CN101591390A - The monoclonal antibody and the application thereof of the avian influenza virus NP in anti-H5N1 source - Google Patents

Abstract

The invention discloses the monoclonal antibody of specificity anti-avian influenza virus nucleoprotein (NP), described antibody sources is the hybridoma cell strain of CCTCC NO:C200810, CCTCC NO:C200811 or CCTCC NO:C200812 in preserving number.Described monoclonal antibody specificity and highly sensitive.The invention also discloses the test kit that detects avian influenza virus.

Description

The monoclonal antibody and the application thereof of the avian influenza virus NP in anti-H5N1 source

Technical field

The invention belongs to field of immunology, more specifically, the present invention relates to the monoclonal antibody and the application thereof of the avian influenza virus NP in anti-H5N1 source.

Background technology

Influenza generally has highly pathogenic, and highly infective is propagated rapidly, and the characteristics that mortality ratio is high are primarily aimed at the bird and the mankind to its diagnosis.Clinical, epidemiology diagnosis, pathology and etiological diagnosis, serodiagnosis and other detection techniques are generally all arranged.The bed symptom of bird flu shows inconsistent because of kind, age, accompanying infection situation and the new differences such as virulence that infect strain that infects fowl.Its pathological change also is not quite similar because of the height of infective virus strain virulence, the length and the kind of the course of disease, and the atypism proterties changes with cuing open to examine.So the diagnosis of influenza depends on Pathogen Isolation and identifies and serodiagnosis always.These diagnostic methods are confined to laboratory diagnosis, and following shortcoming is arranged: (1) operational hazards, take place easily to pollute and infect, and can only operate by the professional in specialized laboratory; (2) length consuming time, operation is many, generally all needs more than 10 hours; (3) instrument is numerous and diverse, the cost height, and need professional's ability analytical results and data and make diagnosis report; This is to the very inconvenience of sifting out of the diagnosis of disease and case.Especially when the flu outbreak of large-scale A type, need carry out extensive examination to Susceptible population and bird, need obtain the result fast and effectively, there are the region limitation again in above method length consuming time, method complexity, are unfavorable for very much the extensive examination and the diagnosis of disease.

According to the difference of virus antigen characteristic and genetic characteristics thereof, influenza virus is divided into first, second, the third three types (being A, B, C type).First type antigenic variability is the strongest, infects human and other animals, in causing, the severe disease, attacks all age group crowds, often causes worldwide being very popular.B-mode variability a little less than, only infect humanly, generally cause slight disease, mainly attack children, can cause local outburst.The third type antigenicity is more stable, only causes infant infection and adult's Sporadic cases.

Influenza A virus is different with N antigen according to H, is divided into many hypotypes again, and H can be divided into 15 hypotypes, and (H1～H15), N have 9 hypotypes (N1～N9).Wherein only H1N1, H2N2, H3N2 mainly infect the mankind, and the natural reservoir (of bird flu viruses) of other many hypotypes is multiple bird and animal.So the common alleged bird flu in this area belongs to influenza A.Wherein to bird harm maximum be H5, H7 and H9 hypotype strain.Generally speaking, avian influenza virus can not infect birds and pig animal in addition.But 18 routine H5N1 human and bird fluenza cases of infection took place in Hong Kong reported first in 1997, and wherein 6 examples are dead, cause global extensive concern.After 1997, avian influenza people's incident has successively taken place again in the world several times.Have highly pathogenic H5N1, H7N7, H9N2, etc. avian influenza virus, have person to person's transmission capacity in case morph, can cause human world bird flu popular, indicating that avian influenza virus has had very big potential threat to the mankind.

Avian influenza virus is that sphere is about 100nm, and the RNA type is made up of three parts, and its core is made up of with the nucleoprotein (NP) that is wrapped in outside it the negative RNA of strand.Its viral RNA fragment 5 is about 115Kb, coding virus nucleocapsid albumen (NP), it is a kind of polypeptide of monomer phosphorylation, it is the major protein composition that constitutes virus nucleocapsid, constitute nucleic acid ribosome (RNP) with geneome RNA, constitute the nucleus of virus then with RNA polymerase jointly.NP albumen has type specificity, is the main foundation that influenza virus is divided A, B, C type, simultaneously, virus genomic transcribe and duplicate and determine all play an important role aspect the host specificity.Because NP is the major antigen of cytotoxic T lymphocyte identification; so expecting its institute's inductive immune protection performance always, people provide protection to animal; yet the monoclonal antibody of NP but can not provide passive protection to animal; and when coming immune animal, also can only produce fainter protective capability with external synthetic NP.AIV nucleoprotein (NP) is for constituting the major protein composition of virus nucleocapsid, its structure height is conservative, aberration rate is very low, have the specificity of group and type, being the basis of classification of influenza virus type and diagnosis, also is the important evidence of avian influenza virus (A type influenza) diagnosis.

Because the outburst of bird flu (A type) can constitute the grave danger to human health, also can cause the massive losses of aquaculture and agricultural, therefore in case the huge fear that the influenza infection incident will cause people socially occurs.But quite a few belongs to Type B and C type in the middle of the influenza, and real A type influenza only occupies the minority.Therefore for influenza is diagnosed more accurately and timely, significant to safeguarding human health and social stability.Only there is the minority product specific diagnosis to distinguish A in the market, B, C type, its quality and stability are all not too reliable.For this outburst rate of influenza height, the disease that mortality ratio is high, diagnostic products has great demand accurately and effectively.

Therefore, this area is necessary to obtain the good avian influenza virus NP protein-specific monoclonal antibody of recognition effect by screening, to identify avian influenza virus more accurately, for clinical diagnosis, treatment are raced against time.

Summary of the invention

The object of the present invention is to provide the monoclonal antibody of a class specificity anti-avian influenza virus nucleoprotein (NP).

Another object of the present invention is to provide the detection kit of specificity anti-avian influenza virus.

In a first aspect of the present invention, the monoclonal antibody of a specific specificity anti-avian influenza virus nucleoprotein (NP) is provided, described monoclonal antibody is produced by the hybridoma cell strain that is selected from down group:

Preserving number is the hybridoma cell strain (S-200-23) of CCTCC-C200812;

Preserving number is the hybridoma cell strain (S-171-9) of CCTCC-C200811; Or

Preserving number is the hybridoma cell strain (S-290-3) of CCTCC-C200810.

