CN101591397A - Long-acting thymosin alpha 1 α's 1 is recombinant expressed and uses thereof - Google Patents

Abstract

The body's immunity that the present invention relates to field of immunology is regulated and the dna recombinant expression technical field in genetically engineered field, is specifically related to the recombinant expressed and uses thereof of long-acting thymosin alpha 1 α 1.This long-acting T α 1 is that the gene by T α 1 is connected a kind of fusion rotein (TAFP) that express the reorganization back with the gene of human albumin in Yeast system.This albumen has the biologic activity of T α 1 equally; Have hepatitis B virus resisting, the anti-tumor activity stronger than T α 1; And the feature that obviously prolongs of transformation period in vivo.Long-acting T α 1 can be used as enhancing body immunologic function, hepatitis B virus resisting and antineoplastic medicine.Compared with prior art, advantage of the present invention is: overcome T α 1 short key issue of transformation period in vivo 1.; 2. TAFP albumen of the present invention and T α 1 have same biologic activity and good prospects for application.

Description

Long-acting thymosin alpha 1 α's 1 is recombinant expressed and uses thereof

Technical field

The body's immunity that the present invention relates to field of immunology is regulated and the dna recombinant expression technical field in genetically engineered field, is specifically related to the recombinant expressed and uses thereof of long-acting thymosin alpha 1 α 1.

Background knowledge

Thymosin is the general name by animal thymus epithelial cell excretory one class polypeptide hormone.Thymosin (Thymosin alpha 1, T α 1) is by the Acid polypeptide at first isolated biologically active from ox TF5 in 1976 such as Low.The T α 1 of people and Niu has identical primary structure.T α 1 has the panimmunity regulatory function, can increase the T cell in various antigens or the former secretion that activates back generation alpha-interferon (INF-α), gamma-interferon (INF-γ), interleukin-class (as IL-1, IL-2, IL-3, IL-6, IL-7) and G CFS multiple lymphokines such as (CSF) of mitogenesis.Because natural thymosin molecular weight is little, utilizes beyond expression of words, the purifying of engineering bacteria.Therefore at present external produce be mostly synthetic, " the Zadaxin of producing as California, USA San Mateo city plug crude drug product company ^TM".The T α 1 main dependence import of domestic application costs an arm and a leg; The ubiquitous problem of what is more important T α 1 product is that in vivo transformation period is shorter, has influenced its clinical application and result of treatment.

Medicine that transformation period in the body is short and albumin amalgamation and expression are with the prolong drug transformation period in vivo, and this method is adopted in field of biological pharmacy in recent years more and more.For example small-molecule drug of easily being removed rapidly by liver and kidney in vivo and macromolecular albumin can prolong the time that it brings into play pharmacological action in vivo after crosslinked greatly, so both can reduce dosage relatively, reduce the treatment cost, also the toxic side effect that can avoid heavy dose of medication to bring is one of contemporary bio-pharmaceuticals advanced means.The present invention carries out gene recombination to thymosin and human albumin on gene level, the fusion gene of will recombinating changes in the pichia spp expresses, by fermentation, a kind of fusion rotein of obtaining of purifying (being called for short TAFP).This albumen and thymosin have the value-added biologic activity of the lymphocyte of stimulation equally; Have stronger antiviral, anti-tumor activity; The more important thing is to have the long transformation period, can be used as long-acting thymosin alpha 1 α 1 product.But recombinant expressed after thymosin and the human albumin gene fusion be yet there are no identical report and patent application.

Summary of the invention

The object of the present invention is to provide the recombinant expressed and uses thereof of a kind of long-acting thymosin alpha 1 α 1, T α 1 costs an arm and a leg in the prior art to overcome, and short shortcoming and defect of transformation period in vivo.

For overcoming the problem that prior art exists, technical scheme provided by the present invention is: a kind of long-acting thymosin alpha 1 α's 1 is recombinant expressed, be with T α 1 and human albumin after gene level merges, a kind of fusion rotein (being called for short TAFP) of in pichia spp, expressing by engineered method.The aminoacid sequence of TAFP is as follows: H ₂N-Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Ile Thr Thr Lys Asp Leu LysGlu Lys Lys Glu Val Val Glu Glu Ala Glu Asn Thr Ser Gly Gly Ser Gly GlySer Asp Ala His Lys Ser Glu Val Ala His Arg Phe Lys Asp Leu Gly Glu GluAsn Phe Lys Ala Leu Val Leu Ile Ala Phe Ala Gln Tyr Leu Gln Gln Cys ProPhe Glu Asp His Val Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Thr CysVal Ala Asp Glu Ser Ala Glu Asn Cys Asp Lys Ser Leu His Thr Leu Phe GlyAsp Lys Leu Cys Thr Val Ala Thr Leu Arg Glu Thr Tyr Gly Glu Met Ala AspCys Cys Ala Lys Gln Glu Pro Glu Arg Asn Glu Cys Phe Leu Gln His Lys AspAsp Asn Pro Asn Leu Pro Arg Leu Val Arg Pro Glu Val Asp Val Met Cys ThrAla Phe His Asp Asn Glu Glu Thr Phe Leu Lys Lys Tyr Leu Tyr Glu Ile AlaArg Arg His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Phe Phe Ala Lys Arg TyrLys Ala Ala Phe Thr Glu Cys Cys Gln Ala Ala Asp Lys Ala Ala Cys Leu LeuPro Lys Leu Asp Glu Leu Arg Asp Glu Gly Lys Ala Ser Ser Ala Lys Gln ArgLeu Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp AlaVal Ala Arg Leu Ser Gln Arg Phe Pro Lys Ala Glu Phe Ala Glu Val Ser LysLeu Val Thr Asp Leu Thr Lys Val His Thr Glu Cys Cys His Gly Asp Leu LeuGlu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln AspSer Ile Ser Ser Lys Leu Lys Glu Cys Cys Glu Lys Pro Leu Leu Glu Lys SerHis Cys Ile Ala Glu Val Glu Asn Asp Glu Met Pro Ala Asp Leu Pro Ser LeuAla Ala Asp Phe Val Glu Ser Lys Asp Val Cys Lys Asn Tyr Ala Glu Ala LysAsp Val Phe Leu Gly Met Phe Leu Tyr Glu Tyr Ala Arg Arg His Pro Asp TyrSer Val Val Leu Leu Leu Arg Leu Ala Lys Thr Tyr Glu Thr Thr Leu Glu LysCys Cys Ala Ala Ala Asp Pro His Glu Cys Tyr Ala Lys Val Phe Asp Glu PheLys Pro Leu Val Glu Glu Pro Gln Asn Leu Ile Lys Gln Ash Cys Glu Leu PheGlu Gln Leu Gly Glu Tyr Lys Phe Gln Asn Ala Leu Leu Val Arg Tyr Thr LysLys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Asn Leu GlyLys Val Gly Ser Lys Cys Cys Lys His Pro Glu Ala Lys Arg Met Pro Cys AlaGlu Asp Tyr Leu Ser Val Val Leu Asn Gln Leu Cys Val Leu His Glu Lys ThrPro Val Ser Asp Arg Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg ArgPro Cys Phe Ser Ala Leu Glu Val Asp Glu Thr Tyr Val Pro Lys Glu Phe AsnAla Glu Thr Phe Thr Phe His Ala Asp Ile Cys Thr Leu Ser Glu Lys Glu ArgGln Ile Lys Lys Gln Thr Ala Leu Val Glu Leu Val Lys His Lys Pro Lys AlaThr Lys Glu Gln Leu Lys Ala Val Met Asp Asp Phe Ala Ala Phe Val Glu LysCys Cys Lys Ala Asp Asp Lys Glu Thr Cys Phe Ala Glu Glu Gly Lys Lys LeuVal Ala Ala Ser Gln Ala Ala Leu Gly Leu-COOH

