CN101597595B - Bi-functional monoclonal antibody capable of anti-human von willbrand factor-A3 - Google Patents
Bi-functional monoclonal antibody capable of anti-human von willbrand factor-A3 Download PDFInfo
- Publication number
- CN101597595B CN101597595B CN2009100275681A CN200910027568A CN101597595B CN 101597595 B CN101597595 B CN 101597595B CN 2009100275681 A CN2009100275681 A CN 2009100275681A CN 200910027568 A CN200910027568 A CN 200910027568A CN 101597595 B CN101597595 B CN 101597595B
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- vwf
- district
- people
- hybridoma cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a hybridoma cell strain SZ-125(3D2) with the prevention number of CGMCC NO.2501 and a bi-functional monoclonal antibody capable of anti-human von willbrand factor-A3 secreted by the hybridoma cell strain. The monoclonal antibody is combined with the VWF A3 to block the combination of the VWF A3 and collagen and simultaneously influences the configuration of domain A1, thereby destroying the original domain A1 configuration capable of combining platelet GPIb alpha and achieving the aim of blocking the interaction of the VWF A1 and the GPIb alpha, so that not only combination of the VWF A3 and the collagen is blocked but also the combination of the VWF A1 and the platelet GPIb alpha is blocked. Thus, the monoclonal antibody can be used for preparing anti-artery thrombosis medicine with anti-platelet adhesion activity.
Description
Technical field
The present invention relates to a kind of monoclonal antibody, be particularly related to the bi-functional monoclonal antibody in anti-human von willebrand disease factor A3 (VWFA3) district and preparation method thereof, the invention further relates to described bifunctional antibody the preparation antiplatelet stick with antithrombotic medicine in application.
Background technology
Increase along with factors such as aging population and poor eating habits, the incidence of myocardial infarction, the medium thrombotic diseases of ischemic cerebral apoplexy and mortality ratio have occupied the first place, and further investigation thrombosis mechanism and development of new antithrombotic reagent are present field of medicaments problems anxious to be solved.
In recent years, thrombocyte Study on Molecular Mechanism in the thrombosis process has been promoted the development of molecular targeted agents, wherein with monoclonal antibody ReoPro (abciximab at platelet glycoprotein (GP) IIb/IIIa, Reopro) be representative, clinical application has obtained good antithrombotic therapy effect.Yet, because also there is the potentially dangerous that causes severe haemorrhage in ReoPro, so hindered the clinical application of this class medicine to a certain extent.
In order to overcome the defective of antithrombotic reagent, recently antiplatelet adheres to and rises as new antithrombotic therapy means, people attempt to come the initial adhesion of blocking platelet and collagen by suppressing collagen-vWF ELISA (VWF)-thrombocyte GPIb axle, promptly the stage stops and hematoblasticly to stick and activate in early days, thrombosis can be resisted to reach, the purpose of danger of bleeding can be reduced again.
Existing studies show that: VWF is mainly synthetic by endotheliocyte, has very significantly heterogeneity but express synthetic VWF, and VWF is the polymer that molecular weight does not wait in the blood plasma.At the initial stage of protein synthesis, VWF has experienced the modification after the translation, comprises dimerization and multimerization, and the cracking in D1～D2 interval.The multiple function of VWF is present in the different protein function districts, relevant as the A1 district with the combination of VWF and platelet glycoprotein I b, the D3 district is relevant with the combination of VWF and FVIII, and the C2 district is relevant with the combination of VWF and platelet glycoprotein IIb-IIIa acceptor, and the A3 district is relevant with the combination of VWF and collagen.
Therefore, interactional monoclonal antibody between development and exploitation blocking-up vWF ELISA A3 district and collagen or A1 district and the thrombocyte GPIb, can not only be from the formation of thrombotic commitment blocking-up thrombus, and may be able to utilize this monoclonal antibody inquire into A3 district and A1 district and how change to regulate hemostatic function by its configuration, thereby further study the mechanism of artery thrombosis and development, for the prevention and the early treatment thrombotic diseases open up new field; At present do not see that other unit has the report of the monoclonal antibody in the anti-angiogenic property of specific dual-use function inhibition christmas factor A3 district.
Summary of the invention
The object of the invention provides a kind of monoclonal antibody with the anti-angiogenic property of specificity christmas factor A3 district of dual-use function, combining of vWF ELISA A3 district and collagen can be blocked, combining of vWF ELISA A1 district and platelet glycoprotein Ib can be blocked again; Another object of the present invention provides the hybridoma cell line of the monoclonal antibody that can produce the anti-angiogenic property of above-mentioned specificity christmas factor A3 district; A further object of the present invention provides the application of monoclonal antibody in the anti-arterial thrombus of preparation in the anti-angiogenic property of above-mentioned specificity christmas factor A3 district.
