CN101591327B - Benzene alkyl amides compound and usage thereof - Google Patents
Benzene alkyl amides compound and usage thereof Download PDFInfo
- Publication number
- CN101591327B CN101591327B CN200810038065XA CN200810038065A CN101591327B CN 101591327 B CN101591327 B CN 101591327B CN 200810038065X A CN200810038065X A CN 200810038065XA CN 200810038065 A CN200810038065 A CN 200810038065A CN 101591327 B CN101591327 B CN 101591327B
- Authority
- CN
- China
- Prior art keywords
- compound
- phenyl
- substituted
- benzo
- heterocyclic radical
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
Abstract
The invention relates to a substituted benzene alkyl amides compound, i.e. 4-(N-substituted amino-sulfonyl) benzene alkyl amide compound and a usage thereof. The inventor makes comprehensive use of CADD and SPR experiment based on Biacore, finds the substituted benzene alkyl amides compound and applies a reasonable drug design method to modify the structure of the substituted benzene alkyl amides compound so as to finally obtain the 4-(N-substituted amino-sulfonyl) benzene alkyl amide compound; after tests, the obtained 4-(N-substituted amino-sulfonyl) benzene alkyl amide compound inhibits the activity of falcipain-2 in in-vitro enzyme level experimental tests; and the result shows that the 4-(N-substituted amino-sulfonyl) benzene alkyl amide compound has strong falcipain-2 activity inhibiting capability and can be used for preparing medicaments for treating malaria caused by plasmodium.
Description
Technical field
The present invention relates to benzene alkyl amides compound and uses thereof, specifically, relate to a kind of substituted benzene alkyl amides compound, be 4-(N-replaces sulfamyl) benzene alkyl amides compound and uses thereof.
Background technology
Malaria is one of the most serious in the world prevailing disease.Have about 3,000,000,000 populations of more than 100 countries and regions to receive the threat of malaria, the annual malarial people in the whole world has 3.5 to 500,000,000, and the patient who dies from malaria every year is 150 to 2,700,000, and is interim, and half the approximately is children.Though there has been effective anti-malaria medicaments at present, malaria patients' mortality ratio still rises year by year, traces it to its cause, and mainly is that the plasmodium that causes malaria adapts to limited antimalarial agent, has promptly produced serious resistance.
Malaria control also depends on the prevention and the treatment of chemicals to a great extent.Over nearly more than 70 years, it is clinical to have only the minority medicine to be applicable to, and the strain of resistance plasmodium day by day increases.Continuous development along with related disciplines such as biological chemistry, molecular biology and molecular pharmacologies; Disclose the effect in the Biochemical processes in vivo of many enzymes and acceptor, carried out the development trend of new drug design having become new drug research exploitation with the enzyme that plays key effect in vivo as drug target.The develop rapidly of Along with computer technology and information science; Area of computer aided medicinal design (Computer-AidedDrug Design on the molecular structure basis; CADD) accelerated the new drug research process greatly; Not only emerge in large numbers the enzyme inhibitors of a large amount of determined curative effects, and deeply illustrated the biochemical reaction process that a lot of enzymes are participated in.The successful example of this respect gets more and more, and generally adopts the enzyme of known three-D space structure to carry out medicinal design.The design of novel medicine for parasitic disease is to be target spot with a kind of L-Cysteine HCL Anhydrous that in the plasmodium life cycle, plays an important role (falcipain), and what promote this evolution is people's deepening continuously to this drug targets understanding of papoid L-Cysteine HCL Anhydrous.Plasmodium is used for the protein synthesis of self as main origin of amino acid through the digestion red corpuscle.Known in the degradation process of oxyphorase, there are three kinds of plasmodium proteolytic enzyme to play an important role.Wherein plasmepain I and II belong to the asparagine pepsin, and falcipain belongs to L-Cysteine HCL Anhydrous.The aspartic acid proteinase inhibitor mainly acts on distinguish protozoon and EF; Cystatin mainly acts on the protozoon nourishing body, acts on the first step of red corpuscle degraded in the plasmodium life cycle specifically, makes plasmodium dead because of the free amino acid that lacks synthetic oneself protein; Chloroquine then suppresses the polymerization of free protoheme, and plasmodium is killed by a large amount of radicals that free hemn discharges.Obviously to kill plasmodial mechanism different with chloroquine for cystatin.Therefore select the target spot of L-Cysteine HCL Anhydrous, be expected to overcome the resistance problem of antimalarial agent as new antimalarial agent research.
L-Cysteine HCL Anhydrous is M
τBe about 21000～30000 protein, o'clock have the highest hydrolytic activity in pH 4～6.5, its reactive site has cysteine residues.Plasmodial L-Cysteine HCL Anhydrous belongs to papoid family.Known plasmodium L-Cysteine HCL Anhydrous has four hypotypes, falcipain-1, falcipain-2A, facipain-2B, falcipain-3.Falcipain1 is the plasmodium L-Cysteine HCL Anhydrous that first expression obtains, and its biological study shows that it is to plasmodial monogony stage did not influence, but the function of ability remarkable influence egg capsule.Falcipain-2A, falcipain-2B have 97% homology, and be only different 7 of aminoacid sequence.Monitoring through oligonucleotide probe finds that the expression level of falcipain-2B mRNA is lower than falcipain-2A.Yet falcipain-2A is very similar with peak value at the time-dependent manner of plasmodium nourishing body its expression in late period with falcipain-2B, and this shows that two kinds of different hypotypes have similar biological function.Falcipain-3 and falcipain-2 have 66.6% homology at catalytic domain, but the stage that they are expressed is different.Falcipain-2 reaches the climax at vegetative stage, and falcipain-3 is in that more the sophisticated plasmodium stage peaks.In these several kinds of hypotypes, maximum for the research of falcipain-2, so the exploitation of its suppressor factor also receives concern more widely.