In another preference, preserving number is the heavy chain variable region gene that the monoclonal antibody of the hybridoma cell strain generation of CCTCC-C200812 has nucleotide sequence shown in the SEQ ID NO:2.

In another preference, preserving number is the heavy chain leader sequence that the monoclonal antibody of the hybridoma cell strain generation of CCTCC-C200812 has nucleotide sequence shown in the SEQ ID NO:1.

In a second aspect of the present invention, the purposes of described monoclonal antibody is provided, be used to prepare the reagent or the test kit that detect avian influenza virus.

In a third aspect of the present invention, a kind of hybridoma cell strain is provided, described hybridoma cell strain is selected from:

Preserving number is the hybridoma cell strain of CCTCC-C200812;

Preserving number is the hybridoma cell strain of CCTCC-C200811; Or

Preserving number is the hybridoma cell strain of CCTCC-C200810.

In a fourth aspect of the present invention, a kind of test kit that detects avian influenza virus is provided, described test kit contains described one or more monoclonal antibody.

In another preference, described test kit contains:

Solid phase carrier is coated with at least a first antibody on the described solid phase carrier, this first antibody is a monoclonal antibody of the present invention.

In another preference, also contain in the described test kit:

Second antibody, this second antibody are the polyclonal antibodies of anti-avian influenza virus nucleoprotein.

In another preference, also contain in the described test kit:

Enzyme linked immunosorbent detection reagent includes but not limited to: marker (as enzyme), the substrate of marker correspondence, developer, washings or stop buffer.

In a fifth aspect of the present invention, provide external (non-diagnosis or therapeutic ground) to detect the method for avian influenza virus, may further comprise the steps:

(a) with the testing sample application of sample in the solid phase carrier that is coated with first antibody, thereby the avian influenza virus nucleoprotein in the testing sample is combined with first antibody on the solid phase carrier, form the solid phase carrier that has " nucleoprotein-first antibody " binary complex; Described first antibody is selected from monoclonal antibody of the present invention (or polyclonal antibody of anti-avian influenza virus nucleoprotein);

(b) solid phase carrier that the second antibody application of sample is obtained in (a), thus the solid phase carrier that has " second antibody-nucleoprotein-first antibody " ternary complex formed; Described second antibody is the polyclonal antibody (or monoclonal antibody of the present invention) of anti-avian influenza virus nucleoprotein; And described second antibody is carried a marker;

(c) detect marker in the ternary complex, the existence of determining avian influenza virus nucleoprotein in the detected sample whether with or the amount that exists, thereby the existence of determining avian influenza virus whether;

Perhaps, may further comprise the steps:

(a1) with the testing sample bag by in solid phase carrier;

(a2) will detect the solid phase carrier of antibody application of sample, thereby make avian influenza virus nucleoprotein in the testing sample and the detection antibodies on the solid phase carrier, form the solid phase carrier that has " nucleoprotein-detection antibody " binary complex " in (a1); Described detection antibody is selected from monoclonal antibody of the present invention, and described detection antibody carries a marker;

(a3) detect marker in the binary complex, the existence of determining avian influenza virus nucleoprotein in the detected sample whether with or the amount that exists, thereby the existence of determining avian influenza virus whether.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

Fig. 1 has shown the SDS-PAGE electrophoretic analysis of NP albumen pronucleus expression.Each swimming lane sample is followed successively by:

1: low molecular weight protein (LMWP) marker;

After 2:PGEX-4t-1-NP was transferred to intestinal bacteria, IPTG induced preceding expression (sample on the thalline);

3 and after 4:PGEX-4t-1-NP is transferred to intestinal bacteria, IPTG (0.5mM) induces back expression (sample on the thalline);

5 and the 6:Thrombin enzyme cut the back prokaryotic expression NP albumen that obtains of purifying.

Before Fig. 2 has shown that the NP albumen pronucleus expression is induced, the SDS-PAGE electrophoretic analysis before and after the ultrasonic broken cell.Each swimming lane sample is followed successively by:

1: low molecular weight protein (LMWP) marker;

After 2:PGEX-4t-1-NP was transferred to intestinal bacteria, IPTG induced preceding expression (sample on the thalline);

3:IPTG induces back expression (sample on the thalline);

4:IPTG induces expression in the back thalline ultrasonication cell conditioned medium (after the thalline ultrasonication on the supernatant sample);

5:IPTG induces expression (sample on the thalline ultrasonication postprecipitation) in the back thalline ultrasonication cell precipitation.

Fig. 3 has shown that immunoblotting detects the NP mouse and resists the proteic ability of discerning among the deactivation AIV of NP more.

A is that the NP mouse resists the identification situation to the NP-GST recombinant protein of prokaryotic expression more, and wherein " AIV deactivation " is that the NP mouse resists the identification situations to deactivation AIV more.

B is that the NP mouse resists the identification situation to the NP recombinant protein of prokaryotic expression more, and wherein " AIV deactivation " is that the NP mouse resists the identification situations to deactivation AIV more.

Fig. 4 A-B has shown that indirect elisa method detects the antibody strain excretory antibody of S-171-9, S-200-23, S-220-10, S-290-3 to antigenic identification situation.

Fig. 4 C has shown that the sandwich ELISA method detects the antibody strain excretory antibody of S-96-10, S-171-9, S-176-8, S-200-23, S-220-10, S-290-3 to antigenic identification situation.

The sandwich ELISA method that shown Fig. 5 A detects S-290-3 antibody strain excretory monoclonal antibody and the many anti-antigenic results of sandwich detection of enzyme mark.

The sandwich ELISA method that shown Fig. 5 B detects S-171-9 antibody strain excretory monoclonal antibody and the many anti-antigenic results of sandwich detection of enzyme mark.

The sandwich ELISA method that shown Fig. 5 C detects S-200-23 antibody strain excretory monoclonal antibody and the many anti-antigenic results of sandwich detection of enzyme mark.

