CN101603008A - A kind of Hexanol degrading bacterium and its production and application - Google Patents
A kind of Hexanol degrading bacterium and its production and application Download PDFInfo
- Publication number
- CN101603008A CN101603008A CNA2008102322485A CN200810232248A CN101603008A CN 101603008 A CN101603008 A CN 101603008A CN A2008102322485 A CNA2008102322485 A CN A2008102322485A CN 200810232248 A CN200810232248 A CN 200810232248A CN 101603008 A CN101603008 A CN 101603008A
- Authority
- CN
- China
- Prior art keywords
- hexyl alcohol
- bacterium
- geotrichum
- hexanol
- hexyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention discloses and a kind ofly from physical environment, cultivate acclimation and screening and separate and obtain geotrichum candidum T3d329TF (Galactomyces geotrichum T3d329TF) through directional induction, be preserved in Chinese typical culture collection center on October 21st, 2008, preserving number is CCTCC NO:M 208167.This bacterial strain has the effect of degraded n-hexyl alcohol, simultaneously, can also produce multiple aroma component.
Description
Technical field
The invention belongs to microbial technology field, be specifically related to a kind of Hexanol degrading bacterium and preparation method thereof and its application in degraded n-hexyl alcohol, manufacturing fragrance.
Background technology
N-hexyl alcohol is to belong to potato spirit
[1]Flavor of raw material, when potato spirit content is high, can cause first-class ill symptoms on the similar wine
[2]The chemical conversion approach of n-hexyl alcohol has at present: n-hexyl alcohol is converted into positive valeric acid
[3]N-hexyl alcohol is converted into n-caproic acid
[4]Or be converted into n-hexyl aldehyde
[5] [6]The natural product of n-hexyl alcohol are present in apple, bigarabe, strawberry, tealeaves, violet, the lavandula angustifolia etc., and its biological metabolism approach has: n-hexyl alcohol is converted into n-hexyl aldehyde through lipoxidase (LOX) effect,
[7] [8], n-hexyl alcohol can generate hexyl acetate through pure acyltransferase (AAT) effect with the acetate effect
[9]But these all are to belong to the intravital pathways metabolism of plant, in being difficult to produce.
Reference
[1] Zhang Yueting, Liu Qiong. brief talk potato spirit. wine brewing [J] .2002, Sep, Vol.29, No.5:18～20.
[2] Jin Chunyu. in the liquor, brewing science and technology [J] .2005, No.10 (Tol.136): 113～116.
[3] Li Shaobai, Zhang Shaoming, Wu Kai, Li Yulin. concentrated nitric acid oxidation straight chain saturated fatty alcohol prepares carboxylic acid. chemical reagent [J] .1992, Vol.14, No.1:60.
[4] Bi Yingli, Wang Min, Zhuan Hong, the n-hexyl alcohol Catalytic Oxygen changes into n-caproic acid on the loading type peroxide phosphorus tungsten heteropoly compound. SCI .May, 2002, Vol.23, No.5:953～954.
[5] Wang Lei, Cheng Tiexin, Zhou Guangdong, Bi Yingli, Zhen Kaiji. the research of n-hexyl alcohol (oxidation) dehydrogenation system n-hexyl aldehyde. Journal of Molecular Catalysis [J] .Dec, 2003, Vol.17, No.6:434～438
[6] Zhou Guangdong, Guo Xiaohong, Lv Xueju, n-hexyl alcohol oxydehydrogenation system n-hexyl aldehyde on the magnesium oxide load molybdenum vanadium phosphate copper catalysts such as Zhen Kaiji. catalysis journal [J] .May, 2005, Vol.26, No.5:389～392.
[7] Wang Han, Xu Shifang, Chen Aiying, Jiang Lixia. the chemical constitution of beany flavor and other smell substances and detection in the soya products. Zhejiang Academy of Medical Sciences journal [J] .2007 March (total the 68th phase): 36～38.
[8] Xie Jizhi, Xiao Lixia, Xia Yulei, Cai Jian. fishy-removing-method is to the influence of n-hexyl aldehyde in the soya-bean milk and n-hexyl alcohol content. Jiangsu Agricultural College's journal [J] .1996,17 (1): 53～56.