In sum, as target, in conjunction with the biological activity test test of CADD and various levels, the micromolecular compound that designs and synthesizes has important practical significance to the exploitation antimalarial agent with L-Cysteine HCL Anhydrous falcipain-2.
Summary of the invention
Contriver's integrated use CADD of the present invention and based on the SPR of Biacore experiment; Found a kind of 4-(N-replaces sulfamyl) benzene alkane amide compound; And utilization rational drug method of design is carried out structural modification to kind of compound and is got 4-(N-replaces sulfamyl) benzene alkyl amides compound; Test gained 4-(N-replaces sulfamyl) benzene alkyl amides compound suppresses the activity of falcipain-2 in the horizontal experiment test of vitro enzyme; The result shows: 4-(N-the replaces sulfamyl) benzene alkyl amides compound of the present invention's design has stronger falcipain-2 and suppresses active, can be used for preparing the malaria treatment medicine that is caused by plasmodium.
The said 4-of the present invention (N-replaces sulfamyl) benzene alkyl amides compound, it has structure shown in the formula I:
Among the formula I: R
1Be hydrogen, C
1-C
6Saturated or the unsaturated alkyl of straight or branched, 5-7 unit aromatic base, group shown in substituted 5-7 unit's aromatic base or the formula (1):
In the formula (1): A is a 5-7 unit aromatic base, the first aromatic base of substituted 5-7,5-7 unit's heterocyclic radical or substituted 5-7 unit heterocyclic radical, m=1～6;
R
2Be hydrogen, C
1-C
6Saturated or the unsaturated alkyl of straight or branched, 5-7 unit aromatic base, the first aromatic base of substituted 5-7; 5-7 unit heterocyclic radical; Substituted 5-7 unit heterocyclic radical, and the 5-7 unit aromatic base of 5-7 unit heterocyclic radical is arranged, and group shown in 5-7 unit's heterocyclic radical or the formula (1) of 5-7 unit aromatic base is arranged;
n＝0～3；
Wherein: the substituting group in said substituted 5-7 unit's aromatic base and the substituted 5-7 unit heterocyclic radical is selected from: halogen (F, Cl, Br or I), C
1-C
6Alkoxyl group, hydroxyl, phenyl, C
1-C
6The straight or branched alkyl, C
1-C
4Unsaturated-oxyl, carboxyl, ester group, C
1-C
6The carboxyl alkoxyl group, C
1-C
6The ester group alkoxyl group, C
1-C
6Carboxyalkyl, C
1-C
6The ester group alkyl, cyanic acid, nitro, amino, methylol, trifluoromethyl, trifluoromethoxy, sulfydryl or C
1-C
4A kind of in the acyl group, two kinds or two or more; Substituent number is 1-4;
That heteroatoms in the said 5-7 unit heterocyclic radical is selected from is a kind of in oxygen, sulphur or the nitrogen, two kinds or two or more, the heteroatoms number is 1-3.
In optimal technical scheme of the present invention, R
1Be 5-7 unit aromatic base, group shown in substituted 5-7 unit's aromatic base or the formula (1);
Wherein: A is 5-7 unit's aromatic base or substituted 5-7 unit aromatic base, m=1～3; Substituting group in the first aromatic base of said substituted 5-7 is halogen (F, Cl, Br or I) or C
1-C
6Alkoxyl group, substituent number are 1-3.
Preferred R
1Be group shown in substituted 6 yuan of aromatic bases or the formula (1);
Wherein: A is 6 yuan of aromatic bases, m=1～3; Substituting group in said substituted 6 yuan of aromatic bases is halogen (F, Cl, Br or I) or C
1-C
6Alkoxyl group, substituent number are 1-3.
Best R
1Be group shown in substituted-phenyl or the formula (1);
Wherein: A is a phenyl, and m is 1 or 2; The substituting group of said substituted-phenyl is halogen (F, Cl, Br or I) or C
1-C
3Alkoxyl group, substituent number are 1-3.Concrete as: benzyl, styroyl, 3,4-Dimethoxyphenyl or 4-fluorophenyl etc.
In another optimal technical scheme of the present invention, R
2Be 5-7 unit aromatic base, substituted 5-7 unit aromatic base, 5-7 unit heterocyclic radical, substituted 5-7 unit heterocyclic radical, and the 5-7 unit aromatic base of 5-7 unit heterocyclic radical is arranged, and group shown in 5-7 unit's heterocyclic radical or the formula (1) of 5-7 unit aromatic base is arranged;
Wherein: A is 5-7 unit's heterocyclic radical or substituted 5-7 unit heterocyclic radical, m=1～3; Substituting group in described substituted 5-7 unit's aromatic base and the substituted 5-7 unit heterocyclic radical is selected from: halogen (F, Cl, Br or I), C
1-C
6Alkoxyl group, C
1-C
6Alkyl, a kind of in hydroxyl or the phenyl, two or more, substituent number is 1-4;
The implication of heterocyclic radical is said identical with preamble.