Described T α 1, its aminoacid sequence is as follows:

H ₂N-Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp?Leu?LysGlu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn-COOH

Described human albumin, its aminoacid sequence is as follows:

H ₂N-Thr?Ser?Gly?Gly?Ser?Gly?Gly?Ser?Asp?Ala?His?Lys?Ser?Glu?Val?Ala?HisArg?Phe?Lys?Asp?Leu?Gly?Glu?Glu?Asn?Phe?Lys?Ala?Leu?Val?Leu?Ile?Ala?PheAla?Gln?Tyr?Leu?Gln?Gln?Cys?Pro?Phe?Glu?Asp?His?Val?Lys?Leu?Val?Asn?GluVal?Thr?Glu?Phe?Ala?Lys?Thr?Cys?Val?Ala?Asp?Glu?Ser?Ala?Glu?Asn?Cys?AspLys?Ser?Leu?His?Thr?Leu?Phe?Gly?Asp?Lys?Leu?Cys?Thr?Val?Ala?Thr?Leu?ArgGlu?Thr?Tyr?Gly?Glu?Met?Ala?Asp?Cys?Cys?Ala?Lys?Gln?Glu?Pro?Glu?Arg?AsnGlu?Cys?Phe?Leu?Gln?His?Lys?Asp?Asp?Asn?Pro?Asn?Leu?Pro?Arg?Leu?Val?ArgPro?Glu?Val?Asp?Val?Met?Cys?Thr?Ala?Phe?His?Asp?Asn?Glu?Glu?Thr?Phe?LeuLys?Lys?Tyr?Leu?Tyr?Glu?Ile?Ala?Arg?Arg?His?Pro?Tyr?Phe?Tyr?Ala?Pro?GluLeu?Leu?Phe?Phe?Ala?Lys?Arg?Tyr?Lys?Ala?Ala?Phe?Thr?Glu?Cys?Cys?Gln?AlaAla?Asp?Lys?Ala?Ala?Cys?Leu?Leu?Pro?Lys?Leu?Asp?Glu?Leu?Arg?Asp?Glu?GlyLys?Ala?Ser?Ser?Ala?Lys?Gln?Arg?Leu?Lys?Cys?Ala?Ser?Leu?Gln?Lys?Phe?GlyGlu?Arg?Ala?Phe?Lys?Ala?Trp?Ala?Val?Ala?Arg?Leu?Ser?Gln?Arg?Phe?Pro?LysAla?Glu?Phe?Ala?Glu?Val?Ser?Lys?Leu?Val?Thr?Asp?Leu?Thr?Lys?Val?His?ThrGlu?Cys?Cys?His?Gly?Asp?Leu?Leu?Glu?Cys?Ala?Asp?Asp?Arg?Ala?Asp?Leu?AlaLys?Tyr?Ile?Cys?Glu?Asn?Gln?Asp?Ser?Ile?Ser?Ser?Lys?Leu?Lys?Glu?Cys?CysGlu?Lys?Pro?Leu?Leu?Glu?Lys?Ser?His?Cys?Ile?Ala?Glu?Val?Glu?Asn?Asp?GluMet?Pro?Ala?Asp?Leu?Pro?Ser?Leu?Ala?Ala?Asp?Phe?Val?Glu?Ser?Lys?Asp?ValCys?Lys?Asn?Tyr?Ala?Glu?Ala?Lys?Asp?Val?Phe?Leu?Gly?Met?Phe?Leu?Tyr?GluTyr?Ala?Arg?Arg?His?Pro?Asp?Tyr?Ser?Val?Val?Leu?Leu?Leu?Arg?Leu?Ala?LysThr?Tyr?Glu?Thr?Thr?Leu?Glu?Lys?Cys?Cys?Ala?Ala?Ala?Asp?Pro?His?Glu?CysTyr?Ala?Lys?Val?Phe?Asp?Glu?Phe?Lys?Pro?Leu?Val?Glu?Glu?Pro?Gln?Asn?LeuIle?Lys?Gln?Asn?Cys?Glu?Leu?Phe?Glu?Gln?Leu?Gly?Glu?Tyr?Lys?Phe?Gln?AsnAla?Leu?Leu?Val?Arg?Tyr?Thr?Lys?Lys?Val?Pro?Gln?Val?Ser?Thr?Pro?Thr?LeuVal?Glu?Val?Ser?Arg?Asn?Leu?Gly?Lys?Val?Gly?Ser?Lys?Cys?Cys?Lys?His?ProGlu?Ala?Lys?Arg?Met?Pro?Cys?Ala?Glu?Asp?Tyr?Leu?Ser?Val?Val?Leu?Asn?GlnLeu?Cys?Val?Leu?His?Glu?Lys?Thr?Pro?Val?Ser?Asp?Arg?Val?Thr?Lys?Cys?CysThr?Glu?Ser?Leu?Val?Asn?Arg?Arg?Pro?Cys?Phe?Ser?Ala?Leu?Glu?Val?Asp?GluThr?Tyr?Val?Pro?Lys?Glu?Phe?Asn?Ala?Glu?Thr?Phe?Thr?Phe?His?Ala?Asp?IleCys?Thr?Leu?Ser?Glu?Lys?Glu?Arg?Gln?Ile?Lys?Lys?Gln?Thr?Ala?Leu?Val?GluLeu?Val?Lys?His?Lys?Pro?Lys?Ala?Thr?Lys?Glu?Gln?Leu?Lys?Ala?Val?Met?AspAsp?Phe?Ala?Ala?Phe?Val?Glu?Lys?Cys?Cys?Lys?Ala?Asp?Asp?Lys?Glu?Thr?CysPhe?Ala?Glu?Glu?Gly?Lys?Lys?Leu?Val?Ala?Ala?Ser?Gln?Ala?Ala?Leu?Gly?Leu-COOH

