CN101595129A - The crystalline structure of THSR acceptor - Google Patents

Abstract

The present invention relates to a kind of crystallizable composition of the TSHR of containing polypeptide, the crystal that relates to a kind of TSHR of containing polypeptide with relate to the application relevant with TSHR.

Description

The crystalline structure of THSR acceptor

Technical field

The present invention relates to thyrotropin receptor---the autoantibody that is also referred to as thyrotropin receptor (TSHR) and reacts with TSHR, especially by the TSHR of X-ray crystallography mensuration and the interaction between this autoantibody.

Background technology

Thyrotropin is that thyrotropic hormone (TSH) is a kind of pituitrin (Szkudlinski MW that regulates thyroid function by TSHR, Fremont V, Ronin C, Weintraub 2002Thyroid-stimulating hormone and TSHR structure-function relationships.Physiological Reviews 82:473-502).TSH is attached to TSHR initiation acceptor and sends signal, and it promotes the formation and the release of Triiodothyronine thyroxine (T4) and triiodothyronine (T3).Have a kind of Feedback mechanism to relate to the level of T4 and T3 in the circulation and by hypothalamus excretory thyrotrophin-releasing hormone (TRH), the release of this mechanism control TSH, TSH control conversely that Tiroidina stimulates and serum in the level of Triiodothyronine.

TSHR is a kind of acceptor of G albumen coupling, and it contains three structural domains: rich leucine structural domain (LRD), cutting structure territory (CD) and membrane spaning domain (TMD) (

Miguel R, Sanders J, Jeffreys J, Depraetere H, Evans M, Richards T, Blundell TL, Rees Smith B, Furmaniak J 2004Analysis of the thyrotropinreceptor-thyrotropin interaction by comparative modeling.Thyroid 14:991-1011).TSHR and other glycoprotein hormones acceptors are that lutropin acceptor (LHR) and Follicle Stimulating Hormone Receptors (FSHR) have amino acid and structural similarity.With the structure of its part (being FSH) compound FSHR 2.9

Resolving power under revealed (Fan QR, HendricksonWA 2005Structure of human follicle-stimulating hormone in complexwith its receptor.Nature 433:269-277).

A lot of data explanations of this area, some autoimmune thyroid disease patient (AITD, a kind of modal autoimmune disease that influences different crowd in the world wide) has autoantibody (the Rees Smith B that reacts with TSHR, McLachlan SM, Furmaniak J 1988Autoantibodies to the thyrotropin receptor.Endocrine Reviews 9:106-121).In most of the cases, these autoantibodies combine and imitate the effect of TSH with TSHR, thereby stimulate Tiroidina to produce high-caliber T4 and T3.It is TSHR autoantibody (TRAb) that these autoantibodies are called as the thyrotrophic hormone(TH) autoantibody, and it has stimulating activity is the TSH agonist activity.The common may command thyroid function of Feedback mechanism, but under the situation that the thyrotrophic hormone(TH) autoantibody exists and have among the patient of hyperthyroidism shape (Triiodothyronine is too much in the serum) no longer valid.This illness is called as hyperthyroidism or GraveShi disease.The TRAb that has stimulating activity among some patient is considered to interact with TSHR in retrobulbar tissue, and causes the eyes symptom of GraveShi disease.

Autoantibody among some AITD patient combines with TSHR, thereby stops TSH and described receptors bind, but does not stimulate the active ability of TSHR, and the autoantibody of these types is called as that to have the activity of blocking-up be the TRAb of TSH antagonistic activity.

When the TSHR autoantibody is present in pregnant woman's the serum with high density, can pass placenta and cause newborn infant's hyperthyroidism (under the situation of pungency autoantibody) or neonatal hypothyroidism (under the situation of barrier autoantibody) (Rees Smith B, McLachlan SM, Furmaniak J1988supra).

Human monoclonal autoantibody as the powerful thyrotrophic hormone(TH) factor (hMAb TSHRl) has a detailed description in International Patent Application WO 2004/050708A2.The binding site of hMAb TSHRl is found the surface that is positioned at the rich leucine structural domain of TSHR (LRD), and widely overlapping with the TSH binding site.Yet the binding pocket of TSH or hMAb TSHRl (binding pocket) has certain conformation, comprises the discontinuity zone of the TSHR that folds.The minutia of the binding site of hMAb TSHRl, especially importantly in TSHR and hMAb TSHRl interact contact amino acid whose minutia, to be intended to improve with the diagnosis of TSHR autoimmune response diseases associated and Study on Management in be very important.

International Patent Application WO 2006/016121A discloses a mutation T SHR preparation that comprises at least one point mutation, and it can be used for patients serum's pungency TSHR autoantibody, patients serum's barrier TSHR autoantibody and thyrotropic hormone in screened patient's humoral sample are carried out differential screening and evaluation.The described invention of international patent application no WO2006/016121A provides the useful information about the TSHR zone, described TSHR zone for comprise hMAb TSHR1, have TSHR and block the multiple antibody of active mouse monoclonal antibody (9D33) and very important with the interaction of TSH.Yet, even if best experimental study (those researchs that relate to TSHR sudden change of for example describing in WO2006/016121A) also can't obtain the interactional details on atomic level between amino acid among the TSHR and the amino acid among the hMAb TSHRl.

The present invention is based on the preparation of the mixture that the Fab fragment by TSHR LRD fragment (participate in form TSH and hMAb TSHRl binding pocket) and hMAb TSHRl forms.For simplicity, the described hMAb TSHRl of this specification sheets preparation is called as M22.M22IgG can buy from RSR company.The TSHR fragment (TSHR260) that comprises amino acid/11-260 is called as TSHR260-M22 with the segmental mixture of hMAb TSHRl (M22) Fab.With TSHR260-M22 purifying, concentrated and crystallization.The data that derive from X-ray diffraction are used to disclose the structure of TSHR260, as described herein.Document description in the past 1.65

Resolving power under structure (the Sanders J of the M22Fab that discloses, Jeffreys J, Depraetere H, Evans M, Richards T, Kiddie A, Brereton K, Premawardhana LDKE, Chirgadze DY, Nunez Miguel R, Blundell TL, Furmaniak J, Rees Smith B 2004Characteristics of a humanmonoclonal autoantibody to the thyrotropin receptor:sequence structureand function.Thyroid 14:560-570).With the M22 in the mixture and its texture ratio of unconjugated M22.Then in the interaction of accurately studying on the atomic level between TSHR260 and the M22.

Now, it is intact through highly purified TSHR preparation in conjunction with activity also can't to obtain its TSH and TRAb.The described purified TSHR preparation in this area is a partially denaturing, and does not reach crystallization required enough purity and homogeneity.

Summary of the invention

One aspect of the present invention provides a kind of crystallizable composition, comprises the TSHR polypeptide, promptly contains the polypeptide of the adjacent amino acid of the primary sequence that comes from thyrotropin receptor.

Another aspect of the present invention provides a kind of crystal of the TSHR of comprising polypeptide.

Another aspect of the present invention provides the crystallizable mixture of a kind of TSHR of comprising polypeptide and TSHR binding entity (entity).

The advantage of this mixture is that the TSHR binding entity can stablize described TSHR polypeptide.The present invention also provides the method that produces the crystallizable mixture comprise TSHR polypeptide and TSHR binding entity, and wherein said TSHR binding entity has relative high affinity to described TSHR polypeptide with TSH is compared, and can stablize described TSHR polypeptide.A kind of suitable TSHR binding entity is M22.When the TSHR joint is used in the generation of TSHR polypeptide it is stablized.For example, when in the cell of the DNA construct of expressing coding TS HR-polypeptide such as insect cell, producing the TSHR polypeptide, can add TSHR joint such as M22Fab, thereby when the TSHR polypeptide secrete, it " be caught " and stablize to this cell.

Another aspect of the present invention provides a kind of DNA construct by expression coding TS HR polypeptide to produce the method for the mixture of TSHR polypeptide and TSHR joint, and described method comprises to be expressed the TSHR polypeptide and add the TSHR polypeptide of TSHR joint with stably excreting.

It is a kind of by expressing the method that DNA construct that coding is connected to the TSHR polypeptide of TSHR binding entity such as M22 produces the mixture of TSHR polypeptide and TSHR joint that another aspect of the present invention provides, and described method comprises expresses the TSHR polypeptide that is connected to the TSHR binding entity.

Another aspect of the present invention provides the cocrystallization (co-crystal) of a kind of TSHR of comprising polypeptide and TSHR binding entity.

The TSHR polypeptide preferably comprises Mammals TSHR sequence.Preferably, described Mammals sequence is the people source, but also can consider to use orangutan, cercopithecus aethiops, macaque (rhesusmonkey), dog, cat, pig, horse, ox or cavy.Preferably, described TSHR polypeptide comprises at least a portion of the rich leucine structural domain of TSHR, most preferably human sequence.Preferably, described TSHR polypeptide comprises the amino acid 22-260 of the human TSHR sequence of wild-type.TSHR polypeptide in the mixture of the present invention can comprise TSHR wild type full-length sequence.Perhaps, described TSHR polypeptide can comprise the mutant nucleotide sequence of wild-type sequence.For example, the specific amino acids of wild-type sequence can be replaced by other amino acid.These replacements are guarded, and promptly an amino acid is had the amino-acid substitution of similar quality by another.The TSHR binding entity is an antibody or its part.A suitable antibody is an autoantibody or its part or the TSHR binding entity that is derived from this autoantibody.Suitable antibody comprises monoclonal antibody.A suitable antibody moiety is M22Fab.

Another aspect of the present invention provides a kind of cocrystallization that comprises the TSHR polypeptide of crystalline form, and described TSHR has the positioning data (co-oridinate) that X-ray crystallography is measured of passing through of Fig. 9 a or 9b.

To the analysis of cocrystallization of the present invention provide with TSHR260 compound M22 2.55

Atom positioning data and structure factor under the resolving power.The degree of confidence of this level can only obtain from the X-ray crystallography analysis that the structure of the mixture that formed by these two molecules (TSHR and M22) is carried out under high resolving power.This is useful because with prediction in conjunction with and the amino acid whose additive method of wanting of overstating is compared, have only crystal structure analysis that the mixture between two molecules is carried out to discern to interact (the interatomic distance that comprises the residue of participation).In addition, the complexity between acceptor and the part interacts and can only obtain from crystalline structure.

Wondrous with the information that crystalline structure provided of TSHR compound M22.Especially, can't obtain described information in the past, can only provide about participating between TSHR and the TSH and interactional amino acid whose basic clue between TSHR and the TSHR autoantibody such as the research of modeling and mutating experiment.All these early stage researchs all are presented at existing between the TSHR binding site of TSH and TSHR autoantibody very big overlapping.Clearly illustrate that also TSHR and FSHR are structurally closely related.

Yet coming to nothing shows interactional whole complexities between TSHR autoantibody (as M22) and the TSHR or the true detailed structure of TSHRLRD.

Another aspect of the present invention provides machine readable data storage medium, and described medium is by the data coding relevant with at least a portion positioning data of the TSHR polypeptide amino acid of Fig. 9 a or 9b or its homologue.Preferably, described data comprise the TSHR polypeptide amino acid positioning data of all Fig. 9 a or 9b.

Another aspect of the present invention provides a computer system that is used to show the tomograph of TSHR polypeptide or its homologue, and wherein said homologue has 0 apart from the trunk atom

To 4

Root-mean-square deviation, described computer system comprises the data storage medium of the TSHR polypeptide amino acid positioning data of data corresponding diagram 9a or the 9b of storing.Described computer system also can comprise the data storage medium of the corresponding positioning data with TSHR polypeptide or the interactional chemical entities of its homologue of the data of storing.

Preferably, described computer system is used to provide the tomograph with the interactional TSHR polypeptide of chemical entities or its homologue.Described chemical entities is an antibody or its part.Preferably, described antibody moiety is M22Fab.

Described computer system can comprise the indicating meter that is used to show TSHR polypeptide tomograph.Preferably, described computer system is used for showing and TSHR polypeptide or the interactional chemical entities of its homologue.

Another aspect of the present invention provides the electronic image of the three-dimensional structure of TSHR polypeptide.Preferably, described TSHR polypeptide comprises the rich leucine structural domain of human TSHR.More preferably, described image shows the amino acid 30-257 of human TSHR at least.Another aspect of the present invention provides the electronic image of the three-dimensional structure of TSHR polypeptide and an antibody or their part.

Another aspect of the present invention provides the method for the interactional chemical entities of at least one amino acid of a kind of identification and TSHR or its homologue, and the three-dimensional structure of described TSHR or its homologue is showed by image that computer system provided or electronic image according to one side before of the present invention.But described chemical entities TSHR agonist or antagonist.Can be identified with at least one the chemical entities among TSHR amino acid K129, E107, K58 and the Y185 by the formation interaction of hydrogen bond.Perhaps or in addition, forming the interactional chemical entities of Van der Waals force with at least one of TSHR amino-acid residue R255, R80, Kl29, R38 and Kl83 can be identified.Perhaps or in addition, the chemical entities that forms electrostatic interaction with at least one of TSHR amino-acid residue D151, K58, Kl29, R80, K209 and Kl83 can be identified.Perhaps or in addition, can be identified by forming the interactional chemical entities of ion pair with TSHR amino-acid residue K209.

The method that the present invention provides a kind of identification may disturb autoantibody and TSHR bonded chemical entities on the other hand, described method comprise identification and the interactional pharmaceutical chemicals of ridge at the altitudinal belt positive charge of the rich leucine structural domain of TSHR N-terminal concave surface.Described autoantibody may be that thyrotrophic hormone(TH) autoantibody or TSH antagonist promptly have the active TSH autoantibody of blocking-up.Suitable chemical entities can with at least one interaction in the following TSHR amino acid: R38, K58, R80, Hl05 and Kl29.

The method that the present invention provides a kind of identification may disturb autoantibody and TSHR bonded chemical entities on the other hand, described method comprise the method that is full of the chemical entities of cavity electronegative on the M22 surface that is made of M22 hypervariable region H1, H2 and H3 (Fig. 5) with the computer of one side before the present invention or electronic image identification at least substantially.Described autoantibody may be that thyrotrophic hormone(TH) autoantibody or TSH antagonist promptly have the active TSH autoantibody of blocking-up.

Common this method comprises that identification destroys TSHR residue R255 and thyrotrophic hormone(TH) autoantibody bonded chemical entities at least substantially.Perhaps or in addition, described method comprises that identification destroys human TSHR residue K209 and thyrotrophic hormone(TH) autoantibody bonded chemical entities.

In the inventive method, measured certain chemical entities and the possible interaction of other acceptor, described chemoreceptor is identified as and can combines with the TSHR polypeptide, perhaps can disturb and the combining of the TSHR polypeptide of TSHR joint.A kind of possible interactional form is combination.Other acceptors may comprise Follicle Stimulating Hormone Receptors or lutropin acceptor.

Another aspect of the present invention provides the method for the autoantibody of a kind of TSHR of detection, comprises relatively the autoantibody inferred and is identified as and the combining of the interactional chemical entities of TSHR polypeptide and TSHR polypeptide by the inventive method.

The present invention is favourable in many aspects, stops thyrotrophic hormone(TH) autoantibody and TSHR bonded new pharmaceutical compositions because it makes the technician can design specificity, thereby the new therapy to autoimmune disease such as GraveShi disease is provided.The present invention also makes the technician can design the new pharmaceutical compositions that differential stimulus contains the tissue of TSHR.

Another aspect of the present invention provides the chemical entities by the method identification of one side before the present invention.Another aspect of the present invention provides the compound that comprises at least one this chemical entities.Another aspect of the present invention provides the pharmaceutical composition that comprises this compound and a kind of pharmaceutical acceptable carrier.

This pharmaceutical composition is applicable to the treatment of autoimmune thyroid disease.Perhaps, this pharmaceutical composition is applicable to the treatment of GraveShi disease.A kind of pharmaceutical composition that is used to stimulate the tissue that contains TSHR also is provided.

Chemical entities provided by the invention may be applicable to the autoantibody that detects TSHR.

Another aspect of the present invention provides the chemical entities or the purposes of compound in the medicament of preparation treatment autoimmune thyroid disease of the aforementioned aspect of the present invention.

Another aspect of the present invention provides the chemical entities or the purposes of compound in the medicament of preparation treatment GraveShi disease of the aforementioned aspect of the present invention.

Pharmaceutical composition of the present invention comprises arbitrary compound of the present invention and its pharmacologically acceptable salts, and any pharmaceutically acceptable carrier, adjuvant or vehicle.The pharmaceutically acceptable carrier that can be used for pharmaceutical composition of the present invention, adjuvant and vehicle include but not limited to ion-exchanger, aluminum oxide, aluminum stearate, Yelkin TTS, serum protein (as human serum albumin), buffer substance (as phosphoric acid salt), glycine, Sorbic Acid, potassium sorbate, the partial glycerol ester mixture of saturated vegetable fatty acid, water, salt or ionogen (as protamine sulfate), Sodium phosphate dibasic, potassium hydrogen phosphate, sodium-chlor, zinc salt, silicon sol, Magnesium Trisilicate, polyvinylpyrrolidone, cellulosic material, polyoxyethylene glycol, Xylo-Mucine, polyacrylic ester, wax, the polyethylene polyoxypropylene block polymer, polyoxyethylene glycol and lanolin.

The administration of pharmaceutical composition of the present invention can be by oral, non-through intestines, spraying suction, part, eye drop or eye ointment, rectum, nasal cavity, oral cavity, vagina or implantation holder.Our preferred oral or drug administration by injection.Pharmaceutical composition of the present invention can contain any traditional nontoxic pharmaceutically acceptable carrier, adjuvant or vehicle.That term used herein " non-through intestines " comprises is subcutaneous, in the intracutaneous, intravenously, intramuscular, intraarticular, synovial membrane, in the breastbone, in the sheath, intralesional and intracranial injection or infusion techn.

Described pharmaceutical composition can be the form of sterile injectable preparation, as the water or the oil suspension of sterile injectable.This suspension can use suitable dispersion agent or wetting agent (as Tween 80) and suspending agent to make according to known technology.Sterile injectable solution or suspension that sterile injectable reagent is also made by outer acceptable diluent of nontoxic intestines or solvent, as be dissolved in the solution form of 1,3 butylene glycol.Spendable acceptable vehicle and solvent are N.F,USP MANNITOL, water, ringer's solution and isotonic sodium chlorrde solution.In addition, aseptic fixed oil is often used as solvent or suspending medium.For this purpose, the fixed oil of any gentleness be can use, synthetic direactive glyceride or double glyceride comprised.Lipid acid such as oleic acid and glycerol derivative thereof can be used for preparing the injectable agent, as the acceptable oils of natural pharmacy (as sweet oil or Viscotrol C) especially its polyoxy ethylization form.These oil solutions or suspension also can contain long-chain alcohol thinner or dispersion agent such as Ph.Helv or similarly pure.

Pharmaceutical composition of the present invention can any oral acceptable medicine type oral administration, includes but not limited to capsule, tablet and aqeous suspension and solution.For tablet for oral use, carrier commonly used comprises lactose and W-Gum.Usually also add lubricant such as Magnesium Stearate.For capsule form for oral use, useful thinner comprises lactose and the W-Gum of doing.When aqeous suspension is used for when oral, its activeconstituents combines with emulsifying agent and suspension agent.If desired, also can add some sweeting agent and/or seasonings and/or pigment.

Pharmaceutical composition of the present invention also can rectal administration suppository form administration.Can prepare these compositions by compound of the present invention is mixed with suitable non-irritating excipient, described vehicle at room temperature is solid-state but is liquid under rectal temperature, thereby thereby can dissolve in rectum and discharge active ingredient.This material includes but not limited to theobroma oil, beeswax and polyoxyethylene glycol.

When required treatment comprised easy zone that arrives of local dispenser or organ, the topical of pharmaceutical composition of the present invention was particularly useful.For the local skin administration, described pharmaceutical composition should be made and contain the suitable ointment that suspends or be dissolved in the active ingredient in the carrier.The carrier that is used for The compounds of this invention local application includes but not limited to mineral oil, liquefied petroleum, white oil, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water.Perhaps, described pharmaceutical composition can be made into and contains suitable lotion or the creme that suspends or be dissolved in the active compound in the carrier.Suitable carriers includes but not limited to mineral oil, Arlacel-60, polysorbate60, cetyl esters wax, palmityl alcohol, 2-Standamul G, phenylcarbinol and water.Pharmaceutical composition of the present invention also can suitable enema forms be used for lower digestive tract.The present invention also comprises local through the skin plaster.

Pharmaceutical composition of the present invention can nasal spray or the form administration of inhalation.The technology preparation that these compositions are known according to field of pharmaceutical preparations, and can use phenylcarbinol or other suitable preservatives, the absorption enhancer that strengthens bioavailability, fluorocarbon/or and other solubility promoters of understanding in the industry or dispersion agent be prepared as salt brine solution.