Preferred R
2Be substituted 6 yuan of aromatic bases, 5-6 unit heterocyclic radical, substituted 5-6 unit heterocyclic radical, and 6 yuan of aromatic bases of 5-6 unit heterocyclic radical are arranged, and group shown in 5-6 unit's heterocyclic radical or the formula (1) of 6 yuan of aromatic bases is arranged;
Wherein: A is 5-6 unit's heterocyclic radical or substituted 5-6 unit heterocyclic radical, m=1～3; Substituting group in described substituted 6 yuan of aromatic bases and the substituted 5-6 unit heterocyclic radical is selected from: halogen (F, Cl, Br or I), C
1-C
3Alkoxyl group, C
1-C
3Alkyl, a kind of in hydroxyl or the phenyl, two or more, substituent number is 1-3.The implication of heterocyclic radical is said identical with preamble.
Best R
2Be substituted phenyl, 5-6 unit heterocyclic radical, substituted 5-6 unit heterocyclic radical, and the phenyl of 5-6 unit heterocyclic radical is arranged, group shown in benzo 5-6 unit's heterocyclic radical or the formula (1);
Wherein: A is 5-6 unit's heterocyclic radical or substituted 5-6 unit heterocyclic radical, and m is 1 or 2; Substituting group in described substituted phenyl and the substituted 5-6 unit heterocyclic radical is selected from: halogen (F, Cl, Br or I), C
1-C
3Alkoxyl group, C
1-C
3Alkyl, a kind of in hydroxyl or the phenyl, two or more, substituent number is 1-3.The implication of heterocyclic radical is said identical with preamble.
The present invention recommends the R that uses
2For: benzo [1,4] dioxane-6-base, benzo [1,3] dioxolane-5-base; Benzo [d] thiazol-2-yl, thiazole-2-methyl, pyridine-2-methyl, 5-ethyl-1; 3,4-thiadiazoles-2-base, 3; The 4-dimethoxy phenyl, 3-hydroxyl-4-methoxyphenyl, 3-chloro-4-fluorophenyl or 4-phenyl thiazole-2-base.
The compound that the present invention designed can be used as the micromolecular inhibitor of plasmodium falcipain-2, and it influences the degraded of plasmodium to host hemoglobin, thereby block plasmodial life cycle through blocking-up plasmodium falcipain-2 catalytic activity.Therefore compound of the present invention can be developed into and is new antimalarial agent.
Description of drawings
Positive contrast of Fig. 1 (Z-Phe-Arg-pNA.HCl) and compound I
A-1 with the sensing figure of FP-2 protein-interacting,
Wherein the compound concentration represented from top to bottom of each bar line is followed successively by 1 * 10
-5M, 5 * 10
-6M, 2.5 * 10
-6M, 1.25 * 10
-6M, 6.25 * 10
-7M, 3.125 * 10
-7M and 0.
Fig. 2. compound I
A-3, compound I
A-6, compound I
A-10 and compound I
A-13 IC
50The value curve.
Embodiment
The method of a kind of preparation 4-of the present invention (N-replaces sulfamyl) benzene alkyl amides compound (structure is suc as formula shown in the I), its synthesis strategy is as follows:
With
R wherein
1And R
2Definition said identical with preamble, n is 1,2 or 3.
Specifically comprise the steps:
I
ASynthetic:
1) benzene substituted fatty acid and the catalytic amount vitriol oil are put into refluxed 10～24 hours in the methanol solution; Steam and remove most of solvent, add water, organic solvent extraction 3 times merges organic phase, and water and sodium hydrogen carbonate solution are washed successively, drying, and solvent evaporated obtains benzene substituted fatty acid methyl esters (II);
2) drip chlorsulfonic acid to benzene substituted fatty acid methyl esters (II), the control rate of addition keeps reacting liquid temperature not to be higher than 40 ℃, stirs 1～5 hour; In reaction solution impouring frozen water, organic solvent extraction, washing; Drying, solvent evaporated obtains 4-chlorosulfonyl benzene substituted fatty acid methyl esters (III).
3) under 20 ℃ of-30 ℃ of conditions, R
1Replace amine (R
1NH
2) in pyridine solution, react with 4-chlorosulfonyl benzene substituted fatty acid methyl esters (III), temperature stirred 12-36 hour at 40 ℃-45 ℃.In reaction solution impouring water, organic solvent extraction, the organic layer that obtains filter through drying, remove solvent under reduced pressure, and the resistates column chromatography for separation gets 4-(N-R
1Replace sulfamyl) benzene substituted fatty acid methyl esters (IV).
4) with 4-(N-R
1The replacement sulfamyl) benzene substituted fatty acid methyl esters (IV) and mineral alkali are put into (V/V=3/1) in an amount of THF/methyl alcohol mixed liquor; 20 ℃-30 ℃ were stirred 10-24 hour, removed solvent under reduced pressure, and resistates adds water; Transfer pH=2～3 with Hydrogen chloride; Separate out a large amount of solids, suction filtration, wash 4-(N-R
1Replace sulfamyl) benzene substituted fatty acid (V).