Fig. 6 shown and utilized many anti-bag quilts, adds behind the antigen again with the sandwich method ELISA method detected result of monoclonal antibody of the present invention as detection antibody.

Embodiment

The inventor finds the monoclonal antibody of the specificity anti-avian influenza nucleoprotein (NP) of a class effect excellence through extensive studies.Described monoclonal antibody is wide for the sensing range of anti-avian influenza virus nucleoprotein.And it can discern the NP antigen in the complex system well, and with other albumen generation cross reaction, specificity and sensitivity are all very not high.

Bird flu NP aminoacid sequence is long, and antigenic determinant much is enclosed in the inside of protein structure, therefore is difficult to the monoclonal antibody that finds a specific specificity high.A lot of antibody identification meter positions of NP are the space epi-position, and a lot of epi-positions are in the middle of sequence, not at protein sequence N end or C end.Antigen of the present invention because be the sex change purifying, is linear epitope district on the identification NP space structure but not space epi-position district so discern the antibody of this metaprotein in preparation process.At present, although some anti-NP monoclonal antibodies have been developed in this area, yet when these antibody are used for actual detected, still suffer from problem with natural NP protein binding characteristic difference, this be since in the testing sample the proteic antigenic determinant of NP be enclosed in protein structure inside, can't touch that antibody causes.When with this monoclonal antibody test sample, sample need be handled (as heat denatured), make by the antigenic determinant of embedding and come out, this causes the complicated of clinical detection program on the one hand, makes detection time long; On the other hand,, thereby improve the incidence of non-specific binding greatly, cause interference, reduce the accuracy that detects because heat denatured can cause other various proteic sex change in the testing sample.

At above-mentioned technical barrier, the inventor has prepared many kinds at the proteic monoclonal antibody of NP, through research trial a large amount of, repeatedly, finally found anti-NP monoclonal antibody of the present invention (respectively by hybridoma cell strain S-200-23, S-290-3, S-171-9 produces), described monoclonal antibody has very high specificity for NP albumen, debond other albumen beyond NP.And, when being used to detect, need not that testing sample is carried out too much processing and can obtain accurate detected result easily.

In order to obtain effect preferably, the inventor adopts the NP-GST fusion rotein to come immune animal, and screens monoclonal antibody with the NP albumen (not containing GST albumen) of purifying.

And,, can easy to prepare, fast and accurately detect the test kit of avian influenza virus based on described monoclonal antibody.

The prokaryotic expression of avian influenza virus nucleoprotein

The method of expressing the avian influenza virus NP is known in the art, generally includes:

(a) pcr amplification obtains the proteic encoding sequence of NP;

(b) encoding sequence with (a) described nucleoprotein inserts in the multiple clone site of expression vector, obtains to have inserted the expression vector of nucleoprotein encoding sequence;

(c) make insertion that (b) obtain the expression vector of nucleoprotein encoding sequence change host cell over to, obtain transformed host cells;

(d) cultivate transformed host cells, thereby give expression to nucleoprotein;

(e) separate acquisition avian influenza virus NP.

As a kind of optimal way of the present invention, described expression vector is the PGEX-4t-1 carrier, wherein carries the GST label.

Expression vector is incorporated in the genetically engineered host cell, can expresses described albumen.In optimal way of the present invention, the host cell of employing is intestinal bacteria Rossetta.

The inventor adopts the method for prokaryotic expression avian influenza virus NP, efficiently expression in escherichia coli and purifying NP, the expression amount height, high specificity is easy to purifying and has complete space conformation.Proteic monoclonal antibody of anti-NP and polyclonal antibody have been developed based on described NP albumen.

Monoclonal antibody

Those skilled in the art all understand, and a kind of antigen may contain a plurality of epitopes (antigenic determinant), therefore, can obtain more than antibody at same antigen, and these antibody all may be different to antigenic binding characteristic (as specificity etc.).Therefore, at same antigen, those skilled in the art need carry out a large amount of comparing repeatedly, screen and identify, just can find to be suitable for specificity bonded monoclonal antibody.The inventor has done a large amount of work, found anti-NP monoclonal antibody of the present invention (respectively by hybridoma cell strain S-200-23, S-290-3, S-171-9 produces), it has high specific in conjunction with the proteic ability of NP, and as seen its bonded is the antigenic determinant (epi-position) that is exposed to the surface on NP albumen (or containing this proteic mixture) space structure.And there is not cross reaction with other albumen beyond the NP albumen.

Antibody of the present invention is that avian influenza virus NP is had specific monoclonal antibody.Here, " specificity " is meant that described antibody capable is incorporated into NP albumen or its fragment; More particularly, refer to that those can combine with NP albumen or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.

Monoclonal antibody of the present invention can be utilized hybridoma technology to prepare (to see Kohler etc., Nature256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; Kohler etc., Eur.J.Immunol.6:292,1976; Hammerling etc., In Monoclonal Antibodies and T CellHybridomas, Elsevier, N.Y., 1981).The preparation method of a kind of hybridoma of monoclonal antibody of the present invention is: (1) utilizes anti-NP immune mouse; (2) separation is merged with the SP2/0 myeloma cell strain through the splenocyte of mice immunized; (3) add mouse peritoneal feeder cell and fused cell and cultivate altogether, and screen positive strain; (4) limiting dilution assay cloning screening, thus cell strain of monoclonal antibody obtained, and screening can be produced the cell strain of required monoclonal antibody from described cell strain.

Monoclonal antibody of the present invention can also be utilized NP gene product or fragment or functional zone, obtains by immunological technique.In addition, can also utilize recombinant methods or utilize Peptide synthesizer synthetic.Those skilled in the art all understand, learn described monoclonal antibody at the hybridoma cell line that has obtained described monoclonal antibody or by means such as order-checkings after, those skilled in the art can obtain described antibody easily.

As one embodiment of the present invention, described monoclonal antibody can be prepared by following preparation method, and described method comprises step: (1) provides adjuvant pretreated mouse; (2) the described hybridoma justacrine monoclonal antibody of inoculation in mouse peritoneal; (3) extract ascites, separate obtaining described monoclonal antibody.As a kind of mode, the separation monoclonal antibody method is from ascites: collect ascites, use through ammonium sulfate, sad precipitation, then with Protein G prepackage chromatography column purifying, obtain highly purified anti-NP monoclonal antibody.