Pharmaceutical composition of the present invention can eye drop, the form administration of eye cream or eye ointment.For eye drop or eye cream, suitable vehicle includes but not limited to water, opens degree modifying agent (as sodium-chlor), sanitas (as benzalkonium chloride) and/or buffer reagent (as sodium dihydrogen phosphate-water and/or anhydrous dibasic sodium phosphate).For eye ointment, suitable vehicle includes but not limited to white vaseline and/or Yellow Vaselin, lanolin and/or whiteruss.

The invention enables the technician to design to measure and assessment at the novel method of the autoantibody of TSHR.The used existing TSHR preparation that passes through recombinant DNA technology production is very expensive in some existing mensuration and the method for assessment at the autoantibody of TSHR.In addition, the TSHR preparation that uses is water insoluble at present, needs the existence of washing composition, and therefore relative " coarse ", promptly they contain other proteic mixtures and represent the sex change acceptor and the mixture of unchangeability acceptor.Synthetic TSHR peptide composition (stride the film district for 7 that do not contain the TSHR complexity, promptly water soluble and be easy to handle) can be designed to have TRAb in conjunction with character according to the interaction of in mixture of the present invention, finding.Sensitive isotropic substance that this composition can be used for setting up or heterotope test are to measure TRAb.These novel methods can be based on M22 (or the mixture of another TSHR mono-clonal autoantibody or TSHR mono-clonal autoantibody or derive from their composition) bonded being suppressed or can be based on combining with the direct of described composition.Described composition can (with isotopic labeling or heterotope mark) mark or is conjugated to multiple reagent known in the art.Described composition can be coated on the solid support (pearl, plank, test tube) in precipitation is measured or be used for solution.

On the contrary, synthetic TSHR bonding composition can be designed for the test of inhibition type to replace M22 (or other TSHR monoclonal antibodies) or TSH.The production and the purifying that are used for the M22IgG of these tests or TSH at present are all relatively costly.The M22IgG fragment that is obtained by enzymic digestion is (as Fab or F (ab ') ₂) be not as stable as IgG, produce costliness, it is difficult for handling with isotropic substance or heterotope mark mark the time.The TSHR bonding composition that can replace M22IgG or TSH is with isotropic substance or heterotope mark mark or can be more stable when being conjugated to other reagent.

And TSHR tests with the TRAb that combining of synthetic TSHR splice combinations thing can cause setting up the sensitivity that is suitable for automatization, easy production, easily use, economy in conjunction with the synthetic composition of epi-position.In addition, the invention enables the technician can design and test the sudden change of specific amino acids among M22 and the TSHR, this can cause finding amino acid that receptor activation is played a crucial role.

And the present invention can help the technician to understand TSHR (participating in the Tiroidina regulation and control) and Follicle Stimulating Hormone Receptors (FSHR; The participation reproduction) similarities and differences between.TSHR and FSHR are the acceptors of height correlation, and they have analog structure, respectively in conjunction with having common hormone subunit (α subunit) and showing very the part TSH and the FSH of macrostructure similarity.Yet TSHR has different functionally activies with FSHR; TSHR participates in Tiroidina regulation and control (general metabolism is played an important role), and FSHR participates in reproduction.These acceptors to they the specificity of corresponding hormone very high, even there is the research report to use the hormone of very high volumetric molar concentration, also have only low-level cross reactivity.Now, the technician can automatically study these two kinds of acceptors first, relatively their structure and with they the binding mechanism of corresponding part.For example, as disclosed herein, to the comparison (Fan﹠amp of TSHR structure and FSHR structure; Hendrickson 2005infra) shows significant similarity (at C _αHave only 1.1 on the atom

Rmsd).And the binding mechanism of FSHR and FSH and TSHR and M22's is closely similar.Now, can study the binding mechanism (using obtainable structure and methods known in the art) of TSH and TSHR, and with its with and the binding mechanism of FSHR-FSH compare.Can discern by means known in the art and to cause its specific separately TSH or FSH amino acid, and the evolutionary process of analyzing described hormone.Interactional further understanding can help the technician to design to have to TSHR or FSHR high degree of specificity and the part of unwanted cross reaction not take place to these 2 kinds of closely-related acceptor-hormones.Such part can be used for the regulation and control of reproductive system and is used for the control of thyroid function.

The present invention also can help the technician to understand can promote concrete TSH autoantibody and the exploitation of general autoantibody and the amynologic mechanism of generation.

In addition, the present invention also provides synthetic water-soluble TSHR peptide composition.Described peptide composition can comprise the amino acid 22-260 of human TSHR.

The data that the crystalline structure of TSHR260-M22 provides can help to design binding molecule (as polypeptide), and its imitation TSHR goes up the binding site of M22 (and have similar surface and in conjunction with the TSHR autoantibody of character).This binding molecule can with suitable upholder coupling, be used to remove the thyrotrophic hormone(TH) autoantibody.Similarly method has been used to remove the autoantibody (GuoC-Y et al, Journal of Immunological Methods, 2005,303, pp 142-147) of acetylcholine receptor.Therefore, another aspect of the present invention provides a kind of particularly method of thyrotropin receptor autoantibody of these serum thyrotropin receptor antibody of removing from the sample that contains serum thyrotropin receptor antibody, the binding molecule that provides one to comprise or imitate the binding site of M22 on the thyrotropin receptor is provided described method, or provides and have with the similar surface of M22 and combine the thyrotropin receptor autoantibody of character; Thereby described sample is contacted with described binding molecule makes serum thyrotropin receptor antibody combine and remove from sample with described binding molecule again.Suitable sample may comprise the patients serum of containing high-caliber thyrotrophic hormone(TH) autoantibody.For promoting coupling, described binding molecule can not influence the fusion of TSHR autoantibody bonded mark with neutral protein or other.For example can use maltose binding protein, as Guo C-Y (2005) et al, supra is disclosed.Described binding molecule can or pass through a this mark coupling with solid support such as agarose or the direct coupling of resin.Can make the described patients serum of containing high-level thyrotrophic hormone(TH) autoantibody by immunosorbent (process that is similar to plasma exchange or plasmapheresis) then, make the serum of removing the TSHR autoantibody turn back to the patient again.This provides a good opportunity for the autoantibody of effectively and fast removing the clinical symptom that causes the Tiroidina overstimulation.This is even more important to thyroid storm.And, from circulation, remove the TSHR autoantibody and can stop them to combine with the TSHR of eye back tissue (or other Tiroidina outside site), control the seriously effective ways of case of Grave illness in eye (or circumscribed myxedema) thereby provide.From pregnant woman's circulation, remove the TSHR autoantibody and can stop described autoantibody to stride placenta to pass, and protection fetus Tiroidina avoids the biology effect of autoantibody.Therefore the present invention also provides a kind of and treats the method for this disease by removing autoantibody as mentioned above, and described method comprises from the patient who suffers from this disease or the step of removing the thyrotrophic hormone(TH) autoantibody the sample that from then on patient obtains.

Description of drawings

In the mode of illustration product of the present invention and method are described now by 1-10 with reference to the accompanying drawings, wherein:

Fig. 1 a is illustrated in the western blot analysis that under the situation that does not have or exist M22IgG the TSHR260 at High Five cell expressing is carried out.Fig. 1 b represents western blot analysis that SHR277, C-del TSHR and TSHR260 the culture supernatant that obtains from the High Five cell of expressing corresponding TSHR construct are carried out before and after partial purification.Fig. 1 c is illustrated in the western blot analysis that the C-del TSHR of High Five cell expressing carries out in partially purified different steps;

Fig. 2 a and b show the result of HPLC gel-filtration; Fig. 2 c is the photo of SDS-PAGE electrophoresis result after TSHR 260-M22Fab mixture produces;

Fig. 3 is the 2F of expression TSHR 260-M22Fab mixture bonding interface ₀-F ₀The perspective view figure of electron density map;

Fig. 4 shows secondary structure (the Mizuguchi K of the TSHR LRD that shows with the JOY form, Deane CM, Blundell TL, Johnson MS, Overington JP 1998JOY:proteinsequence-structure representation and analysis.Bioinformatics 14:617-623) (the TSHR LRD amino acid sequence is SEQ ID NO:14);

Fig. 5 is a series of expression M22Fab and the interactional figure of TSHR:

Fig. 5 a represents the molecular surface of TSHR-M22Fab mixture;

Fig. 5 b is the open visual angle figure of described surf zone, and the residue distance each other of its outstanding and mark is all 4

In;

Fig. 5 c shows the hypervariable region of and M22Fab that mark indicate outstanding with different shades;

Fig. 5 d represents the electrostatic potential surface of TSHR-M22Fab mixture;

Fig. 5 e is the residue tabulation of M22Fab hypervariable region;

Fig. 6 a is the image stack of FSHR-FSH composite structure and TSHR-M22Fab composite structure;

Fig. 6 b shows that Fig. 6 a turn 90 degrees the image that obtains along the Z-axis dextrorotation;

Fig. 6 c is that TSHR and FSHR are according to sequence alignment (the Mizuguchi K of JOY form based on structure, Deane CM, Blundell TL, Johnson MS, Overington JP 1998JOY:protein sequence-structure representation and analysis.Bioinformatics 14:617-623) (the FSHR amino acid sequence is SEQ IDNO:15); Protein sequence-structure representation and analysis.Bioinformatics 14:617-623) (the FSHR amino acid sequence is SEQ IDNO:15);

Fig. 6 d is the space multistory ball image of TSHR LRD and M22Fab and FSHR LRD and FSH surface in contact.Participating in interactional amino acid represents with Dark grey;

Fig. 7 is the synoptic diagram by the amino-acid residue of TSHR-M22Fab mixture interfacial interaction;

Fig. 8 is in the antibody of TSHR-M22Fab mixture-the be subjected to observed direct interaction of body interface (distance＜4

) perspective view figure;

Fig. 9 is the positioning data table that derives from following crystallography experiment, wherein:

Fig. 9 a=2.55

The resolving power tabulation;

Fig. 9 b=3.1

Resolving power tabulation (the human thyrotrophic hormone(TH) autoantibody of chain A=M22 light chain, the human thyrotrophic hormone(TH) autoantibody of chain B=M22 heavy chain, the human thryoid receptor (TSHR) of chain C=, fragment=rich leucine repeating structure territory (section 22-260).In the M22 positioning data, the light chain leucine of position 1 and the heavy chain Threonine of position 131 are shown as L-Ala.In the TSHR positioning data, the L-glutamic acid of position 34,35, the aspartic acid of position 36; The phenylalanine of position 37, the leucine of position 42, the arginine of post-11.2 is shown as L-Ala.These residues are modeled as L-Ala or glycine is because lack electron density);

Figure 10 a shown TSHR consensus amino acid sequences (SEQ ID NO:16) (number of obtaining P16473,

http://www.ncbi.nhn.nih.gov/entrez/viewer.fcgi？db＝protein&val＝62298994)；

Figure 10 b has shown the Misrahi at M, H Loosfelt, M Atger, S Sar, AGuiochon-Mantel, E Milgrom.Cloning, the sequence (SEQ ID NO:17) (number of obtaining M32215, the http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi that discern among the sequencing and expression ofhuman TSH receptor.Biochem Biophys Res Commun 1990166:394-403? db=nucleotide﹠amp; Val=307524);

Figure 10 c has shown the Frazier at AL, LS Robbins, PJ Stork, R Sprengel, the sequence (SEQ ID NO:18) (number of obtaining M73747, the http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi that discern among the DLSegalofi ζ RD Cone.Isolation of TSH and LH/CG receptor cDNAs fromhuman thyroid:regulation by tissue specific splicing.MoI Endocrinol19904:1264-1276? db=nucleotide﹠amp; Val=903759);

Figure 10 d has shown the Nagayama at Y, KD Kaufman, P Seto, B Rapoport.Molecular cloning, the sequence (SEQ ID NO:19) (number of obtaining M31774, the http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi that discern among sequence and functional expression of the cDNA forthe human thyrotropin receptor Biochem Biophys Res Commun 1989 165:1184-1190? db=nucleotide﹠amp; Val=340003);

Has Figure 10 e shown a control sequence (SEQ ID NO:20) (number of obtaining M73747, http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi? db=nucleotide﹠amp; Val=64085120);

And Figure 10 f has shown the sequence (SEQ ID NO:21) that provides in EP 0433509A.

Embodiment

In insect cell, produce TSHR260

Human TSHR is template (Oda Y with total length, Sanders J, Roberts S3 Maruyama M, Kato R, Perez M, Petersen VB, Wedlock N, Furmaniak J, Rees Smith B1998 Binding characteristics of antibodies to the TSH receptor.Journal ofMolecular Endocrinology 20:233-244), with 5 '-cactgcaggatccaaatgaggccggcggacttg-3 ' (SEQ ID NO:1) and 5 '-cagtcctctagattatcagtgatggtggtggtgatggttaagagtccaggtgtttc ttgctat-3 ' (SEQ ID NO:2) primer (Sigma Genosys) amplification TSHR260 construct (the human TSHR amino acid/11-260 shown in the code pattern 10a), add a BamHI restriction site at N-terminal, it is histidine-tagged to add one 1 amino acid joint (l-asparagine) and one 6 at C-terminal, terminator codon and an XbaI restriction site.25 95 ℃ 1 minute, 50 ℃ 1 minute and 72 ℃ of circulations of 1 minute are carried out in described PCR reaction, with BamHI and Xbal restriction site TSHR 260 is cloned into pFastbacl (Invitrogen then, UK) in, and confirm dna sequence dna (Sanger F with Sanger Coulson method, Nicklen S, Coulson AR 1977 DNA sequencing with chain terminating inhibitors.Proceedings of the National Academy of Sciences of the USA 74:5463-5467).(Invitrogen UK) makes the reorganization bacmid dna by Bac to Bac baculovirus table system.In brief, with 1ng (5 μ L) pFastBacl-TSHR 260 transfections to the D H10Bac cell that contains rod granule (baculovirus shuttle vectors) and helper plasmid of 100 μ L maximum efficiencies (Invitrogen, UK) in.Behind the ice bath 30 minutes, with described cell 42 ℃ of heat-shockeds 45 seconds, then cooled on ice 2 minutes, add again 900 μ L SOC substratum (Invitrogen, UK).Test tube was used 10 times of serial dilutions of SOC substratum in 4 hours then at 37 ℃ of wave and culture, be inoculated in and contain 50 μ g/mL kantlex, 7 μ g/mL gentamicins, 10 μ g/ml tsiklomitsins, 100 μ g/mLX-gal (Promega, UK) and LB agar plate (Tryptones lOg/L, the yeast extract 5g/L of 40 μ g/mL isopropyl-s (IPTG), NaCl 10g/L and 20g/L agar) on, cultivate 48 hours to carry out indigo plant/white selection at 37 ℃ again.White clone is cultivated, with plasmid midi test kit (Qiagen, UK) preparation recombinant plasmid dna and confirm the existence of TSHR260DNA in the reorganization rod granule with PCR.

Sf-9 insect cell (Invitrogen is arrived in the transfection of described reorganization bacmid dna, UK) in, (Invitrogen cultivates in UK), to obtain and amplification recombinant baculovirus original seed at the TC100 substratum that is added with 10% (v/v) foetal calf serum and 7 μ g/ml gentamicins.From the SF-9 culture, gathered in the crops viral original seed in centrifugal 5 minutes and supernatant liquor is stored in 2-8 ℃ by 500g.According to manufacturer all viral original seeds of titration are described with the quick titration test kit of BacPAK baculovirus (BD Clonetech).

In addition, two TSHR constructs that are used in the insect cell system expression have also been prepared as mentioned above.With human total length TSHR is template, use primer: 5 '-caggaaacagctatgac-3 ' (SEQ ID NO:3) and 5 '-gctactcgagctagtggtggtggtggtggtgaaggtcagcccgtgtgaggtgaagg aaactcaag-3 ' (SEQ ID NO:4) (Sigma Genosys) TSHR277 construct (the human TSHR amino acid/11-277 shown in the code pattern 10a) that increases, described construct has been added into one 6 histidine-tagged, terminator codon and an Xhol restriction site at C-terminal.25 95 ℃ 1 minute, 40 ℃ 1 minute and 72 ℃ of circulations of 1 minute are carried out in described PCR reaction, with BamHI and XhoI restriction site TSHR 277 is cloned into pFastbacl (Invitrogen then, UK) in, and confirm dna sequence dna (Sanger F with Sanger Coulson method, Nicklen S, Coulson AR 1977DNA sequencing with chainterminating inhibitors.Proceedings of the National Academy of Sciencesof the USA 74:5463-5467).Make the reorganization bacmid dna of TSHR260 and confirm the existence of reorganization rod granule with PCR.The bacmid dna transfection of will recombinating is to Sf-9 insect cell, the viral original seed and the titration that prepare the TSHR260 construct as mentioned above.

Also prepared C-del TSHR construct, the TSHR amino acid/11-410 (TSHR amino acid as Figure 10 a shown in) of described construct coding except that the sequence (by from deleting the sequence) of coding TS HR amino acid 313-353.In addition, to contain three sudden changes introducing in order to prevent proteolytic cleavage be R312E, E358T and E360T to described TSHR C-del construct.The preparation of described construct divides four stages independently.Be that template is introduced two sudden change E358T/E360T at first with total length TSHR.As described in WO2006/016121A, setting up two different PCR reactions (PCR1 and PCR2) before.PCR1 reaction is used T7 promoter primer 5 '-taatacgactcactataggg-3 ' (SEQ ID NO:5) and at " oppositely " primer 5 '-accaatgatctcatccgtttgtgtttcaaagaagacgta-3 ' (SEQ ID NO:6) of sudden change, and PCR2 reaction use at the forward primer 5 of " sudden change " '-tacgtcttctttgaaacacaaacggatgagatcattggt-3 ' (SEQ ID NO:7) and Trobest polyadenylation signal reverse primer (BGHR) 5 '-tagaaggcacagtcgagg-3 ' (SEQ IDNO:8).Carry out PCR1 and 2 reactions with GeneAmp PCR system 9700 (Applied Biosystems): 94 ℃ 5 minutes, carry out 30 94 ℃ 1 minute, 40 ℃ 1 minute and 72 ℃ of circulations of 2 minutes then.The reaction product of PCR1 and PCR2 is downcut from sepharose, and (LU2 OEB is UK) according to manufacturer's explanation purifying for Anachem Ltd, Luton to use Geneclean II test kit then.The PCR1 of purifying and PCR2 product are used to carry out PCR3 contains sudden change with structure complete TSHR sequence.Described PCR3 reaction comprises 200ng PCR1 product and 200ng PCR2 product.PCR3 carries out 7 94 ℃ 1.5 minutes, 65 ℃ 1.5 minutes and 72 ℃ of circulations of 1.5 minutes.And then temperature is elevated to 94 ℃ reaches 2 minutes, add T7 primer and BGHR primer then, carry out 30 94 ℃ 1 minute, 52 ℃ 1 minute and 72 ℃ of circulations of 2 minutes again.With BamHI and XhoI restriction site described PCR3 product (TSHR E358T/E360T) is cloned in the pcDNA 5.1/FRT carrier (Invitrogen), and confirm (the Sanger F that exists of sudden change with Sanger Coulson method, Nicklen S, Coulson AR 1977DNA sequencing with chainterminating inhibitors.Proceedings of the National Academy of Sciencesof the USA 74:5463-5467).

Then described TSHR E358T/E360T construct is used with top as template DNA and introduce the 3rd sudden change (R312E) at the same method of TSHR E358T/E360T.PCR1 reaction is used at " oppositely " primer 5 '-gcattcacagatttttcctggcgcaagctcttgca-3 ' (SEQ ID NO:9) of sudden change and the PCR2 reaction is used at " forward " primer 5 '-tgcagagcttgcgccaggaaaaatctgtgaatgc-3 ' (SEQ ID NO:10) that suddenlys change.The PCR1 and the PCR2 product of purifying are carried out the PCR3 reaction as mentioned above, with BamHI and XhoI restriction site described PCR3 product (TSHRE358T/E360T/R312E) is cloned in the pcDNA 5.1/FRT carrier (Invitrogen), and confirm (the Sanger F that exists of sudden change with Sanger Coulson method order-checking, Nicklen S, Coulson AR1977 DNA sequencing with chain terminating inhibitors.Proceedings ofthe National Academy of Sciences of the USA 74:5463-5467).