5) with 4-(N-R
1The replacement sulfamyl) benzene substituted fatty acid (V) and chlorinating agent are dissolved in the inert solvent, and 30 ℃-70 ℃ were stirred 2-10 hour, concentrating under reduced pressure, and resistates dissolves with a small amount of exsiccant methylene dichloride.Above-mentioned solution under 20 ℃ of-30 ℃ of stirrings, is splashed into R
2Replace amine (R
2NH
2) the pyridine mixing solutions in.20 ℃-30 ℃ reactions 12-24 hour add water, and organic solvent extraction, the organic layer that obtains be through drying, filters, and removes solvent under reduced pressure, the resistates column chromatography for separation get target compound 4-(N '-R
1Replace sulfamyl)-N-R
2Substituted benzene replaces fatty amide (I
A), one of target compound.
With
I
BSynthetic:
1) p-methyl benzenesulfonic acid and Pottasium Hydroxide is soluble in water, under 80 ℃ of stirrings of temperature control, drip the aqueous solution of potassium permanganate, finish, in reaction solution, add adequate amount of ethanol, to filter, filtrating concentrates to carboxyl Phenylsulfonic acid potassium (VI).
2) to carboxyl Phenylsulfonic acid potassium (VI) is dripped chlorsulfonic acid, the control rate of addition keeps reacting liquid temperature not to be higher than 30 ℃, stirred 1-5 hour, and in reaction solution impouring frozen water, suction filtration, washing obtains 4-chlorosulfonyl phenylformic acid (VII).
3) R under the room temperature
1Replace amine (R
1NH
2) in pyridine solution, react with 4-chlorosulfonyl phenylformic acid (VII), temperature stirred 12-36 hour at 40 ℃-45 ℃.In reaction solution impouring water, organic solvent extraction, the organic layer that obtains filter through drying, remove solvent under reduced pressure, and the resistates column chromatography for separation gets 4-(N-R
1Replace sulfamyl) phenylformic acid (VIII).
4) with 4-(N-R
1The replacement sulfamyl) phenylformic acid (VIII) and chlorinating agent are dissolved in the inert solvent, and 30 ℃-70 ℃ were stirred 2-10 hour, concentrating under reduced pressure, and resistates dissolves with a small amount of exsiccant methylene dichloride.Above-mentioned solution under stirring at room, is splashed into R
2Replace amine (R
2NH
2) the pyridine mixing solutions in.Room temperature reaction 12-24 hour, add water, organic solvent extraction, the organic layer that obtains be through drying, filters, and removes solvent under reduced pressure, the resistates column chromatography for separation get target compound 4-(N '-R
1Replace sulfamyl)-N-R
2Substituted benzamide (I
B), two of target compound.
Through embodiment the present invention is done further elaboration below.These embodiment only are used for better understanding content of the present invention, the protection domain that it does not limit the present invention in any way.
Embodiment 1
The preparation of 3-phenylpropionic acid methyl esters (compound I I-1)
3.0 gram 3-phenylpropionic acids are dissolved in the 50mL round-bottomed flask that the 30mL anhydrous methanol is housed, are heated to 70 ℃ of backflows, be cooled to 20 ℃-30 ℃ then; Be controlled at this temperature; Under stirring the 1mL vitriol oil is slowly dropped in the reaction solution, be warming up to 70 ℃, refluxed 5 hours.Underpressure distillation removes and desolvates, and adds 30mL ETHYLE ACETATE, uses zero(ppm) water (10mL * 3) successively; 5% sodium hydrogencarbonate (10mL * 3), zero(ppm) water (10mL * 3) is washed, and ethyl acetate layer is used anhydrous magnesium sulfate drying; Filter; Removal of solvent under reduced pressure gets 3-phenylpropionic acid methyl esters (II-1) 2.9 grams, is colourless liquid, yield 88%.MS(EI)m/z?164(M
+)。
Embodiment 2
The preparation of 3-(4-chlorosulfonyl phenyl) methyl propionate (compound III-1)