For achieving the above object, the concrete technical scheme of the present invention is, a kind of hybridoma cell strain, and its preparation method may further comprise the steps:
(1) use recombinant human blood vessel christmas factor A3 district (rVWF A3) albumen as immunogen (referring to embodiment 1), with ordinary method immunity Balb/C mouse;
(2) obtain fused cell growth clone: from the aseptic B cell of getting its splenocyte as antigen sensibilization of the qualified mouse of immunity, according to a conventional method, B cell and myeloma cell SP2/0 strain are merged, utilize conventional fused cell HAT screening method to screen then, and then obtain fused cell growth clone;
(3) use biochemical and immunological technique screening and evaluation such as ELISA method and Western blotting after, pick out hybridoma cell strain SZ-123 (1B9) and SZ-125 (3D2) (referring to embodiment 2) that two strains have high antibody-secreting level;
In the technique scheme, use rVWF A3 albumen, conventional three immunizations female Balb/c mouse in 8 age in week (each 4 weeks at interval) as immunogen; Detect the existence and the concentration of monoclonal antibody in the immunized animal serum with enzyme-linked immunosorbent assay (ELISA); After immunity is finished, select to produce the sero-fast mouse of enough high densitys, the separating animal's spleen also prepares splenocyte suspension; According to known hybridoma technology (referring to:
And Milstein, Nature, 215:495-497,1975;
Et al, ImmunologyToday, 4:72-76,1983) resulting mouse boosting cell is merged mutually with myelomatosis, prepare the hybridoma cell line of the anti-angiogenic property of the sustainable justacrine that goes down to posterity christmas factor A3 region monoclonal antibody.
Because the function of two strain of hybridoma strains is identical, therefore select a wherein strain to carry out preservation, the preservation information of described hybridoma cell line is: depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center; Address: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica; Preservation date on May 14th, 2008; Deposit number CGMCC NO.2501; Classification name: hybridoma cell strain (mouse) Hybridoma Cell (Mouse);
For achieving the above object, concrete technical scheme of the present invention is: the monoclonal antibody in a kind of anti-angiogenic property christmas factor A3 district, described monoclonal antibody belongs to IgG1 subclass antibody, is produced by above-mentioned hybridoma cell line, and preparing described monoclonal antibody method has two kinds:
(1) the above-mentioned hybridoma of inoculation in the hybridoma nutrient solution, separation and purification gets the monoclonal antibody in the anti-angiogenic property of required specificity christmas factor A3 district in the nutrient solution of cultivation back;
(2) at the above-mentioned hybridoma of animal intraperitoneal inoculation, separation and purifying get the monoclonal antibody in the anti-angiogenic property of required specificity christmas factor A3 district in the animal ascites fluid.
Can use double antibody sandwich method to measure IgG concentration, and can further use immunoblotting (Western-Blot) to detect the specificity of gained monoclonal antibody.Among the present invention, distinguished called after SZ-123 and SZ-125 (referring to embodiment 3) by the monoclonal antibody that two strain of hybridoma produce.
Through detecting with immune double diffusion method, monoclonal antibody of the present invention belongs to IgG1 subclass antibody.The enzyme-linked immune analytic method detected result shows that monoclonal antibody of the present invention can combine with the people VWF specificity of rVWFA3 and wild-type, and does not have cross reaction with the vWF ELISA A1 and A2 district (rVWFA1 and the rVWFA2) that recombinate.In addition, our immunoblotting assay shows, monoclonal antibody of the present invention can combine with the VWF specificity of reductibility, and two strain monoclonal antibodies (SZ-123 and SZ-125) are two protein binding (referring to embodiment 3) of 250KDa and 170Kda at molecular weight with the VWF of reductibility respectively.
Our biological activity research shows, monoclonal antibody of the present invention can be blocked combine (referring to the embodiment 4) of human von willebrand disease factor A3 district and collagen effectively.
Our research proves first, anti-VWF A3 district monoclonal antibody SZ-123 of the present invention and SZ-125 both can suppress Rui Situo mycin (Ristocetin), rich Tobramycin (Botrocetin) and Ox blood plasma inductive human platelet aggregation (referring to embodiment 5-A) also can suppress Rui Situo mycin (Ristocetin) inductive VWF and immobilised rGPIb (H1-V289) active fragments and hematoblastic combination the (referring to embodiment 5-B).Therefore, monoclonal antibody of the present invention is difunctional inhibition type monoclonal antibody, and promptly SZ-123 and SZ-125 not only can suppress people VWF and the interaction of III Collagen Type VI, and suppresses VWF and thrombocyte GPIb α interaction.
For achieving the above object, concrete technical scheme of the present invention is: the bi-functional Monoclonal Antibody in described anti-human von willebrand disease factor A3 district has the application in the anti-arterial thrombus medicine of antiplatelet adhesive activity.
Principle of the present invention is: anti-VWF A3 district monoclonal antibody can combine with VWF A3 district, influences A1 district configuration, thus destroy originally can with thrombocyte GPIb α bonded A1 district configuration, reach and block the interactional purpose of VWF A1-GPIb α.Our experimental result prompting (referring to embodiment 4 and 5), VWF A1 district function is subjected to the indirect regulation of monoclonal antibody SZ-123 or SZ-125-VWF A3 coupling collar.Confirm that simultaneously the functionally active of VWF A3 and A1 is subjected to its adjusting of configuration separately.Therefore, can blocking platelet sticking on III Collagen Type VI molecule, again can blocking platelet sticking on the Laminin ELISA molecule.
At first, our proof, under in-vitro simulated high shear force state, anti-VWF A3 region monoclonal antibody of the present invention can suppress people's whole blood thrombocyte sticking on people's placenta and ox-hide skin III Collagen Type VI (referring to embodiment 6-A) in dose-dependently ground mode.
Secondly, experiment in vitro proves, the monoclonal antibody in anti-VWF A3 of the present invention district suppresses combine (referring to the embodiment 6-B) of people, macaque or Begle dog plasma VWF and collagen in the dose-dependently mode.
Once more, experiment in vitro proves that the monoclonal antibody in anti-VWF A3 of the present invention district also suppresses ristomycin (1.25mg/ml) and induces macaque platelet aggregation (referring to embodiment 6-C).