[9] Li Dapeng. apple alcohol acyl transferase gene MdAAT2 participates in the research of the synthetic Regulation Mechanism of cruel class fragrance. the doctor of Shandong Agricultural University Diplomarbeit .20051120. China academic dissertation full-text database.
Summary of the invention
At above-mentioned problems of the prior art and defective, the object of the present invention is to provide a kind of Hexanol degrading bacterium, this bacterium can reduce the n-hexyl alcohol content in the sour environment effectively, thereby, improve the quality of natural apple essence by the n-hexyl alcohol content in the biological degradation method reduction natural apple essence.
The technical scheme that realizes the foregoing invention purpose is that a kind of geotrichum candidum T3d329TF (Galactomycesgeotrichum T3d329TF) is (hereinafter to be referred as the TF bacterial strain, this bacterial classification has been preserved in Chinese typical culture collection center on October 21st, 2008, preserving number is CCTCC NO:M 208167, the preservation address: Chinese Wuhan Wuhan University.
A further object of the invention is the application of bacterial classification CCTCC M 208167 in the degraded n-hexyl alcohol.
A further object of the invention is the application of bacterial classification CCTCC M 208167 in preparation fragrance.
Compare with existing technology, the present invention has the following advantages:
1) the present invention combines directed mutagenesis with the domestication beneficiation technologies, has improved the separation screening probability of Hexanol degrading bacterium;
2) the present invention has big application potential at Hexanol degrading aspect the development and use of enzyme, thereby provides the basis for the biological degradation at industrial realization n-hexyl alcohol;
3) present technique can realize that the positive thing of multiple aroma component is synthetic.
Description of drawings
The process flow sheet of Fig. 1 Hexanol degrading bacterium domestication enrichment.
The bacterium colony photo that Fig. 2 bacterial strain TF grew 3 days on the PDA flat board.
The photo of Fig. 3 bacterial strain TF mycelia (A), fibrillae of spores (B), spore (C) and spore germination (D).
The nrDNA district total length 422bp gene order of Fig. 4 bacterial strain TF.
Fig. 5 obtains phylogenetic tree based on the 26S rDNA D1/D2 district gene sequencing of bacterial strain TF.
Embodiment
Accompanying drawing that provides below in conjunction with the contriver and concrete test example and specific embodiment further specify beneficial effect and the preparation method of TF of the present invention.
Separation, authentication method and the biological characteristics thereof of embodiment 1TF bacterial strain
1. materials and methods
1.1 key instrument and reagent
GC9800 gas chromatographicanalyzer (Shanghai Kechuang Chromatograph Instruments Co., Ltd.), PYX-DHS-40x50 water isolation type electro-heating standing-temperature cultivator (Shanghai City make a leapleap forward farm medical apparatus and instruments factory), the biochemical incubator of SPX-300B-II (Shanghai make a leapleap forward medical apparatus and instruments factory), HWY individual layer large vol total temperature constant temperature oscillator (the sincere analytical instrument of Shanghai intelligence Manufacturing Co., Ltd), SW-CJ-2FD clean bench (SuZhou Antai Air Tech Co., Ltd.), Motic BA 400 digital image-forming opticmicroscopes (attached Motic 3.1 Preview Software).N-hexyl alcohol (chromatographically pure) (Chemical Reagent Co., Ltd., Sinopharm Group's import packing).
1.2 substratum
Strain domestication enrichment culture liquid: peptone 10g, yeast extract paste 5g, glucose 1g, MgSO
47H
2O0.5g, KH
2PO
41.0g, NH
4NO
31.0g, K
2HPO
41.0g, NaCl 0.2g, FeCl
30.05g distilled water 1000mL transfers pH to 3.8-4.0 with the citrate buffer solution of 0.2M pH 4.2.
MSM substratum: MgSO
47H
2O 0.5g, KH
2PO
41.0g, NH
4NO
31.0g, the CaCl of 6.67g/L
2Solution 3mL, the FeCl of 17g/L
3Solution 3mL, FeSO
47H
2O 0.05g, NaNO
31.0g, the n-hexyl alcohol of design concentration (being dissolved in a certain amount of sterilized water with 0.05%Tween 80 earlier) again with adding in the substratum after the 0.22 μ m membrane filtration sterilization, distilled water 1000mL regulates pH to 4.4-4.6 with HCL and NaOH.
Solid MSM substratum: the agar that in above-mentioned MSM substratum, adds 20g/L.