Then described TSHR E358T/E360T/R312E (comprising three sudden changes) is made amino acid 313-353 disappearance as template DNA with above-mentioned PCR method.Using of PCR1 reaction at " oppositely " primer 5 '-catccgtttgtgtttcaaagaagacttcctggcgcaagctctgcatactg-3 ' (SEQ ID NO:11) that lacks, and " forward " primer 5 '-cagtatgcagagcttgcgccaggaagtcttctttgaaacacaaacggatg-3 ' (SEQE ID NO:12) at disappearance is used in the PCR2 reaction.The PCR1 and the PCR2 product of purifying are carried out the PCR3 reaction as mentioned above, to encode the C-del TSHR product cloning of TSHR amino acid/11-764 of residue 313-353 disappearance in pcDNA 5.1/FRT carrier (Invitrogen) with BamHI and XhoI restriction site, and with Sanger Coulson method (Sanger F, Nic klen S, Coulson AR 1977DNA sequencing with chainterminating inhibitors.Proceedings of the National Academy of Sciencesof the USA 74:5463-5467) disappearance is confirmed in order-checking, increase with T7 promoter primer and 5 '-gctactcgagctagtggtggtggtggtggtggtcttcacacgggttgaactcatcg gacttg-3 ' (SEQ ID NO:13) as template then, consequently one 6 of the adding of the C-terminal behind TSHR amino acid 410 is histidine-tagged, terminator codon and XhoI restriction site.25 95 ℃ 1 minute, 50 ℃ 1 minute and 72 ℃ of circulations of 1 minute are carried out in described PCR reaction, with BamHI and XhoI restriction site described C-del TSHR is cloned into pFastbacl (Invitrogen then, UK) in, and with SangerCoulson method (Sanger F, Nickden S, Coulson AR 1977DNA sequencing withchain terminating inhibitors.Proceedings of the National Academy ofSciences of the USA 74:5463-5467) order-checking affirmation dna sequence dna.Make the reorganization bacmid dna of TSHR260 and confirm the existence of reorganization rod granule with PCR.The bacmid dna transfection of will recombinating is to the Sf-9 insect cell, as above at viral original seed of the described preparation of TSHR260 and titration.

The preparation of purifying M22IgG and Fab

Use MabSelect ^TMThe albumin A affinity chromatography (GE Healthcare UK) makes M22IgG from allos hybridoma culture supernatants, as Sanders J, and Jeffreys J, Depraetere H, Evans M, Richards T, Kiddie A, Brereton K, Premawardhana LDKE, Chirgadze D Y

Miguel R, Blundell TL, Furmaniak J, Rees Smith B2004 Characteristics of a human monoclonal autoantibody to thethyrotropin receptor:sequence structure and function.Thyroid 14:560-570 is described.(Sigma, UK) IgG of processing purifying passes through MabSelect then with the mercury papain with 1: 50 ratio of enzyme/albumen ^TMPost is removed any complete IgG or Fc from the Fab preparation, as Sanders J, and Jeffreys J, Depraetere H, Evans M, Richards T, Kiddie A, Brereton K, Premawardhana LDKE, Chirgadze DY, Miguel R3Blundell T L, Furmaniak J is described in the Rees Smith B 2004Characteristics of a humanmonoclonal autoantibody to the thyrotropin receptor:sequence structureand function.Thyroid 14:560-570.Under reductive condition, analyze M22Fab to measure purity with sds polyacrylamide gel electrophoresis (SDS-PAGE).Detect the biologic activity of M22Fab by the cyclic amp irritant test with Chinese hamster ovary (CHO) cell of expressing TSHR.In addition, also analyzed the M22Fab inhibition ¹²⁵I-TSH or ¹²⁵I-M22 and TSHR bag are by the ability of pipe jointing (Sanders J, Oda Y, Roberts S3Kiddie A3Richards T3Bolton J3 McGrath V3 Walters S3 Jaskolski D3 Furmaniak J3 ReesSmith B 1999 The interaction of TSH receptor autoantibodies with125I-labelled TSH receptor.Journal of Clinical Endocrinology andMetabolism 84:3797-3802).

The preparation of TSHR 260-M22 mixture

With High Five ^TM(BTI-TN-5B1-4, Invitrogen UK) place the EXCell substratum that is added with 0.1mmol/L KI and 7 μ g/mL gentamicins to insect cell, at 22 ℃, under the ventilation agitation condition of 60rpm, cultivate in the rotary flask (Techne) of 500mL.Cell inoculation density in each flask is 0.5x10 ⁶Cell/mL, and under 22 ℃, cultivated 24 hours, infecting with the baculovirus original seed then, infection multiplicity (MOI) is the 0.0006pfu/ cell.Continue to cultivate cell culture, and added the M22Fab of purifying in back 96 hours in infection, final concentration is 2 μ g/mL.The culture supernatants that contains the TSHR260-M22Fab mixture back 120 hours of infection by centrifugal 10 minutes results of 500g.Every 200mL supernatant liquor adds a slice Complete proteinase inhibitor (Roche), is stored in-70 ℃ then up to purifying.

Carry out a series of independently measurings and do not have M22IgG, having 8 μ g/mL M22IgG and exist under the situation of 12 μ g/mL M22IgG, i.e. the 3rd, 4,5 and 6 day stability after infection during TSHR260 produces in High Five insect cell culture.In High Five cell culture supernatant, added M22IgG the same day in infection.Each sample to culture supernatant carries out western blot analysis, thereby (Fig. 1 a) for the integrity of the TSHR260 that mensuration is expressed.With 1 μ g/mL concentration can and amino acid 246-260 between the mouse monoclonal antibody that reacts of TSHR epi-position (TSHR MAb 18C5) carry out Western blot (Jeffreys J, Depraetere H, Sanders J, Oda Y, Evans M, Kiddie A, Richards T, Furmaniak J, Rees Smith B 2002Characterization of the thyrotropin binding pocket.Thyroid 12:1051-1061).

Particularly, Fig. 1 a is illustrated under the situation that does not have or exist M22IgG after infection detected TSHR260 in the 3rd, 4,5 and 6 day (being respectively swimming lane 1-4) High Five cell culture supernatant.The cell culture supernatant sample that illustration 1=obtains from the High Five cell of expressing TSHR 260 under the situation that does not have M22IgG (swimming lane 1-4 represents respectively and infected the back the 3rd, 4,5 and 6 day, and swimming lane 5 is the HighFive culture supernatant that obtain from the cell of not expressing TSHR 260 as negative control).The cell culture supernatant sample that illustration 2=obtains from the High Five cell of expressing TSHR 260 under the situation that has 8 μ g/mL M22IgG (swimming lane 1-4 represents respectively and infected the back the 3rd, 4,5 and 6 day, and swimming lane 5 is the High Five culture supernatant that obtain from the cell of not expressing TSHR260 as negative control).The cell culture supernatant sample that illustration 3=obtains from the High Five cell of expressing TSHR 260 under the situation that has 12 μ g/mL M22IgG (swimming lane 1-4 represents respectively and infected the back the 3rd, 4,5 and 6 day, and swimming lane 5 is the High Five culture supernatant that obtain from the cell of not expressing TSHR 260 as negative control).

As shown in Figure 1a, cultivate under the condition that does not have M22IgG, the molecular weight of representing TSHR 260 is that the intensity of band of 34kDa was increased to maximum on the 5th day after infection.Yet, the 6th day (illustration 1 after infection; Swimming lane 4) most of TSHR 260 product degradation are that molecular weight is the albumen of 29kDa or the condensation zone that forms 41kDa.When being added with the M22IgG of 8 μ g/mL in the substratum, can be observed similar pattern, except that degraded or polymeric material, also there was how complete TSHR 260 (Fig. 1 a illustration 2) at the 6th day although compare with the experiment that does not have M22IgG.When the M22IgG concentration in the substratum is increased to 12 μ g/mL, the amount of detected complete TSHR 260 similar to the 5th day at the 6th day.

These results show that TSHR 260 is by protected in substratum with M22IgG formation mixture.The TSHR 277 of High Five insect cell expression and the stability of C-del TSHR product when further having studied M22Fab and have (added substratum on the 4th day after infection, final concentration is 2 μ g/ml) by other experiments.The 5th day High Five cell harvesting culture supernatant after infection from the virus infection that had corresponding TSHR construct, and with the chromatographic fraction purifying (as described below) on the Streamline HST matrix.Each culture supernatant sample is carried out western blot analysis, thereby measure the existence and the molecular weight (Fig. 1 b and c) of the TSHR product of expressing.With 1 μ g/mL concentration can and amino acid 246-260 between the mouse monoclonal antibody that reacts of TSHR epi-position (TSHR MAb 18C5) carry out Western blot (Jeffreys J, Depraetere H, Sanders J, Oda Y, Evans M, Kiddie A, Richards T, Furmaniak J, Rees Smith B 2002Characterization of the thyrotropin binding pocket.Thyroid 12:1051-1061).

Particularly, Fig. 1 b shows before the purifying and with TSHR 277, C-del TSHR and the TSHR 260 of the culture supernatant that is present in collection behind the Streamline post partial purification.Swimming lane 1=expresses the cell culture supernatant sample of the High Five cell of TSHR 277, the partially purified TSHR 277 of swimming lane 2=.Swimming lane 3=is present in the C-del TSHR of cell culture supernatant, the same material behind the swimming lane 4=partial purification.Swimming lane 5 and 6 is respectively the TSHR 260 before and after the partial purification.In swimming lane 2 and 4, can be observed some non-specific combination of TSHR MAb 18C5 and M22Fab (molecular weight is 46kDa).

Shown in Fig. 1 b, the High Five cell expressing molecular weight of cultivating under the condition that M22Fab exists is about the TSHR 277 of 34kDa, yet the decrease in molecular weight of TSHR 277 is to 30kDa (Fig. 1 b swimming lane 1 and 2) behind the partial purification.Under the condition that M22Fab exists, in the cell culture supernatant sample, detect the C-del TSHR of High Five cell expressing, show as the 46kDa protein band, it is degraded to the albumen (Fig. 1 b swimming lane 3 and 4) of 30kDa behind partial purification.TSHR 260 in this serial experiment is detected as the albumen (Fig. 1 b swimming lane 5 and 6) of 30-32kDa before and after purifying.

This tests demonstration, and TSHR277 and C-del TSHR product with expection molecular weight (being respectively 34kDa and 46kDa) are expressed in High Five cell, but these two kinds of albumen are all degraded behind partial purification to the proteic size of TSHR260 (approximately 30kDa).

Another example that C-del TSHR degrades when partial purification is shown in Fig. 1 c.When having the M22Fab of 2 μ g/mL, C-del TSHR expresses in High Five cell.

Particularly, Fig. 1 c shows in the High Five cell culture supernatant and the C-del TSHR of the different steps of purifying on StreamlineHST matrix.TSHR 260 in the swimming lane 1=High Five cell culture supernatant; C-delTSHR in the swimming lane 2=High Five cell culture supernatant; Swimming lane 3=expresses the High Five cell culture supernatant of C-del TSHR, and it is diluted and be adjusted to and can go up sample to Streamline HST post; Swimming lane 4=is by the material of Streamline HST post; Streamline HST post level part of containing partial purification C-del TSHR of swimming lane 5-8=wash-out.

Shown in Fig. 1 c, the High Five cell of cultivating under the condition that M22Fab exists is that the C-del TSHR of 46kDa expresses (swimming lane 2) in the culture supernatant with molecular weight.On to the StreamlineHST post, also detect complete C-del TSHR (swimming lane 3) in the sample material, in the post effluent liquid, do not detected C-del TSHR (swimming lane 4).Yet degrading to molecular weight from the C-del TSHR of wash-out on the post is about 30kDa (swimming lane 5-8), suitable with the molecular weight of the TSHR260 shown in the swimming lane 1.

This serial experiment explanation, when M22Fab existed, the TSHR polypeptide chain with different expection length was expressed in High Five cell by employed construct.Yet even early stage at purifying, TSHR 277 and C-del TSHR product also can be degraded to the size of TSHR 260 products.There is not evidence to show that TSHR 260 can degrade (also as follows) when purifying.Therefore, most probably the combination of M22Fab relates to most of TSHR 260 polypeptide chains and protects it to avoid proteolysis.The C-terminal that the TSHR aminoacid sequence begins from residue 260 unlikely participates in the stable bond of M22Fab, so the TSHR sequence between amino acid 260 and 277 or 260 and 410 is by protein degradation.

The TSHR260-M22Fab mixture has surprising stability.This follows former instability, the TSHR polypeptide formulations of sex change is opposite rapidly under the generation condition.Described TSHR260-M22Fab mixture is analyzed with HPLC gel-filtration and SDS-PAGE electrophoresis, shown in Fig. 2 a-c after process is with the two-wheeled affinity purification before and after the endoglycosidase F3 de-glycosylation.

Particularly, Fig. 2 a shows: the TSHR 260-M22Fab mixture of purifying before de-glycosylation---(TSK-GEK G3000SW carries out in 150mmol/LNaCl, 10mmol/L Tris pH 7.0 analysis by gel-filtration HPLC; A level part volume is 0.5mL).Peak 1=TSHR260-M22Fab mixture.Peak 2=has only M22Fab, with the analytical results overlaid that carries out separately.Fig. 2 b is presented at the TSHR 260-M22Fab mixture of purifying after the de-glycosylation, the separation on cationic exchange HPLC and concentrating; Promptly be used for the crystalline material---analyze by gel-filtration HPLC, shown in Fig. 2 a.Peak 1=TSHR 260-M22Fab mixture, the peak 2=M22Fab that dissociates.Shown among Fig. 2 c and under non-reduced condition, used the analysis of SDS-PAGE (12% acrylamide gel), and indicated the position of molecular weight marker the TSHR260-M22Fab of purifying.Marked the position of de-glycosylation front and back M22Fab and TSHR 260.TSHR260-M22Fab before the swimming lane 1=de-glycosylation; After the swimming lane 2=de-glycosylation and on cationic exchange HPLC post before the purifying; Swimming lane 3=de-glycosylation and behind purifying on the cationic exchange HPLC post; Swimming lane 4=de-glycosylation and after purifying on the cationic exchange HPLC post and final concentrating.Swimming lane 1,2 and 4 every swimming lanes are approximately gone up the TSHR260-M22Fab of sample 10 μ g, and swimming lane 3 is approximately gone up sample 5 μ g.

Shown in Fig. 2 a, the analytical results of TSHR260-M22Fab mixture is single substantially spike (peak 1), has only a small amount of (5%) free M22Fab to be present in the sample.In de-glycosylation with after separating on the cationic exchange HPLC post, as judging by gel-filtration HPLC, TSHR260-M22 mixture globality complete (Fig. 2 b peak 1) only detects (7%) free M22Fab (Fig. 2 b peak 2) on a small quantity being used for the whole preparation of crystalline.

SDS-PAGE analysis to the TSHR260-M22Fab of purifying under non-reduced condition is decomposed into ratio two components (TSHR260 and M22Fab about equally with this mixture; Fig. 2 c swimming lane 1).When calculating according to SDS-PAGE, the molecular weight of glycosylation M22Fab is approximately 56kDa and the molecular weight of TSHR260 is about 40kDa.Sample after all de-glycosylations is (after separating preceding, cationic exchange HPLC and after concentrating with endoglycosidase F3 by cationic exchange HPLC; Fig. 2 c is respectively swimming lane 2,3 and 4) all show similar protein band pattern.Topmost the band of the ratio minimum of about 56kDa is represented the not deglycosylated M22Fab of some remnants.The protein band of the about 54kDa of molecular weight is represented deglycosylated M22Fab, and the protein band of the about 37kDa of molecular weight is represented deglycosylated TSHR260.

The N-terminal amino acid analysis of the protein band of the about 40kDa of molecular weight (as Fig. 2 c, shown in the swimming lane 1) shows below sequence: Met-Gly-X-Ser-Ser-Pro.Wherein X may be Cys.Sequence between this corresponding human TSHR amino acid 22-27 is Met-Gly-Cys-Ser-Ser-Pro and consistent with the expressed sequence that originates in residue 22 (residue 1-21 is a signal peptide) (Misrahi M, Loosfelt H, Atger M, Sar S, Guiochon-Mantel A, Milgrom E 1990 Cloning, sequencing and expression of human TSH receptor.Biochemical andBiophysical Research Communications 166:394-403).Therefore, we have determined the character of TSHR260 in the mixture of purifying by the N-terminal amino acid sequencing.

The purifying of TSHR260-M22Fab mixture

Use 500mmol/L NaH ₂PO4 is adjusted to culture supernatant (14.4 and 17.4L two batches) pH 6.2 and goes up samples that (GE Healthcare is UK) on the 75mL treamline Direct HST matrix in to Streamline25 expanded bed chromatography system.Another batch culture supernatant (11.9L) is handled with the same manner in independent experiment.With 50mmol/L sodium phosphate (pH 6.0), 50mmol/L NaCl washing, use 100mmol/NaCl, 50mmol/L Tris-HCl (pH 6.5) washing again, and with 100mmol/L NaCl, 50mmol/L Tris-HCl (pH 8.0) wash-out.With 1 μ g/mL concentration can and amino acid 246-260 between the mouse monoclonal antibody that reacts of TSHR epi-position (TSHR MAb 18C5) carry out Western blot to confirm (the Jeffreys J that exists of TSHR260-M22 mixture in wash-out level part, Depraetere H, Sanders J, Oda Y, Evans M, Kiddie A, Richards T, Furmaniak J, Rees Smith B 2002Characterization of thethyrotropin binding pocket.Thyroid 12:1051-1061).

Again with being coupled to CNBr activated agarose gel-4B (Sigma, UK) antibody TSHRMAb 14C4 carries out purifying (Jeffreys J by affinity chromatography to the TSHR260-M22 mixture, Depraetere H, Sanders J, Oda Y, Evans M, Kiddie A, Richards T, Furmaniak J, Rees Smith B 2002Characterization of the thyrotropinbinding pocket.Thyroid 12:1051-1061), the conformational epitope between the amino acid 22-261 of described antibody and TSHR ectodomain combines.In brief, with sample on the described mixture in the 4mL affinity column, wash with 100mmol/L NaCl, 50mmol/L Tris-HCl (pH 8.0), with 100mmol/L NaCl, 100mmol/L Citrate trianion (pH 4.0) wash-out, collect (0.5mol/L Tris-HCl in isopyknic neutralization buffer, pH 8.0), carry out dialysis 50mmol/L NaCl, 10mmol/L Tris-HCl (pH 8.0) then.

With the Nickel affinity chromatography mixture through dialysis is further purified then.(Qiagen UK), uses the lavation buffer solution eluting cmp that is added with the 20mmol/L imidazoles again with lavation buffer solution (50mmol/LNaCl, 10mmol/L Tris-HCl pH 8.0) washing in the Ni-NTA agarose column with sample on the described mixture.Carry out dialysis described mixture among 50mmol/L NaCl, the 10mmol/LTris-HCl (pH 8.0) and be used to carry out de-glycosylation and react.The concentration of described mixture is calculated according to the optical density at 280nm, and its basis is the TSHR260-M22Fab that 1 absorbance units is equivalent to 0.69mg/mL.

The de-glycosylation and the final purification of TSHR 260-M22 mixture

With endoglycosidase F3 (Sigma, UK) the mixture de-glycosylation of 16mg (or the 7.5mg that another experiment, the obtains) purifying that in the 50mmol/L of pH 4.5 sodium-acetate buffer, will obtain from the 31.8L culture supernatant from the 11.9L culture supernatant, the ratio of enzyme and mixture is the 152mU/mg mixture, is reflected to carry out under 20 ℃ 5 days.Sample on the described de-glycosylation reactant is arrived cationic exchange HPLC Bioassist S post (TOPOH).In brief,, filter by 0.22 μ m strainer, then upper prop with the described reactant of 1: 1 dilution proportion with 200mmol/LTris-HCl (pH 6.8).Use 20mmol/L NaCl (pH 6.5) to wash described post then, use the described mixture of pH gradient liquid (pH 6.5-pH 9.0) wash-out again.Use Microcon YM-10 thickener (Millipore then, UK) mixture with 5mg (or another experiment in 2.4mg) purifying is concentrated to 32.8mg/mL (or 32mg/mL), measures the integrity of described mixture by the gel-filtration analysis and analyzes by SDS-PAGE with HPLC tsk gel G3000SW post (TOSOH) and measure purity.This material is used for the crystallization screening test or is stored in-20 ℃ with five equilibrium style form.

The protein sequencing of TSHR 260

The TSHR260-M22Fab mixture (30 μ g) of purifying is being run glue (under non-reduced condition) on the 12%SDS-PAGE, trace is to the Immobilon p in the 3-of 10mmol/L hexamethylene amino-1-propanesulfonic acid (CAPS) (pH 11) and 10% methyl alcohol then ^SQTransfer film (Millipore, Watford, UK) on.With described film coomassie brilliant blue staining, downcut band represent TSHR260 and analysis N-terminal aminoacid sequence (Alta Biosciences, Birmingham, UK).The amino acid mutation of M22 heavy chain (HC) or light chain (LC)

" C " end has 6 histidine-tagged M22HC and LC sequence and is cloned in the carrier derived from pUC 18, as Sanders J, Jeffreys J, Depraetere H, Evans M, Richards T, Kiddie A, Brereton K, Premawardhana LDKE, Chirgadze DY, Nunez Miguel R, Blundell TL, Furmaniak J, Rees Smith B 2004Characteristics of a human monoclonal autoantibody to the thyrotropinreceptor:sequence structure and function.Thyroid 14:560-570 is described.