Described ' H ₂N-' represents protein amino terminal (N-terminal), and ' COOH ' represents protein carboxyl terminal (C-terminal).

The above-mentioned application of long-acting thymosin alpha 1 α 1 in the medicine for treating tumor thing.

The application of above-mentioned long-acting thymosin alpha 1 α 1 in the treatment hepatitis B medicament.

The application of above-mentioned long-acting thymosin alpha 1 α 1 in enhancing body immunizing power medicine.

In order to prolong T α 1 transformation period in vivo, increase its curative effect, reduce the number of times of drug administration by injection, the present invention adopts genetic engineering means, and T α 1 is merged with albumin gene, and fusion gene obtains Yeast engineering bacteria after transforming Pichia yeast.This Yeast engineering bacteria adopts ordinary method to carry out fermentation expression under methanol induction, and successful expression has gone out TAFP albumen, and the proteic expression amount of product TAFP is up to 1mg/ml.

Compared with prior art, advantage of the present invention is:

1, overcome T α 1 short key issue of transformation period in vivo: with T the α 1 (" Zadaxin that California, USA San Mateo city plug crude drug product company produces of chemosynthesis ^TM") positive contrast, intravenous rabbit is injected " Zadaxin respectively ^TM" and TAFP, TAFP was reduced to half at blood level in about the 40th hour.Then at the 8th hour, blood level was reduced to half to T α 1.The TAFP transformation period has in vivo prolonged about 5 times than T α 1.This product can carry out large-scale production, and this uses at T α 1 is a breakthrough.

2, TAFP albumen of the present invention and T α 1 have same biologic activity and good prospects for application: comprising:

(1) with the T α 1 of the chemosynthesis (" Zadaxin that California, USA San Mateo city plug crude drug product company produces ^TM") positive contrast, the lymphocyte of vitro culture is carried out stimulation test, detect the situation that TAFP stimulates lymphocyte growth.TAFP is the same with T α 1 for the experimental result proof, has the effect that stimulates lymphocyte growth.

(2) with the T α 1 of the chemosynthesis (" Zadaxin that California, USA San Mateo city plug crude drug product company produces ^TM") positive contrast, be animal model with the SCID-hu mouse, detect the anti-tumor activity of TAFP.At the TAFP and the T α 1 that use same concentrations, behind the single administration, the result proves that TAFP has the 1 better anti-tumor activity than T α.

(3) with the T α 1 of the chemosynthesis (" Zadaxin that California, USA San Mateo city plug crude drug product company produces ^TM") positive contrast; the mouse of inoculation hepatitis B HBsAg vaccine (Lanzhou institute of Biological Products product) is carried out the mensuration of HBsAb titre; the result confirms that TAFP and T α 1 have the body of raising HBsAb titre usefulness equally; and TAFP illustrates that than the higher antibody titers of T α 1 generation TAFP has the ability of stronger hepatitis B virus resisting than T α 1.As seen, TAFP possesses the biologic activity of T α 1 equally; Have stronger antitumor, antiviral activity.

Description of drawings

Accompanying drawing TAFP change in concentration in animal body.

Embodiment

To describe in detail the present invention by embodiment below.

Embodiment 1: efficiently express TAFP in pichia spp

(1) acquisition of T α 1 gene

Press the habitual codon design of yeast T α 1 gene fragment, authorized company synthesizes following fragment:

F1：

5’tcgagaaaagatcagacgcagccgtagacaccagttccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaata3’

F2：

5’ctagtattttctgcctcttccacaacttccttcttctcctttaagtccttggtggtgagttcggaactggtgtctacggctgcgtctgatcttttc3’；

F1 and F2 fragment are annealed, the annealing product is connected between the XhoI and SpeI site of cloning vector pBluescriptIISK, structure contains the recombinant vectors of complete T α 1 gene, 5 ' end of this sequence has 6 bases, i.e. tactcgagaaaaga of xhoI restriction endonuclease sites and alpha factor signal peptide end.