In addition, also can be according to the Zooblast cultivation method of routine, the described hybridoma of cultured and amplified in vitro, thus make it to secrete described monoclonal antibody.

After having obtained anti-NP monoclonal antibody of the present invention, those skilled in the art can come delicately NP albumen and concentration thereof in the test sample by number of ways, and the technology of employing can be a technology commonly used in the field of immunology.

Detection kit

The invention provides a kind of detection kit whether test sample exists avian influenza virus that is used for, contain one or more anti-NP monoclonal antibodies of the present invention (respectively by hybridoma cell strain S-200-23, S-290-3, S-171-9 generation) in this test kit.

After having obtained anti-NP monoclonal antibody provided by the invention, can prepare the detection kit that is used for the specific detection avian influenza virus easily.Except containing anti-NP monoclonal antibody of the present invention, can also comprise other detection reagent or assistant agent in the described test kit, as developer, marker, two anti-, anti-antibody, sensitizer etc.Those skilled in the art should be understood that the detection kit of various versions all is included among the present invention, as long as wherein utilized anti-NP monoclonal antibody conduct of the present invention and NP specificity bonded reagent.

As a kind of optimal way of the present invention, the inventor has prepared a kind of test kit that is used to detect the NP protein level according to the double antibodies sandwich ratio juris.The way of double antibodies sandwich method routine is that coated antibody is fixed in carrier, coated antibody and antigen-reactive then, (described detection antibody carries detectable signal with detecting antibody response again after the washing, or can combine with the material that carries detectable signal), carry out chemoluminescence or enzyme connection color reaction detection signal at last.The double antibodies sandwich method is specially adapted to have the detection of antigens of two or more epi-positions.

The inventor finds, adopts anti-NP monoclonal antibody of the present invention and another kind of antibody (preferably a kind of anti-NP polyclonal antibody) with target antigen NP absorption and location, and its location and amplification effect are good, have good specificity and precision.

As the selectable detection mode of another kind, adopt indirect elisa method, with to be measured antigen coated on solid phase carrier, utilize monoclonal antibody of the present invention to detect NP.

Described coated antibody is coated on the solid phase carrier.The present invention has no particular limits the solid phase carrier that is adopted, if its can with monoclonal antibody of the present invention or polyclonal antibody coupling mutually (connection).For example, described solid phase carrier is selected from: microtiter plate (as 96 orifice plates) or microballoon etc.Described detection antibody can be monoclonal antibody of the present invention or polyclonal antibody.Monoclonal antibody of the present invention can be fixed on the solid phase carrier as coated antibody, be used as detecting antibody with the proteic polyclonal antibody of anti-NP; In addition, also can adopt the proteic polyclonal antibody of anti-NP, adopt monoclonal antibody of the present invention as detecting antibody as coated antibody.

Described polyclonal antibody can prepare by the method for routine, for example, can by will be described NP albumen import in the animal and obtain, for example with the virus immunity animal of NP albumen or deactivation.Immunization method can use the animal subcutaneous injection.Described animal can be selected from rabbit, sheep, ox etc.For example with 0.1mg/ immunize rabbit of NP albumen, cycle 1.5-4 of immunity month (preferred, as to be about 2 months), preferred interval 2-4 week repeats immunity; Can from intravenous rabbit blood, gather in the crops antiserum(antisera) and purifying then, obtain anti-NP polyclonal antibody.

As used herein, described " marker " be meant be used for determining detected sample NP existence whether and the mark of the amount that exists.After having determined the coated antibody that test kit of the present invention adopted and/or having detected antibody, can adopt this area routine to be used for the various markers that detect with the detection antibodies.The present invention has no particular limits the marker that is adopted, so long as can with described detection antibodies, and after suitably handling, can indicate exactly the proteic existence of NP in the detected sample whether and the marker of amount all are available.Described marker can directly be set at and detect on the antibody; Perhaps, described marker also can be set on the anti-antibody of the anti-detection of specificity antibody, and those skilled in the art can select suitable marker according to the kind and the characteristic of the antibody that is adopted.For example, described marker can be selected from: horseradish peroxidase (HRP), alkaline phosphatase (AP), glucose oxidase, beta-D-galactosidase, urase, catalase or glucoamylase.

When adopting some enzyme labelling things as implied above, also need to adopt some and corresponding enzyme bonded substrate, thereby can have situation or an amount by what modes such as colour developing were reported marker.As used herein, described " with the corresponding substrate of marker " is meant and can be labeled the catalysis colour developing of thing institute, be used for showing that the bonded recognition signal takes place for detection antibody and NP.Described substrate is for example: the O-Phenylene Diamine (OPD), tetramethyl benzidine (TMB), the ABTS that are used for horseradish peroxidase; Be used for alkaline phosphatase the p-nitrophenyl phosphoric acid ester (p-nitrophenyl phosphate, p-NPP); Or the like.Those skilled in the art can select suitable substrate according to the kind and the characteristic of the marker that is adopted.

In order to obtain quantitative result, the proteic standard substance of a plurality of NP that contain concentration known can be set in testing process.Method to set up for standard substance can adopt conventional method.

Utilize described standard substance, the following setting of typical curve: the OD value detected result with standard substance is ordinate zou (Y-axis), and standard substance concentration is that X-coordinate (X-axis) is depicted as and is used for the quantitative criterion curve.Thereby, detect the OD value that obtains according to testing sample, utilize typical curve can calculate the proteic concentration of NP in the testing sample.

In order to eliminate false positive and false negative, also Quality Control (contrast) can be set in testing process.

In addition, in order to make test kit of the present invention more convenient when detecting, preferably also comprise some other auxiliary reagent in the described test kit, described auxiliary reagent is conventional some reagent that use in the ELISA test kit, and the characteristic of these reagent and their compound method all are well-known to those skilled in the art.Described reagent is (but being not limited to) for example: developer, washings, stop buffer, enhanced sensitivity diluent.

In addition, in described test kit, also can comprise working instructions, be used to illustrate the using method of the reagent that wherein loads.