Concrete " forward " and " oppositely " PCR primer have been designed at each sudden change, with the nucleotide coding sequence that changes HC or the LC correct amino acid mutation of encoding.Described primer is by SigmaGenosys (Cambridge, UK) preparation.Carry out two independently PCR reactions (PCR1 and PCR2).For the PCR1 of LC reaction, use the M13 reverse sequencing primer and at " oppositely " primer of sudden change; And for PCR2 reaction, use at " forward " primer of sudden change and-20M13 " forward " sequencing primer.For the PCR1 of HC reaction, use M13 " oppositely " sequencing primer and at " forward " primer that suddenlys change; And for PCR2 reaction, use at " forward " primer of sudden change and-20M13 " forward " sequencing primer.(AppliedBiosystems UK) carries out PCR1 and PCR2 reaction, and 94 ℃ were carried out 94 ℃ 1 minute, 42 ℃ 1 minute and 72 ℃ of 30 circulations of 2 minutes in 5 minutes then earlier to use GeneAmp PCR System 9700.Downcut PCR1 and PCR2 product and (Anachem Ltd UK) carries out purifying according to manufacturer's explanation with Geneclean II test kit from sepharose.PCR1 and PCR2 product with purifying is used to carry out PCR3 contains sudden change with structure complete HC or LC sequence then.Described PCR3 reactant comprises 200ng PCR1 product and 200ng PCR2 product.PCR3 carries out 7 94 ℃ 1.5 minutes, 65 ℃ 1.5 minutes and 72 ℃ of circulations of 1.5 minutes.Then temperature is elevated to 94 ℃ once again and reaches 2 minutes, adding-20M13 " forward " sequencing primer and M13 " oppositely " sequencing primer carry out 30 94 ℃ 1 minute, 42 ℃ 1 minute and 72 ℃ of circulations of 2 minutes again.

The M22HC of wild-type or sudden change is cloned in Xhol and the Spel restriction site, and the M22LC of wild-type or sudden change is cloned into Immunozap H/L carrier (Stratagene Europe; Amsterdam in SacI Netherlands) and the Xbal restriction site, and used the Sanger-Coulson method order-checking of this area to confirm the existence of sudden change.

The plasmid DNA that contains M22HC and LC sequence is transformed in the HB2151 cell (Amersham Bio sciences) and pre-the cultivation; A colony that will be transformed HB2151 spends the night at 30 ℃ of wave and culture in 10mL contains the LB ampicillin medium (Tryptones 10g/L, yeast extract 5g/l, NaCl 10g/l, penbritin 100 μ g/mL) of 1% glucose.With pre-culture dilution (5mL is diluted in the 500mLLB ampicillin medium) and 30 ℃ of cultivations, reach 1.2 then up to the 600nm absorption value.Adding 1.8mol/L sucrose to final concentration then is 0.3mol/L, and culture is got back to 1.2 30 ℃ of cultivations until the 600nm absorption value.After this add Virahol-β-D thiogalactoside (IPTG) to final concentration and be 1mmol/L and with culture 23 ℃ of continuous wave and culture 24 hours.With culture under 4 ℃ centrifugal 30 minutes, add 1mmol/L phenylmethylsulfonyl fluoride (PMSF) and every 100ml supernatant liquor adding 1 Complete proteinase inhibitor (Roche), and before purifying, supernatant liquor is placed-70 ℃ of storages then with 9000rpm.(Sigma UK) carries out the expression that western blot analysis is confirmed reorganization Fab with anti-human IgG (Fab is special) antibody.Western blot analysis can detect the wild-type reorganization M22 of 10ng.The purifying of reorganization wild-type and sudden change M22Fab

The supernatant liquor (each purifying with 4 liters) that will contain the M22Fab that recombinates with the SODIUM PHOSPHATE, MONOBASIC (pH 4.0) of 500mmol/L be adjusted to pH 6.0 and on samples to 75mLStreamline Direct HST post (GE Healthcare, UK).Wash described post and reach below 0.1 with 10mmol/L Tris-HCl (pH 6.8), 0.1mol/LNaCl, use 0.3mol/L NaCl and 10mmol/L Tris-HCl (pH 8.3) wash-out M22Fab again up to the 280nm absorption value.(Qiagen UK), with 0.3mol/L NaCl and 10mmol/L Tris-HCl (pH 8.3) washing that contains the 40mmol/L imidazoles, uses the imidazoles wash-out M22Fab of 120mmol/L again in the Ni-NTA agarose column with sample on the material of wash-out.

Record purity＞95% of the Fab of wash-out by SDS-PAGE, and calculate the concentration of Fab according to the absorption value of 280nm, its basis is the Fab that 1 absorbance units is equivalent to 0.7mg/mL.The amino acid mutation of human TSHR sequence

Be used for described in the method such as WO2006/016121A of the specific sudden change of TSHR sequence introducing.

In brief, according to the standard cloning process utilize BamHI and Xhol restriction site with TSHR full length nucleotide sequence clone in pcDNA5.1/FRT carrier (Invitrogen).Concrete " forward " and " oppositely " PCR primer have been designed at each sudden change, nucleotide coding sequence is changed the correct amino acid mutation of encoding.All primers are all by Sigma Genosys (Cambridge, UK) preparation.Carry out two independently PCR reactions (PCR1 and PCR2).PCR1 reaction is used T7 and at " oppositely " primer of sudden change, and the PCR2 reaction is used at " forward " primer and the Polisac polyadenylation signal reverse primer (BGHR primer) that suddenly change.Carry out PCR1 and 2 reactions with GeneAmp PCR system 9700 (Applied Biosystems): 94 ℃ 5 minutes, carry out 30 94 ℃ 1 minute, 40 ℃ 1 minute and 72 ℃ of circulations of 2 minutes then.The product of PCR1 and 2 is downcut from sepharose, and (LU2OEB is UK) according to manufacturer's explanation purifying for Anachem Ltd, Luton to use Geneclean II test kit then.The PCR1 of purifying and PCR2 product are used to carry out PCR3 contains sudden change with structure complete TSHR sequence.Described PCR3 reactant comprises 200ng PCR1 product and 200ng PCR2 product.PCR3 carries out 7 94 ℃ 1.5 minutes, 65 ℃ 1.5 minutes and 72 ℃ of circulations of 1.5 minutes.Temperature is elevated to 94 ℃ then and reaches 2 minutes, add T7 primer and BGHR primer, carry out 30 94 ℃ 1 minute, 52 ℃ 1 minute and 72 ℃ of circulations of 2 minutes again.With the BamHI/XhoI restriction site described PCR3 product cloning is arrived in the pcDNA 5.1/FRT carrier (Invitrogen), and confirm the existence of sudden change with the Sanger Coulson method of this area.

With the FIp-In system Chinese hamster ovary celI is arrived in the TSHR construct transfection of sudden change

Method therefor is as described in the WO2006/016121A.In brief, described FIp-In system (Invitrogen) is used for wild-type (Wt) and mutation T SHR cDNA transfection are arrived Chinese hamster ovary celI.Each FIp-In-CHO cell contains a FIp-In site, and therefore TSHR DNA can be inserted into genomic same position in each test, and only can there be a copy in every cell.The FIp-In-CHO cell that one flask is converged is used for inoculating 24 orifice plates, every hole inoculation 1x10 ⁵-1.5x10 ⁵Individual cell contains DMEM (Invitrogen) and 10% foetal calf serum (FCS) (Invitrogen) in the hole, do not contain microbiotic, with described cell at 37 ℃, 5%CO ₂Spend the night with cultivating under the condition of＞95% humidity.Use lipofectamine (Invitrogen) pcDNA5.1/FRT TSHRDNA and POG44DNA (Invitrogen) transfection to be advanced the FIp-In Chinese hamster ovary celI then according to manufacturer's explanation.Select cell with the substratum that contains 600 μ g/mL Totomycin (Invitrogen), TSHR can be inserted in the FIp-In-CHO cellular genome by those cells of POG44 plasmid DNA and pcDNA5.1/FRT TSHR transfection and show hygromycin resistance.

The analysis of the stimulation that cyclic amp is generated

WO2006/016121A describes in detail and is used for detecting the stimulation that generates by the Chinese hamster ovary celI cyclic amp of wild-type or mutation T SHR transfection, with the method for the function of confirming described construct.

In brief, Chinese hamster ovary celI is inoculated into (every hole 12500-20000 cell) in 96 orifice plates, and in the DMEM that contains 10% foetal calf serum, cultivated 48 hours.Then DMEM is removed, be added in the cyclic amp analysis buffer and (do not contain NaCl, but contain Hank ' the s buffered salts solution of 1g/L glucose, 20mmol/LHEPES, 222mmol/L sucrose, 15g/L bovine serum albumin (BSA) and 0.5mmol/l 3-isobutyl-1-methylxanthine, pH 7.4) middle pig TSH (the RSR Ltd that dilutes; 0.01-3ng/mL) and the M22Fab (0.1-10ng/mL) of wild-type or sudden change, in 37 ℃, air, 5%CO is arranged again ₂Atmosphere under cultivated 1 hour.After removing test soln, lysing cell is also with the cyclic amp concentration in the Biotrak enzyme immunity test systems measurement lysate of Amersham Biosciences.

Be dissolved in the wild-type of washing composition and the preparation of mutation T SHR preparation

Method therefor is as described in the WO2006/016121A.

The FIp-In-CHO cell of expressing wild-type or mutation T SHR is at 175cm ²Flask in be cultured to and converge, with (Invitrogen) washed cell of DulbeccoShi PBS (not calcic and magnesium ion), scrape 10mL ice-cold buffer A (50mmol/L NaCl, 10mmol/L Tris-HCl then, pH 7.5) in, damping fluid contains the 1mmol/L phenylmethylsulfonyl fluoride and every 200mL damping fluid contains 1 Complete proteinase inhibitor (Roche Diagnostics).Described cell with the centrifugal precipitation that obtains of 1000xg, is used glass homogenizer homogenate with pellet resuspended again in the 1mL buffer A and on ice under 4 ℃.Cytolemma obtained precipitation in centrifugal 30 minutes with 12000xg under 4 ℃, be resuspended in the buffer A that is added with 0.5g/L sodiumazide and 2.75g/L6mL iodo-acid amide again, and precipitate once more as mentioned above.Then the film throw out is resuspended in the ice-cold buffer A that contains 1%Triton X-100 and 0.5g/L sodiumazide of 1mL and homogenate.Described dissolved TSHR preparation under 4 ℃ with 9000xg centrifugal 2 hours is stored in supernatant liquor-70 ℃.Right ¹²⁵I-M22IgG or ¹²⁵I-TSH and TSHR bonded suppress

Carry out with the test tube that is coated with wild-type TSHR ¹²⁵The M22IgG of I mark or ¹²⁵The TSH of I mark is in conjunction with inhibition test, as Sanders J, Oda Y, Roberts S, Kiddie A, Richards T, Bolton J, McGrath V, Walters S, Jaskolski D, Furmaniak J, Rees Smith B 1999The interaction of TSH receptor autoantibodies with125I-labeled TSH receptor.Journal of Clinical Endocrinology andMetabolism 84:3797-3802 described (reagent is available from RSR Ltd).Each test all comprises a working curve (1-100ng/mL) with the M22Fab preparation, and described M22Fab uses from the IgG of M22 Hybridoma Cell Culture thing supernatant liquor purifying to prepare.

In this test, place the test tube of TSHR bag quilt at room temperature to shake cultivation 2 hours gently the wild-type of 100 μ L purifying or the Fab of sudden change (in test damping fluid (50mmol/L NaCl, 10mmol/L Tris-HCl pH 7.8,0.1%Triton X-100), being diluted to 0.001-100 μ g/mL).After extracting liquid out,, add 100 μ L then with 1mL test damping fluid washing test tube twice ¹²⁵I-M22IgG (50,000cpm) or ¹²⁵(80,000cpm) and at room temperature wave and culture is 1 hour for I-TSH.Then with 1mL test damping fluid washing test tube twice, sucking-off liquid is also counted with gamma counter.M22IgG or TSH bonded are suppressed to calculate according to following formula:

The collection of crystallization and diffraction data

Concentration is that the de-glycosylation TSHR-M22Fab mixture of 32.8mg/mL is used for vapor diffusion hanging drop crystallization experiment.At Wizard Crystal Screen I, (small-crystalline bunch appears in Inc.) to condition #46 in Emerald BioStructures in about two week backs.Then crystallization solution is optimized in 8%PEG8000,0.1mol/L MES pH 6.0,0.25mol/L zinc acetate, this can make crystallization bigger but still can cluster.Using macroscopic view/microcosmic seeded crystallization technique is unsuccessful with the trial that obtains single crystal.With size is 0.02x0.02x0.05mm ³Single crystal from bunch artificial the separation and cooling fast in the liquid nitrogen that contains 26% ethylene glycol (as cryoprotectant).

Carry out X ray diffracting data with " self-control " copper wheel anode radioactive source (producer RU-H3R, Rigaku-MSC Ltd. are equipped with the burnt multilayer film eyeglass of Max-Flux copolymerization, Osmic Inc.) at 100K and collect experiment.With Raxis IV++ image plate detector (Rigaku-MCS Ltd.) record diffraction data.Collect original diffraction data with single crystal once swinging step (collecting 129 degree altogether), handle suit index, these data (Otwinowski Z that integrates, measures and reduce with the HKL diffraction data then, Minor W 1997Processing of X-ray diffraction datacollected in oscillation mode.Methods in Enzymology:MacromolecularCrystallography, part A 276:307-326).Described crystal belongs to quadrature I2 ₁2 ₁2 ₁Spacer, it has TSHR-M22Fab mixture (54% solvent) and is diffracted into 3.1 at asymmetry unit

Bragg ' s spacing.(refinement) statistic data of refining is as shown in table 1.

Mixture by describing refabrication TSHR260 and M22Fab is concentrated into 32mg/mL and carries out crystallization trial, obtains crystal according to the crystallization condition identical with first campaign.(Daresbury UK) carries out X ray diffracting data and collects for workstation PXl 4.2, Council for the Central Laboratory of theResearch Councils with the synchrotron radioactive source.Be increased to 2.55 at 100K from single crystal collection data and diffraction resolution

Bragg ' s spacing.Then with 2.55 of new acquisition Resolution data will be with 3.1

The original texture that obtains of resolving power refine again, to the R factor (R-factor) be 18.1% (R _Free=24.5%).The statistic data of refining is as shown in table 1.

The result

Structure determination and refining

The success crystallization of the deglycosylated TSHR260-M22Fab mixture of part but only generate polycrystal bunch, this crystal bunch can not further be developed to obtain single crystal.The single crystal that is suitable for X-ray diffraction analysis can be by bunch acquisition of manual division crystal.

Described structure is replaced by molecule and is resolved.M22Fab (Sanders J, Jeffreys J, DepraetereH, Evans M, Richards T, Kiddie A, Brereton K, Premawardhana LDKE, Chirgadze DY, Nunez Miguel R, Blundell TL, Furmaniak J, Rees Smith B2004Characteristics of a human monoclonal autoantibody to thethyrotropin receptor:sequence structure and function.Thyroid 14:560-570) and FSHR (Fan QR, Hendrickson WA 2005Structure of humanfollicle-stimulating hormone in complex with its receptor.Nature 433:269-277) crystalline structure be used as molecule and replace search model; Calculating is finished on the AmoRe of CCP4 package (Bailey S 1994 The CCP4suite-programs for protein crystallography.Acta Crystallography Section D 50:760-763) (Navaza J 1994Amore-an automated package for molecular replacement.ActaCrystallography Section D 50:157-163).M22Fab search probe further is divided into two: one only contains the variable region, and another contains constant region.Successfully obtain the position of interior TSHR of asymmetry unit and M22Fab variable region, caused 48.2% the R factor.But, constant region is not obtained resolving, therefore use the electron density map that calculates after refining in the first round manually to settle these constant regions.Before refining, the model that obtains has 43.5% the R factor and 45.5% R _FreeCarry out 8 altogether and take turns that crystallography is refined and artificial the reconstruction.Atomic crystal is learned to refine and is used CNS (Brunger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse-Kunstleve RW, Jiang JS, Kuszewski J, Nigles M, Pannu NS, ReadRJ, Rice LM, Simonson T, Warren GL 1998Crystallography and NMRsystem:a new software suite for macromolecular structure determination.Acta Crystallography Section D 54:905-921), and at latter stage use REFMAC (Murshudov GN, Vagin AA, Dodson EJ 1997Refinement ofmacromolecular structures by the maximum-likelihood method.ActaCrystallography Section D 53:240-255) wrap and finish.Two-wheeled was refined before the simulated annealing method that uses among the CNS was used for, but was replaced by the Powell Method for minimization in the step in the back.Use the 2Fo-Fc of sigmaA weighting, Fo-Fc and annealing are omitted figure and are rebuild the enterprising pedestrian worker of Coot (Emsley P, Cowtan K2004Coot:model-building tools for assessing the accuracy of crystalstructures.Nature 355:472-475).Zn ²⁺Ion, N-acetylglucosamine residue and water molecules only are used for the later stage and refine/reconstruction procedures.The composite structure model is 3.1 On the resolving power by refined to the R factor be 20.7% (R _Free=28.3%).Use 2.55 then

The new data that obtain of resolving power are refined once more 3.1

Original texture to the R factor that resolving power obtains is 18.1% (R _Free=24.5%) (table 1).

Final structure is made up of M22LC (residue 1-208), HC (residue 1-127 and 134-213), TSHR (residue 30-257), 6 N-acetylglucosamine residues, 5 zine ions and 289 water moleculess.Continuous electron density is observed in a site (LC N26) at all N linked glycosylation sites (N77, N99, Nl13, Nl77 and Nl98) of TSRH and M22.Because unordered, the one-tenth ring residue of M22HC128-133 and some terminal residue (M22Fab LC 209-212, M22Fab HC 214-220, TSHR residue 22-29,258-260 and C-terminal 6-Histidine) do not have electron density.The side chain atom of TSHR E35 lacks electron density clearly, so this residue is modeled as L-Ala.

An example of electron density map is referring to Fig. 3.Particularly, Fig. 3 has shown the part interface between TSHR (roughly towards this figure top) and the M22Fab heavy chain (roughly towards this figure bottom).This figure delineates out profile on 1.2 σ levels, the residue of all demonstrations all is labeled.

The TSHR structure

TSHR is the slight bending tubulose, and relative convex-concave surface is arranged, with 10 chain beta sheets that are positioned at concave surface.The full hydrophobic residue of internal surface row of pipe.Homologue near TSHR is FSHR, itself and TSHR share 40.9% sequence identity (Misrahi M, Loosfelt H, Atger M, Sar S, Guiochon-Mantel A, Milgrom E 1990Cloning, sequencing and expressionof human TSH receptor.Bioc hemical and Biophysical ResearchCommunications 166:394-403 (Figure 10 b) and Fan QR, Hendrickson WA 2005Structure of human follicle-stimulating hormone in complex with itsreceptor. Nature 433:269-277); C between both structures _αRoot-mean-square deviation on the core atom (rmsd) is 1.1

There are 10 β chains in the concave surface that human TSHR is rich in leucic repeating structure in a parallel βZhe Die, and forms 9 repetitions.Every chain from the residue quantity that the N-end begins is: 4,5,5,5,5,7,5,6,3,3.That β chain before first repeats chain then forms the beta hairpin structure in addition.Convex surface in the LRD structure has 8 chainlets (every chain has two residues), forms two 3-chain βZhe Dies and 1 2-chain βZhe Die.In TSHR LRD structure, there is not spiral, as shown in Figure 4.Use David Keith Smith (1989, undisclosed data) discerns secondary structure based on the SSTRUC software of DSSP algorithm (Kabsch W, Sander C 1983Dictionary of proteinsecondary structure:pattern recognition of hydrogen-bonded andgeometrical features.Biopolymers 22:2677-2637) exploitation.Last whole five (N77, N99, N113, Nl77 and the Nl98) glycosylation sites of TSHR all are positioned at convex surface.

The TSHR-M22Fab mixture

The structure of TSHR-M22Fab mixture shows that M22Fab combines with the concave surface of TSHR 260, and the symmetry axis of this TSRH " pipe " almost with autoantibody weight chain between the interface parallel, as shown in Figure 5.(rmsd of all atoms is 0.4 to compare those residues that do not have in conjunction with M22

), the most of residue of bonding interface that is positioned at the antibody variable region of M22 almost is in same position when being attached to TSHR.C for HC P97 _αAtom is observed the maximum deviation of the atom of M22 trunk residue and is had only 1.1 In addition, compare, have only the side chain of 6 M22 residues to exist greater than 2 with unconjugated M22 Deviation (table 5).

The overall positions of M22Fab constant region and the difference of the overall positions that does not combine the M22Fab structure is around the have an appointment rotations of 20 degree of the axle between constant region and the variable region, and this rotation is because in the crystal due to the packing of molecules.There are enough electron densities that the carbohydrate residue of the glycosylation site (N26) on all 5 possible glycosylation sites and the M22Fab on the acceptor is carried out modeling.All are positioned at glycosylation site on the TSHR260 all away from bonding interface, do not influence the M22Fab combination.The comparative result of TSHR260-M22Fab mixture and FSH-FSH LRD mixture is seen Fig. 6.Fig. 6 has shown the animation figure of two kinds of structures, only uses the residue of FSHR and TSHR to carry out overlapping.