(2) structure of carrier

1. the clone of human albumin gene

At first synthetic following primer

alb?pf：

5’gaattcactagtggtggctcaggtggatccgatgcacacaagagtgaggttg?3’；

alb?pr：

5’atgcggccgcttaccgcggtaagcctaaggcagcttgac?3’；

5 ' the end of upstream primer alb pf has been introduced EcoRI restriction enzyme site gaattc and added sequence: actagtggtggctcaggtggatcc has also comprised the restriction enzyme site of Spe I in the sequence.Downstream primer albpr 5 ' end is introduced Not I restriction endonuclease sites.Clone's detailed process is as follows: get about 0.1 gram of aborted fetus liver organization, and freeze thawing, Trizol RNA extracting solution, the chloroform 200 μ l of adding 1ml after the homogenate, the total RNA in the extracting tissue uses isopropanol precipitating subsequently.Sedimentary total RNA is dissolved in the 50 μ l DEPC treated waters.Get the total RNA of 5 μ l, with Ol igo dT 16 as reverse transcriptase primer, AMV be reversed transcriptive enzyme in containing the 20 μ l volumes of dNTP, 40 ℃ of reverse transcription 40min.Get 5 μ l reverse transcription products, albumin gene increases in 50 μ l reaction volumes.Amplification condition is: 94 ℃ of 2min, 94 ℃ of 50s, 55 ℃ of 50s, 72 ℃ of 2min, totally 30 circulations.Amplified production has an amplified band clearly at about 1.8kb size place after 1% agarose electrophoresis.From sepharose, reclaim this DNA band, be connected with the T carrier subsequently.Connect product and transform DH5 α intestinal bacteria (competence), select 5 white colonies on the penbritin flat board of IPTG and X-gal containing.Extract plasmid respectively, identify that with double digestion 5 clones' plasmid can both cut out the fragment of 1.8kb size as a result.Getting one of them clone send company order-checking, result to show that institute's cloned genes and human albumin gene are in full accord.

2. the human albumin gene clone is to yeast expression vector

With alb pf and this a pair of primer amplification of alb pr and be cloned in albumin gene 5 ' end and 3 ' on the T carrier and hold and include EcoR I restriction enzyme site and Not I restriction enzyme site respectively.Behind EcoR I and Not I double digestion T carrier, reclaim the albumin gene of 1.8kb, be connected with the pPIC9K carrier of same double digestion that (this pPIC9K carrier is the carrier through transforming, only contain an Xho I restriction enzyme site that is positioned at alpha factor signal peptide gene end), transform DH5 α competence bacteria, getting 3 clones identifies with EcoR I and NotI double digestion, the result can both cut out two fragments, and (fragment is the carrier of 9.3kb, another is the albumin gene of 1.8kb), get one of them clone and carry out sequencing, turn out to be the human albumin gene clone in the pPIC9K carrier, so far, successfully made up ' alb-pPIC9K ' carrier.

3.T α 1 gene clone is to ' alb-pPIC9K ' carrier

The recombinant vectors of ' alb-pPIC9K ' carrier and pBluescriptII SK-T α 1 gene carries out double digestion with Xho I and Spe I, is connected with above-mentioned T α 1 gene, transforms rear clone, order-checking.The clone is the same with the method for order-checking.The result has confirmed successfully to make up expression vector ' the T α 1-alb-pPIC9K ' that expresses the fusion of T α 1-human albumin.

4. the Pichia yeast engineering of construction expression TAFP

Extract ' T α 1-alb-pPIC9K ' cloned plasmids, after the SalI enzyme is cut into linearity, the purifying recovery.It is linearizing that ' the about 0.1 μ g of T α 1-alb-pPIC9K ' plasmid (in 0.2 μ l pure water) mixes with the competence GS115 Pichia yeast of 50 μ l, at 25 μ F, 2.5kV electroporation under the condition is with ' T α 1-alb-pPIC9K ' plasmid changes in the Pichia yeast.GS115 Pichia yeast after electricity is worn is suspended in the sorbyl alcohol that 1ml concentration is 1M, is coated on the MD flat board.Behind 30 ℃ of cultivation 5d, collect all pichia spp bacterium colonies, be coated on again after mixing on the YNB flat board that contains 3mg/ml G418, behind 30 ℃ of cultivation 5d, obtain the Yeast engineering bacteria clone of 3 anti-3mg/ml G418.These three clones are carried out small-scale abduction delivering experiment: be seeded in earlier in the BMGY substratum of 5ml, go in the BMMY substratum behind 30 ℃ of cultivation 36h, induce 48h for 30 ℃, the centrifuging and taking supernatant is through these three clones' of SDS-PAGE electrophoresis comparison expression amount.Therefrom chosen at last a highest clone of expression amount, as the Yeast engineering bacteria of expressing TAFP.

(3) fermentation expression

Yeast engineering bacteria adopts ordinary method to carry out fermentation expression under methanol induction.Fermented liquid obtains TAFP behind centrifugal, ultrafiltration, ion exchange column purifying.TAFP is used for subsequently experimentation on animals and cell experiment as medicine.

Detailed process is as follows:

1. the fermentation of engineering bacteria

The Pichia yeast engineering 0.5ml of cryopreservation is inoculated in the Erlenmeyer flask that contains 100mL YPD, and 30 ℃ of 200rpm cultivate 24h.Average mark to three respectively contains in the Erlenmeyer flask of 200ml BMGY, and 30 ℃ of 200rpm continue to cultivate 24h.Forward at last in the 30L fermentor tank that contains the 10L basic culture solution.Temperature, oxygen dissolved and pH value are set in 30 ℃, 30%, 5.0 respectively.Aqua ammonia with 30% is regulated pH.Through after the cultivation of 24h, the OD of bacterium liquid ₆₀₀Value can reach about 42.Beginning the glycerine batch feeding this moment cultivates.The glycerin medium that stream adds contains the trace mineral supplement of 50% glycerine and 12ml/L.The base speed that stream adds is 20mL/L/h, should adjust (regulate the dissolved oxygen of fermentation liquid degree to adjust the speed that stirs, make oxygen dissolved remain on 30%-40%) according to the oxygen dissolved situation accordingly.Behind the hungry 0.5h, begin inducing of methyl alcohol.The flow acceleration of methyl alcohol is 1mL/L/h to 5mL/L/h, and 4h to the fermentation ends stops stream and adds methyl alcohol, and induction time is generally 72h.

