | 2009-07-07 | 2009-07-07 | Magnetic DNA fluorescent probe and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101603085A CN101603085A (en) | 2009-12-16 |
| CN101603085B true CN101603085B (en) | 2011-11-09 |
Family
ID=41468986
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100696144A Expired - Fee Related CN101603085B (en) | 2009-07-07 | 2009-07-07 | Magnetic DNA fluorescent probe and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101603085B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102191325B (en) * | 2011-04-15 | 2013-01-23 | 武汉大学 | Detection method of vegetal single copy genes |
| CN102181441B (en) * | 2011-04-15 | 2012-09-26 | 武汉大学 | Method for coupling single long-chain DNA (deoxyribonucleic acid) molecules through single quantum dots |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101012378A (en) * | 2007-02-01 | 2007-08-08 | 上海交通大学 | Method of preparing CdTe quantum dot |
| CN101049918A (en) * | 2007-05-11 | 2007-10-10 | 北京化工大学 | Method for preparing CdTe Nano grains possible to be dissolved in water and organic solvent |
-
2009
- 2009-07-07 CN CN2009100696144A patent/CN101603085B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101012378A (en) * | 2007-02-01 | 2007-08-08 | 上海交通大学 | Method of preparing CdTe quantum dot |
| CN101049918A (en) * | 2007-05-11 | 2007-10-10 | 北京化工大学 | Method for preparing CdTe Nano grains possible to be dissolved in water and organic solvent |
Non-Patent Citations (2)
| Title |
|---|
| 张纪梅等.CdTe@Fe3O4磁性复合纳米粒子的合成与表征.《纳米技术与精密工程》.2009,第7卷(第2期),全文. * |
| 许世超等.表面修饰CdTe量子点的合成及其光学特性.《影像科学与光化学》.2009,第27卷(第3期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101603085A (en) | 2009-12-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kumar et al. | Recent trends in the developments of analytical probes based on lanthanide-doped upconversion nanoparticles | |
| Yang et al. | Strategies of molecular imprinting-based fluorescence sensors for chemical and biological analysis | |
| Shen et al. | Recent advances in nanotechnology for simultaneous detection of multiple pathogenic bacteria | |
| Wu et al. | Environmentally responsive plasmonic nanoassemblies for biosensing | |
| Wang et al. | Engineering nanomaterial surfaces for biomedical applications | |
| Hong et al. | Metal-enhanced fluorescence of carbon nanotubes | |
| CN101487046B (en) | DNA fluorescent probe and preparation thereof | |
| Nie et al. | Applications of gold nanoparticles in optical biosensors | |
| Tan et al. | Bionanotechnology based on silica nanoparticles | |
| Liang et al. | Hydrothermal growth of nitrogen-rich carbon dots as a precise multifunctional probe for both Fe3+ detection and cellular bio-imaging | |
| CN102507921B (en) | Method for detecting microcystin | |
| Fang et al. | Amplified using DNase I and aptamer/graphene oxide for sensing prostate specific antigen in human serum | |
| Martins et al. | New insights on optical biosensors: techniques, construction and application | |
| Wittenberg et al. | Using nanoparticles to push the limits of detection | |
| JP4444502B2 (en) | Nucleic acid sequence identification | |
| Doughan et al. | Solid-phase covalent immobilization of upconverting nanoparticles for biosensing by luminescence resonance energy transfer | |
| Wu et al. | Ratiometric fluorescence sensor for the sensitive detection of Bacillus thuringiensis transgenic sequence based on silica coated supermagnetic nanoparticles and quantum dots | |
| Ge et al. | Fluorescence resonance energy transfer sensor between quantum dot donors and neutral red acceptors and its detection of BSA in micelles | |
| CN104360077A (en) | Aptamer nucleic acid probe kit for detecting doxycycline residue as well as preparation method and application thereof | |
| Wang et al. | Highly sensitive and selective aptasensor for detection of adenosine based on fluorescence resonance energy transfer from carbon dots to nano-graphite | |
| CN114657185B (en) | Gold magnetic nano probe based on ordered arrangement of aptamer and application of gold magnetic nano probe in field halichondrin acid detection | |
| CN101603085B (en) | Magnetic DNA fluorescent probe and preparation method thereof | |
| JP2007531496A (en) | Multiplex molecular beacon assay for detecting pathogens | |
| CN110274948A (en) | One kind is based on the bis- amplification ECL biosensors of triple helical molecule switch oversoul sensitive detection LPS and its application | |
| CN101587070A (en) | The application of supramolecular ordered body in detecting G-four serobila structural DNAs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111109 Termination date: 20120707 |