Purifying and fermentation detect substratum: (1) potato dextrose agar (PDA) and liquid potato glucose substratum (PDB).Wherein, 20% potato is soaked juice 1000mL, glucose 20g, agar 20g (PDA) or 0g (PDB).
1.3 domestication enrichment culture, separation screening and the purifying of bacterial classification
With apple orchard soil, apple residue, apple distiller's wort is separation source, carries out the domestication enrichment and the separation screening of bacterial classification by the following method with step.
1.3.1 the domestication enrichment culture and the screening of Hexanol degrading bacterium
Carry out according to following operation: (1) adds 100mL domestication enrichment culture liquid (FJ) and certain density n-hexyl alcohol in the 250mL triangular flask, insert 10g strain separating source, and at 28 ℃, shaking table is cultivated under the 150rpm condition.(2) cultivate 1d after, the inoculum size with 10% inserts culture in the fresh FJ nutrient solution, and places after 5min is shone at 6cm place under the 20W ultraviolet lamp, puts into shaking table and cultivates.Simultaneously, culture in the remaining former FJ nutrient solution is transferred pH to 3.8-4.0 (cultivate end back pH and generally can rise to 4.7-4.8) with the citrate buffer solution of 0.2M pH4.2, place 4 ℃ to preserve 1d, the bacterial classification that can adapt to pH3.8-4.0 is carried out primary dcreening operation, therefrom draw the 0.1mL nutrient solution, coat contain with former FJ nutrient solution in the MSM solid plate with the concentration n-hexyl alcohol, in 28 ℃ of water proof constant incubators, cultivate, the bacterium colony that picking is grown under each n-hexyl alcohol concentration is as the primary dcreening operation bacterial classification.According to 200,400,600,1000,1600,2600, the level of 4200ppm improves the n-hexyl alcohol concentration in FJ nutrient solution and the MSM solid medium successively.Level of the every increase of n-hexyl alcohol concentration all repeats the operation in (2) step, and the n-hexyl alcohol concentration in nutrient solution increases to 4200ppm, and the domestication enrichment of bacterial classification and the concrete operations flow process of screening are seen (Fig. 1).
Choose the bacterial classification that under the condition that the 4200ppm n-hexyl alcohol exists, still can grow, as first screening bacterial classification.Again it is inserted in the FJ nutrient solution and liquid MSM substratum that contains the 4000ppm n-hexyl alcohol its degradation capability of check behind the cultivation 7d respectively to n-hexyl alcohol.Contrast is the no thalline nutrient solution with the concentration n-hexyl alcohol of containing through identical cultivation.
1.3.3 bacterial classification purifying
Be chosen at the bacterium colony of the n-hexyl alcohol of can significantly degrading under the liquid culture condition, carry out the bacterial classification purifying through method of scoring.Bacterial classification behind the purifying is kept on the potato culture, and 4 ℃ of preservations are standby.
1.4 the evaluation of bacterial classification
1.4.1 morphologic observation
Bacterial classification behind above-mentioned purifying point is connected to PDA substratum central authorities, 28 ℃ of cultivations, colony characteristicses such as its mycelia color of routine observation, mycelial growth, colonial morphology; Do the moist chamber slide glass simultaneously and cultivate, under MoticBA 400 digital image-forming opticmicroscopes, observe after the film-making and take its sporulation process, spore shape and thalline features such as size, mycelia form and size.
1.4.226S rDNA D1/D2 district and ITS region sequence are analyzed
Carry total DNA of bacterial classification to be measured with the Biospin of BioFlux company fungal gene group DNA extraction test kit, Fungi Identification PCR Kit (D317) test kit with TaKaRa company carries out 26S rDNAD1/D2 district and ITS district complete sequence pcr amplification, transfer to Shanghai sunny bio tech ltd and disturb under strain identification result's the condition, the specificity product of pcr amplification is directly checked order getting rid of the sequence difference that causes by the rRNA polymorphism.
1.4.3 the structure of sequential analysis and genealogical tree
Resource in the base sequence that records and the international nucleic acid sequence data of the NCBI storehouse is carried out the homologous sequence search, adopt sequence map analysis software Chromas,, sequence is manually proofreaded with reference to forward and reverse sequence map; Carry out sequence alignment (alignment) with ClustalX 1.8; Grow tree with MEGA4.02Neighbor-Joining method (NJ) constructing system, and carry out 1000 Bootstrap checks.