At last, further experimental studies results shows, under the high shear force state, monoclonal antibody of the present invention is enough to suppress the sticking on Laminin ELISA (laminin) molecule of thrombocyte in people's whole blood (referring to embodiment 6-D).
Because the technique scheme utilization, the present invention compared with prior art has following advantage:
(1) monoclonal antibody of the present invention can combine with people VWFA3 specificity, and does not have cross reaction with the human von willebrand disease factor A1 and the A2 district of reorganization, so can block combining of human von willebrand disease factor A3 district and collagen effectively.
(2) monoclonal antibody of the present invention can combine with VWF A3 district, influences A1 district configuration, thus destroy originally can with thrombocyte GPIb α bonded A1 district configuration, reach and block the interactional purpose of VWF A1-GPIb α.
Description of drawings
The preservation information of hybridoma cell line is: depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center; Address: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica; Preservation date on May 14th, 2008; Deposit number CGMCC NO.2501; Classification name: hybridoma cell strain (mouse) Hybridoma Cell (Mouse);
Fig. 1 is the proteic electrophorogram of reorganization VWFA3 of 12%SDS-PAGE identification and analysis purifying;
Fig. 2 shows that the ELISA method detects monoclonal antibody SZ-123 and SZ-125 and rVWFA3 specificity association reaction;
Fig. 3 demonstration measures SZ-123 with the Western-Blot blotting and SZ-125 combines with rVWFA3 and VWF specificity;
Fig. 4 shows that monoclonal antibody SZ-123 and SZ-125 suppress the combination of people VWF on the III Collagen Type VI of people's placenta or ox-hide skin of purifying respectively;
Fig. 5 shows that monoclonal antibody SZ-123 and SZ-125 suppress ristomycin, rich holder enzyme element and Ox blood plasma and induce the human platelet aggregation effect;
Fig. 6 shows that monoclonal antibody SZ-123 and SZ-125 suppress combining of ristomycin inductive people VWF and immobilised recombinant platelet GPIb alpha active fragment (rGPIb α H1-V298);
Fig. 7 shows that monoclonal antibody SZ-123 and SZ-125 suppress thrombocyte sticking on people's placenta or ox-hide skin III Collagen Type VI molecule in people's whole blood;
Fig. 8 shows that monoclonal antibody SZ-123 and SZ-125 suppress thrombocyte sticking on people's placenta Laminin ELISA (laminin) molecule in people's whole blood.
Embodiment
Below in conjunction with drawings and Examples the present invention is further described:
Embodiment 1: immunogen---the preparation in recombinant human blood vessel christmas factor A3 district (rVWF-A3)
(1) PCR design of primers and synthetic: design and synthesize a pair of primer that lays respectively at the upstream and downstream both sides of coding VWF-A3 district's (amino acid/11 681-1877) cDNA sequence (594bp),
Upstream primer, see the described base sequence of SEQ ID NO.1: 5 '-AT AAG CTT TCC CCTGCA CCT GAC TGC-3 ', 5 ' end contains Hind III restriction enzyme site;
Downstream primer, see the described base sequence of SEQ ID NO.2: 5 '-TG CTC GAG CCT AACAAA TCC AGA GCA-3 ', 5 ' end contains Xho I restriction enzyme site; Utilizing above-mentioned primer, is template with the VWF full-length cDNA, carries out pcr amplification, obtains the PCR product.
(2) clone of goal gene and sequential analysis: under the effect of T4DNA ligase enzyme, the PCR product of purifying directly is connected with the pUCm-T carrier, obtains the pUCm-T-VWF-A3 recombinant plasmid.With gained recombinant plasmid transformed TG1,, cut evaluation with Hind III and Xho I enzyme again through blue hickie screening.With the recombinant plasmid is that the full-automatic sequenator of template is measured dna sequence dna, and the dna sequence dna and the known VWF-A3 district cDNA sequence that record cloned sequence are in full accord, show that further clone's A3 district gene fragment is correct.
(3) construction and expression of pET20b (+)-VWF-A3 expression vector:, reclaim target gene fragment with Xho I, Hind III double digestion pUCm-T-VWF-A3 recombinant plasmid.In the presence of the T4DNA ligase enzyme, the same expression vector pET20b (Tag that contains 6 * His) that handles is connected with goal gene and process.Enzyme is cut and is identified recon pET20b (+)-VWF-A3, is used to transform host bacterium TG1, DE3.Get single colony inoculation and contain in the LB substratum of penbritin (100 μ g/ml), paraxin (25 μ g/ml) in 3ml, 37 ℃ of shaking culture are spent the night.Be inoculated in 3ml by 5% then and contain among the LB of penbritin, paraxin, be cultured to A
600nm=0.6-0.8 adds IPTG (final concentration is 1mmol/L) and induced 4-6 hour.The 15%SDS-PAGE electrophoresis is carried out in sampling, determines that with thin layer scanning the target protein of expressing accounts for the per-cent of total bacterial protein.After collecting thalline and carrying out ultrasonic bacteria breaking, collect respectively and go up cleer and peaceful precipitation, carry out the SDS-PAGE electrophoresis, to observe the existence form of expression product.Behind metal chelate chromatography post Ni-NTA resin (QIAGEN is company's product) purifying, its purity reaches more than 95%.Western engram analysis result shows, the albumen of reorganization can be specifically and anti-His antibody response, single tangible combined belt occur, and molecular weight (27KDa) consistent with inductive albumen (Fig. 1, wherein swimming lane 1 is the molecular weight of albumen standard; Swimming lane 2 is the pure product of rVWFA3; Swimming lane 3 and 4 is inclusion bodies of colibacillus).