2. the separation of fermented liquid

The fermented liquid of collecting in the fermentor tank is total to 28L, behind the centrifugal 20min of 5000rpm, collects supernatant liquor 15L.The supernatant that takes a morsel is identified expression product (TAFP in the supernatant liquor) with the SDS-PAGE electrophoretic method.The result shows that a tangible protein expression is arranged at about 70kD place, protein electrophoresis gel scanning analysis, and the TAFP expression amount can reach 1mg/ml.Polyclonal antibody with anti-human albumin and anti-T α 1 carries out the western-blot evaluation respectively, and the result proves that expression product has the double characteristic of T α 1 and human albumin.The supernatant liquor of fermentation carries out ultrafiltration and concentration with the ultrafiltration plate of 10kD subsequently, obtains ultrafiltration and concentration liquid 2L.

3.TAFP purifying

2L ultrafiltration and concentration liquid at first by the dialysis desalination, adopts DEAE-sepharose anion-exchange chromatography post afterwards, at the PBS of the continuous concentration gradient NaCl of 0-1M (pH7.0) wash-out, collects the TAFP that main peak liquid is purifying.The final TAFP 11g that obtains, yield rate is about 70%.Purified product is through SDS-PAGE electrophoresis and grayness scanning, and the purity of TAFP can reach 99% behind the confirmation purifying.

The concrete application of product of the present invention embodies as follows:

Described long-acting thymosin alpha 1 α 1 is as the application of enhancing body immunizing power medicine.

Described long-acting thymosin alpha 1 α 1 is as the application of treatment hepatitis B medicament.

Long-acting thymosin alpha 1 α 1 according to claim 1 is as the application of medicine for treating tumor thing.

Embodiment 2: long-acting thymosin alpha 1 α 1 is as the application (the splenic lymphocyte increment is active) of enhancing body immunizing power medicine

Get 6 of Kunming kind small white mouses (body weight 18g ± 2g), get spleen respectively and grind on the net at stainless steel sift, be prepared into splenocyte suspension,, be prepared into 2 * 10 with the RPMI-1640 that contains 10% calf serum at last with serum-free RPMI-1640 washed cell 3 times (1640 is Gibco BRL company product) ⁷The splenocyte suspension of/ml.Splenocyte suspension joins in 96 orifice plates, and every hole 0.1ml contains 2 * 10 ⁶Individual splenocyte.Every hole adds T α 1 the contrast (" Zadaxin that California, USA San Mateo city plug crude drug product company produces that contains different concns TAFP or different concns again ^TM") 0.1ml.The blank (negative control is only added the nutrient solution of 0.1ml in the splenocyte) in 4 holes is established in 4 holes of each protein concentration simultaneously.Cultivate in 37 ℃ of carbonic acid gas incubators after 72 hours, add the cytoactive detection reagent.Cytoactive detects the Cell Counting kit-8 test kit that adopts Japanese colleague's chemistry institute (Dojindo).Every hole adds the cytoactive detection reagent of 10 μ l, and behind 37 ℃ of effect 2h, the 450nm wavelength is measured light absorption value (A value).With the viable cell quantity in the height telltale hole of light absorption value, the high more representative viable count of A value is many more, and the low more representative viable count of A value is few more.The same splenocyte propagation (differing not remarkable between the A value, p＞0.05) that stimulates of TAFP group with positive controls.All differ significantly (p＜0.05) with negative control group.Illustrate that TAFP is the same with T α 1, have the biologic activity of identical stimulation splenocyte propagation.

Table 1 different concns TAFP is to the in-vitro multiplication experiment of splenocyte

The every hole of concentration 3nM T α 1 or every hole 0.3nM T α 1 or every hole 0.03nM T α 1

A value when A value during A value TAFP during TAFP or TAFP

TAFP 0.85±0.53 0.66±0.25 0.46±0.19

T α 1 control peptide (positive control) 0.80 ± 0.33 0.65 ± 0.23 0.45 ± 0.21

Blank (negative control) 0.45 ± 0.23

Embodiment 3: long-acting thymosin alpha 1 α 1 is as the application (TAFP strengthens the immunne response of mouse to hepatitis B virus surface antigen) of treatment hepatitis B medicament

40 (body weight 22g ± 4g), be divided into 4 groups, 10 every group of Kunming kind small white mouse.A group: TAFP group, every mouse peritoneal injection TAFP 2mg (30nM), in 30 day time, injection in 6 days once at interval, inoculated hepatitis b surface antigen vaccine HBsAg (Lanzhou institute of Biological Products product) in the 7th day 2 of the subcutaneous branches of mouse back, every inoculum size 1 μ g, in the 20th day and blood sampling in the 30th day, ELISA detected tire (the surface antibody detection kit of DiaSorin company) of anti-HBsAg antibody.B group: per 2 days injection T α 1 peptide the group (" Zadaxins that California, USA San Mateo city plug crude drug product company produces ^TM"), every mouse peritoneal injection T α 1 0.1mg (30nM) is in 30 day time; injection in per 2 days was once inoculated HBsAg, every inoculum size 1 μ g in the 7th day 2 of the subcutaneous branches of mouse back; in the 20th day and blood sampling in the 30th day, ELISA detected tiring of anti-HBsAg antibody.C group: injected T α 1 peptide group at interval in 6 days, every mouse peritoneal injection T α 1 0.1mg (30nM), in 30 day time, injection in 6 days once at interval, inoculated HBsAg in the 7th day 2 of the subcutaneous branches of mouse back, every inoculum size 1 μ g, in the 20th day and blood sampling in the 30th day, ELISA detected tiring of anti-HBsAg antibody.The D group: the blank group, every mouse peritoneal injecting normal saline 0.1ml is in 30 day time, injection in 3 days was once inoculated HBsAg, every inoculum size 1 μ g in the 7th day 2 of the subcutaneous branches of mouse back at interval, in the 20th day and blood sampling in the 30th day, ELISA detected tiring of anti-HBsAg antibody.The result shows (table 2): the A group has the effect that identical promotion mouse produces anti-HbsAg antibody with the B group, these two groups stimulate titres that mouse produces antibody apparently higher than control group (D group) the 20th day and the 30th day, these the two groups significant differences of organizing with D (P＜0.05).The effect that C group enhancing antibody produces is starkly lower than A group and B group.These presentation of results TAFP can promote immunity system to the replying of HBsAg in vivo, is promoting anti-HBsAg antibody to produce than T α the last 1, and TAFP can keep the activity of longer time in vivo than T α 1.