By enzyme linked immunological absorption (ELISA) experiment confirm, the avian influenza virus (A type influenza virus) of monoclonal antibody of the present invention and the deactivation of polyclonal antibody energy effective recognition.Prepared the ELISA test kit that can be used for the diagnosis of A type influenza virus thus.Its specificity and sensitivity all reach good requirement.

The inventor adopts the NP monoclonal antibody of this method development and the detection that the ELISA test kit can effectively be used for A type influenza virus, the specificity height, highly sensitive, weak point consuming time, cost is low, and operation is simple, can effectively A type influenza virus be diagnosed by rapid sensitive, with itself and B, the C type is distinguished by influenza virus.

Detect the method for avian influenza virus

After having obtained anti-NP monoclonal antibody provided by the invention and/or test kit, can utilize the panimmunity methods involving to come NP albumen or its content in the test sample, thereby whether the donor of learning testing sample infects bird flu, and these methods are all in the present invention involved.

As a kind of optimal way, the invention provides the method that a kind of external (non-diagnosis or therapeutic ground) detects avian influenza virus, may further comprise the steps:

(a) with the testing sample application of sample in the solid phase carrier that is coated with first antibody, thereby the avian influenza virus NP in the testing sample is combined with first antibody on the solid phase carrier, form the solid phase carrier that has " NP-first antibody " binary complex; Described first antibody is monoclonal antibody of the present invention (or polyclonal antibody of anti-avian influenza virus nucleoprotein);

(b) solid phase carrier that the second antibody application of sample is obtained in (a), thus the solid phase carrier that has " second antibody-NP-first antibody " ternary complex formed; Described second antibody is the polyclonal antibody (or monoclonal antibody of the present invention) of anti-NP and carries a marker;

(c) detect marker in the ternary complex, thus the existence of determining avian influenza virus NP in the detected sample whether with or the amount that exists, thereby the existence of determining avian influenza virus whether.

As the selectable detection mode of another kind, adopt indirect elisa method, may further comprise the steps:

(a1) with the testing sample bag by in solid phase carrier;

(a2) will detect the solid phase carrier of antibody application of sample, thereby make avian influenza virus NP in the testing sample and the detection antibodies on the solid phase carrier, form the solid phase carrier that has " NP-detects antibody " binary complex " in (a1); Described detection antibody is monoclonal antibody of the present invention, and described detection antibody carries a marker;

(a3) detect marker in the binary complex, the existence of determining avian influenza virus NP in the detected sample whether with or the amount that exists, thereby the existence of determining avian influenza virus whether.

In addition, also can monoclonal antibody of the present invention be come NP albumen or its content in the test sample as detecting antibody with the polyclonal antibody bag that resists NP by in solid phase carrier.

According to the method described above,, make concentration standard curve, by just can draw the NP content in the testing sample according to concentration standard curve as long as the antigen control of concentration known is set.

As a kind of optimal way of the present invention, the proteic method of detection by quantitative NP is specific as follows:

(i) antigen antibody reaction: anti-NP monoclonal antibody of the present invention is coated on the porous plate, in the different micropores of porous plate, adds standard substance, the quality control product (optional) of different concns afterwards respectively, or the test serum sample;

(ii) integrated enzyme reaction: with second antibody (its be provided with marker or can with the antibodies of carrying marker) solution adds each hole, vibrate, hatch, wash;

(iii) color reaction: every hole adds substrate, the developer corresponding to marker, hatches, and every hole adds reaction terminating liquid, finishes reaction;

(iv) microplate reader is measured the OD value;

(v) the result calculates:

A) production standard curve: with standard substance concentration is X-coordinate, and it is ordinate zou that standard substance are measured the OD value, makes typical curve;

B) pass judgment on quality control product concentration (optional):, read corresponding concentration value from typical curve according to the OD value of quality control product; When quality control product mensuration concentration value was in given range, this time measured effectively;

C) calculate testing sample concentration:, calculate the NP protein concentration of test serum sample from typical curve according to the OD value of sample to be tested when typical curve and quality control product (optional) are determined when effective.

As another kind of mode of the present invention, the proteic method of detection by quantitative NP is specific as follows:

(1) respectively with different concns NP standard substance and testing sample bag by solid phase carrier;

(2) on the solid phase carrier of bag quilt, adding monoclonal antibody of the present invention, be connected with marker on this monoclonal antibody or can be connected (comprising that also the adding marker makes it to be connected in this monoclonal antibody) with marker;

(3) adding is corresponding to substrate, the colour developing of marker;

(4) result calculates (with aforementioned).

Major advantage of the present invention is:

(1) providing a class the new monoclonal antibody specific at avian influenza virus NP, is in conjunction with the monoclonal antibody that exposes epi-position on the natural NP albumen space structure.

(2) described monoclonal antibody has sensitivity, special, characteristics that preparation cost is low, when being used to detect, need not testing sample is carried out the content that too much processing can detect NP in the sample easily, and with sample in other albumen no cross reaction.

(3) provide a kind of test kit based on described monoclonal antibody, described test kit sensitivity and accuracy are very high.And described test kit does not need treatment steps such as heating when operation, can measure quickly and accurately.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

The proteic prokaryotic expression of embodiment 1:NP

The inventor has obtained to contain the reorganization pGEM-T-vector carrier (washing one's hair bio tech ltd available from Shanghai English) of target gene fragment, is template with this carrier, with

CGCGGATCCATGGCGTCTCAAGGC (SEQ ID NO:3); With

CCGCTCGAGTTTAATTGTCATACTC(SEQ?ID?NO：4)

Be primer, by the pcr amplification proteic goal gene of NP that obtains encoding.The gene that obtains does not contain sudden change through sequence verification.

Primer by two ends interpolation BamH I and Xho I restriction enzyme site is connected to PGEX-4t-1 carrier (available from Novagen company) with above-mentioned cloned genes, obtains the PGEX-4t-1-NP recombinant plasmid.Again with this recombinant plasmid transformed in Rossetta expression type intestinal bacteria, under 0.5mM IPTG condition, induce, expressed proteins mainly is present in the supernatant.