Coding schedule intelligent VWF-A3 district cDNA sequence total length 594bp, see that the concrete sequence of the described base sequence of SEQ ID NO.3 is as follows:
TCCCCTGCACCTGACTGCAGCCAGCCCCTGGACGTGATCCTTCTCCTGGATGGCTCCTCCAGTTTCCCAGCTTCTTATTTTGATGAAATGAAGAGTTTCGCCAAGGCTTTCATTTCAAAAGCCAATATAAGGGCCTCGTCTCACTCAGGTGTCAGTGCTGCAGTATGGAAGCATCACCACCATTGACGTGCCATGGAACGTGGTCCCGGAGAAAGCCCATTTGCTGAGCCTTGTGGACGTCATGCAGCGGGAGGGAGGCCCCAGCCAAATCGGGGATGCCTTGGGCTTTGCTGTGCGATACTTGACTTCAGAAATGCATGGTGCCAGGCCGGGAGC?CTCAAAGGCGGTGGTCATCCTGGTCACGGACGTCTCTGTGGATTCAGTGGATGCAGCAGCTGATGCCGCCAGGTCCAACAGAGTGACAGTGTTCCCAATTGGAATTGGAGATCGCTACGATGCAGCCGACCTACGGATCTTGGCAGGCCCAAGCAGGCGACTCCAACGTGGGGAAAGCTCCAGCGAATCGAAGACCTCCCTACCATGGTCACCTTGGGCAATTCCTTCCTCCACAAACTGTGCTCTGGATTTGTTAGG。
Embodiment 2: the MONOCLONAL ANTIBODIES SPECIFIC FOR in the anti-angiogenic property of specificity christmas factor A3 district
We use routine immunization method and hybridoma technology (
And Milstein, Nature, 215:495-497,1975) prepare monoclonal antibody of the present invention.
At first, with rVWF-A3 district protein immune 8 all female Balb/c mouse in age (Shanghai academy of sciences Experimental Animal Center) of purifying, immunity is three times altogether, around each interval.Add abdominal injection for the subcutaneous multi-point injection in back preceding twice, for the third time for to add abdominal injection through mouse tail vein injection.
After treating to be reached enough height, put to death animal and separating spleen cell by the serum antibody titer of immune mouse.The monoclonal antibody cell-fusion techniques of application standard will be carried out cytogamy by the SP2/0 myeloma cell of spleen cell of immune Balb/c mouse and mouse (introduce in Paris, FRA blood Collection Center hybridoma laboratory).In the HAT substratum, select to cultivate fused cell, get supernatant filters out high-level secretory antibody with the ELISA method cell strain after the cultivation.Be used for further enlarged culturing or frozen.
After using biochemical and immunological technique screening such as ELISA method and Western blotting and identifying, obtain the monoclonal antibody in the anti-angiogenic property of two strain specificitys christmas factor A3 district, difference called after SZ-123 and SZ-125 (Fig. 2).
For a large amount of preparation monoclonal antibodies, we select BALB/c mouse or its parental generation mouse for use, earlier with the capable mouse peritoneal injection of pristane, after the week hybridoma are inoculated in the mouse peritoneal (5 * 10
5/ mouse).Promptly have tangible ascites to produce greatly after one week of inoculation, every mouse can be collected 5～10ml ascites.
Embodiment 3: the chemical property of monoclonal antibody of the present invention
(1) use immune double diffusion method and measure confirmation, monoclonal antibody SZ-123 of the present invention and SZ-125 all belong to the IgG1 subclass.
(2) monoclonal antibody SZ-123 and SZ-125 are inoculated in Balb/c mouse peritoneal generation ascites,, obtain IgG 3-6mg but predict every 1mL ascites purifying with G-Sepharose-4B (Pharmacia company product) column purification.
(3) ELISA measuring SZ-123 and SZ-125 specificity: (the FVIII enriched material that provides from Anhui green cross biological products company limited is by Sepharose 4B gel chromatography column purification) (2 μ g/ml) wraps quilt respectively on 96 orifice plates with VWF A1, A2, the A3 (being this laboratory expresses and purifying) of reorganization and the pure product of people VWF.4 ℃ are spent the night and after the washing of PBS-0.05%-polysorbas20, spend the night with the 2%BSA-PBS sealing.Every hole adds the monoclonal antibody (500ng/ml) of purifying respectively, and 37 ℃ were reacted 1 hour.After the washing, add the sheep anti-mouse antibody (Beckman-Immunotech company product) of horseradish peroxidase-labeled, 37 ℃ of reactions add the OPD colour developing after 1 hour then.Enzyme-linked immunosorbent assay is measured and is shown, SZ-123 and SZ-125 combine with people VWF high specific, and with the reorganization rVWF-A1 district and rVWF-A2 district no cross reaction (Fig. 2, X-coordinate is the various antigens of the tested drafting board of bag, and ordinate zou is the antibody represented with 490nm place absorbancy and the binding capacity of envelope antigen.Experiment repeats 3 times).