Table 2TAFP promotion mouse generation anti-hepatitis b HbsAg antibody (x ± s, mIU/ml)

A group B group C group D group

The 20th day 85 ± 26 80 ± 29 55 ± 18 50 ± 20

Antibody titers

The 30th day 200 ± 43 189 ± 52 120 ± 44 100 ± 36

Antibody titers

Embodiment 4: long-acting thymosin alpha 1 α 1 is as the application (people's liver cancer) of medicine for treating tumor thing

From people's periphery anticoagulation, separate PBMC, every injection about 5 * 10 of NOD-SCID mouse (raising in SPF level Animal House) ⁷PBMC sets up the people-mouse chimaeric animals NOD-SCID-Hu with human immune feature.Animal model is divided into 4 groups, 5 every group after setting up.A group: every mouse left thigh dorsal part subcutaneous vaccination 3 * 10 ⁶Individual human liver cancer cell (hHCC), and three days every mouse peritoneals are injected TAFP 2mg at interval, measure knurl body volume after 20 days.B group: every mouse left thigh dorsal part subcutaneous vaccination 3 * 10 ⁶Individual human liver cancer cell (hHCC), every mouse abdominal injection every day T α 1 (" Zadaxin that California, USA San Mateo city plug crude drug product company produces ^TM") 0.1mg, measure knurl body volume after 20 days.C group: every mouse left thigh dorsal part subcutaneous vaccination 3 * 10 ⁶Individual human liver cancer cell (hHCC), three days every mouse peritoneal injection T α 1 (" Zadaxins that California, USA San Mateo city plug crude drug product company produces at interval ^TM") 0.1mg, measure knurl body volume after 20 days.D group: negative control group, every mouse left thigh dorsal part subcutaneous vaccination 3 * 10 ⁶Individual human liver cancer cell (hHCC), and three days every the mouse peritoneal injecting normal saline 0.1ml in interval are measured knurl body volume after 20 days.The results are shown in following table (table 3), the A group differs not significantly (P＞0.05) with the knurl body size of B group; The A group differs significantly (P＜0.05) with negative control group D group; The B group differs significantly P＜0.05 with negative control group D group).Illustrate that the A group is the same with the B group, all has the effect that the knurl body increases that suppresses.The knurl body volume of A group also is significantly less than the knurl body (P＜0.05) of D group, illustrates that the TAFP of A group has stronger anti-tumor activity.

Table 3TAFP is to influence (n=10, x ± s, the mm of lotus knurl SCID-hu mouse tumor volume ³)

Grouping A group B group C group D group

Knurl body size 230 ± 88 250 ± 76 589 ± 112 685 ± 160

Embodiment 5: long-acting thymosin alpha 1 α 1 transformation period is in animal body measured

10 (body weight 2.0kg ± 0.3kg), be divided into two groups of A, B at random, 5 every group of normal male new zealand white rabbit.The A group is T the α 1 (" Zadaxin that California, USA San Mateo city plug crude drug product company produces ^TM") control group, the T α 1 of every intravenous injection 1mg.The B group is experimental group, the TAFP of every intravenous injection 20mg.The every interval 2h in injection back gathers the venous blood of 0.5ml, the 2nd, 3 day interval 4h blood sampling.Separation of serum ,-20 ℃ of preservations.T α 1 Determination on content adopts USCNLIFE in the blood ^TM" human thymosin alfa 1 enzyme-linked immunosorbent assay kit " description operation of company.Detected result confirms that the time that TAFP keeps maximum concentration in vivo is 32 hours, and the time that T α 1 keeps maximum concentration in vivo is 4 hours.From curve as can be seen, at about the 40th hour, TAFP was reduced to half at blood level.Then at the 8th hour, blood level was reduced to half to T α 1.That is to say that the TAFP transformation period has in vivo prolonged about 5 times than T α 1.

SEQUENCE?LISTING

＜110〉stone, it is red to continue

＜120〉long-acting thymosin alpha 1 α's 1 is recombinant expressed and uses thereof

<160>1

<170>PatentIn?version?3.3

<210>1

<211>621

<212>PRT

<213>Pichia?pastoris

<400>1

Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp?Leu

1 5 10 15

Lys?Glu?Lys?Lys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Thr?Ser?Gly?Gly