The 5.5mL chlorsulfonic acid dropwise is added drop-wise in the 2.9 gram 3-phenylpropionic acid methyl esters (II-1), and the control rate of addition keeps reacting liquid temperature not to be higher than 40 ℃, finishes and continues stirring reaction 1.5 hours.In reaction solution impouring 80mL frozen water, dichloromethane extraction (30mL * 3) is used salt solution (10mL * 3) successively; Zero(ppm) water (10mL * 3) is washed; Organic phase is used anhydrous magnesium sulfate drying, filters, and removal of solvent under reduced pressure gets 3.3 gram 3-(4-chlorosulfonyl phenyl) methyl propionates (III-1); Be white solid, yield 72%.mp?62-64℃；MS(EI)m/z?262(M
+)。
Embodiment 3
The preparation of 3-(4-(N-styroyl-sulfamyl) phenyl) methyl propionate (compound IV-1)
1.0 gram 2-phenyl-ethyl amines are joined in the pyridine of 20mL, and 20 ℃ of-30 ℃ of stirrings join 1.0 gram 3-(4-chlorosulfonyl phenyl) methyl propionates (III-1) in the reaction solution in batches; Finish, continued stirring reaction 2 hours, removal of solvent under reduced pressure; Add suitable quantity of water and use dichloromethane extraction, use 6N hydrochloric acid successively, washing; Methylene dichloride is used anhydrous magnesium sulfate drying, filters, and removal of solvent under reduced pressure gets 0.78 gram 3-(4-(N-styroyl-sulfamyl) phenyl) methyl propionate (IV-1); Be light yellow liquid, yield 60%.MS(EI)m/z?347(M
+)。
Embodiment 4
The preparation of 3-(4-(N-styroyl-sulfamyl) phenyl) propionic acid (compound V-1)
0.70 gram 3-(4-(N-styroyl-sulfamyl) phenyl) methyl propionate (IV-1) is dissolved in the mixed solvent (V/V=3: 1), add 0.20 gram LiOH.H of 15mL THF and methyl alcohol
2O, 20 ℃-30 ℃ were stirred 10 hours, and the evaporated under reduced pressure solvent adds suitable quantity of water, transfers pH=2.5 with Hydrogen chloride, separates out solid, and suction filtration gets 0.49 gram 3-(4-(N-styroyl-sulfamyl) phenyl) propionic acid (V-1), is light yellow solid, yield 75%.mp?114-116℃；MS(EI)m/z?333(M
+)；
1H-NMR(CDCl
3，500MHz)δ2.69(t，2H)，2.78(t，2H)，3.04(t，2H)，3.23(t，2H)，7.09(m，2H)，7.23(m，1H)，7.29(m，2H)，7.34(d，2H)，7.74(d，2H)。
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(benzo [1,4] dioxane-6-yl) propionic acid amide (compound I
AA kind of (I
A-1) preparation)
0.33 gram 3-(4-(N-styroyl-sulfamyl) phenyl) propionic acid (V-1) is dissolved in the 20mL methylene dichloride, and ice bath stirs, and under nitrogen protection, 0.24 gram oxalyl chloride is added drop-wise in the reaction solution, finishes; Stirring reaction 1.5 hours, the evaporated under reduced pressure solvent gets yellow oily liquid, dissolves with the 5mL methylene dichloride; Drop in the reaction flask that 0.15 gram benzo [1,4] dioxane-6-amine and 20mL pyridine are housed, finish; 20 ℃-30 ℃ were stirred 2 hours, and removal of solvent under reduced pressure is used dichloromethane extraction; Washing (10mL * 3), anhydrous magnesium sulfate drying filters; Concentrating under reduced pressure, resistates column chromatography for separation (eluent: ethyl acetate/petroleum ether=1: 1), get 0.28 gram white solid (I
A-1), yield 61%.mp?132-134℃；
1H-NMR(CDCl
3，500MHz)δ2.64(t，2H)，2.77(t，2H)，3.12(t，2H)，3.23(t，2H)，4.23(m，4H)，4.35(br，1H)，6.82(m，2H)，7.08(m，4H)，7.28(m，2H)，7.54(d，2H)，7.71(d，2H)；MS(EI)m/z?466(M
+)。
Embodiment 6
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(benzo [1,3] dioxolane-5-yl) propionic acid amide (compound I
AA kind of (I
A-2) preparation)
Benzo [1,4] dioxane-6-amine is replaced to benzo [1,3] dioxolane-5-amine, and all the other desired raw materials, reagent and preparation method get pale solid with embodiment 5.mp?141-144℃；
1H-NMR(CDCl
3，400MHz)δ2.66(t，2H)，2.77(t，2H)，3.16(t，2H)，3.24(t，2H)，4.37(br，1H)，5.94(s，2H)，6.71(m，2H)，7.11(t，3H)，7.29(m，3H)，7.39(d，2H)，7.72(d，2H)；MS(EI)m/z?452(M
+)。
Embodiment 7
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(benzo [d] thiazol-2-yl) propionic acid amide (compound I
AA kind of (I
A-3) preparation)