(4) immunoblot assay (Western-blot) is determined the antigen molecule of monoclonal antibody identification of the present invention: the rVWFA3 of purifying, rVWFA1 separate with 5%SDS-PAGE through 12% respectively with VWF, and electrotransfer is to the nitric acid film.37 ℃ of reactions of nitric acid film and monoclonal antibody (5 μ g/ml) make the sheep anti-mouse antibody of bonded monoclonal antibody and horseradish peroxidase-labeled react 1 hour for 37 ℃ after 1 hour again, and electricity consumption chemoluminescence method (ECL) carries out the substrate colour developing then.The Western-blot Blot experiment confirms, SZ-123 and SZ-125 can combine with the VWF of reductibility, and be that combined belt (Fig. 3 appears respectively in 250KDa and 170KDa at molecular weight, wherein A demonstration rVWF A3 or VWF after 12% or 5%SDS-PAGE electrophoretic separation of reductibility, combine with the anti-people VWF of the rabbit antibody (VWFpAb) of monoclonal antibody SZ-123 or SZ-125 or horseradish peroxidase-labeled respectively respectively.B shows r VWF A1 after the 12%SDS-PAGE of reductibility electrophoretic separation and immunity transfer, with monoclonal antibody SZ-123 or SZ-125 reaction).This result proves that further SZ-123 and SZ-125 combine with people VWFA3 district high specific, and with the reorganization rVWF-A1 district no cross reaction.
(5) Scatchard analyzes the affinity costant Ka of monoclonal antibody and the constant K d that dissociates: use
125I mark monoclonal antibody carries out Scatchard then and analyzes, and records SZ-123 and SZ-125 and vWF ELISA bonded affinity costant Ka and the constant K d (table 1) that dissociates.This presentation of results, SZ-123 and SZ-125 and VWF have high affinity.
Table 1:SZ-123 and SZ-125 affinity costant Ka and the constant K d value of dissociating
| mAbs? | Ka(×10 11L/Mol) | Kd(×10 -12Mol/L) |
| SZ-123? | 6.5±3.9? | 1.5±0.9? |
| SZ-125? | 2.1±1.3? | 4.7±2.4? |
Embodiment 4: monoclonal antibody blocking-up vWF ELISA A3 of the present invention district combines with collagen
Acetate acidifying people's placenta or ox-hide skin III Collagen Type VI (Sigma company product) are wrapped respectively by on 96 orifice plates (2 μ g/ hole), and 4 ℃ are spent the night.After 2%BSA sealing and the washing of PBS-0.05%-polysorbas20, in the hole of each glue primordial covering, add the people VWF and the monoclonal antibody (0.03-8 μ g/ml) of 100 μ l purifying simultaneously, 37 ℃ are incubated 2 hours.After the washing, measure bonded VWF with the anti-people VWF of the rabbit antibody (DakoCytomation company) of horseradish peroxidase-labeled.The result shows that anti-VWF A3 region monoclonal antibody SZ-123 and SZ-125 suppress purifying in dosage dependence mode people VWF combines with the III Collagen Type VI of people or ox.Therefore can prove further that monoclonal antibody SZ-123 of the present invention and SZ-125 can suppress the interaction between VWF and III Collagen Type VI.Wherein SZ-123 and SZ-125 suppress VWF and people's placenta III Collagen Type VI (IC respectively
50=0.07 ± 0.01 and 0.15 ± 0.03 μ g/ml) and ox-hide skin III Collagen Type VI (IC
50Keying action=0.48 ± 0.06 and 0.51 ± 0.07 μ g/ml) (Fig. 4, wherein A shows people's placenta III Collagen Type VI; B shows ox-hide skin III Collagen Type VI.The antibody concentration that X-coordinate is represented with the concentration logarithm of antibody, ordinate zou represent that antibody is to VWF and collagen bonded inhibiting rate.Experiment repeats 3 times).
Embodiment 5: monoclonal antibody blocking-up vWF ELISA A1 of the present invention district combines with thrombocyte GPIb's
The influence that A, monoclonal antibody SZ-123 and SZ-125 test human platelet aggregation:
Gathered normal healthy people whole blood (1/9 anti-freezing of 3.8% Trisodium Citrate) 100 * g centrifugal 10 minutes, and got the upper strata and be rich in thrombocyte blood plasma (PRP).With the monoclonal antibody (3.5-100 μ g/ml) of various concentration respectively with PRP room temperature insulation in advance 10 minutes, and then use ristomycin (Ristocetin respectively, Sigma company product) (1.25mg/ml), rich holder enzyme element (Botrocetin, Belgium Katholieke UniversityLeuven Campus, Deckmyn professor H provides) (0.5 μ g/ml), Ox blood plasma (10%, Sigma company product), collagen (2ug/ml, Chrono-Log company product) or adenosine diphosphate (ADP) (ADP) (2 μ mol/ml, Sigma company product) induced platelet assemble.Platelet aggregation test is the result show, anti-VWF A3 district monoclonal antibody SZ-123 and SZ-125 suppress ristomycin, rich Tobramycin and Ox blood plasma (Sigma company) inductive platelet aggregation (Fig. 5 respectively, wherein the negative control antibodies of SZ-34 and 82D6A3 is tested and is repeated 3 times).Wherein, SZ-123 and SZ-125 rely on mode ground inhibition ristomycin induced platelet gathering (IC with dosage
50=4.54 ± 0.62 and 8.21 ± 1.02 μ g/ml).