Especially allow the people surprised in conjunction with some aspect of arranging in the mixture, these aspects comprise:

(a) M22 fastens the concave surface of TSHR LRD in the mode that is very similar to FSH and fastens TSHR LRD.And 2 solid axles of 2 solid axles of M22 (2 fold axis) and FSH are overlapping fully in their mixtures separately.Significantly, autoantibody and hormone have the feature that combines much at one.Prior art does not have the prompting about this.

(b) in addition, with the concave surface area very big (2500 of the interactional TSHR LRD of M22

), and extend to C-terminal from N-terminal.

This is surprising and unexpected, and prior art is to this not prompting that interacts widely.

(c) except have with LRD bonded big area, observed dissimilar interactional intensity and quantity are surprising in the compound crystal structure.For example, it is the rarest the network of 22 hydrogen bonds and salt bridge being arranged between two interactional albumen.

(d) structure of M22 in the mixture and free M22 be comparison shows that the atom that participates in TSHR bonded M22 residue does not move basically.This also allows the people surprised, because some induced-fit can be predicted originally.When FSH combines with FSHR, also have significantly and move.

About the structure of TSHR LRD self, itself and FSHR LRD are shockingly similar, but some significant differences is also arranged, and comprise the quantity of β chain.

Autoantibody-acceptor interaction

Have 2500

The long-pending interface that is buried between autoantibody and the acceptor of solvent-accessible surface.Interaction between TSHR and the M22Fab is represented one, and hydrogen bond network, salt bridge (22 hydrogen bond with salt bridge), non-hydrogen bond polar interaction contact (table 2 with hydrophobicity widely; Fig. 7 and Fig. 8) mixing.In Fig. 8, interactional residue is represented with rod and is marked.Hydrogen bond dots.

Though two chains all form a large amount of hydrogen bonds and salt bridge (14 of heavy chains, 8 of light chains), and are more than light chain with the heavy chain residue of the interactional M22Fab of TSHR.The most of interactional residues of M22Fab are positioned at Kabat (Kabat E, Perry H, Wu T, Gottesman K, Foeller C1991 Sequences of proteins of immunological interest, 5th ed.US PublicService Health Service.Bethesda, MD) Ding Yi hypervariable region L2, H1, H2 and H3 is shown in Fig. 5 e.At Fig. 5 e, the residue that participates in receptors bind is all represented (Otwinowski Z with runic and underscore, Minor W 1997Processing of X-ray diffraction datacollected in oscillation mode.Methods in Enzymology:MacromolecularCrystallography, part A 276:307-326).Bury the surface at interface between TSHR LRD and M22LC, TSHR LRD's is 526.9

And M22LC's is 526.5

And for the interaction between TSHR LRD and the M22HC, the area of TSHR LRD is 730.1

And the area of M22HC is 730.4

7 hydrogen bonds are arranged between TSHR LRD and the M22LC, 7 hydrogen bonds are also arranged between TSHR LRD and the M22HC.Particularly, M22HC Y99 and two TSHR residue El07 (comprising the trunk nitrogen of M22Y99 and the side chain of TSHR E107) and K58 (side chain that comprises these two residues) are with hydrogen bonded.M22LC Q53 also produces two hydrogen bonds (with TSHR N208 and Q235).TSHR K129 produces 3 hydrogen bonds that comprise M22HC T30 and T53, and TSHR Q235 and 2 M22 residues (LC D52 and LC Q53) are with hydrogen bonded.

TSHR260-M22Fab interacts and also comprises the hydrogen bond (seeing Table 2) of 14 water mediations.Participating in interacting with strong Van der Waals force with M22 (is that interactive surfaces is long-pending above 60

) the TSHR residue be R255 (102.2

), R80 (91.9 ), R38 (76.6

), K129 (75.5

), K183 (64.4

) and R109 (60.6 ).Participating in interacting with strong Van der Waals force with TSHR260 (is that interactive surfaces is long-pending above 70

) the M22 residue be HC R28 (115.8

), HC Y56 (86.6 ), LC Y50 (86.4

), HC Y99 (79.4

), LC Q53 (76.7

) and HC P97 (70.8

).The electrostatic interaction that exists in the TSHR260-M22Fab mixture relates to following residue (being reduced to preface with intensity): TSHR D1 51 and M22HC R28 (minor increment 2.76 ), TSHR K58 and M22LC D95A (minor increment 2.60

), TSHR R80 and M22HC D54 (minor increment 2.75

), TSHR K183 and M22HC E96 (minor increment 3.04

), TSHR K209 and M22LC D52 (minor increment 3.57

), TSHR R80 and M22HC D52 (minor increment 3.20

), TSHR K129 and M22HC R28 (minor increment 4.05

), TSHR K209 and M22HC D51 (minor increment 4.50

), TSHR R255 and M22LC D60 (minor increment 4.39

), TSHRK129 and M22LC D52 (minor increment 5.27

) (table 3), these interact and to determine by the Henderson-Hasselbalch equation that is used to calculate the residue side-chain charges, and are used for assessing the self-compiling program of the distance between atomic charge and the charge atom in execution, include pH in consideration.

In the TSHR residue, TSHR R80 and M22 residue produce intensive accumulation electrostatic interaction, and M22HC R28 and TSHR residue produce intensive and accumulate electrostatic interaction.Hypervariable region H1, the H2 of M22Fab heavy chain and the residue of H3 have formed the outer rim of electronegative cavity, the regional interaction of described electronegative cavity and TSHR (R38, K58, R80, Hl05, K129) altitudinal belt positive charge.

Sudden change among the TSHR LRD is to the influence of M22 to the stimulation of the production of cyclic monophosphate in the Chinese hamster ovary celI of the expression TSHR relevant with the interaction seen in the TSHR260-M22Fab crystalline structure

The active action effect of ring AMP that M22 is stimulated by the amino acid mutation among the TSHR LRD of test determination is as described in the WO2006/016121A.Analyze these action effects according to the interaction of finding in the TSHR260-M22 crystalline structure then.

For example, sudden change R80A, E107A, R109A, K129A, K183A, Y185A, R255A have remarkably influenced (than wild-type TSHR active low 60%) (WO2006/016121A) to the M22 stimulating activity, and in the compound crystal structure transactional analysis between TSHR260 and the M22Fab show all these TSHR residues all with M22Fab interaction (table 2 and 3).And they participate in this structure 9 and the effect (table 2) of salt bridge in 22 hydrogen bonds, and TSHR R109 generates the hydrogen bond (table 2) and the strong Van der Waals force interaction of two water mediations.R80, E107, R109, K183, Y185 and R255 also participate in two non-hydrogen bond polar interaction and contact (table 2) with the hydrophobicity of M22.

As in TSHR LRD M22 pungency activity being had another sudden change of remarkably influenced as described in the WO2006/016121A is F130A, and crystalline structure demonstrates the F130 that contacts with HCG98 (table 2) hydrophobicity with M22HC P97.

In TSHR LRD, carried out several new sudden changes (in WO2006/016121A not describe) and it has been tested.Sudden change K209E has remarkably influenced (less than wild-type TSHR active 20%) to the M22 stimulating activity.TSHR K209 has participated in the non-hydrogen bond polar interaction with M22LC Y50, forming hydrophobicity with M22LC Q53 (table 2) contacts, and be formed with the attraction electrostatic interaction with M22LC D51 and LC D52 (table 4), this give mutation T SHR K209E why can cause the M22 loss of activity (less than wild-type activity TSHR 20%) explanation is provided.

The action effect that the M22 of ring AMP in the TSHR transfection CHO cell relevant with the interaction seen in the TSHR260-M22Fab crystalline structure is stimulated with sudden change among the M 22

Several monamino acid sudden changes are introduced in M22Fab heavy chain and the sequence of light chain, and have studied the action effect (table 4) of these sudden changes to the M22 stimulation of cyclic amp generation in the Chinese hamster ovary celI of expressing wild-type TSHR.

Several when sudden change performance to the effective amino acid of M22 stimulating activity (be lower than wild-type 80%) in, HC R28 and TSHR D151 form 3 salt bridges, formed polar interaction with TSHR F153 and I152, and formed hydrophobicity with TSHR I152 and F153 and contact (table 2).The intensive electrostatic interaction takes place in M22HC D52 and TSHR R80, and with TSHRH105 polar interaction (table 2 and 3) takes place.The intensive electrostatic interaction takes place in M22HC D54 and TSHR R80, and by water and TSHR T104 with hydrogen bonded (table 2 and 3), polar interaction takes place in M22HC Y56 and TSHR R38, and contacts (table 2) with TSHR R38, T56 and R80 generation intensive hydrophobicity.At last, M22LC D52 and TSHR Q235 form hydrogen bond, and with TSHR K209 intensive electrostatic interaction (table 2 and 3) take place.

Sudden change among TSHR and the M22 is combined the interactional analysis between TSHR and the M22Fab in the analysis that influences the result of M22 stimulating activity and its compound crystal structure, can discern among TSHR and the M22Fab to cause in the bioactive interaction it is very important residue.Particularly, TSHR R38 and M22HL T57 hydrogen bonded, and TSHR R80 and M22Fab (HC D52 and HC D54) form 3 salt bridges, and participation contacts (table 2) with the hydrophobicity of M22HC Y56.In addition, TSHR K129 and M22Fab (HC T30 and HC T53) have formed 3 hydrogen bonds.Therefore, the terminal positively charged residual base cluster of the N-of TSHR LRD concave surface with cause in the bioactive M22 interaction it is very important (Fig. 5 d).

Yet our test finds that also the residue of C-terminal part of concave surface among the TSHR LRD is also very important for the biological activity of M22, and participates in the interaction between the TSHR and M22 in the compound crystal structure.In these residues, TSHR R255 especially receives publicity, and this is because the sudden change of R255 has remarkably influenced to the M22 activity, but to the active not influence (WO2006/016121A) of TSH.Several interactions take place (with two hydrogen bonds of M22LC V58 formation in M22Fab in TSHR R255 and the crystalline structure, form electrostatic interaction with M22LC D60, form polar interaction with LC D60, and form hydrophobic interaction with LC L54) (referring to above reaching table 2 and 3).

In M22 heavy chain and light chain, have many residues all participate in mixture in the interaction (table 2) of TSHR LRD.This wherein has (M22HC R28, HC D52, HC D54, HC Y56 and LC D52) especially to receive publicity, because shown in our test, the sudden change of these residues has influence (see and go up and table 2 and 4) to the biological activity of M22.

Conclusion

In a word, the various sudden changes among TSHR or the M22 are to having good consistence between the observed mutual relationship in the crystalline structure of the effect Analysis of M22 stimulating activity and TSHR260-M22Fab.This shows the method that the design molecular structure is provided with M22Fab compound TSHR260 crystalline structure, and this molecular structure will interact with TSHR or interact in the interactional this mode of interference acceptor-autoantibody with molecule such as M22.This interference effect provides the method for a kind of GravesShi of prevention patient's TSHR autoantibody hormesis.

For example, the small molecules that the electronegative cavity in M22 surface (being formed with H3 by M22H1, H2) is filled in design should stop M22 (and the TSHR autoantibody with similar surface characteristic) to be attached on the acceptor, and the wherein said electronegative cavity and the N-of TSHR LRD concave surface hold the ridge of altitudinal belt positive charge to interact.On the contrary, design come with above-mentioned TSHR LRD on the interactional small molecules of positively charged ridge expected and can be stoped M22 (and TSHR autoantibody) and TSRH interaction with similar surface characteristic.In addition, can design small molecules stops important TSRH residue R255 and M22 and other TSRH autoantibodies to interact.

Specific amino acids sudden change among TSHR LRD and the M22 can be designed to study the TSHR activation mechanism, points out thus further to prevent that the TSHR autoantibody from activating the method for TSHR.And the understanding to the TSHR activation mechanism that obtains from these researchs can provide research and understand the method for gonadotropin receptor activation, because closely related on gonadotropin acceptor and the TSHR structure.

And, to the M22 that provides by the compound crystal structure and the interactional understood in detail between the TSHR, in conjunction with the further research of above mentioned receptors bind mechanism, can design recruit again as the TSHR agonist.When the tissue needs that contain TSHR were stimulated, this Tiroidina stimulation molecule can work in vivo.For example, be used to stimulate any residual thyroid carcinoma of after ablation, staying as current ¹³¹The recombinate surrogate of TSH of the people that I takes in.

The part that the details that the TSHR-M22 crystalline structure provides also allow to design new improvement be used for measuring with the assess patient serum sample in the TSHR autoantibody.

Interaction between TSHR and the M22 is extensive and complicated.And, with FSH (Fan QR, Hendrickson WA 2005Structure of human follicle-stimulating hormone incomplex with its receptor.Nature 433:269-277) crystalline structure of compound FSHR and comparison shows that of TSHR-M22 crystalline structure, M22 is with mode relative TSHR location self (table 6) about the same, the location of relative FSHR with FSH.Particularly, M22 and FSH are at the acceptor that fastens with respect to the about 90 ° of directions of receptor tube major axis separately.The interactional comparison model of TSH-TSHR shows, has extremely similarly structure (Nunez Miguel R by FSH and acceptor thereof mixture that forms and the mixture that is compounded to form by FSH and FSHR, Sanders J, Jeffreys J, Depraetere H, Evans M, Richards T, Blundell TL, Rees Smith B, Furmaniak J 2004 Analysis of the thyrotropin receptor-thyrotropininteraction by comparative modeling.Thyroid 14:991-1011and NunezMiguel R, Sanders J, Blundell TL, Rees Smith B3 Furmaniak J 2005Comparative Modeling of the Thyrotropin Receptor.Thyroid 15:746-747).

The evolution pressure of immunity system and TSHR is significant, and it causes the formation of autoantibody, described autoantibody by with the effect of acceptor interaction with simulation TSH, wherein with the interaction mode and the hormone analog of acceptor.Now, on molecular level, clearly determined the interactional details of M22-TSHR, can occur more autoimmune understandings why to these evolution pressures and TSHR and may become clear.

Table 1.2.55

Crystal data under the resolving power is collected and the statistics of refining

The correspondence statistics of value representation under the highest resolution scope in the parenthesis.

¹R _Sym=∑ | I _h-＜I〉|/∑ _hI _h, I here _hBe the intensity of reflection h,＜I〉be all average intensities of symmetry reflection relatively.

²R _Cryst=∑ ‖ F _Obs|-| F _Calc|/∑ | F _Obs|, F _ObsAnd F _CalcActual measurement and the structure factor amplitude that calculates.

³R _FreeFor R _CrystUse the random subclass of getting rid of outside refining of data (about 5%) (BrungerAT 1992Free R value:a novel statistical quantity for assessing theaccuracy of crystal structures.Nature 355:472-475).

⁴Estimate the positioning data error, based on the R of REFMAC calculating _FreeValue (Murshudov GN, VaginAA, Dodson EJ 1997Refinement of macromolecular structures by themaximum-likelihood method.Acta Crystallograpy SelectionD53:240-255).

⁵Calculate (Laskowski RA with PROCHECK, MacArthur MW, Moss DS, Thornton JM 1993PROCHECK:a program to check the stereochemicalquality of protein structures.J Appl Crystallogr 26:283-281).

Table 2. is the interaction between observed TSHR260 and the M22Fab in the crystalline structure of mixture

^*Represent salt bridge.

The hydrogen bond of water mediation

¹The hydrogen bond distance range is at 2.3-3.4

Between.

²Letter representation M22Fab chain residue in the bracket belongs to: A-light chain, B-heavy chain.

³The polarity contact distance is between 3.4 to 4.0

Between.

⁴The contact of carbon carbon is 4.0

In.

Table 3.

Ion pair in the TSHR260-M22Fab mixture interacts

The shown interaction strength that is used for comparison, unit is newton, use self-compiling program (ELECINT, R.Nunez Miguel, unpublished) calculate, wherein electrostatic field is calculated and get ε=1, the side chain atomic charge of using the Henderson-Hasselbalch formula to calculate charged residue is got pH=7.4.

The influence that the M22 that sudden change among the table 4.M22 generates cyclic amp in the Chinese hamster ovary celI of expressing wild-type TSHR stimulates

The M22Fab preparation of sudden change	The stimulation that M22Fab produces cAMP
		Wild-type	+++++
HC?R28D	+++
		HC?T30A	+++++
HC?D52A	++
		HC?D52K	-
HC?D54R	+
		HC?Y56A	++
HC?K64E	+++++
		HC?K73D	+++++
HC?R94E	+++
		HC?E96A	++++
HC?E96R	Do not detect expression
		LC?D51K	+++++
LC?D52A	+++
		LC?D52R	Do not detect expression
LC?D93R	+++++

++ ++ +=wild-type activity (100%),

++ ++=＜100-80% of wild-type activity,

The 80-60% of ++ +=＜wild-type activity,

The 60-40% of ++=＜wild-type activity,

The 40-20% of +=＜wild-type activity,

20% of-=＜wild-type activity.

Every kind of sudden change suppresses the M22 of mark and mark to M22Fab TSH and the effect of TSHR bonded ability are similar to hormesis to cyclic amp.

Table 5.

The deviation of atom site in unconjugated M22 and bonded M22 structure

Trunk

Unique variation that is considered is on the trunk:

Pro97HC, its C alpha atom takes place 1.1

Skew

Side chain

Skew is (greater than 2

)

Arg28HC, its NH2 atom takes place 4.8 Skew.

Trp33HC, its NE1 atom takes place 4.0

Skew.

Arg66LC, its NH1 atom takes place 3.2

Skew.

Lys64HC, its NZ atom takes place 3.0

Skew.

Asp95LC, its OD1 atom takes place 2.2

Skew.

Asp 52HC, its OD1 atom takes place 2.1

Skew.

Skew is (greater than 1.3

And less than 2 )

Ser56LC, its OG atom takes place 1.8

Skew.

Tyr99HC, its OH atom takes place 1.6

Skew.

Asp ó O LC, its OD2 atom takes place 1.4

Skew.

Pro97HC, its CB atom takes place 1.3

Skew.

Table 6.

The comparison of FSHR-FSH and TSHR-M22 mixture

A. respectively with FSH or M22Fab (HC=heavy chain; The LC=light chain) with interactional FSHR of Van der Waals force or TSHR residue.

B. respectively with FSH or M22Fab (HC=heavy chain; The LC=light chain) with the FSHR or the TSHR residue of interaction of hydrogen bond.

C. respectively with FSH or M22Fab (HC=heavy chain; The LC=light chain) with interactional FSHR of strong ion pair or TSHR residue.

Residue among Table A-C is numbered the residue of corresponding FSHR and TSHR sequence same position.

A. Van der Waals force interacts

^*Produce strong interactional residue (Δ ASA＞40

).

B. hydrogen bond

X ³This residue produces three hydrogen bonds with corresponding chain

C. ion pair interaction (interaction strength is greater than 4.0e-10N)

X ²Represent that two ion pairs interact X ³Represent three interactions.

Sequence table

＜110〉RSR Ltd.