Benzo [1,4] dioxane-6-amine is replaced to benzo [d] thiazole-2-amine, and all the other desired raw materials, reagent and preparation method get white solid with embodiment 5.mp?141-144℃；
1H-NMR(CDCl
3，400MHz)δ2.65(t，2H)，2.82(t，2H)，2.93(m，2H)，3.04(t，2H)，7.12(d，2H)，7.16(t，1H)，7.25(m，2H)，7.31(t，1H)，7.46(m，3H)，7.65(t，1H)，7.72(t，3H)，7.96(d，1H)，12.38(s，1H)；MS(EI)m/z?465(M
+)。
Embodiment 8
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(thiazole-2-methyl) propionic acid amide (compound I
AA kind of (I
A-4) preparation)
Benzo [1,4] dioxane-6-amine is replaced to thiazole-2-methylamine, and all the other desired raw materials, reagent and preparation method get white solid with embodiment 5.mp?97-98℃；
1H-NMR(DMSO-d
6，400MHz)δ2.45(t，2H)，2.67(t，2H)，2.93(m，4H)，4.38(d，2H)，6.84(d，1H)，6.90(q，1H)，7.16(t，2H)，7.19(d，1H)，7.27(t，2H)，7.32(q，1H)，7.39(d，2H)，7.66(m，3H)，8.47(t，1H)；MS(EI)m/z?428(M
+)。
Embodiment 9
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(pyridine-2-methyl) propionic acid amide (compound I
AA kind of (I
A-5) preparation)
Benzo [1,4] dioxane-6-amine is replaced to pyridine-2-methylamine, and all the other desired raw materials, reagent and preparation method get white solid with embodiment 5.mp?121-123℃；
1H-NMR(CDCl
3，400MHz)δ2.52(t，2H)，2.68(t，2H)，2.94(q，2H)，4.31(d，2H)，7.00(d，1H)，7.14(t，2H)，7.15-7.27(m，4H)，7.42(d，2H)，7.68(m，4H)8.45(m，2H)；MS(EI)m/z?423(M
+)。
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(5 '-ethyl-1 ', 3 ', 4 '-thiadiazoles-2-yl) propionic acid amide (compound I
AA kind of (I
A-6) preparation)
Benzo [1,4] dioxane-6-amine is replaced to 5-ethyl-1,3,4-thiadiazoles-2-amine, all the other desired raw materials, reagent and preparation method get white solid with embodiment 5.mp?185-188℃；
1H-NMR(CDCl
3，400MHz)δ1.28(t，3H)，2.66(t，2H)，2.82(t，2H)，3.00(m，6H)，7.12(d，2H)，7.18(t，1H)，7.26(t，2H)，7.43(d，2H)，7.68(m，3H)，12.41(s，1H)；MS(EI)m/z?444(M
+)。
Embodiment 11
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(3 ', 4 '-dimethoxy phenyl) propionic acid amide (compound I
AA kind of (I
A-7) preparation)
Benzo [1,4] dioxane-6-amine is replaced to 3, the 4-dimethoxyaniline, all the other desired raw materials, reagent and preparation method get white solid with embodiment 5.mp?145-148℃；
1H-NMR(CDCl
3，400MHz)δ2.66(m，4H)，2.98(m，4H)，3.69(s，6H)，6.84(d，1H)，7.04(d，1H)，7.12(d，2H)，7.19(d，1H)，7.24(m，3H)，7.44(d，2H)，7.69(m，3H)，9.77(s，1H)；MS(EI)m/z?468(M
+)。
Embodiment 12
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(3 '-hydroxyl-4 '-methoxyphenyl) propionic acid amide (compound I
AA kind of (I
A-8) preparation)
Benzo [1,4] dioxane-6-amine is replaced to 3-hydroxyl-4-anisidine, and all the other desired raw materials, reagent and preparation method get white solid with embodiment 5.mp?115-120℃；
1H-NMR(DMSO-d
6，400MHz)δ2.60(t，2H)，2.66(t，2H)，2.96(m，4H)，3.67(s，3H)，6.78(d，1H)，6.88(q，1H)，7.12(m，3H)，7.18(t，1H)，7.26(m，2H)，7.44(d，2H)，7.65(t，1H)，7.70(d，2H)，9.00(s，1H)，9.65(s，1H)；MS(EI)m/z?454(M
+)。
Embodiment 13
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(3 '-chloro-4 '-fluorophenyl) propionic acid amide (compound I
AA kind of (I
A-9) preparation)
Benzo [1,4] dioxane-6-amine is replaced to 3-chloro-4-fluoroaniline, and all the other desired raw materials, reagent and preparation method get white solid with embodiment 5.mp?156-157℃；
1H-NMR(CDCl
3，400MHz)δ2.67(m，4H)，2.93(m，2H)，2.99(m，2H)，7.12(d，2H)，7.18(t，1H)，7.25(m，2H)，7.34(t，1H)，7.45(m，3H)，7.69(m，3H)，7.90(q，1H)，10.14(s，1H)；MS(EI)m/z?460(M
+)。
Embodiment 14
3-(4-(N '-styroyl-sulfamyl) phenyl)-N-(4 '-phenyl thiazole-2-yl) propionic acid amide (compound I
AA kind of (I
A-10) preparation)
Benzo [1,4] dioxane-6-amine is replaced to 4-phenyl thiazole-2-amine, and all the other desired raw materials, reagent and preparation method get white solid with embodiment 5.mp?119-121℃；
1H-NMR(CDCl
3，400MHz)δ2.77(t，4H)，3.08(t，2H)，3.18(t，2H)，4.83(t，1H)，7.02(d，2H)，7.12(s，1H)，7.18-7.25(m，5H)，7.39(m，3H)，7.72(t，4H)；MS(EI)m/z?491(M