1.5 n-hexyl alcohol Determination on content
Get cultured nutrient solution, shake up the back and draw 5mL, with the aseptic filter membrane of 0.22 μ m (cellulose acetate film) filtration sterilization, collect filtrate in head space micro-extraction bottle, with gas chromatography determination n-hexyl alcohol content, be interior mark with 5% (v/v) 4-methyl-2-amylalcohol (acetone constant volume), carry out quantitative analysis.Degradation rate according to formula (1) plan n-hexyl alcohol.
Hexanol degrading rate (%)=(in the contrast in n-hexyl alcohol content-sample n-hexyl alcohol content)/(n-hexyl alcohol content in the contrast) * 100% formula (1)
Being configured to of used gas chromatograph, DB-WAX-10 fused-silica capillary column (Φ 30 * 0.25), detector FID; Testing conditions is moving phase N
2, sample size 300 μ L, temperature programming: fs, 55 ℃ of initial temperatures (3min), 15 ℃/min of temperature rise rate, 200 ℃ of final temperatures (3min); Subordinate phase, 0 ℃ of initial temperature (0min), 0 ℃/min of temperature rise rate, 0 ℃ of final temperature (0min).
2 results
2.1 domestication enrichment, primary dcreening operation, separation and the purifying of Hexanol degrading bacterium
Domestication enrichment result to microorganism in the different separation source shows, when n-hexyl alcohol content in the substratum is relatively lower, the colony growth that different shape is all arranged in three kinds of strain separating sources, but when the n-hexyl alcohol content in the substratum reaches 400ppm and 600ppm when above, in the apple residue 3 kinds, the different bacterium colony of 2 kinds of forms in the apple distiller's wort all can not be grown.1 kind of bacterium colony that domestication is enriched to from the soil in apple orchard can tolerate the n-hexyl alcohol of 4200ppm, after separation and purification, and called after TF.
2.2 the bacterial classification morphological classification is identified
The TF bacterial classification is connected to the PDA flat board, 28 ℃ cultivate get final product behind the 3d complete bacterium colony, as shown in Figure 2.All there is strong fruit aroma to produce on both PDA cultures.The microscopic examination result that the moist chamber slide glass is cultivated shows the mycelia of two bacterium and the generative process and the form of spore, shown in Fig. 3 and table 1.
The morphological feature of table 1 bacterial strain TF
The morphological feature of comprehensive contrast bacterial strain TF, and go up the classification foundation of listed bacterial classification with fungi identification handbook (1979), can preliminary judgement bacterial strain TF belong to Mycophyta (Fungi) imperfect fungi (imperfect fungi) (Fungi Imperiecti), Moniliales (Moniliales), from stalk spore section (Moniliaceae) from stalk spore section's monospore subfamily (Amerosporoideae of Moniliaceae), the mould family of avette spore (Oosporeae) Geotrichum (Geotrichum, Lk).
2.3 the classification of the molecular biology of bacterial classification is identified
Detect gained TF bacterium nrDNA district total length 422bp, its gene order as shown in Figure 4.(clustalX1.8 sequence alignment, the MEGA4.02N-J method is contribute, model: Kimura-2-Parameter, Gap/MissingData:Pairwise Deletion, the Bootstrap value is 1000, internode digitized representation bootstrap supported value (not showing below 50%); G.sp-TF is a strains tested; G. represent Geotrichum; Ga. represent Galactomyces; Ga.G. represent GalactomycesGeotrichum; Ca. represent Candida; D. represent Dipodascus; )
Choose with nearer type strain and the similar bacterial strain of TF bacterial strain nrDNA ITS district kinship, assemble their nrDNA ITS region sequence, utilize clustalx1.8 to do sequence alignment, utilize the MEGA4.02N-J method, the Kimura-2-Parameter model is grown tree to the nrDNA ITS district nucleotide sequence constructing system of strains tested, and by systematic evolution tree (Fig. 5) as can be seen the TF bacterium with Galactomycesgeotrichum isolate GG1 (similarity=100%), Galactomyces geotrichum strainPY-8 (similarity=99.089%), Galactomyces geotrichum strain DSM1240 (similarity=98.39%), G.klebahnii strain KCTC6183 (similarity=95.35%) is in same monoid.9 kinds of red zymic phylogenetic trees by comparison rDNA D1/D2 district and the drafting of ITS region sequence, the variability of finding the ITS zone is higher than the D1/D2 region sequence, but the two conclusion unanimity, illustrate the sequence of utilizing the ITS zone classify saccharomycetic genus, to plant following level be feasible, thereby can assert that the Galactomycesgeotrichum isolate GG1 among TF and the Galactomyes geotrichum (Geotrichum geotrichum candidum) is of the same race.