Be expressed in the GST label purifying that the NP albumen in the supernatant carries by carrier, purification media adopts the product G lutathione Sepharose 4B of Pharmacia Corp.The protein concentration 2mg/ml of purifying is total to 6ml, 12mg.

With the NP-GST recombinant protein that obtains, by thrombin restriction enzyme site special on the recombinant protein, with thrombin enzyme (sigma company product) NP and GST albumen are cut, by GlutathioneSepharose 4B pearl with GST and NP albumen sepn, obtain the NP albumen of prokaryotic expression, concentration 1.5mg/ml is total to 7ml, about 10mg.The albumen size is as follows:

NP albumen size: 55KD;

NP-GST recombinant protein: 81-83KD.

Expression after NP protein induced expression front and back and enzyme are cut is seen Fig. 1.

The NP albumen pronucleus expression induces the expression before and after preceding, the ultrasonic broken cell to see Fig. 2.

Embodiment 2: animal immune

NP-GST fusion protein immunization mouse with purifying among the embodiment 1.Every of Balb/c mouse immune dosage: 0.1mg is each.The muscle multi-point injection.Immune programme for children: 0,3,6 weeks were carried out three immunity.Merge and got 0.1mg albumen abdominal injection in preceding 3 days, doing to recall stimulates.Get mouse resisting anteserum, how anti-can obtain mouse-anti NP.

NP protein immunization male New Zealand rabbit with purifying among the embodiment 1.Every of dosage: 1mg is each.Multi-point injection in the subcutaneous body.Immune programme for children: 0,3,6 week 3 immunity.Get antiserum(antisera), how anti-obtain the anti-NP of rabbit.

Embodiment 3: inactivated avian influenza virus (H5N1 strain) immunoblotting detects

Viral protein is provided by Wuhan virus behind deactivation bird flu (AIV) the H5N1 strain purifying.It is carried out immunoblotting detect with mouse-anti NP is how anti-.Experiment flow is as follows:

1.SDS-PAGE

Sample: the NP of prokaryotic expression and NP-GST recombinant protein; Inactivated avian influenza virus (H5N1 strain), the recombinant expressed bird flu HA albumen of protokaryon.

Applied sample amount: 5 μ l;

Upper strata glue: 3.5%, lower floor's glue: 12%, upper strata glue 100V 30 minutes, the glue 150V of lower floor 1 hour.

2. commentaries on classics film

Electric current: 200mA, 90 minutes.

3. sealing

3%BSA sealing 2 hours.

4. hybridization

One is anti-: be diluted in the corresponding confining liquid in equal 1: 5000,4 ℃ of hybridization are spent the night.

Anti-antibody: sheep anti mouse HRP (available from Sigma company), dilution in 1: 1000.All hybridized 1 hour.

5. colour developing

The how anti-Western trace of mouse confirmatory experiment.

Negative control (NC): HA albumen.

Interpretation of result as shown in Figure 3, cross reaction does not take place to HA in the NP albumen that the NP mouse is how anti-in can specific recognition deactivation AIV.Can begin to merge the preparation monoclonal antibody.

Embodiment 4: the structure of hybridoma cell strain and MONOCLONAL ANTIBODIES SPECIFIC FOR

Mouse is recalled stimulation and did fusion in back 3 days.The spleen cell and the rat bone marrow tumour cell SP2/0 that get immunity back mouse adopt the conventional fusion method of polyoxyethylene glycol (PEG) to do fusion.

Add the HAT selective medium after the fusion, the ELISA method is adopted in screening, and the antigen that is used for screening is the NP albumen of embodiment 1 purifying.Through 3 limiting dilution assay clonings screening, from many monoclonal antibody strains, select to obtain 6 strain monoclonal antibodies, comprise S-96-10, S-220-10, S-171-9, S-200-23, S-290-3, S-176-8.Further screen by following ELISA then.

1. indirect elisa method

By indirect elisa method, clone number is carried out the recognition effect checking for the antibody strain excretory antibody of S-171-9, S-200-23, S-220-10, S-290-3.

Bag quilt: wrap by 96 orifice plates concentration 10 μ g/ml with inactivated avian influenza virus (H5N1 strain).Positive control (PC): use prokaryotic expression recombinant NP albumen bag by 96 orifice plates, concentration 5 μ g/ml.After ordinary method is washed plate,, wash plate with the 5%BSA sealing.

Being added one anti-ly in each hole of antigenic 96 orifice plates at bag, is respectively S-171-9, S-200-23, S-220-10, S-290-3, according to the doubling dilution concentration gradient is: 1: 200, and 1: 400,1: 800,, 1: 102400.Ordinary method is washed plate.

Each Kong Zhongzai of 96 orifice plates through aforementioned processing adds sheep anti mouse anti-antibody 1: 5000, ordinary method washing, colour developing.

Found that S-220-10 excretory antibody can not be discerned the NP albumen in the avian influenza virus of deactivation, the identification of other 3 strain antibody is all right, sees Fig. 4 A-B.

2. sandwich assay

Coated antibody: be respectively 6 strain monoclonal antibodies of aforementioned acquisition, the clone number is respectively S-96-10, S-171-9, S-176-8, S-200-23, S-220-10, S-290-3; And it is how anti-.

Antigen: inactivated avian influenza virus albumen; Negative control (NC): detect protokaryon HA albumen.

Detect antibody: how anti-the anti-NP of enzyme mark rabbit is; Contrast: it is how anti-that enzyme is marked anti-H5N2 mouse.

The same indirect elisa method of others working method.

The results are shown in Figure 4C, visible S-96-10, S-220-10, S-176-8 are as coated antibody, and recognition effect is undesirable; And adopt the recognition effect of S-171-9, S-200-23, S-171-9 comparatively desirable.

As fully visible, except that S-220-10 excretory antibody can not be discerned albumen in the natural inactivation of viruses, other 5 strain excretory antibody all can be discerned.Found in+the experiment that many antienzymes mark detects that S-171-9, S-200-23, S-290-3 three strain antibody strain excretory antibody can successfully sandwich detections carrying out the monoclonal antibody bag, this three strain antibodies strain excretory monoclonal antibody can be discerned NP albumen, specificity height well.