+)。
Embodiment 15
3-(4-(N '-((3 ", 4 "-dimethoxy) phenyl) sulfamyl) phenyl)-N-(benzo [1,4] dioxane-6-yl) propionic acid amide (compound I
AA kind of (I
A-11) preparation)
The 2-phenyl-ethyl amine is replaced to 3, the 4-dimethoxyaniline, all the other desired raw materials, reagent and preparation method get white solid with embodiment 3～～5.mp?186-189℃；
1H-NMR(CDCl
3，400MHz)δ2.58(t，2H)，2.93(t，2H)，3.58(s，3H)，3.63(s，3H)，4.20(q，4H)，6.52(m，1H)，6.63(d，1H)，6.75(q，2H)，6.90(q，1H)，7.18(d，1H)，7.39(d，2H)，7.61(d，2H)；MS(EI)m/z?498(M
+)。
Embodiment 16
3-(4-(N '-(phenmethyl) sulfamyl) phenyl)-N-(benzo [1,3] dioxolane-5-yl) propionic acid amide (compound I
AA kind of (I
A-12) preparation)
2-phenyl-ethyl amine and benzo [1,4] dioxane-6-amine are replaced to benzylamine and benzo [1,3] dioxolane-5-amine respectively, and all the other desired raw materials, reagent and preparation method get white solid with embodiment 3～5.mp?174-176℃；
1H-NMR(DMSO-d
6，400MHz)δ2.62(t，2H)，2.97(t，2H)，3.93(d，2H)，5.96(s，2H)，6.83(d，1H)，6.90(q，1H)，7.21(m，3H)，7.28(m，3H)，7.43(d，2H)，7.71(d，2H)，8.09(t，1H)，9.80(s，1H)；MS(EI)m/z?438(M
+)。
Embodiment 17
3-(4-(N '-(4 "-fluorophenyl) sulfamyl) phenyl)-N-(5 '-ethyl-1 ', 3 ', 4 '-thiadiazoles-2-yl) propionic acid amide (compound I
AA kind of (I
A-13) preparation)
2-phenyl-ethyl amine and benzo [1,4] dioxane-6-amine are replaced to 4-fluoroaniline and 5-ethyl-1,3 respectively, 4-thiadiazoles-2-amine, all the other desired raw materials, reagent and preparation method get white solid with embodiment 3～5.mp?235-239℃；
1H-NMR(DMSO-d
6，400MHz)δ1.29(t，3H)，2.77(t，2H)，2.99(m，4H)，7.06(d，4H)，7.41(d，2H)，7.63(d，2H)，10.20(s，1H)，12.40(s，1H)；MS(EI)m/z?434(M
+)。
Embodiment 18
2-(4-(N '-styroyl-sulfamyl) phenyl)-N-(benzo [1,4] dioxane-6-yl) ethanamide (compound I
AA kind of (I
A-14) preparation)
The 3-phenylpropionic acid is replaced to toluylic acid, and all the other desired raw materials, reagent and preparation method get white solid with embodiment 1～5.mp?91-92℃；
1H-NMR(DMSO-d
6，400MHz)δ2.67(t，2H)，2.94(t，2H)，3.68(s，2H)，4.17(m，4H)，6.76(d，1H)，6.95(m，1H)，7.10-7.22(m，6H)，7.50(m，2H)，7.75(m，2H)；MS(EI)m/z?452(M
+)。
Embodiment 19
Preparation to carboxyl Phenylsulfonic acid potassium (compound VI)
1.7 gram p-methyl benzenesulfonic acids and 0.68 gram Pottasium Hydroxide are dissolved in the 15mL water, under 80 ℃ of stirrings of temperature control, the aqueous solution of dropping potassium permanganate (1.6 grams/13mL); Finish, in reaction solution, add 20mL ethanol, filter; Filtrating concentrates to carboxyl Phenylsulfonic acid potassium (VI) 1.2 grams, yield 51%.Directly be used for step reaction down.
The preparation of 4-chlorosulfonyl phenylformic acid (compound VI I)
In 1.2 restrain carboxyl Phenylsulfonic acid potassium (VI), drip the 4mL chlorsulfonic acid, the control rate of addition keeps reacting liquid temperature not to be higher than 30 ℃, finishes; Continue to stir 2 hours, in reaction solution impouring frozen water, suction filtration; Washing obtains 4-chlorosulfonyl phenylformic acid (VII) 0.22 gram, is white solid, yield 20%.mp?230-232℃。
Embodiment 21
The preparation of 4-(N-styroyl-sulfamyl) phenylformic acid (compound VIII-1)
0.13 gram 2-phenyl-ethyl amine is joined in the pyridine of 5mL, and stirring at room joins 0.22 gram 4-chlorosulfonyl phenylformic acid (VII) in the reaction solution in batches, finishes; Continued stirring reaction 12 hours, removal of solvent under reduced pressure adds suitable quantity of water and uses dichloromethane extraction; Use 6N hydrochloric acid successively, washing, methylene dichloride is used anhydrous magnesium sulfate drying; Filter concentrating under reduced pressure, resistates column chromatography for separation (eluent: ethyl acetate/petroleum ether=1: 2); Get 4-(N-styroyl-sulfamyl) phenylformic acid (compound VIII-1) 0.15 gram, be white solid, yield 50%.