＜120〉crystalline structure of THSR acceptor

<130>P108061PCT

<150>US?60/840,967

<151>2006-08-30

<150>US?60/901,685

<151>2007-02-16

<150>GB?0617239.3

<151>2006-08-31

<150>GB?0703070.3

<151>2007-02-16

<160>21

<170>PatentIn?version?3.3

<210>1

<211>33

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>1

cactgcagga?tccaaatgag?gccggcggac?ttg 33

<210>2

<211>63

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>2

cagtcctcta?gattatcagt?gatggtggtg?gtgatggtta?agagtccagg?tgtttcttgc 60

tat 63

<210>3

<211>17

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>3

caggaaacag?ctatgac 17

<210>4

<211>65

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>4

gctactcgag?ctagtggtgg?tggtggtggt?gaaggtcagc?ccgtgtgagg?tgaaggaaac 60

tcaag 65

<210>5

<211>20

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>5

taatacgact?cactataggg 20

<210>6

<211>39

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>6

accaatgatc?tcatccgttt?gtgtttcaaa?gaagacgta 39

<210>7

<211>39

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>7

tacgtcttct?ttgaaacaca?aacggatgag?atcattggt 39

<210>8

<211>18

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>8

tagaaggcac?agtcgagg 18

<210>9

<211>34

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>9

gcattcacag?atttttcctg?gcgcaagctc?tgca 34

<210>10

<211>34

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>10

tgcagagctt?gcgccaggaa?aaatctgtga?atgc 34

<210>11

<211>50

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>11

catccgtttg?tgtttcaaag?aagacttcct?ggcgcaagct?ctgcatactg 50

<210>12

<211>50

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>12

cagtatgcag?agcttgcgcc?aggaagtctt?ctttgaaaca?caaacggatg 50

<210>13

<211>62

<212>DNA

＜213〉artificial

<220>

＜223〉primer

<400>13

gctactcgag?ctagtggtgg?tggtggtggt?ggtcttcaca?cgggttgaac?tcatcggact 60

tg 62

<210>14

<211>228

<212>PRT

＜213〉people (Homo sapiens)

<400>14

Glu?Cys?His?Gln?Glu?Glu?Asp?Phe?Arg?Val?Thr?Cys?Lys?Asp?Ile?Gln

1 5 10 15

Arg?Ile?Pro?Ser?Leu?Pro?Pro?Ser?Thr?Gln?Thr?Leu?Lys?Leu?Ile?Glu

20 25 30

Thr?His?Leu?Arg?Thr?Ile?Pro?Ser?His?Ala?Phe?Ser?Asn?Leu?Pro?Asn

35 40 45

Ile?Ser?Arg?Ile?Tyr?Val?Ser?Ile?Asp?Val?Thr?Leu?Gln?Gln?Leu?Glu

50 55 60

Ser?His?Ser?Phe?Tyr?Asn?Leu?Ser?Lys?Val?Thr?His?Ile?Glu?Ile?Arg

65 70 75 80

Asn?Thr?Arg?Asn?Leu?Thr?Tyr?Ile?Asp?Pro?Asp?Ala?Leu?Lys?Glu?Leu

85 90 95

Pro?Leu?Leu?Lys?Phe?Leu?Gly?Ile?Phe?Asn?Thr?Gly?Leu?Lys?Met?Phe

100 105 110

Pro?Asp?Leu?Thr?Lys?Val?Tyr?Ser?Thr?Asp?Ile?Phe?Phe?Ile?Leu?Glu

115 120 125

Ile?Thr?Asp?Asn?Pro?Tyr?Met?Thr?Ser?Ile?Pro?Val?Asn?Ala?Phe?Gln

130 135 140

Gly?Leu?Cys?Asn?Glu?Thr?Leu?Thr?Leu?Lys?Leu?Tyr?Asn?Asn?Gly?Phe

145 150 155 160

Thr?Ser?Val?Gln?Gly?Tyr?Ala?Phe?Asn?Gly?Thr?Lys?Leu?Asp?Ala?Val

165 170 175

Tyr?Leu?Asn?Lys?Asn?Lys?Tyr?Leu?Thr?Val?Ile?Asp?Lys?Asp?Ala?Phe

180 185 190

Gly?Gly?Val?Tyr?Ser?Gly?Pro?Ser?Leu?Leu?Asp?Val?Ser?Gln?Thr?Ser

195 200 205

Val?Thr?Ala?Leu?Pro?Ser?Lys?Gly?Leu?Glu?His?Leu?Lys?Glu?Leu?Ile

210 215 220

Ala?Arg?Asn?Thr

225

<210>15

<211>242

<212>PRT

＜213〉people (Homo sapiens)

<400>15

Cys?His?His?Arg?Ile?Cys?His?Cys?Ser?Asn?Arg?Val?Phe?Leu?Cys?Gln

1 5 10 15

Glu?Ser?Lys?Val?Thr?Glu?Ile?Pro?Ser?Asp?Leu?Pro?Arg?Asn?Ala?Ile

20 25 30

Glu?Leu?Arg?Phe?Val?Leu?Thr?Lys?Leu?Arg?Val?Ile?Gln?Lys?Gly?Ala

35 40 45

Phe?Ser?Gly?Phe?Gly?Asp?Leu?Glu?Lys?Ile?Glu?Ile?Ser?Gln?Asn?Asp

50 55 60

Val?Leu?Glu?Val?Ile?Glu?Ala?Asp?Val?Phe?Ser?Asn?Leu?Pro?Lys?Leu

65 70 75 80

His?Glu?Ile?Arg?Ile?Glu?Lys?Ala?Asn?Asn?Leu?Leu?Tyr?Ile?Asn?Pro

85 90 95

Glu?Ala?Phe?Gln?Asn?Leu?Pro?Asn?Leu?Gln?Tyr?Leu?Leu?Ile?Ser?Asn

100 105 110

Thr?Gly?Ile?Lys?His?Leu?Pro?Asp?Val?His?Lys?Ile?His?Ser?Leu?Glu

115 120 125

Lys?Val?Leu?Leu?Asp?Ile?Gln?Asp?Asn?Ile?Asn?Ile?His?Thr?Ile?Glu

130 135 140

Arg?Asn?Ser?Phe?Val?Gly?Leu?Ser?Phe?Glu?Ser?Val?Ile?Leu?Trp?Leu

145 150 155 160

Asn?Lys?Asn?Gly?Ile?Gln?Glu?Ile?His?Asn?Cys?Ala?Phe?Asn?Gly?Thr

165 170 175

Gln?Leu?Asp?Glu?Leu?Asn?Leu?Ser?Asp?Asn?Asn?Asn?Leu?Glu?Glu?Leu

180 185 190

Pro?Asn?Asp?Val?Phe?His?Gly?Ala?Ser?Gly?Pro?Val?Ile?Leu?Asp?Ile

195 200 205

Ser?Arg?Thr?Arg?Ile?His?Ser?Leu?Pro?Ser?Tyr?Gly?Leu?Glu?Asn?Leu

210 215 220

Lys?Lys?Leu?Arg?Ala?Arg?Ser?Thr?Tyr?Asn?Leu?Lys?Lys?Leu?Pro?Thr

225 230 235 240

Leu?Glu

<210>16

<211>764

<212>PRT

＜213〉people (Homo sapiens)

<400>16

Met?Arg?Pro?Ala?Asp?Leu?Leu?Gln?Leu?Val?Leu?Leu?Leu?Asp?Leu?Pro

1 5 10 15

Arg?Asp?Leu?Gly?Gly?Met?Gly?Cys?Ser?Ser?Pro?Pro?Cys?Glu?Cys?His

20 25 30

Gln?Glu?Glu?Asp?Phe?Arg?Val?Thr?Cys?Lys?Asp?Ile?Gln?Arg?Ile?Pro

35 40 45

Ser?Leu?Pro?Pro?Ser?Thr?Gln?Thr?Leu?Lys?Leu?Ile?Glu?Thr?His?Leu

50 55 60

Arg?Thr?Ile?Pro?Ser?His?Ala?Phe?Ser?Asn?Leu?Pro?Asn?Ile?Ser?Arg

65 70 75 80

Ile?Tyr?Val?Ser?Ile?Asp?Val?Thr?Leu?Gln?Gln?Leu?Glu?Ser?His?Ser

85 90 95

Phe?Tyr?Asn?Leu?Ser?Lys?Val?Thr?His?Ile?Glu?Ile?Arg?Asn?Thr?Arg

100 105 110

Asn?Leu?Thr?Tyr?Ile?Asp?Pro?Asp?Ala?Leu?Lys?Glu?Leu?Pro?Leu?Leu

115 120 125

Lys?Phe?Leu?Gly?Ile?Phe?Asn?Thr?Gly?Leu?Lys?Met?Phe?Pro?Asp?Leu

130 135 140

Thr?Lys?Val?Tyr?Ser?Thr?Asp?Ile?Phe?Phe?Ile?Leu?Glu?Ile?Thr?Asp

145 150 155 160

Asn?Pro?Tyr?Met?Thr?Ser?Ile?Pro?Val?Asn?Ala?Phe?Gln?Gly?Leu?Cys

165 170 175

Asn?Glu?Thr?Leu?Thr?Leu?Lys?Leu?Tyr?Asn?Asn?Gly?Phe?Thr?Ser?Val

180 185 190

Gln?Gly?Tyr?Ala?Phe?Asn?Gly?Thr?Lys?Leu?Asp?Ala?Val?Tyr?Leu?Asn

195 200 205

Lys?Asn?Lys?Tyr?Leu?Thr?Val?Ile?Asp?Lys?Asp?Ala?Phe?Gly?Gly?Val

210 215 220

Tyr?Ser?Gly?Pro?Ser?Leu?Leu?Asp?Val?Ser?Gln?Thr?Ser?Val?Thr?Ala

225 230 235 240

Leu?Pro?Ser?Lys?Gly?Leu?Glu?His?Leu?Lys?Glu?Leu?Ile?Ala?Arg?Asn

245 250 255

Thr?Trp?Thr?Leu?Lys?Lys?Leu?Pro?Leu?Ser?Leu?Ser?Phe?Leu?His?Leu

260 265 270

Thr?Arg?Ala?Asp?Leu?Ser?Tyr?Pro?Ser?His?Cys?Cys?Ala?Phe?Lys?Asn

275 280 285

Gln?Lys?Lys?Ile?Arg?Gly?Ile?Leu?Glu?Ser?Leu?Met?Cys?Asn?Glu?Ser

290 295 300

Ser?Met?Gln?Ser?Leu?Arg?Gln?Arg?Lys?Ser?Val?Asn?Ala?Leu?Asn?Ser

305 310 315 320

Pro?Leu?His?Gln?Glu?Tyr?Glu?Glu?Asn?Leu?Gly?Asp?Ser?Ile?Val?Gly

325 330 335

Tyr?Lys?Glu?Lys?Ser?Lys?Phe?Gln?Asp?Thr?His?Asn?Asn?Ala?His?Tyr

340 345 350

Tyr?Val?Phe?Phe?Glu?Glu?Gln?Glu?Asp?Glu?Ile?Ile?Gly?Phe?Gly?Gln

355 360 365

Glu?Leu?Lys?Asn?Pro?Gln?Glu?Glu?Thr?Leu?Gln?Ala?Phe?Asp?Ser?His

370 375 380

Tyr?Asp?Tyr?Thr?Ile?Cys?Gly?Asp?Ser?Glu?Asp?Met?Val?Cys?Thr?Pro

385 390 395 400

Lys?Ser?Asp?Glu?Phe?Asn?Pro?Cys?Glu?Asp?Ile?Met?Gly?Tyr?Lys?Phe

405 410 415

Leu?Arg?Ile?Val?Val?Trp?Phe?Val?Ser?Leu?Leu?Ala?Leu?Leu?Gly?Asn

420 425 430

Val?Phe?Val?Leu?Leu?Ile?Leu?Leu?Thr?Ser?His?Tyr?Lys?Leu?Asn?Val

435 440 445

Pro?Arg?Phe?Leu?Met?Cys?Asn?Leu?Ala?Phe?Ala?Asp?Phe?Cys?Met?Gly

450 455 460

Met?Tyr?Leu?Leu?Leu?Ile?Ala?Ser?Val?Asp?Leu?Tyr?Thr?His?Ser?Glu

465 470 475 480

Tyr?Tyr?Asn?His?Ala?Ile?Asp?Trp?Gln?Thr?Gly?Pro?Gly?Cys?Asn?Thr

485 490 495

Ala?Gly?Phe?Phe?Thr?Val?Phe?Ala?Ser?Glu?Leu?Ser?Val?Tyr?Thr?Leu

500 505 510

Thr?Val?Ile?Thr?Leu?Glu?Arg?Trp?Tyr?Ala?Ile?Thr?Phe?Ala?Met?Arg

515 520 525

Leu?Asp?Arg?Lys?Ile?Arg?Leu?Arg?His?Ala?Cys?Ala?Ile?Met?Val?Gly

530 535 540

Gly?Trp?Val?Cys?Cys?Phe?Leu?Leu?Ala?Leu?Leu?Pro?Leu?Val?Gly?Ile

545 550 555 560

Ser?Ser?Tyr?Ala?Lys?Val?Ser?Ile?Cys?Leu?Pro?Met?Asp?Thr?Glu?Thr

565 570 575

Pro?Leu?Ala?Leu?Ala?Tyr?Ile?Val?Phe?Val?Leu?Thr?Leu?Asn?Ile?Val

580 585 590

Ala?Phe?Val?Ile?Val?Cys?Cys?Cys?Tyr?Val?Lys?Ile?Tyr?Ile?Thr?Val

595 600 605

Arg?Asn?Pro?Gln?Tyr?Asn?Pro?Gly?Asp?Lys?Asp?Thr?Lys?Ile?Ala?Lys

610 615 620

Arg?Met?Ala?Val?Leu?Ile?Phe?Thr?Asp?Phe?Ile?Cys?Met?Ala?Pro?Ile

625 630 635 640

Ser?Phe?Tyr?Ala?Leu?Ser?Ala?Ile?Leu?Asn?Lys?Pro?Leu?Ile?Thr?Val

645 650 655

Ser?Asn?Ser?Lys?Ile?Leu?Leu?Val?Leu?Phe?Tyr?Pro?Leu?Asn?Ser?Cys

660 665 670

Ala?Asn?Pro?Phe?Leu?Tyr?Ala?Ile?Phe?Thr?Lys?Ala?Phe?Gln?Arg?Asp

675 680 685

Val?Phe?Ile?Leu?Leu?Ser?Lys?Phe?Gly?Ile?Cys?Lys?Arg?Gln?Ala?Gln

690 695 700

Ala?Tyr?Arg?Gly?Gln?Arg?Val?Pro?Pro?Lys?Asn?Ser?Thr?Asp?Ile?Gln

705 710 715 720

Val?Gln?Lys?Val?Thr?His?Asp?Met?Arg?Gln?Gly?Leu?His?Asn?Met?Glu

725 730 735

Asp?Val?Tyr?Glu?Leu?Ile?Glu?Asn?Ser?His?Leu?Thr?Pro?Lys?Lys?Gln

740 745 750

Gly?Gln?Ile?Ser?Glu?Glu?Tyr?Met?Gln?Thr?Val?Leu

755 760

<210>17

<211>764

<212>PRT

＜213〉people (Homo sapiens)

<400>17

Met?Arg?Pro?Ala?Asp?Leu?Leu?Gln?Leu?Val?Leu?Leu?Leu?Asp?Leu?Pro

1 5 10 15

Arg?Asp?Leu?Gly?Gly?Met?Gly?Cys?Ser?Ser?Pro?Pro?Cys?Glu?Cys?His

20 25 30

Gln?Glu?Glu?Asp?Phe?Arg?Val?Thr?Cys?Lys?Asp?Ile?Gln?Arg?Ile?Pro

35 40 45

Ser?Leu?Pro?Pro?Ser?Thr?Gln?Thr?Leu?Lys?Leu?Ile?Glu?Thr?His?Leu

50 55 60

Arg?Thr?Ile?Pro?Ser?His?Ala?Phe?Ser?Asn?Leu?Pro?Asn?Ile?Ser?Arg

65 70 75 80

Ile?Tyr?Val?Ser?Ile?Asp?Val?Thr?Leu?Gln?Gln?Leu?Glu?Ser?His?Ser

85 90 95

Phe?Tyr?Asn?Leu?Ser?Lys?Val?Thr?His?Ile?Glu?Ile?Arg?Asn?Thr?Arg

100 105 110

Asn?Leu?Thr?Tyr?Ile?Asp?Pro?Asp?Ala?Leu?Lys?Glu?Leu?Pro?Leu?Leu

115 120 125

Lys?Phe?Leu?Gly?Ile?Phe?Asn?Thr?Gly?Leu?Lys?Met?Phe?Pro?Asp?Leu

130 135 140

Thr?Lys?Val?Tyr?Ser?Thr?Asp?Ile?Phe?Phe?Ile?Leu?Glu?Ile?Thr?Asp

145 150 155 160

Asn?Pro?Tyr?Met?Thr?Ser?Ile?Pro?Val?Asn?Ala?Phe?Gln?Gly?Leu?Cys

165 170 175

Asn?Glu?Thr?Leu?Thr?Leu?Lys?Leu?Tyr?Asn?Asn?Gly?Phe?Thr?Ser?Val

180 185 190

Gln?Gly?Tyr?Ala?Phe?Asn?Gly?Thr?Lys?Leu?Asp?Ala?Val?Tyr?Leu?Asn

195 200 205

Lys?Asn?Lys?Tyr?Leu?Thr?Val?Ile?Asp?Lys?Asp?Ala?Phe?Gly?Gly?Val

210 215 220

Tyr?Ser?Gly?Pro?Ser?Leu?Leu?Asp?Val?Ser?Gln?Thr?Ser?Val?Thr?Ala

225 230 235 240

Leu?Pro?Ser?Lys?Gly?Leu?Glu?His?Leu?Lys?Glu?Leu?Ile?Ala?Arg?Asn

245 250 255

Thr?Trp?Thr?Leu?Lys?Lys?Leu?Pro?Leu?Ser?Leu?Ser?Phe?Leu?His?Leu

260 265 270

Thr?Arg?Ala?Asp?Leu?Ser?Tyr?Pro?Ser?His?Cys?Cys?Ala?Phe?Lys?Asn

275 280 285

Gln?Lys?Lys?Ile?Arg?Gly?Ile?Leu?Glu?Ser?Leu?Met?Cys?Asn?Glu?Ser

290 295 300

Ser?Met?Gln?Ser?Leu?Arg?Gln?Arg?Lys?Ser?Val?Asn?Ala?Leu?Asn?Ser

305 310 315 320

Pro?Leu?His?Gln?Glu?Tyr?Glu?Glu?Asn?Leu?Gly?Asp?Ser?Ile?Val?Gly

325 330 335

Tyr?Lys?Glu?Lys?Ser?Lys?Phe?Gln?Asp?Thr?His?Asn?Asn?Ala?His?Tyr

340 345 350

Tyr?Val?Phe?Phe?Glu?Glu?Gln?Glu?Asp?Glu?Ile?Ile?Gly?Phe?Gly?Gln

355 360 365

Glu?Leu?Lys?Asn?Pro?Gln?Glu?Glu?Thr?Leu?Gln?Ala?Phe?Asp?Ser?His

370 375 380

Tyr?Asp?Tyr?Thr?Ile?Cys?Gly?Asp?Ser?Glu?Asp?Met?Val?Cys?Thr?Pro

385 390 395 400

Lys?Ser?Asp?Glu?Phe?Asn?Pro?Cys?Glu?Asp?Ile?Met?Gly?Tyr?Lys?Phe

405 410 415

Leu?Arg?Ile?Val?Val?Trp?Phe?Val?Ser?Leu?Leu?Ala?Leu?Leu?Gly?Asn

420 425 430

Val?Phe?Val?Leu?Leu?Ile?Leu?Leu?Thr?Ser?His?Tyr?Lys?Leu?Asn?Val

435 440 445

Pro?Arg?Phe?Leu?Met?Cys?Asn?Leu?Ala?Phe?Ala?Asp?Phe?Cys?Met?Gly

450 455 460

Met?Tyr?Leu?Leu?Leu?Ile?Ala?Ser?Val?Asp?Leu?Tyr?Thr?His?Ser?Glu

465 470 475 480

Tyr?Tyr?Asn?His?Ala?Ile?Asp?Trp?Gln?Thr?Gly?Pro?Gly?Cys?Asn?Thr

485 490 495

Ala?Gly?Phe?Phe?Thr?Val?Phe?Ala?Ser?Glu?Leu?Ser?Val?Tyr?Thr?Leu

500 505 510

Thr?Val?Ile?Thr?Leu?Glu?Arg?Trp?Tyr?Ala?Ile?Thr?Phe?Ala?Met?Arg

515 520 525

Leu?Asp?Arg?Lys?Ile?Arg?Leu?Arg?His?Ala?Cys?Ala?Ile?Met?Val?Gly

530 535 540

Gly?Trp?Val?Cys?Cys?Phe?Leu?Leu?Ala?Leu?Leu?Pro?Leu?Val?Gly?Ile

545 550 555 560

Ser?Ser?Tyr?Ala?Lys?Val?Ser?Ile?Cys?Leu?Pro?Met?Asp?Thr?Glu?Thr

565 570 575

Pro?Leu?Ala?Leu?Ala?Tyr?Ile?Val?Phe?Val?Leu?Thr?Leu?Asn?Ile?Val

580 585 590

Ala?Phe?Val?Ile?ValCys?Cys?Cys?Tyr?Val?Lys?Ile?Tyr?Ile?Thr?Val

595 600 605

Arg?Asn?Pro?Gln?Tyr?Asn?Pro?Gly?Asp?Lys?Asp?Thr?Lys?Ile?Ala?Lys

610 615 620

Arg?Met?Ala?Val?Leu?Ile?Phe?Thr?Asp?Phe?Ile?Cys?Met?Ala?Pro?Ile

625 630 635 640

Ser?Phe?Tyr?Ala?Leu?Ser?Ala?Ile?Leu?Asn?Lys?Pro?Leu?Ile?Thr?Val

645 650 655

Ser?Asn?Ser?Lys?Ile?Leu?Leu?Val?Leu?Phe?Tyr?Pro?Leu?Asn?Ser?Cys

660 665 670

Ala?Asn?Pro?Phe?Leu?Tyr?Ala?Ile?Phe?Thr?Lys?Ala?Phe?Gln?Arg?Asp

675 680 685

Val?Phe?Ile?Leu?Leu?Ser?Lys?Phe?Gly?Ile?Cys?Lys?Arg?Gln?Ala?Gln

690 695 700

Ala?Tyr?Arg?Gly?Gln?Arg?Val?Pro?Pro?Lys?Asn?Ser?Thr?Asp?Ile?Gln

705 710 715 720

Val?Gln?Lys?Val?Thr?His?Glu?Met?Arg?Gln?Gly?Leu?His?Asn?Met?Glu

725 730 735

Asp?Val?Tyr?Glu?Leu?Ile?Glu?Lys?Ser?His?Leu?Thr?Pro?Lys?Lys?Gln

740 745 750

Gly?Gln?Ile?Ser?Glu?Glu?Tyr?Met?Gln?Thr?Val?Leu

755 760

<210>18

<211>763

<212>PRT

＜213〉people (Homo sapiens)