B, SZ-123 and SZ-125 influence VWF and immobilised recombinant platelet GPIb alpha active fragment (rGPIb α H1-V298) bonded:
Antiplatelet GPIb α monoclonal antibody 2D4 (5 μ g/ml) (Belgian KatholiekeUniversity Leuven Campus with non-barrier, Deckmyn professor H provides) wrap by on 96 hole enzyme plates, after the 0.05%-tween-20-PBS washing 3 times, the rGPIb α H1-V298 (2.5 μ g/ml) (this laboratory expression and purification) that adds the expressing cho cell of 100 μ l purifying, 37 ℃ are incubated 1 hour.After the washing, add VWF (0.6 μ g/ml)-ristomycin (0.5mg/ml)-SZ-123 or SZ-125 (3.125-5 μ g/ml) 100 μ l simultaneously, 37 ℃ are continued insulation 1 hour.After the washing, the bonded VWF anti-people VWF of the rabbit TPPA of horseradish peroxidase-labeled.Experimental result shows that SZ-123 and SZ-125 suppress Ristocetin inductive VWF and combine (Fig. 6, wherein the negative control antibodies of SZ-34 is tested and repeated 3 times) with immobilised reorganization rGPIb (H1-V289) active fragments and thrombocyte.
In addition, we also confirm, monoclonal antibody SZ-123 and SZ-125 also suppress ristomycin inductive VWF and combine with the immobilization thrombocyte, therefore anti-VWF A3 district monoclonal antibody SZ-123 and SZ-125 not only suppress VWF and the interaction of III Collagen Type VI, also suppressing VWF and thrombocyte GPIb α and interact, is the difunctional inhibition type of two strains monoclonal antibody.These two the anti-VWF A3 of description of test district monoclonal antibodies can combine with VWF A3 district, influence A1 district configuration, thus destroy originally can with thrombocyte GPIb α bonded A1 district configuration, reach and block the interactional purpose of VWF A1-GPIb α.
Embodiment 6: the application of monoclonal antibody of the present invention
A: monoclonal antibody of the present invention suppresses thrombocyte sticking on III Collagen Type VI molecule in people's whole blood
Under in-vitro simulated high shear force state, application of shear force is 1000S
-1Flow chamber test (peristaltic pump of use (Perfusor compact S8714843) is a German B.Braun Mesurgen AGC company product).Whole filling process all carries out at 37 ℃.Through people's whole blood of anticoagulant heparin (40U/ml), hatched 15 minutes at 37 ℃ with monoclonal antibody SZ-123 or SZ-125 or SZ-34 (1-50 μ g/ml) at first respectively.Whole blood pours into 5 minutes (2ml/ branch) respectively in wrapping by the Tissue Culture Dish of people's placenta or ox-hide skin III Collagen Type VI (100 μ g/ml) surface cell then.Will be through Tissue Culture Dish surface that thrombocyte adhered to lightly after the rinsing 2 times, fix 15 minutes, under LEICA DC300 microscope (German LEICA DMIRB company product), observe and take adherent thrombocyte at last with 2% Paraformaldehyde 96 with PBS.The result shows, anti-VWF A3 district monoclonal antibody SZ-123 and SZ-125 suppress human blood platelets sticking on people's placenta and ox-hide skin III Collagen Type VI in dosage dependence mode respectively that (Fig. 7, wherein A shows and pours into after 5 minutes, takes adherent thrombocyte at microscopically.Used antibody concentration is 10 μ g/ml, wherein the negative control antibodies of SZ-34.B (human placental collagen) and C (ox-hide skin collagen) show that respectively the quantitative analysis monoclonal antibody of different concns (0-50 μ g/ml) adheres to the influence of percentage ratio to thrombocyte on III Collagen Type VI surface.Experiment repeats 3 times).Monoclonal antibody SZ-123 and SZ-125 suppress platelet adhesion reaction and suppress antibody concentration (IC in 50% of people's placenta III Collagen Type VI
50) be respectively 3.6 ± 0.5 μ g/ml and 10.3 ± 4.8 μ g/ml, and SZ-123 and SZ-125 suppress the 50% inhibition antibody concentration (IC of platelet adhesion reaction in ox-hide skin III Collagen Type VI
50) be respectively 3.1 ± 0.6 μ g/ml and 11.3 ± 3.6 μ g/ml (Fig. 7).This experiment confirm, monoclonal antibody of the present invention are enough to suppress thrombocyte sticking on III Collagen Type VI molecule in the whole blood.
B: monoclonal antibody of the present invention suppresses the association reaction of people, macaque or Begle dog plasma VWF and collagen
Acetate acidifying people's placenta or ox-hide skin III Collagen Type VI (Sigma company product) are wrapped respectively by on 96 orifice plates (2 μ g/ hole), and 4 ℃ are spent the night.After 2%BSA sealing and the washing of PBS-0.05%-polysorbas20, add 100 μ l people or macaque or Begle dog plasma (macaque and Beagle dog blood are provided by Suzhou Western Hills Experimental Animal Center) and monoclonal antibody (0.03-8 μ g/ml) simultaneously, 37 ℃ are incubated 2 hours.After the washing, measure bonded VWF with the anti-people VWF of the rabbit antibody (DakoCytomation company) of horseradish peroxidase-labeled.The result shows, combine (table 2 and 3) of anti-VWF A3 region monoclonal antibody SZ-123 and SZ-125 dose-dependently ground inhibition people, macaque or Begle dog plasma VWF and people's placenta or ox-hide skin III Collagen Type VI.