Embodiment 5: the specific recognition compliance test result

Adopt sandwich method ELISA, step is as follows:

(1) bag quilt

Monoclonal antibody S-171-9, S-200-23 and S-290-3 were diluted (5 μ g/ml) with coating buffer by 1: 5000 respectively, and application of sample is in the hole of 96 orifice plates, and every hole adds 50 μ l, and 4 ℃ of bags are spent the night.

(2) sealing

Confining liquid: 3%BSA.

Every hole 100 μ l, 37 ℃ were sealed 2 hours.

(3) washing

Water washes every hole 10 times, adds washing lotion and soaks 3 minutes, discards washing lotion again, pats dry 96 orifice plates after repeating 1 time.

(4) add sample

Add inactivated avian influenza virus (H5N1 strain) in each hole, with confining liquid (5%BSA) dilution, concentration is respectively: 10 μ g/ml, 5 μ g/ml, 2.5 μ g/ml, 1 μ g/ml, 500ng/ml, 100ng/ml, 50ng/ml, 10ng/ml, 0.

Negative control: the bird flu HA albumen of prokaryotic expression, with confining liquid (5%BSA) dilution, concentration is respectively: 10 μ g/ml, 5 μ g/ml, 2.5 μ g/ml, 1 μ g/ml, 500ng/ml, 100ng/ml, 50ng/ml, 10ng/ml, 0.

Positive control: the NP albumen of prokaryotic expression.

Every hole 50 μ l were hatched 2 hours for 37 ℃.

(5) washing

Water washes every hole 10 times, adds washing lotion and soaks 3 minutes, discards washing lotion again, pats dry 96 orifice plates after repeating 1 time.

(6) add anti-antibody hybridization

How anti-ordinary method is with the rabbit of the aforementioned preparation of HRP mark, and how anti-the rabbit that obtains mark is.

The HRP enzyme is marked aforementioned anti-avian influenza virus NP rabbit anti-serum, and how the rabbit of mark was diluted in the confining liquid in anti-1: 1000, and every hole adds 50 μ l, hatches 2 hours for 37 ℃.

(7) washing

Water washes every hole 10 times, adds washing lotion and soaks 3 minutes, discards washing lotion again, pats dry 96 orifice plates after repeating 1 time.

(8) colour developing

Add substrate colour developing 5-8 minute, the OD450 reading.

The results are shown in Figure 5.Experimental result shows, the monoclonal antibody of inventor's preparation and polyclonal antibody can effectively be discerned the NP albumen in the avian influenza virus, can be by the NP albumen in the sandwich ELISA method identification avian influenza virus, and to other albumen nonrecognition in the avian influenza virus, the specificity height, rapid sensitive, operation is simple.S-171-9, S-200-23 detect lower limit and are about 5ug/ml, and the detection lower limit of S-290-3 is about 2.5 μ g/ml.

Embodiment 6: monoclonal antibody of the present invention is as the identification checking that detects antibody

Adopt the sandwich method ELISA method.Wrap quilt with the anti-NP of rabbit is how anti-, behind antigen-reactive, add monoclonal antibody of the present invention again, detect as detecting antibody.

1. bag quilt:

How anti-pressing with coating buffer diluted (5 μ g/ml) to the rabbit that purifying is good at 1: 2000, joins in 96 orifice plates, and every hole adds 50 μ l, and 4 ℃ of bags are spent the night.

2. sealing

Confining liquid: 3%BSA;

Every hole 100 μ l, 37 ℃ 2 hours.

3. washing

Water washes every hole 10 times, adds washing lotion and soaks 3 minutes, discards washing lotion again, pats dry 96 orifice plates after repeating once.

4. add antigen

Add inactivated avian influenza virus (H5N1 strain), with the confining liquid dilution, concentration is: 5 μ g/ml;

Negative control (NC): the bird flu HA albumen of prokaryotic expression, with the confining liquid dilution, concentration is: 5 μ g/ml;

Positive control (PC): the NP albumen of prokaryotic expression;

Every hole adds 50 μ l, 37 ℃ 2 hours.

5. washing

Water washes every hole 10 times, adds washing lotion and soaks 3 minutes, discards washing lotion again, pats dry 96 orifice plates after repeating once.

6. add and detect antibody hybridization

Add monoclonal antibody S-171-9, S-200-23 and S-290-3, by dilution in 1: 1000, every hole added 50 μ l with confining liquid, 37 ℃ 2 hours.

7. washing

Water washes every hole 10 times, adds washing lotion and soaks 3 minutes, discards washing lotion again, pats dry 96 orifice plates after repeating once.

8. add the hybridization of enzyme labelling anti-antibody

Add sheep anti mouse HRP, dilution in 1: 1000.Equal 37 ℃ of hybridization 1 hour.Wash plate.

9. colour developing

Add substrate colour developing 5-8 minute, the OD450 reading.

The results are shown in Figure 6, visible monoclonal antibody of the present invention also can be discerned NP albumen in the inactivated avian influenza virus well as detecting antibody.

Embodiment 7: the order-checking of monoclonal antibody of the present invention

To the monoclonal antibody of the present invention evaluation of checking order, wherein the heavy chain gene of S-200-23 antibody strain excretory monoclonal antibody is as follows:

Heavy chain leader sequence (signal peptide nucleotide sequence) (SEQ ID NO:1):

ATGGGATGGAGCTATATCATCCTCTTTTTGGTAGCAACAGCAACAGGTGTCCACTCC

Weight chain variable region nucleotide sequence (SEQ ID NO:2; Underscore is CDR1 successively, CDR2 and CDR3):

CAGGTCCAACTGCAGCAGTCTGGGACTGAACTGGTGAAGCCTGGGGCTTCAGTGAAGT

TGTCCTGCAAGGCTTCTGGCTACACCTTCACC AGCTACTATATGTACTGGGTGAAACA

GAGGCCTGGACAAGGCCTTGAGTTGATTGGA GAGATTGATCCTAGCAATGGTGGTA

CTAACTTCAATGAGAAGTTCAAGAGCAAGGCCACACTGACTGTAGACAAATCCTCCA

GCACATCATACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGT

TCAAGA TCCCGCTTCTATGATGGTTACCGGGGGTACTTCGATGTCTGGGGCGCAG

GGACCACGGTCACCGTCTCCTCA

Embodiment 8: test kit

With concentration (be dissolved in the carbonate coating buffer) coated elisa plate of S-200-23 antibody with 10 μ g/ml, 4 ℃ are spent the night.Wash plate with the ELISA washings; Seal 2h with 1%BSA in 37 ℃.Wash plate with the ELISA washings.