<400>18

Met?Arg?Pro?Ala?Asp?Leu?Leu?Gln?Leu?Val?Leu?Leu?Leu?Asp?Leu?Pro

1 5 10 15

Arg?Asp?Leu?Gly?Gly?Met?Gly?Cys?Ser?Ser?Pro?Pro?Cys?Glu?Cys?His

20 25 30

Gln?Glu?Glu?Asp?Phe?Arg?Val?Thr?Cys?Lys?Asp?Ile?Gln?Arg?Ile?Pro

35 40 45

Ser?Leu?Pro?Pro?Ser?Thr?Gln?Thr?Leu?Lys?Leu?Ile?Glu?Thr?His?Leu

50 55 60

Arg?Thr?Ile?Pro?Ser?His?Ala?Phe?Ser?Asn?Leu?Pro?Asn?Ile?Ser?Arg

65 70 75 80

Ile?Tyr?Val?Ser?Ile?Asp?Val?Thr?Leu?Gln?Gln?Leu?Glu?Ser?His?Ser

85 90 95

Phe?Tyr?Asn?Leu?Ser?Lys?Val?Thr?His?Ile?Glu?Ile?Arg?Asn?Thr?Arg

100 105 110

Asn?Leu?Thr?Tyr?Ile?Asp?Pro?Asp?Ala?Leu?Lys?Glu?Leu?Pro?Leu?Leu

115 120 125

Lys?Ser?Leu?Ala?Phe?Ser?Asn?Thr?Gly?Leu?Lys?Met?Phe?Pro?Asp?Leu

130 135 140

Thr?Lys?Val?Tyr?Ser?Thr?Asp?Ile?Phe?Phe?Ile?Leu?Glu?Ile?Thr?Asp

145 150 155 160

Asn?Pro?Tyr?Met?Thr?Ser?Ile?Pro?Val?Asn?Ala?Phe?Gln?Gly?Leu?Cys

165 170 175

Asn?Glu?Thr?Leu?Thr?Leu?Lys?Leu?Tyr?Asn?Asn?Gly?Phe?Thr?Ser?Val

180 185 190

Gln?Gly?Tyr?Asp?Phe?Phe?Gly?Thr?Lys?Leu?Asp?Ala?Val?Tyr?Leu?Asn

195 200 205

Lys?Asn?Lys?Tyr?Leu?Thr?Val?Ile?Asp?Lys?Asp?Ala?Phe?Gly?Gly?Val

210 215 220

Tyr?Ser?Gly?Pro?Ser?Leu?Leu?Asp?Val?Ser?Gln?Thr?Ser?Val?Thr?Ala

225 230 235 240

Leu?Pro?Ser?Lys?Gly?Leu?Glu?His?Leu?Lys?Glu?Leu?Ile?Ala?Arg?Asn

245 250 255

Ser?Trp?Thr?Leu?Lys?Lys?Leu?Ala?Leu?Ser?Leu?Ser?Phe?Leu?His?Leu

260 265 270

Thr?Arg?Ala?Asp?Leu?Ser?Tyr?Pro?Ser?His?Cys?Cys?Ala?Phe?Lys?Asn

275 280 285

Gln?Lys?Lys?Ile?Arg?Gly?Ile?Leu?Glu?Ser?Leu?Met?Cys?Asn?Glu?Ser

290 295 300

Ser?Ile?Glu?Thr?Leu?Arg?Gln?Arg?Lys?Ser?Val?Asn?Ala?Leu?Asn?Ser

305 310 315 320

Pro?Leu?His?Gln?Glu?Tyr?Glu?Glu?Asn?Leu?Gly?Asp?Ser?Ile?Val?Gly

325 330 335

Tyr?Lys?Glu?Lys?Ser?Lys?Phe?Gln?Asp?Thr?His?Asn?Asn?Ala?His?Tyr

340 345 350

Tyr?Val?Phe?Phe?Glu?Glu?Gln?Glu?Asp?Glu?Ile?Ile?Gly?Phe?Gly?Gln

355 360 365

Glu?Leu?Lys?Asn?Pro?Gln?Glu?Glu?Thr?Leu?Gln?Ala?Phe?Asp?Ser?His

370 375 380

Tyr?Asp?Tyr?Thr?Ile?Cys?Gly?Asp?Ser?Glu?Asp?Met?Val?Cys?Thr?Pro

385 390 395 400

Lys?Ser?Asp?Glu?Phe?Asn?Pro?Cys?Glu?Asp?Ile?Met?Gly?Tyr?Lys?Phe

405 410 415

Leu?Arg?Ile?Val?Val?Trp?Phe?Val?Ser?Leu?Leu?Ala?Leu?Leu?Gly?Asn

420 425 430

Val?Phe?Val?Leu?Leu?Ile?Leu?Leu?Thr?Ser?His?Tyr?Lys?Leu?Asn?Val

435 440 445

Pro?Arg?Phe?Leu?Met?Cys?Asn?Leu?Ala?Phe?Ala?Asp?Phe?Cys?Met?Gly

450 455 460

Met?Tyr?Leu?Leu?Leu?Ile?Ala?Ser?Val?Asp?Leu?Tyr?Thr?His?Ser?Glu

465 470 475 480

Tyr?Tyr?Asn?His?Ala?Ile?Asp?Trp?Gln?Thr?Gly?Pro?Gly?Cys?Asn?Thr

485 490 495

Ala?Gly?Phe?Phe?Thr?Val?Phe?Ala?Ser?Glu?Leu?Ser?Val?Tyr?Thr?Leu

500 505 510

Thr?Val?Ile?Thr?Leu?Glu?Arg?Trp?Tyr?Ala?Ile?Thr?Phe?Ala?Met?Ala

515 520 525

Leu?Asp?Arg?Lys?Ile?Arg?Leu?Arg?His?Ala?Cys?Ala?Ile?Met?Val?Gly

530 535 540

Gly?Trp?Val?Cys?Cys?Phe?Leu?Leu?Ala?Leu?Leu?Pro?Leu?Val?Gly?Ile

545 550 555 560

Ser?Ser?Tyr?Ala?Lys?Val?Ser?Ile?Cys?Leu?Pro?Met?Asp?Thr?Glu?Thr

565 570 575

Pro?Leu?Ala?Leu?Ala?Tyr?Ile?Val?Phe?Val?Leu?Thr?Leu?Asn?Ile?Val

580 585 590

Ala?Phe?Val?Ile?Val?Cys?Cys?Cys?Tyr?Val?Lys?Ile?Tyr?Ile?Thr?Val

595 600 605

Arg?Asn?Pro?His?Asn?Pro?Gly?Asp?Lys?Asp?Thr?Lys?Ile?Ala?Lys?Arg

610 615 620

Met?Ala?Val?Leu?Ile?Phe?Thr?Asp?Phe?Thr?Cys?Met?Ala?Pro?Ile?Ser

625 630 635 640

Phe?Tyr?Ala?Val?Ser?Ala?Ile?Leu?Asn?Lys?Pro?Leu?Ile?Thr?Val?Ser

645 650 655

Asn?Ser?Lys?Ile?Leu?Leu?Val?Leu?Phe?Tyr?Pro?Ile?Asn?Ser?Cys?Ala

660 665 670

Asn?Pro?Phe?Leu?Tyr?Ala?Ile?Phe?Thr?Lys?Ala?Phe?Gln?Arg?Asp?Val

675 680 685

Phe?Ile?Leu?Leu?Ser?Lys?Phe?Gly?Ile?Cys?Lys?Arg?Gln?Ala?Gln?Ala

690 695 700

Tyr?Arg?Gly?Gln?Arg?Val?Pro?Pro?Lys?Asn?Ser?Thr?Asp?Ile?Gln?Val

705 710 715 720

Gln?Lys?Val?Thr?His?Asp?Met?Arg?Gln?Gly?Leu?His?Asn?Met?Glu?Asp

725 730 735

Val?Tyr?Glu?Leu?Ile?Glu?Ash?Ser?His?Leu?Thr?Pro?Lys?Lys?Gln?Gly

740 745 750

Gln?Ile?Ser?Glu?Glu?Tyr?Met?Gln?Thr?Val?Leu

755 760

<210>19

<211>764

<212>PRT

＜213〉people (Homo sapiens)

<400>19

Met?Arg?Pro?Ala?Asp?Leu?Leu?Gln?Leu?Val?Leu?Leu?Leu?Asp?Leu?Pro

1 5 10 15

Arg?Asp?Leu?Gly?Gly?Met?Gly?Cys?Ser?Ser?Pro?Pro?Cys?Glu?Cys?His

20 25 30

Gln?Glu?Glu?Asp?Phe?Arg?Val?Thr?Cys?Lys?Asp?Ile?Gln?Arg?Ile?Pro

35 40 45

Ser?Leu?Pro?Pro?Ser?Thr?Gln?Thr?Leu?Lys?Leu?Ile?Glu?Thr?His?Leu

50 55 60

Arg?Thr?Ile?Pro?Ser?His?Ala?Phe?Ser?Asn?Leu?Pro?Asn?Ile?Ser?Arg

65 70 75 80

Ile?Tyr?Val?Ser?Ile?Asp?Val?Thr?Leu?Gln?Gln?Leu?Glu?Ser?His?Ser

85 90 95

Phe?Tyr?Asn?Leu?Ser?Lys?Val?Thr?His?Ile?Glu?Ile?Arg?Asn?Thr?Arg

100 105 110

Asn?Leu?Thr?Tyr?Ile?Asp?Pro?Asp?Ala?Leu?Lys?Glu?Leu?Pro?Leu?Leu

115 120 125

Lys?Phe?Leu?Gly?Ile?Phe?Asn?Thr?Gly?Leu?Lys?Met?Phe?Pro?Asp?Leu

130 135 140

Thr?Lys?Val?Tyr?Ser?Thr?Asp?Ile?Phe?Phe?Ile?Leu?Glu?Ile?Thr?Asp

145 150 155 160

Asn?Pro?Tyr?Met?Thr?Ser?Ile?Pro?Val?Asn?Ala?Phe?Gln?Gly?Leu?Cys

165 170 175

Asn?Glu?Thr?Leu?Thr?Leu?Lys?Leu?Tyr?Asn?Asn?Gly?Phe?Thr?Ser?Val

180 185 190

Gln?Gly?Tyr?Ala?Phe?Asn?Gly?Thr?Lys?Leu?Asp?Ala?Val?Tyr?Leu?Asn

195 200 205

Lys?Asn?Lys?Tyr?Leu?Thr?Val?Ile?Asp?Lys?Asp?Ala?Phe?Gly?Gly?Val

210 215 220

Tyr?Ser?Gly?Pro?Ser?Leu?Leu?Asp?Val?Ser?Gln?Thr?Ser?Val?Thr?Ala

225 230 235 240

Leu?Pro?Ser?Lys?Gly?Leu?Glu?His?Leu?Lys?Glu?Leu?Ile?Ala?Arg?Asn

245 250 255

Thr?Trp?Thr?Leu?Lys?Lys?Leu?Pro?Leu?Ser?Leu?Ser?Phe?Leu?His?Leu

260 265 270

Thr?Arg?Ala?Asp?Leu?Ser?Tyr?Pro?Ser?His?Cys?Cys?Ala?Phe?Lys?Asn

275 280 285

Gln?Lys?Lys?Ile?Arg?Gly?Ile?Leu?Glu?Ser?Leu?Met?Cys?Asn?Glu?Ser

290 295 300

Ser?Met?Gln?Ser?Leu?Arg?Gln?Arg?Lys?Ser?Val?Asn?Ala?Leu?Asn?Ser

305 310 315 320

Pro?Leu?His?Gln?Glu?Tyr?Glu?Glu?Asn?Leu?Gly?Asp?Ser?Ile?Val?Gly

325 330 335

Tyr?Lys?Glu?Lys?Ser?Lys?Phe?Gln?Asp?Thr?His?Asn?Asn?Ala?His?Tyr

340 345 350

Tyr?Val?Phe?Phe?Glu?Glu?Gln?Glu?Asp?Glu?Ile?Ile?Gly?Phe?Gly?Gln

355 360 365

Glu?Leu?Lys?Asn?Pro?Gln?Glu?Glu?Thr?Leu?Gln?Ala?Phe?Asp?Ser?His

370 375 380

Tyr?Asp?Tyr?Thr?Ile?Cys?Gly?Asp?Ser?Glu?Asp?Met?Val?Cys?Thr?Pro

385 390 395 400

Lys?Ser?Asp?Glu?Phe?Asn?Pro?Cys?Glu?Asp?Ile?Met?Gly?Tyr?Lys?Phe

405 410 415

Leu?Arg?Ile?Val?Val?Trp?Phe?Val?Ser?Leu?Leu?Ala?Leu?Leu?Gly?Asn

420 425 430

Val?Phe?Val?Leu?Leu?Ile?Leu?Leu?Thr?Ser?His?Tyr?Lys?Leu?Asn?Val

435 440 445

Pro?Arg?Phe?Leu?Met?Cys?Asn?Leu?Ala?Phe?Ala?Asp?Phe?Cys?Met?Gly

450 455 460

Met?Tyr?Leu?Leu?Leu?Ile?Ala?Ser?Val?Asp?Leu?Tyr?Thr?His?Ser?Glu

465 470 475 480

Tyr?Tyr?Asn?His?Ala?Ile?Asp?Trp?Gln?Thr?Gly?Pro?Gly?Cys?Asn?Thr

485 490 495

Ala?Gly?Phe?Phe?Thr?Val?Phe?Ala?Ser?Glu?Leu?Ser?Val?Tyr?Thr?Leu

500 505 510

Thr?Val?Ile?Thr?Leu?Glu?Arg?Trp?Tyr?Ala?Ile?Thr?Phe?Ala?Met?Arg

515 520 525

Leu?Asp?Arg?Lys?Ile?Arg?Leu?Arg?His?Ala?Cys?Ala?Ile?Met?Val?Gly

530 535 540

Gly?Trp?Val?Cys?Cys?Phe?Leu?Leu?Ala?Leu?Leu?Pro?Leu?Val?Gly?Ile

545 550 555 560

Ser?Ser?Tyr?Ala?Lys?Val?Ser?Ile?Cys?Leu?Pro?Met?Asp?Thr?Glu?Thr

565 570 575

Pro?Leu?Ala?Leu?Ala?Tyr?Ile?Val?Phe?Val?Leu?Thr?Leu?Asn?Ile?Val

580 585 590

Ala?Phe?Val?Ile?Val?Cys?Cys?Cys?His?Val?Lys?Ile?Tyr?Ile?Thr?Val

595 600 605

Arg?Asn?Pro?Gln?Tyr?Asn?Pro?Gly?Asp?Lys?Asp?Thr?Lys?Ile?Ala?Lys

610 615 620

Arg?Met?Ala?Val?Leu?Ile?Phe?Thr?Asp?Phe?Ile?Cys?Met?Ala?Pro?Ile

625 630 635 640

Ser?Phe?Tyr?Ala?Leu?Ser?Ala?Ile?Leu?Asn?Lys?Pro?Leu?Ile?Thr?Val

645 650 655

Ser?Asn?Ser?Lys?Ile?Leu?Leu?Val?Leu?Phe?Tyr?Pro?Leu?Asn?Ser?Cys

660 665 670

Ala?Asn?Pro?Phe?Leu?Tyr?Ala?Ile?Phe?Thr?Lys?Ala?Phe?Gln?Arg?Asp

675 680 685

Val?Phe?Ile?Leu?Leu?Ser?Lys?Phe?Gly?Ile?Cys?Lys?Arg?Gln?Ala?Gln

690 695 700

Ala?Tyr?Arg?Gly?Gln?Arg?Val?Pro?Pro?Lys?Asn?Ser?Thr?Asp?Ile?Gln

705 710 715 720

Val?Gln?Lys?Val?Thr?His?Asp?Met?Arg?Gln?Gly?Leu?His?Asn?Met?Glu

725 730 735

Asp?Val?Tyr?Glu?Leu?Ile?Glu?Asn?Ser?His?Leu?Thr?Pro?Lys?Lys?Gln

740 745 750

Gly?Gln?Ile?Ser?Glu?Glu?Tyr?Met?Gln?Thr?Val?Leu

755 760

<210>20

<211>764

<212>PRT

＜213〉people (Homo sapiens)