Table 2.SZ-123 and SZ-125 inhibition people, macaque and Beagle dog thing blood plasma VWF combine with ox-hide skin III Collagen Type VI
Table 3.SZ-123 and SZ-125 inhibition people, macaque and Beagle dog thing blood plasma VWF combine with people's placenta III Collagen Type VI
C: monoclonal antibody of the present invention suppresses ristomycin inductive macaque platelet aggregation
Gathered normal health macaque whole blood (1/9 anti-freezing of 3.8% Trisodium Citrate) 100 * g centrifugal 10 minutes, and got the upper strata and be rich in thrombocyte blood plasma (PRP).With the monoclonal antibody (3.5-100 μ g/ml) of various concentration respectively with PRP room temperature insulation in advance 10 minutes, and then use respectively ristomycin (Ristocetin, Sigma company product) (1.25mg/ml) induced platelet assemble.Platelet aggregation test is the result show, anti-VWF A3 district monoclonal antibody SZ-123 and SZ-125 suppress ristomycin (Sigma company) inductive macaque platelet aggregation platelet aggregation respectively.
D: monoclonal antibody of the present invention suppresses thrombocyte sticking at people's placenta Laminin ELISA in people's whole blood
Under in-vitro simulated high shear force state, application of shear force is 1000S respectively
-1, 2000S
-1Flowchamber test (peristaltic pump of use (Perfusor compact S8714843) is a German B.BraunMesurgen AGC company product).Whole filling process all carries out at 37 ℃.Through people's whole blood of anticoagulant heparin (40U/ml), hatched 15 minutes at 37 ℃ with monoclonal antibody SZ-123 or SZ-125 or SZ-34 (50 μ g/ml) at first respectively.Then whole blood respectively in wrapping by the Tissue Culture Dish of people's placenta Laminin ELISA (50 μ g/ml) surface cell perfusion (shearing force was respectively 1000S in 5 minutes
-1, 2000S
-1).Will be through Tissue Culture Dish surface that thrombocyte adhered to lightly after the rinsing 2 times, fix 15 minutes, under LEICA DC300 microscope (German LEICA DMIRB company product), observe and take adherent thrombocyte at last with 2% Paraformaldehyde 96 with PBS.The result shows, anti-VWF A3 district monoclonal antibody SZ-123 and SZ-125 suppress human blood platelets respectively and stick at people's placenta Laminin ELISA that (Fig. 8, wherein top 3 figure demonstration shearing forces are 1000S
-1Pour into after 5 minutes, take adherent thrombocyte at microscopically.Used antibody concentration is 50 μ g/ml, wherein the negative control antibodies of SZ-34; Below 3 figure show that shearing forces are 2000S
-1Pour into after 5 minutes, take adherent thrombocyte at microscopically, used antibody concentration is 50 μ g/ml, wherein the negative control antibodies of SZ-34.The result be in 3 repeated experiments once).This experiment confirm, monoclonal antibody of the present invention are enough to suppress thrombocyte sticking at people's placenta Laminin ELISA in the whole blood.
SE?QUENCE?LISTING
＜110〉University Of Suzhou
＜120〉the bi-functional monoclonal antibody in anti-human von willebrand disease factor A3 district
<160>3
<170>PatentIn?version?3.5
<210>1
<211>26
<212>DNA
＜213〉synthetic
<400>1
ataagctttc?ccctgcacct?gactgc 26
<210>2
<211>26
<212>DNA
＜213〉synthetic
<400>2
tgctcgagcc?taacaaatcc?agagca 26
<210>3
<211>594
<212>DNA
＜213〉species home sapiens (Homo sapiens)
<4000>3
tcccctgcac?ctgactgcag?ccagcccctg?gacgtgatcc?ttctcctgga?tggctcctcc 60
agtttcccag?cttcttattt?tgatgaaatg?aagagtttcg?ccaaggcttt?catttcaaaa 120
gccaatataa?gggcctcgtc?tcactcaggt?gtcagtgctg?cagtatggaa?gcatcaccac 180
cattgacgtg?ccatggaacg?tggtcccgga?gaaagcccat?ttgctgagcc?ttgtggacgt 240
catgcagcgg?gagggaggcc?ccagccaaat?cggggatgcc?ttgggctttg?ctgtgcgata 300
cttgacttca?gaaatgcatg?gtgccaggcc?gggagcctca?aaggcggtgg?tcatcctggt 360
cacggacgtc?tctgtggatt?cagtggatgc?agcagctgat?gccgccaggt?ccaacagagt 420
gacagtgttc?ccaattggaa?ttggagatcg?ctacgatgca?gccgacctac?ggatcttggc 480
aggcccaagc?aggcgactcc?aacgtgggga?aagctccagc?gaatcgaaga?cctccctacc 540
atggtcacct?tgggcaattc?cttcctccac?aaactgtgct?ctggatttgt?tagg 594
Claims (3)
1. hybridoma cell strain is characterized in that: described hybridoma cell strain is for by China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation, and deposit number is the hybridoma cell strain SZ-125 of CGMCC NO.2501.
2. the bi-functional monoclonal antibody in an anti-human von willebrand disease factor A3 district is characterized in that: described monoclonal antibody is for by the described hybridoma cell strain excretory of claim 1 monoclonal antibody.