Test example 1 pure bacterial strain TF is to the degradation effect of n-hexyl alcohol
In order to detect the degradation effect of TF to n-hexyl alcohol, carried out the degraded test of n-hexyl alcohol, cultivate when just having begun, in substratum, add the n-hexyl alcohol of 4000ppm, cultivate the n-hexyl alcohol content in the detection architecture after 7 days.For the speed of growth and the increment that improves bacterial classification, be PDB with basic medium.TF shows that to the degradation effect (table 2) of n-hexyl alcohol the TF bacterium has certain degraded to n-hexyl alcohol on PDB, can be calculated by table 2, and TF degradation rate to n-hexyl alcohol in PDB is (23.823 ± 9.2695) %.
Table 2 bacterial strain TM and TF are to all degradation effects of n-hexyl alcohol in the substratum
Test the product fragrant composition test of routine 2TF bacterium at liquid PDB
The TF bacterium is inoculated in the container, after the standing for fermentation 6 days, pass through headspace injection method, with gas phase-mass spectrometry method detection volatilization gas composition wherein, compare discrepant component (similarity degree with material is that data are selected limit greater than 50%) as shown in table 3 with contrast (the not PDB substratum of microbe inoculation).
Table 3TF bacterium newborn substance in the PDB substratum
As can be seen from Table 3, the TF bacterium produces fragrance and is mainly the ester class, secondly is alcohol, ketone, acid and other organism.
The TF bacterium produces ester class in the aroma component and is mainly ester class from C4～C13, accounts for totally 27.19%, and other compositions be sour, alkane, and alkene, phenol, nicotine accounts for overall 13.28%.
＜110〉Xibei Univ. of Agricultural ﹠ Forest Science ﹠ Technology
＜120〉a kind of Hexanol degrading bacterium and its production and application
<160>1
<210>1
<211>422
<212>DNA
＜213〉geotrichum sp (Geotrichum, Lk)
<400>1
CGCCAGGGTTTTCCCAGTCACGACTCCGTAGGTGAACCTGCGGAAGGATCATTAAGAATT60
ATAAATATTTGTGAAATTTACACAGCAAACAATAATTTTATAGTCAAAACAAAAATAATC120
AAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGA180
TATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGG240
TATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCTTTTCT300
AAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGAT360
TACCCGCTGAACTTAAGCATATCAATAAGCGGAGGACCTGTGTGAAATTGTTATCCGCTC420
AA422
Claims (3)
1. geotrichum sp (Geotrichum, Lk) TF CCTCC NO:M 208167.
2, geotrichum sp (Geotrichum, the Lk) application of TF CCTCC NO:M 208167 in the degraded n-hexyl alcohol.