<400>20

Met?Arg?Pro?Ala?Asp?Leu?Leu?Gln?Leu?Val?Leu?Leu?Leu?Asp?Leu?Pro

1 5 10 15

Arg?Asp?Leu?Gly?Gly?Met?Gly?Cys?Ser?Ser?Pro?Pro?Cys?Glu?Cys?His

20 25 30

Gln?Glu?Glu?Asp?Phe?Arg?Val?Thr?Cys?Lys?Asp?Ile?Gln?Arg?Ile?Pro

35 40 45

Ser?Leu?Pro?Pro?Ser?Thr?Gln?Thr?Leu?Lys?Leu?Ile?Glu?Thr?His?Leu

50 55 60

Arg?Thr?Ile?Pro?Ser?His?Ala?Phe?Ser?Asn?Leu?Pro?Asn?Ile?Ser?Arg

65 70 75 80

Ile?Tyr?Val?Ser?Ile?Asp?Val?Thr?Leu?Gln?Gln?Leu?Glu?Ser?His?Ser

85 90 95

Phe?Tyr?Asn?Leu?Ser?Lys?Val?Thr?His?Ile?Glu?Ile?Arg?Asn?Thr?Arg

100 105 110

Asn?Leu?Thr?Tyr?Ile?Asp?Pro?Asp?Ala?Leu?Lys?Glu?Leu?Pro?Leu?Leu

115 120 125

Lys?Phe?Leu?Gly?Ile?Phe?Asn?Thr?Gly?Leu?Lys?Met?Phe?Pro?Asp?Leu

130 135 140

Thr?Lys?Val?Tyr?Ser?Thr?Asp?Ile?Phe?Phe?Ile?Leu?Glu?Ile?Thr?Asp

145 150 155 160

Asn?Pro?Tyr?Met?Thr?Ser?Ile?Pro?Val?Asn?Ala?Phe?Gln?Gly?Leu?Cys

165 170 175

Asn?Glu?Thr?Leu?Thr?Leu?Lys?Leu?Tyr?Asn?Asn?Gly?Phe?Thr?Ser?Val

180 185 190

Gln?Gly?Tyr?Ala?Phe?Asn?Gly?Thr?Lys?Leu?Asp?Ala?Val?Tyr?Leu?Asn

195 200 205

Lys?Asn?Lys?Tyr?Leu?Thr?Val?Ile?Asp?Lys?Asp?Ala?Phe?Gly?Gly?Val

210 215 220

Tyr?Ser?Gly?Pro?Ser?Leu?Leu?Asp?Val?Ser?Gln?Thr?Ser?Val?Thr?Ala

225 230 235 240

Leu?Pro?Ser?Lys?Gly?Leu?Glu?His?Leu?Lys?Glu?Leu?Ile?Ala?Arg?Asn

245 250 255

Thr?Trp?Thr?Leu?Lys?Lys?Leu?Pro?Leu?Ser?Leu?Ser?Phe?Leu?His?Leu

260 265 270

Thr?Arg?Ala?Asp?Leu?Ser?Tyr?Pro?Ser?His?Cys?Cys?Ala?Phe?Lys?Asn

275 280 285

Gln?Lys?Lys?Ile?Arg?Gly?Ile?Leu?Glu?Ser?Leu?Met?Cys?Asn?Glu?Ser

290 295 300

Ser?Met?Gln?Ser?Leu?Arg?Gln?Arg?Lys?Ser?Val?Asn?Ala?Leu?Asn?Ser

305 310 315 320

Pro?Leu?His?Gln?Glu?Tyr?Glu?Glu?Asn?Leu?Gly?Asp?Ser?Ile?Val?Gly

325 330 335

Tyr?Lys?Glu?Lys?Ser?Lys?Phe?Gln?Asp?Thr?His?Asn?Asn?Ala?His?Tyr

340 345 350

Tyr?Val?Phe?Phe?Glu?Glu?Gln?Glu?Asp?Glu?Ile?Ile?Gly?Phe?Gly?Gln

355 360 365

Glu?Leu?Lys?Asn?Pro?Gln?Glu?Glu?Thr?Leu?Gln?Ala?Phe?Asp?Ser?His

370 375 380

Tyr?Asp?Tyr?Thr?Ile?Cys?Gly?Asp?Ser?Glu?Asp?Met?Val?Cys?Thr?Pro

385 390 395 400

Lys?Ser?Asp?Glu?Phe?Asn?Pro?Cys?Glu?Asp?Ile?Met?Gly?Tyr?Lys?Phe

405 410 415

Leu?Arg?Ile?Val?Val?Trp?Phe?Val?Ser?Leu?Leu?Ala?Leu?Leu?Gly?Asn

420 425 430

Val?Phe?Val?Leu?Leu?Ile?Leu?Leu?Thr?Ser?His?Tyr?Lys?Leu?Asn?Val

435 440 445

Pro?Arg?Phe?Leu?Met?Cys?Asn?Leu?Ala?Phe?Ala?Asp?Phe?Cys?Met?Gly

450 455 460

Met?Tyr?Leu?Leu?Leu?Ile?Ala?Ser?Val?Asp?Leu?Tyr?Thr?His?Ser?Glu

465 470 475 480

Tyr?Tyr?Asn?His?Ala?Ile?Asp?Trp?Gln?Thr?Gly?Pro?Gly?Cys?Asn?Thr

485 490 495

Ala?Gly?Phe?Phe?Thr?Val?Phe?Ala?Ser?Glu?Leu?Ser?Val?Tyr?Thr?Leu

500 505 510

Thr?Val?Ile?Thr?Leu?Glu?Arg?Trp?Tyr?Ala?Ile?Thr?Phe?Ala?Met?Arg

515 520 525

Leu?Asp?Arg?Lys?Ile?Arg?Leu?Arg?His?Ala?Cys?Ala?Ile?Met?Val?Gly

530 535 540

Gly?Trp?Val?Cys?Cys?Phe?Leu?Leu?Ala?Leu?Leu?Pro?Leu?Val?Gly?Ile

545 550 555 560

Ser?Ser?Tyr?Ala?Lys?Val?Ser?Ile?Cys?Leu?Pro?Met?Asp?Thr?Glu?Thr

565 570 575

Pro?Leu?Ala?Leu?Ala?Tyr?Ile?Val?Phe?Val?Leu?Thr?Leu?Asn?Ile?Val

580 585 590

Ala?Phe?Val?Ile?Val?Cys?Cys?Cys?Tyr?Val?Lys?Ile?Tyr?Ile?Thr?Val

595 600 605

Arg?Asn?Pro?Gln?Tyr?Asn?Pro?Gly?Asp?Lys?Asp?Thr?Lys?Ile?Ala?Lys

610 615 620

Arg?Met?Ala?Val?Leu?Ile?Phe?Thr?Asp?Phe?Ile?Cys?Met?Ala?Pro?Ile

625 630 635 640

Ser?Phe?Tyr?Ala?Leu?Ser?Ala?Ile?Leu?Asn?Lys?Pro?Leu?Ile?Thr?Val

645 650 655

Ser?Asn?Ser?Lys?Ile?Leu?Leu?Val?Leu?Phe?Tyr?Pro?Leu?Asn?Ser?Cys

660 665 670

Ala?Asn?Pro?Phe?Leu?Tyr?Ala?Ile?Phe?Thr?Lys?Ala?Phe?Gln?Arg?Asp

675 680 685

Val?Phe?Ile?Leu?Leu?Ser?Lys?Phe?Gly?Ile?Cys?Lys?Arg?Gln?Ala?Gln

690 695 700

Ala?Tyr?Arg?Gly?Gln?Arg?Val?Pro?Pro?Lys?Asn?Ser?Thr?Asp?Ile?Gln

705 710 715 720

Val?Gln?Lys?Val?Thr?His?Glu?Met?Arg?Gln?Gly?Leu?His?Asn?Met?Glu

725 730 735

Asp?Val?Tyr?Glu?Leu?Ile?Glu?Asn?Ser?His?Leu?Thr?Pro?Lys?Lys?Gln

740 745 750

Gly?Gln?Ile?Ser?Glu?Glu?Tyr?Met?Gln?Thr?Val?Leu

755 760

<210>21

<211>764

<212>PRT

＜213〉people (Homo sapiens)

<400>21

Met?Arg?Pro?Ala?Asp?Leu?Leu?Gln?Leu?Val?Leu?Leu?Leu?Asp?Leu?Pro

1 5 10 15

Arg?Asp?Leu?Gly?Gly?Met?Gly?Cys?Ser?Ser?Pro?Pro?Cys?Glu?Cys?His

20 25 30

Gln?Glu?Glu?Asp?Phe?Arg?Val?Thr?Cys?Lys?Asp?Ile?Gln?Arg?Ile?Pro

35 40 45

Ser?Leu?Pro?Pro?Ser?Thr?Gln?Thr?Leu?Lys?Leu?Ile?Glu?Thr?His?Leu

50 55 60

Arg?Thr?Ile?Pro?Ser?His?Ala?Phe?Ser?Asn?Leu?Pro?Asn?Ile?Ser?Arg

65 70 75 80

Ile?Tyr?Val?Ser?Ile?Asp?Leu?Thr?Leu?Gln?Gln?Leu?Glu?Ser?His?Ser

85 90 95

Phe?Tyr?Asn?Leu?Ser?Lys?Val?Thr?His?Ile?Glu?Ile?Arg?Asn?Thr?Arg

100 105 110

Asn?Leu?Thr?Tyr?Ile?Asp?Pro?Asp?Ala?Leu?Lys?Glu?Leu?Pro?Leu?Leu

115 120 125

Lys?Phe?Leu?Gly?Ile?Phe?Asn?Thr?Gly?Leu?Lys?Met?Phe?Pro?Asp?Leu

130 135 140

Thr?Lys?Val?Tyr?Ser?Thr?Asp?Ile?Phe?Phe?Ile?Leu?Glu?Ile?Thr?Asp

145 150 155 160

Asn?Pro?Tyr?Met?Thr?Ser?Ile?Pro?Val?Asn?Ala?Phe?Gln?Gly?Leu?Cys

165 170 175

Asn?Glu?Thr?Leu?Thr?Leu?Lys?Leu?Tyr?Asn?Asn?Gly?Phe?Thr?Ser?Val

180 185 190

Gln?Gly?Tyr?Ala?Phe?Asn?Gly?Thr?Lys?Leu?Asp?Ala?Val?Tyr?Leu?Asn

195 200 205

Lys?Asn?Lys?Tyr?Leu?Thr?Val?Ile?Asp?Lys?Asp?Ala?Phe?Gly?Gly?Val

210 215 220

Tyr?Ser?Gly?Pro?Ser?Leu?Leu?Asp?Val?Ser?Gln?Thr?Ser?Val?Thr?Ala

225 230 235 240

Leu?Pro?Ser?Lys?Gly?Leu?Glu?His?Leu?Lys?Glu?Leu?Ile?Ala?Arg?Asn

245 250 255

Thr?Trp?Thr?Leu?Lys?Lys?Leu?Pro?Leu?Ser?Leu?Ser?Phe?Leu?His?Leu

260 265 270

Thr?Arg?Ala?Asp?Leu?Ser?Tyr?Pro?Ser?His?Cys?Cys?Ala?Phe?Lys?Asn

275 280 285

Gln?Lys?Lys?Ile?Arg?Gly?Ile?Leu?Glu?Ser?Leu?Met?Cys?Asn?Glu?Ser

290 295 300

Ser?Met?Gln?Ser?Leu?Arg?Gln?Arg?Lys?Ser?Val?Asn?Ala?Leu?Asn?Ser

305 310 315 320

Pro?Leu?His?Gln?Glu?Tyr?Glu?Glu?Asn?Leu?Gly?Asp?Ser?Ile?Val?Gly

325 330 335

Tyr?Lys?Glu?Lys?Ser?Lys?Phe?Gln?Asp?Thr?His?Asn?Asn?Ala?His?Tyr

340 345 350

Tyr?Val?Phe?Phe?Glu?Glu?Gln?Glu?Asp?Glu?Ile?Ile?Gly?Phe?Gly?Gln

355 360 365

Glu?Leu?Lys?Asn?Pro?Gln?Glu?Glu?Thr?Leu?Gln?Ala?Phe?Asp?Ser?His

370 375 380

Tyr?Asp?Tyr?Thr?Ile?Cys?Gly?Asp?Ser?Glu?Asp?Met?Val?Cys?Thr?Pro

385 390 395 400

Lys?Ser?Asp?Glu?Phe?Asn?Pro?Cys?Glu?Asp?Ile?Met?Gly?Tyr?Lys?Phe

405 410 415

Leu?Arg?Ile?Val?Val?Trp?Phe?Val?Ser?Leu?Leu?Ala?Leu?Leu?Gly?Asn

420 425 430

Val?Phe?Val?Leu?Leu?Ile?Leu?Leu?Thr?Ser?His?Tyr?Lys?Leu?Asn?Val

435 440 445

Pro?Arg?Phe?Leu?Met?Cys?Asn?Leu?Ala?Phe?Ala?Asp?Phe?Cys?Met?Gly

450 455 460

Met?Tyr?Leu?Leu?Leu?Ile?Ala?Ser?Val?Asp?Leu?Tyr?Thr?His?Ser?Glu

465 470 475 480

Tyr?Tyr?Asn?His?Ala?Ile?Asp?Trp?Gln?Thr?Gly?Pro?Gly?Cys?Asn?Thr

485 490 495

Ala?Gly?Phe?Phe?Thr?Val?Phe?Ala?Ser?Glu?Leu?Ser?Val?Tyr?Thr?Leu

500 505 510

Thr?Val?Ile?Thr?Leu?Glu?Arg?Trp?Tyr?Ala?Ile?Thr?Phe?Ala?Met?Arg

515 520 525

Leu?Asp?Arg?Lys?Ile?Arg?Leu?Arg?His?Ala?Cys?Ala?Ile?Met?Val?Gly

530 535 540

Gly?Trp?Val?Cys?Cys?Phe?Leu?Leu?Ala?Leu?Leu?Pro?Leu?Val?Gly?Ile

545 550 555 560

Ser?Ser?Tyr?Ala?Lys?Val?Ser?Ile?Cys?Leu?Pro?Met?Asp?Thr?Glu?Thr

565 570 575

Pro?Leu?Ala?Leu?Ala?Tyr?Ile?Val?Phe?Val?Leu?Thr?Leu?Asn?Ile?Val

580 585 590

Ala?Phe?Val?Ile?Val?Cys?Cys?Cys?Tyr?Val?Lys?Ile?Tyr?Ile?Thr?Val

595 600 605

Arg?Asn?Pro?Gln?Tyr?Asn?Pro?Gly?Asp?Lys?Asp?Thr?Lys?Ile?Ala?Lys

610 615 620

Arg?Met?Ala?Val?Leu?Ile?Phe?Thr?Asp?Phe?Ile?Cys?Met?Ala?Pro?Ile

625 630 635 640

Ser?Phe?Tyr?Ala?Leu?Ser?Ala?Ile?Leu?Asn?Lys?Pro?Leu?Ile?Thr?Val

645 650 655

Ser?Asn?Ser?Lys?Ile?Leu?Leu?Val?Leu?Phe?Tyr?Pro?Leu?Asn?Ser?Cys

660 665 670

Ala?Asn?Pro?Phe?Leu?Tyr?Ala?Ile?Phe?Thr?Lys?Ala?Phe?Gln?Arg?Asp

675 680 685

Val?Phe?Ile?Leu?Leu?Ser?Lys?Phe?Gly?Ile?Cys?Lys?Arg?Gln?Ala?Gln

690 695 700

Ala?Tyr?Arg?Gly?Gln?Arg?Val?Pro?Pro?Lys?Asn?Ser?Thr?Asp?Ile?Gln

705 710 715 720

Val?Gln?Lys?Val?Thr?His?Asp?Met?Arg?Gln?Gly?Leu?His?Asn?Met?Glu

725 730 735

Asp?Val?Tyr?Glu?Leu?Ile?Glu?Asn?Ser?His?Leu?Thr?Pro?Lys?Lys?Gln

740 745 750

Gly?Gln?Ile?Ser?Glu?Glu?Tyr?Met?Gln?Thr?Val?Leu

755 760

Claims (66)

1. crystallizable composition that contains the TSHR polypeptide.

2. crystal that contains the TSHR polypeptide.

3. crystallizable mixture that contains TSHR polypeptide and TSHR binding entity.

4. cocrystallization that contains TSHR polypeptide and TSHR binding entity.

5. according to the crystallizable composition of claim 1, or according to the crystal of claim 2, or according to the crystallizable mixture of claim 3, or according to the cocrystallization of claim 4, wherein said TSHR polypeptide comprises the part of the rich leucine structural domain of Mammals TSHR at least.

6. according to the crystallizable composition of claim 1, or according to the crystal of claim 2, or according to the crystallizable mixture of claim 3, or according to the cocrystallization of claim 4, wherein said TSHR polypeptide has the mankind, orangutan, pig, ox, dog, cat or cavy sequence.

7. according to claim 1,5 or 6 crystallizable composition, or according to claim 2,5 or 6 crystal, or according to claim 3,5 or 6 mixture, or according to claim 4,5 or 6 cocrystallization, wherein said TSHR polypeptide comprises the amino acid 22-260 or the corresponding amino acid of other Mammals TSHR sequences of human wild type sequence.

8. according to claim 3,5,6 or 7 mixture, wherein said TSHR polypeptide contains TSHR wild type full-length sequence.

9. according to claim 1,5,6 or 7 crystallizable composition, or according to claim 2,5,6 or 7 crystal, or according to claim 3,5,6,7 or 8 mixture, or according to claim 4,5,6 or 7 cocrystallization, wherein at least one wild-type TSHR amino acid is suddenlyd change.

10. according to claim 3,5,6,7,8 or 9 mixture, or according to claim 4,5,6,7 or 9 cocrystallization, wherein said TSHR binding entity is an antibody or its part.

11. according to the mixture or the cocrystallization of claim 10, wherein said antibody is an autoantibody or its a part of or derivatives thereof.

12. according to the mixture or the cocrystallization of claim 10 or 11, wherein said antibody is a monoclonal antibody.

13. according to claim 9,10 or 11 mixture or cocrystallization, wherein said antibody is M22.

14. according to each cocrystallization of claim 4-13, it contains the TSHR polypeptide of crystalline form, described polypeptide has the positioning data shown in Fig. 9 a or 9b.

15. a machine readable data storage medium is coded by at least a portion positioning data of the TSHR polypeptide amino acid that relates to Fig. 9 a or 9b or its homologue.

16. a machine readable data storage medium is coded by all TSHR polypeptide amino acid positioning datas that relate to Fig. 9 a or 9b.

17. a computer system that is used to show the tomograph of TSHR polypeptide or its homologue, wherein said homologue has apart from the trunk atom

Arrive

Root-mean-square deviation, described computer system comprises the data storage instrument of the data of the TSHR polypeptide amino acid positioning data with corresponding diagram 9a or 9b.

18. according to the computer system of claim 17, described computer system comprises the data storage instrument of the positioning data with corresponding and TSHR polypeptide or the interactional chemical entities of its homologue.

19., be used to provide tomograph with the interactional TSHR polypeptide of described chemical entities or its homologue according to the computer system of claim 18.

20. according to the computer system of claim 18 or 19, wherein said chemical entities is an antibody or its part.

21. according to the computer system of claim 20, wherein said antibody moiety is M22Fab.

22., comprise the indicating meter that is used to show TSHR polypeptide tomograph according to each computer system of claim 17-21.

23., be used for showing and TSHR polypeptide or the interactional chemical entities of its homologue according to the computer system of claim 22.

24. the electronic image of a TSHR polypeptide three-dimensional structure.

25. according to the electronic image of claim 24, it shows the rich leucine structural domain of human TSHR polypeptide.

26. according to the electronic image of claim 25, it shows the amino acid 30-257 of human TSHR at least.

27. the electronic image of the three-dimensional structure of a TSHR polypeptide and an antibody or their part.

28. the method for the interactional chemical entities of at least one amino acid of an identification and TSHR or its homologue, the three-dimensional structure of described TSHR or its homologue is by according to each the image that computer system provided or shown by each electronic image of claim 24-27 of claim 19-23.

29. the method according to claim 28, wherein said chemical entities is the TSHR agonist.

30. the method according to claim 28, wherein said chemical entities is the TSHR antagonist.

31. one kind according to each method of claim 28-30, wherein discerned with described TSHR amino acid K129, E107, K58 and Y185 at least one by forming hydrogen bond interactional chemical entities.

32. one kind according to each method of claim 28-31, wherein discerned with described TSHR amino-acid residue R255, R80, K129, R38 and Kl83 at least one by Van der Waals force and interactional chemical entities.

33. one kind according to each method of claim 28-32, wherein discerned with described TSHR amino-acid residue D151, K58, K129, R80, K209 and K183 at least one by electrostatic interaction and interactional chemical entities.

34. one kind according to each method of claim 27-31, has wherein discerned with described TSHR amino-acid residue K209 to interact and interactional chemical entities by forming ion pair.

35. an identification may be disturbed the method for autoantibody and TSHR bonded chemical entities, described method comprises identification and the interactional chemical entities of ridge at the altitudinal belt positive charge of the rich leucine structural domain of described TSHR concave surface N-terminal.

36. the method according to claim 35, wherein said autoantibody is the thyrotrophic hormone(TH) autoantibody.

37. the method according to claim 35, wherein said autoantibody is the TSH antagonist.

38. one kind according to claim 35,36 or 37 method, at least one interaction in wherein said chemical entities and the following TSHR amino acid: R38, K58, R80, H105 and K129.

39. an identification may be disturbed the method for autoantibody and TSHR bonded chemical entities, described method comprise use according to claim 18-22 each computer or according to claim 24-27 each electronic image identification is full of the method for the chemical entities of cavity electronegative on the M22 surface that is made of M22H1, H2 and H3 at least substantially.

40. the method according to claim 39, wherein said autoantibody is the thyrotrophic hormone(TH) autoantibody.

41. the method according to claim 39, wherein said autoantibody is the TSH antagonist.

42. the method according to claim 39, described method comprise that identification destroys TSHR residue R255 and thyrotrophic hormone(TH) autoantibody bonded chemical entities at least substantially.

43. the method according to claim 40 or 42, described method comprise that identification destroys human TSHR residue K209 and thyrotrophic hormone(TH) autoantibody bonded chemical entities.

44. one kind according to each method of claim 28-43, wherein measures chemical entities and the possible interaction of other acceptors.

45. the method according to claim 44, wherein said possible interaction is combination.

46. the method according to claim 44 or 45, wherein said other acceptors comprise follitropin acceptor and/or lutropin acceptor.

47. a method that detects the TSHR autoantibody comprises relatively the autoantibody inferred and by being identified as according to each method of claim 28-46 and the combining of the interactional chemical entities of TSHR polypeptide and TSHR polypeptide.

48. one kind by according to each the chemical entities of method identification of claim 28-47.

49. compound that comprises at least one according to the chemical entities of claim 48.

50. a pharmaceutical composition contains the compound and the pharmaceutical acceptable carrier of with good grounds claim 48.

51. the pharmaceutical composition according to claim 50 is used for the treatment of autoimmune thyroid disease.

52., be used for the treatment of the GravesShi disease according to the pharmaceutical composition of claim 51.

53., be used to stimulate the tissue that contains described TSHR according to the pharmaceutical composition of claim 50.

54., be used to detect the autoantibody of described TSHR according to the chemical entities of claim 48.

55. according to the chemical entities of claim 48 or be used for the treatment of purposes on the medicament of autoimmune thyroid disease in preparation according to the compound of claim 49.

56. according to the chemical entities of claim 48 or be used for the treatment of purposes on the medicament of GravesShi disease in preparation according to the compound of claim 49.

57. method of from the sample that contains the thyrotropin receptor autoantibody, removing these thyrotropin receptor autoantibodies, the binding molecule that provides one to comprise or imitate the binding site of M22 on the thyrotropin receptor is provided described method, or provides and have with the similar surface of M22 and combine the thyrotropin receptor autoantibody of character; Thereby described sample is contacted with described binding molecule makes the thyrotropin receptor autoantibody combine and remove from sample with described binding molecule again.

58. the method according to claim 57, wherein said sample comprises patients serum or the blood plasma that contains the thyrotrophic hormone(TH) autoantibody.

59. the method according to claim 57 or 58, wherein said binding molecule and neutral protein or other do not influence TSHR autoantibody bonded mark and are connected.

60. the method according to claim 59, wherein said neutral protein is a maltose binding protein.

61. one kind according to claim 57,58,59 or 60 method, the direct coupling of wherein said binding molecule and solid support or by the mark coupling.

62. the method according to claim 61, wherein said solid support is agarose or resin.

63. one kind according to each method of claim 57-62, the wherein said sample of therefrom removing antibody is returned to the experimenter.

64. according to each method of claim 57-63, wherein said experimenter is human.

65. a treatment is tried the method for Mammals Tiroidina relative disease, described method comprises by each method of claim 57-64 removes thyrotropin receptor from the sample of taking from described experimenter.

66. the method according to claim 65, wherein said Tiroidina relative disease are GravesShi illness in eye or circumscribed myxedema or neonatal thyrotoxicosis.

Images