3. the bi-functional monoclonal antibody in the described anti-human von willebrand disease factor A3 of claim 2 district has application in the anti-arterial thrombus medicine of antiplatelet adhesive activity in preparation, described anti-arterial thrombus medicine can blocking platelet sticking on III Collagen Type VI molecule, again can blocking platelet sticking on the Laminin ELISA molecule.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100275681A CN101597595B (en) | 2009-05-12 | 2009-05-12 | Bi-functional monoclonal antibody capable of anti-human von willbrand factor-A3 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100275681A CN101597595B (en) | 2009-05-12 | 2009-05-12 | Bi-functional monoclonal antibody capable of anti-human von willbrand factor-A3 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101597595A CN101597595A (en) | 2009-12-09 |
| CN101597595B true CN101597595B (en) | 2010-12-08 |
Family
ID=41419192
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100275681A Expired - Fee Related CN101597595B (en) | 2009-05-12 | 2009-05-12 | Bi-functional monoclonal antibody capable of anti-human von willbrand factor-A3 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101597595B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102614513A (en) * | 2012-04-12 | 2012-08-01 | 苏州大学附属第一医院 | Application of anti-angiohemophilia factor A3 zone bifunctional monoclonal antibody |
| CN105732814A (en) * | 2016-03-08 | 2016-07-06 | 苏州大学 | Human-mouse chimeric monoclonal antibody for human von willebrand factor A3 region as well as preparation method and application of human-mouse chimeric monoclonal antibody |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117229423B (en) * | 2023-11-10 | 2024-02-06 | 北京科技大学 | Polypeptide nano material for binding collagen and preparation method and application thereof |
-
2009
- 2009-05-12 CN CN2009100275681A patent/CN101597595B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102614513A (en) * | 2012-04-12 | 2012-08-01 | 苏州大学附属第一医院 | Application of anti-angiohemophilia factor A3 zone bifunctional monoclonal antibody |
| CN105732814A (en) * | 2016-03-08 | 2016-07-06 | 苏州大学 | Human-mouse chimeric monoclonal antibody for human von willebrand factor A3 region as well as preparation method and application of human-mouse chimeric monoclonal antibody |
| CN105732814B (en) * | 2016-03-08 | 2019-05-28 | 苏州大学 | People's mouse chimeric mAb in the area anti-human von willebrand disease factor A3 and its preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101597595A (en) | 2009-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105087497B (en) | Hybridoma cell strain ZJEB8-01, anti-Ebola virus GP protein monoclonal antibody and its preparation and application | |
| CN112442124B (en) | anti-CD 23 protein monoclonal antibody, cell line, preparation method and application thereof | |
| CN111454360B (en) | anti-CD 61 protein monoclonal antibody, cell line, preparation method and application thereof | |
| CN110903389B (en) | Monoclonal antibody and cell line for resisting GFAP protein, and preparation method and application thereof | |
| CN113234155B (en) | anti-Calponin protein monoclonal antibody, cell strain thereof, preparation method and application | |
| CN113045652B (en) | anti-DOG 1 protein monoclonal antibody and cell strain, preparation method and application thereof | |
| CN113265003B (en) | anti-TdT protein monoclonal antibody, cell strain thereof, preparation method and application | |
| KR100855299B1 (en) | Monoclonal antibodies specific against il-32 antigens, hybridoma producing the monoclonal antibodies and diagnostic systems using the monoclonal antibodies | |
| CN113045667A (en) | anti-IDO 1 protein monoclonal antibody and cell strain, preparation method and application thereof | |
| CN101074264B (en) | Recombinant anti-CTLA4 monoclonal antibody, its production and use | |
| CN101597595B (en) | Bi-functional monoclonal antibody capable of anti-human von willbrand factor-A3 | |
| CN108659125B (en) | Monoclonal antibody of anti-helicobacter pylori protein, cell strain, preparation method and application thereof | |
| CN110172097A (en) | A kind of monoclonal antibody and its application of Killing Mycobacterium Tuberculosis CFP-10 albumen | |
| CN108997501A (en) | Anti- VWF protein monoclonal antibody and application thereof | |
| CN107188965A (en) | Anti- DOG1 protein monoclonal antibodies and application thereof | |
| CN110511277A (en) | A kind of anti-HSP90 monoclonal antibody and its application | |
| CN105754953B (en) | The monoclonal antibody and its application of anti-human flatfoot albumen blood platelet accumulation regions | |
| CN108998423A (en) | Anti- vimentin (Vimentin) monoclonal antibody and application thereof | |
| CN109096400A (en) | Anti- PDPN protein monoclonal antibody and application thereof | |
| CN113845592A (en) | anti-CK 5/6 protein monoclonal antibody, cell strain thereof, preparation method and application | |
| CN113831410A (en) | anti-CD 56 protein monoclonal antibody and cell strain, preparation method and application thereof | |
| CN106977605A (en) | Anti- CD19 protein monoclonal antibodies and application thereof | |
| AU2021104248A4 (en) | Recombinant Human VASN Protein-LRR Domain Protein and Monoclonal Antibody Thereof | |
| CN104530211B (en) | A kind of tumor associated antigen MAGE-D4 restructuring truncated proteins and preparation method and applications | |
| CN108387731A (en) | A kind of enzyme linked immunosorbent detection and preparation method for people's PD1 albumen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: SUZHOU SUDA SAI ER IMMUNITY BIOTECHNOLOGY CO., LTD Free format text: FORMER OWNER: SUZHOU UNIVERSITY Effective date: 20120209 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 215123 SUZHOU, JIANGSU PROVINCE TO: 215000 SUZHOU, JIANGSU PROVINCE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20120209 Address after: 215000 No. 502 South Street, Suzhou Industrial Park, Jiangsu, China Patentee after: Suzhou Suda Saier Immunobiology Technology Co., Ltd. Address before: 215123 Suzhou City, Suzhou Province Industrial Park, No. love road, No. 199 Patentee before: Soochow University |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101208 Termination date: 20120512 |