3, geotrichum sp (Geotrichum, the Lk) application of TF CCTCC NO:M 208167 in making fragrance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102322485A CN101603008B (en) | 2008-11-13 | 2008-11-13 | Hexanol degrading bacterium and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102322485A CN101603008B (en) | 2008-11-13 | 2008-11-13 | Hexanol degrading bacterium and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101603008A true CN101603008A (en) | 2009-12-16 |
| CN101603008B CN101603008B (en) | 2011-03-23 |
Family
ID=41468911
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102322485A Expired - Fee Related CN101603008B (en) | 2008-11-13 | 2008-11-13 | Hexanol degrading bacterium and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101603008B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102217780A (en) * | 2011-02-23 | 2011-10-19 | 红云红河烟草(集团)有限责任公司 | Concrete flavouring for tobacco and preparation method and application thereof |
| CN103484279A (en) * | 2013-08-19 | 2014-01-01 | 师俊玲 | Method for reducing content of higher alcohols and improving content of esters in wine by using geotrichum candidum |
| CN106085977A (en) * | 2016-06-08 | 2016-11-09 | 西北工业大学 | The recombination of glutamte dehydrogenase and acquisition methods thereof and application |
| CN107345185A (en) * | 2017-08-21 | 2017-11-14 | 广西壮族自治区农业科学院农产品加工研究所 | A kind of processing method of flavored type litchi spirit |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| SU907060A1 (en) * | 1979-02-07 | 1982-02-23 | Всесоюзный Научно-Исследовательский Биотехнический Институт | Process for preparing rose oil |
| US5695973A (en) * | 1996-07-03 | 1997-12-09 | R.J. Reynolds Tobacco Company | Isolated alcohol dehydrogenase producing mold |
| CN100537741C (en) * | 2002-08-21 | 2009-09-09 | 麒麟麦酒株式会社 | Decolorized yeast cell wall fraction |
-
2008
- 2008-11-13 CN CN2008102322485A patent/CN101603008B/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102217780A (en) * | 2011-02-23 | 2011-10-19 | 红云红河烟草(集团)有限责任公司 | Concrete flavouring for tobacco and preparation method and application thereof |
| CN103484279A (en) * | 2013-08-19 | 2014-01-01 | 师俊玲 | Method for reducing content of higher alcohols and improving content of esters in wine by using geotrichum candidum |
| CN103484279B (en) * | 2013-08-19 | 2015-04-22 | 师俊玲 | Method for reducing content of higher alcohols and improving content of esters in wine by using geotrichum candidum |
| CN106085977A (en) * | 2016-06-08 | 2016-11-09 | 西北工业大学 | The recombination of glutamte dehydrogenase and acquisition methods thereof and application |
| CN107345185A (en) * | 2017-08-21 | 2017-11-14 | 广西壮族自治区农业科学院农产品加工研究所 | A kind of processing method of flavored type litchi spirit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101603008B (en) | 2011-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107629973B (en) | Pichia kudriavzevii strain for producing β -phenethyl alcohol and application thereof | |
| CN109266562A (en) | One plant height produces ethyl acetate exception Brunswick Durham yeast and its cultural method and application | |
| CN102676392B (en) | Endophytic fungus in salvia miltiorrhiza bunge and application thereof | |
| CN101603008B (en) | Hexanol degrading bacterium and preparation method and application thereof | |
| CN109294933A (en) | One Accharomyces cerevisiae and its method for co-culturing raising traditional fermented food quality with ester-producing yeast | |
| CN101993847B (en) | Bacterial cellulose strain | |
| CN105925646A (en) | Method for preparing cytochalasin H by using endophytic fungi in mangrove forest | |
| CN107937315A (en) | A kind of DSF colony induction signalings degradation bacteria and its application in control of plant disease | |
| CN101280279B (en) | Phomopsis capable of producing gallic acid | |
| CN107365719A (en) | The aerobic flora of one group of quick composting stalk | |
| CN109161488A (en) | One plant height produces Irpex lacteus strain and its cultural method of cordycepin | |
| CN102676405B (en) | Liquorice endophytic fungus for generating liquiritin | |
| CN109136100A (en) | One plant of Tabin aspergillus bacterial strain and the application on fermentation green brick tea | |
| CN112410231B (en) | Trichoderma viride new strain and application thereof | |
| CN102839140A (en) | L-lactic acid producing strain separated and screened out of corn soaking water | |
| CN106754430A (en) | Dendritic bacterial strains of cladosporium Cc 106 of high yield monascus purpureus and application thereof | |
| CN114317290A (en) | Bacterial strain capable of degrading diuron and application thereof | |
| Avchar et al. | Yeast isolation methods from specialized habitats | |
| CN106399181A (en) | Lactobacillus buchneri 8-2N and application thereof in preparation of phenyllactic acid | |
| CN113736669B (en) | Cordyceps sinensis fungus new species and separation and identification method thereof | |
| CN108624510B (en) | Cordyceps militaris single-mating strain 2461 and application thereof | |
| CN102234669B (en) | Biotransformation and purification method of 4-(2,3,5,6-tetramethylpyrazine-1-group)-4'-demethylepipodophyllotoxin | |
| CN103805543A (en) | Bacterial strain for producing herbimycin and application of bacterial strain | |
| CN108753663A (en) | One plant of streptomycete and its application with antibacterial activity | |
| CN109619382A (en) | A kind of application of volume branch Mucor in degradation gossypol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110323 Termination date: 20111113 |