The enzyme plate of above-mentioned processing is dried, be loaded in the suitable packing, how anti-the anti-NP of rabbit of the aforementioned preparation of also packing into therein simultaneously is, and anti-rabbit enzyme mark anti-antibody, thereby obtain described test kit.

The biomaterial preservation

The hybridoma of the present invention's preparation is deposited in Chinese typical culture collection center (CCTCC, Chinese Wuhan), is respectively:

Hybridoma cell strain S-290-3: preserving number CCTCC NO:C200810; March 27 2008 preservation day;

Hybridoma cell strain S-171-9: preserving number CCTCC NO:C200811; March 27 2008 preservation day;

Hybridoma cell strain S-200-23: preserving number CCTCC NO:C200812; March 27 2008 preservation day.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉monoclonal antibody and the application thereof of the avian influenza virus NP in anti-H5N1 source

<130>082684

<160>4

<170>PatentIn?version?3.3

<210>1

<211>57

<212>DNA

＜213〉mouse (Mus musculus)

<400>1

atgggatgga?gctatatcat?cctctttttg?gtagcaacag?caacaggtgt?ccactcc 57

<210>2

<211>366

<212>DNA

＜213〉mouse (Mus musculus)

<400>2

caggtccaac?tgcagcagtc?tgggactgaa?ctggtgaagc?ctggggcttc?agtgaagttg 60

tcctgcaagg?cttctggcta?caccttcacc?agctactata?tgtactgggt?gaaacagagg 120

cctggacaag?gccttgagtt?gattggagag?attgatccta?gcaatggtgg?tactaacttc 180

aatgagaagt?tcaagagcaa?ggccacactg?actgtagaca?aatcctccag?cacatcatac 240

atgcagctca?gcagcctgac?atctgaggac?tctgcggtct?attactgttc?aagatcccgc 300

ttctatgatg?gttaccgggg?gtacttcgat?gtctggggcg?cagggaccac?ggtcaccgtc 360

tcctca 366

<210>3

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>3

cgcggatcca?tggcgtctca?aggc 24

<210>4

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>4

ccgctcgagt?ttaattgtca?tactc 25

Claims (10)

1. the monoclonal antibody of a specific specificity anti-avian influenza virus nucleoprotein is characterized in that, described monoclonal antibody is produced by the hybridoma cell strain that is selected from down group:

Preserving number is the hybridoma cell strain of CCTCC-C200812;

Preserving number is the hybridoma cell strain of CCTCC-C200811; Or

Preserving number is the hybridoma cell strain of CCTCC-C200810.

2. monoclonal antibody as claimed in claim 1 is characterized in that, preserving number is the heavy chain variable region gene that the monoclonal antibody of the hybridoma cell strain generation of CCTCC-C200812 has nucleotide sequence shown in the SEQ ID NO:2.

3. monoclonal antibody as claimed in claim 1 is characterized in that, preserving number is the heavy chain leader sequence that the monoclonal antibody of the hybridoma cell strain generation of CCTCC-C200812 has nucleotide sequence shown in the SEQ ID NO:1.

4. the purposes of the arbitrary described monoclonal antibody of claim 1-3 is characterized in that, is used to prepare the reagent or the test kit that detect avian influenza virus.

5. a hybridoma cell strain is characterized in that, described hybridoma cell strain is selected from:

Preserving number is the hybridoma cell strain of CCTCC-C200812;

Preserving number is the hybridoma cell strain of CCTCC-C200811; Or

Preserving number is the hybridoma cell strain of CCTCC-C200810.

6. a test kit that detects avian influenza virus is characterized in that, described test kit contains the described one or more monoclonal antibodies of claim 1.

7. test kit as claimed in claim 6 is characterized in that, described test kit contains:

Solid phase carrier is coated with first antibody on the described solid phase carrier, and this first antibody is the described monoclonal antibody of claim 1.

8. as claim 6 or 7 described test kits, it is characterized in that, also contain in the described test kit:

Second antibody, this second antibody are the polyclonal antibodies of anti-avian influenza virus nucleoprotein.

9. test kit as claimed in claim 6 is characterized in that, also contains in the described test kit:

Enzyme linked immunosorbent detection reagent.

10. the method for vitro detection avian influenza virus is characterized in that, may further comprise the steps:

(a) with the testing sample application of sample in the solid phase carrier that is coated with first antibody, thereby the avian influenza virus nucleoprotein in the testing sample is combined with first antibody on the solid phase carrier, form the solid phase carrier that has " nucleoprotein-first antibody " binary complex; Described first antibody is selected from the described monoclonal antibody of claim 1;

(b) solid phase carrier that the second antibody application of sample is obtained in (a), thus the solid phase carrier that has " second antibody-nucleoprotein-first antibody " ternary complex formed; Described second antibody is the polyclonal antibody of anti-avian influenza virus nucleoprotein; And described second antibody is carried a marker;

(c) detect marker in the ternary complex, the existence of determining avian influenza virus nucleoprotein in the detected sample whether with or the amount that exists, thereby the existence of determining avian influenza virus whether;

Perhaps, may further comprise the steps:

(a1) with the testing sample bag by in solid phase carrier;

(a2) will detect the solid phase carrier of antibody application of sample, thereby make avian influenza virus nucleoprotein in the testing sample and the detection antibodies on the solid phase carrier, form the solid phase carrier that has " nucleoprotein-detection antibody " binary complex " in (a1); Described detection antibody is selected from the described monoclonal antibody of claim 1, and described detection antibody carries a marker;

(a3) detect marker in the binary complex, the existence of determining avian influenza virus nucleoprotein in the detected sample whether with or the amount that exists, thereby the existence of determining avian influenza virus whether.

Images