20 25 30

Ser?Gly?Gly?Ser?Asp?Ala?His?Lys?Ser?Glu?Val?Ala?His?Arg?Phe?Lys

35 40 45

Asp?Leu?Gly?Glu?Glu?Asn?Phe?Lys?Ala?Leu?Val?Leu?Ile?Ala?Phe?Ala

50 55 60

Gln?Tyr?Leu?Gln?Gln?Cys?Pro?Phe?Glu?Asp?His?Val?Lys?Leu?Val?Asn

65 70 75 80

Glu?Val?Thr?Glu?Phe?Ala?Lys?Thr?Cys?Val?Ala?Asp?Glu?Ser?Ala?Glu

85 90 95

Asn?Cys?Asp?Lys?Ser?Leu?His?Thr?Leu?Phe?Gly?Asp?Lys?Leu?Cys?Thr

100 105 110

Val?Ala?Thr?Leu?Arg?Glu?Thr?Tyr?Gly?Glu?Met?Ala?Asp?Cys?Cys?Ala

115 120 125

Lys?Gln?Glu?Pro?Glu?Arg?Asn?Glu?Cys?Phe?Leu?Gln?His?Lys?Asp?Asp

130 135 140

Asn?Pro?Asn?Leu?Pro?Arg?Leu?Val?Arg?Pro?Glu?Val?Asp?Val?Met?Cys

145 150 155 160

Thr?Ala?Phe?His?Asp?Asn?Glu?Glu?Thr?Phe?Leu?Lys?Lys?Tyr?Leu?Tyr

165 170 175

Glu?Ile?Ala?Arg?Arg?His?Pro?Tyr?Phe?Tyr?Ala?Pro?Glu?Leu?Leu?Phe

180 185 190

Phe?Ala?Lys?Arg?Tyr?Lys?Ala?Ala?Phe?Thr?Glu?Cys?Cys?Gln?Ala?Ala

195 200 205

Asp?Lys?Ala?Ala?Cys?Leu?Leu?Pro?Lys?Leu?Asp?Glu?Leu?Arg?Asp?Glu

210 215 220

Gly?Lys?Ala?Ser?Ser?Ala?Lys?Gln?Arg?Leu?Lys?Cys?Ala?Ser?Leu?Gln

225 230 235 240

Lys?Phe?Gly?Glu?Arg?Ala?Phe?Lys?Ala?Trp?Ala?Val?Ala?Arg?Leu?Ser

245 250 255

Gln?Arg?Phe?Pro?Lys?Ala?Glu?Phe?Ala?Glu?Val?Ser?Lys?Leu?Val?Thr

260 265 270

Asp?Leu?Thr?Lys?Val?His?Thr?Glu?Cys?Cys?His?Gly?Asp?Leu?Leu?Glu

275 280 285

Cys?Ala?Asp?Asp?Arg?Ala?Asp?Leu?Ala?Lys?Tyr?Ile?Cys?Glu?Asn?Gln

290 295 300

Asp?Ser?Ile?Ser?Ser?Lys?Leu?Lys?Glu?Cys?Cys?Glu?Lys?Pro?Leu?Leu

305 310 315 320

Glu?Lys?Ser?His?Cys?Ile?Ala?Glu?Val?Glu?Asn?Asp?Glu?Met?Pro?Ala

325 330 335

Asp?Leu?Pro?Ser?Leu?Ala?Ala?Asp?Phe?Val?Glu?Ser?Lys?Asp?Val?Cys

340 345 350

Lys?Asn?Tyr?Ala?Glu?Ala?Lys?Asp?Val?Phe?Leu?Gly?Met?Phe?Leu?Tyr

355 360 365

Glu?Tyr?Ala?Arg?Arg?His?Pro?Asp?Tyr?Ser?Val?Val?Leu?Leu?Leu?Arg

370 375 380

Leu?Ala?Lys?Thr?Tyr?Glu?Thr?Thr?Leu?Glu?Lys?Cys?Cys?Ala?Ala?Ala

385 390 395 400

Asp?Pro?His?Glu?Cys?Tyr?Ala?Lys?Val?Phe?Asp?Glu?Phe?Lys?Pro?Leu

405 410 415

Val?Glu?Glu?Pro?Gln?Asn?Leu?Ile?Lys?Gln?Asn?Cys?Glu?Leu?Phe?Glu

420 425 430

Gln?Leu?Gly?Glu?Tyr?Lys?Phe?Gln?Asn?Ala?Leu?Leu?Val?Arg?Tyr?Thr

435 440 445

Lys?Lys?Val?Pro?Gln?Val?Ser?Thr?Pro?Thr?Leu?Val?Glu?Val?Ser?Arg

450 455 460

Asn?Leu?Gly?Lys?Val?Gly?Ser?Lys?Cys?Cys?Lys?His?Pro?Glu?Ala?Lys

465 470 475 480

Arg?Met?Pro?Cys?Ala?Glu?Asp?Tyr?Leu?Ser?Val?Val?Leu?Asn?Gln?Leu

485 490 495

Cys?Val?Leu?His?Glu?Lys?Thr?Pro?Val?Ser?Asp?Arg?Val?Thr?Lys?Cys

500 505 510

Cys?Thr?Glu?Ser?Leu?Val?Asn?Arg?Arg?Pro?Cys?Phe?Ser?Ala?Leu?Glu

515 520 525

Val?Asp?Glu?Thr?Tyr?Val?Pro?Lys?Glu?Phe?Asn?Ala?Glu?Thr?Phe?Thr

530 535 540

Phe?His?Ala?Asp?Ile?Cys?Thr?Leu?Ser?Glu?Lys?Glu?Arg?Gln?Ile?Lys

545 550 555 560

Lys?Gln?Thr?Ala?Leu?Val?Glu?Leu?Val?Lys?His?Lys?Pro?Lys?Ala?Thr

565 570 575

Lys?Glu?Gln?Leu?Lys?Ala?Val?Met?Asp?Asp?Phe?Ala?Ala?Phe?Val?Glu

580 585 590

Lys?Cys?Cys?Lys?Ala?Asp?Asp?Lys?Glu?Thr?Cys?Phe?Ala?Glu?Glu?Gly

595 600 605

Lys?Lys?Leu?Val?Ala?Ala?Ser?Gln?Ala?Ala?Leu?Gly?Leu

610 615 620

Claims (4)

1, a kind of long-acting thymosin alpha 1 α's 1 is recombinant expressed, it is characterized in that: it is to merge a kind of recombinant protein (being called for short TAFP) of expressing the back by thymosin (thymosin alpha 1, T α 1) and human albumin at gene level, and its aminoacid sequence is:

H ₂N-Ser?Asp?Ala?Ala?Val?Asp?Thr?Ser?Ser?Glu?Ile?Thr?Thr?Lys?Asp?Leu?Lys?Glu?LysLys?Glu?Val?Val?Glu?Glu?Ala?Glu?Asn?Thr?Ser?Gly?Gly?Ser?Gly?Gly?Ser?Asp?Ala?HisLys?Ser?Glu?Val?Ala?His?Arg?Phe?Lys?Asp?Leu?Gly?Glu?Glu?Asn?Phe?Lys?Ala?Leu?ValLeu?Ile?Ala?Phe?Ala?Gln?Tyr?Leu?Gln?Gln?Cys?Pro?Phe?Glu?Asp?His?Val?Lys?Leu?ValAsn?Glu?Val?Thr?Glu?Phe?Ala?Lys?Thr?Cys?Val?Ala?Asp?Glu?Ser?Ala?Glu?Asn?CysAsp?Lys?Ser?Leu?His?Thr?Leu?Phe?Gly?Asp?Lys?Leu?Cys?Thr?Val?Ala?Thr?Leu?ArgGlu?Thr?Tyr?Gly?Glu?Met?Ala?Asp?Cys?Cys?Ala?Lys?Gln?Glu?Pro?Glu?Arg?Asn?GluCys?Phe?Leu?Gln?His?Lys?Asp?Asp?Asn?Pro?Asn?Leu?Pro?Arg?Leu?Val?Arg?Pro?GluVal?Asp?Val?Met?Cys?Thr?Ala?Phe?His?Asp?Asn?Glu?Glu?Thr?Phe?Leu?Lys?Lys?TyrLeu?Tyr?Glu?Ile?Ala?Arg?Arg?His?Pro?Tyr?Phe?Tyr?Ala?Pro?Glu?Leu?Leu?Phe?Phe?AlaLys?Arg?Tyr?Lys?Ala?Ala?Phe?Thr?Glu?Cys?Cys?Gln?Ala?Ala?Asp?Lys?Ala?Ala?Cys?LeuLeu?Pro?Lys?Leu?Asp?Glu?Leu?Arg?Asp?Glu?Gly?Lys?Ala?Ser?Ser?Ala?Lys?Gln?ArgLeu?Lys?Cys?Ala?Ser?Leu?Gln?Lys?Phe?Gly?Glu?Arg?Ala?Phe?Lys?Ala?Trp?Ala?Val?AlaArg?Leu?Ser?Gln?Arg?Phe?Pro?Lys?Ala?Glu?Phe?Ala?Glu?Val?Ser?Lys?Leu?Val?Thr?AspLeu?Thr?Lys?Val?His?Thr?Glu?Cys?Cys?His?Gly?Asp?Leu?Leu?Glu?Cys?Ala?Asp?AspArg?Ala?Asp?Leu?Ala?Lys?Tyr?Ile?Cys?Glu?Asn?Gln?Asp?Ser?Ile?Ser?Ser?Lys?Leu?LysGlu?Cys?Cys?Glu?Lys?Pro?Leu?Leu?Glu?Lys?Ser?His?Cys?Ile?Ala?Glu?Val?Glu?Asn?AspGlu?Met?Pro?Ala?Asp?Leu?Pro?Ser?Leu?Ala?Ala?Asp?Phe?Val?Glu?Ser?Lys?Asp?Val?CysLys?Asn?Tyr?Ala?Glu?Ala?Lys?Asp?Val?Phe?Leu?Gly?Met?Phe?Leu?Tyr?Glu?Tyr?Ala?ArgArg?His?Pro?Asp?Tyr?Ser?Val?Val?Leu?Leu?Leu?Arg?Leu?Ala?Lys?Thr?Tyr?Glu?Thr?ThrLeu?Glu?Lys?Cys?Cys?Ala?Ala?Ala?Asp?Pro?His?Glu?Cys?Tyr?Ala?Lys?Val?Phe?Asp?GluPhe?Lys?Pro?Leu?Val?Glu?Glu?Pro?Gln?Asn?Leu?Ile?Iys?Gln?Asn?Cys?Glu?Leu?PheGlu?Gln?Leu?Gly?Glu?Tyr?Lys?Phe?Gln?Asn?Ala?Leu?Leu?Val?Arg?Tyr?Thr?Lys?Lys?ValPro?Gln?Val?Ser?Thr?Pro?Thr?Leu?Val?Glu?Val?Ser?Arg?Asn?Leu?Gly?Lts?Val?Gly?SerLys?Cys?Cys?Lys?His?Pro?Glu?Ala?Lys?Arg?Met?Pro?Cys?Ala?Glu?Asp?Tyr?Leu?Ser?ValVal?Leu?Asn?Gln?Leu?Cys?Val?Leu?His?Glu?Lys?Thr?Pro?Val?Ser?Asp?Arg?Val?Thr?LysCys?Cys?Thr?Glu?Ser?Leu?Val?Asn?Arg?Arg?Pro?Cys?Phe?Ser?Ala?Leu?Glu?Val?AspGlu?Thr?Tyr?Val?Pro?Lys?Glu?Phe?Asn?Ala?Glu?Thr?Phe?Thr?Phe?His?Ala?Asp?Ile?CysThr?Leu?Ser?Glu?Lys?Glu?Arg?Gln?Ile?Lys?Lys?Gln?Thr?Ala?Leu?Val?Glu?Leu?Val?LysHis?Lys?Pro?Lys?Ala?Thr?Lys?Glu?Gln?Leu?Lys?Ala?Val?Met?Asp?Asp?Phe?Ala?Ala?PheVal?Glu?Lys?Cys?Cys?Lys?Ala?Asp?Asp?Lys?Glu?Thr?Cys?Phe?Ala?Glu?Glu?Gly?LysLys?Leu?Val?Ala?Ala?Ser?Gln?Ala?Ala?Leu?Gly?Leu-COOH

Described ' H ₂N-' represents protein amino terminal (N-terminal), and ' COOH ' represents protein carboxyl terminal (C-terminal).

2, the application of long-acting thymosin alpha 1 α 1 as claimed in claim 1 in the medicine for treating tumor thing.

3, the application of long-acting thymosin alpha 1 α 1 as claimed in claim 1 in the treatment hepatitis B medicament.

4, the application of long-acting thymosin alpha 1 α 1 as claimed in claim 1 in enhancing body immunizing power medicine.

Images