1H-NMR(DMSO-d
6，400MHz)δ2.65(t，2H)，2.99(t，2H)，7.19(m，3H)，7.26(m，2H)，7.90(d，2H)，8.10(d，2H)。
Embodiment 22
4-(N '-styroyl-sulfamyl)-N-(benzo [1,4] dioxane-6-yl) BM (compound I
BA kind of (I
B-1) preparation)
0.15 gram 4-(N-styroyl-sulfamyl) phenylformic acid (compound VIII-1) is dissolved in the 20mL methylene dichloride, and ice bath stirs, and under nitrogen protection, 0.24 gram oxalyl chloride is added drop-wise in the reaction solution, finishes; Stirring reaction 1.5 hours, the evaporated under reduced pressure solvent gets yellow oily liquid, dissolves with the 5mL methylene dichloride; Drop in the reaction flask that 0.15 gram benzo [1,4] dioxane-6-amine and 10mL pyridine are housed, finish; Stirring at room 2 hours, removal of solvent under reduced pressure is used dichloromethane extraction; Washing (10mL * 3), anhydrous magnesium sulfate drying filters; Concentrating under reduced pressure, resistates column chromatography for separation (eluent: ethyl acetate/petroleum ether=1: 1), get 0.062 gram light yellow solid (I
B-1), yield 29%.mp?135-138℃；
1H-NMR(CDCl
3，500MHz)δ2.72(t，2H)，2.99(t，2H)，4.24(m，4H)，6.83(d，1H)，7.19(m，4H)，7.27(m，2H)，7.37(d，1H)，7.90(m，3H)，8.07(d，2H)，10.28(s，1H)；MS(EI)m/z?438(M
+)。
Embodiment 23
The compounds of this invention I
A-1 combines determination of activity with Falcipain-2 proteolytic enzyme:
Falcipain-2 proteolytic enzyme and I
A-1 combine active screening and kinetic constant mensuration based on SPR (surface plasma resonance) principle, the instrument of use be Biacore 3000 (Biacore AB, Uppsala, Sweden).
(1) structure of Falcipain-2 plasmid (pQE30-Fal2)
According to Falcipain-2 cDNA sequences Design primer; Forward and reverse primer are respectively 5 ' CGTGGATCCCAAATGAATTATGAAG3 ' and 5 ' ATATGTCGACTTATTCAATTAATGGAATG3 '; Comprise BamH I and Sal I restriction enzyme site; Through pcr amplification Falcipain-2 fragment, the PCR product after enzyme cut is connected the back and identifies correctly with expression vector pQE30, be transformed into intestinal bacteria M15 (Qiagen) and express.
(2) the proteic expression and purification of Falcipain-2 (FP-2)
The plasmid pQE30-Fal2 that builds changed over to obtain expressing engineering bacteria among the intestinal bacteria M15; Engineering bacteria is incubated at overnight cultures (peptone 10g/L in the 10mL LB substratum that contains 100 μ g/mL penbritins and 50 μ g/mL kantlex; Yeast extract 5g/L, sodium-chlor 10g/L).Go into 1L by switching in 1: 100 then and contain in the fresh LB substratum of penbritin and kantlex, under 37 ℃, 220 rev/mins of cultivations.When OD600 reaches about 0.8 the time, add IPTG to final concentration 0.5mM, reduce the temperature to 25 ℃ simultaneously and cultivate and carried out induction expression of protein in 12 hours.4000 rev/mins of centrifugal 30 minutes collection thalline are put in-80 ℃ of Ultralow Temperature Freezers preservations and spend the night after collection is good.Thalline is hanged with the buffer 1 of 20mL (and 10mM imidazole, pH 8.0 for 20mM Tris-Cl, 0.5MNaCl), with ultrasonic disruption on the suspension-s ice bath (300W worked 30 minutes, one time 5 seconds, midfeather 10 seconds).The cell homogenates that obtains after the fragmentation is at 4 ℃, with 10000 rev/mins centrifugal 30 minutes, abandon supernatant; With buffer 2 (6M guanidine HCl 20mM Tris-Cl 250mM NaCl 20mMimidazole, the pH 8.0) dissolution precipitation of 20mL, mild stirring is 1 hour under the room temperature; 10000 rev/mins of centrifugal 30min, and with appearance on the supernatant to Binding buffer 2 (6M guanidine HCl, 20mM Tris-Cl; 250mM NaCl, pH 8.0) Ni that balance is good
2+On-NTA the post, successively use Wash buffer 1 (8M urea, 20mM Tris-Cl; 500mM NaCl pH 8.0) and the foreign protein of each 30ml flush away non-specific binding of Washbuffer 2 (8M urea, 20mM Tris-Cl, 30mM imidazole); Use Elution buffer (8M urea again; 20Mm Tris-Cl, 1M imidazole) 10ml flush away target protein, detect proteic molecular weight and purity with SDS-PAGE.
(3) renaturation of FP-2 inclusion body protein
The albumen that purifying is obtained adds 10mM DTT, 37 ℃ down temperature bathe after 45 minutes, protein solution is diluted to the 10 μ g/ml (dialyzate: 100mM Tris-Cl of dialysing; 1mM EDTA, 20%glycerol, 250mM L-arginine; 1mMGSH, 1mM SSG, pH 8.0) spend the night.The albumen that dialysis is good concentrates the mensuration that promptly can be used as enzyme inhibition activity.
(4) the proteic coupling of FP-2
After thoroughly cleaning Biacore 3000 machines, steady with HBS-EP damping fluid (3mMEDTA and 0.005% (v/v) surfactant P20, pH 7.4 for 10mM Hepes, 150mM NaCl) balancing machine to baseline.0.2MN-ethyl-N '-dimethylaminopropyl carbodiimide (N-ethyl-N '-dimethyl aminopropyl carbodiimide) and 50mMMN-HOSu NHS (EDC/NHS) 1: 1 are mixed, with 5 μ L/min sample introductions 7 minutes with the activation chip surface.FP-2 albumen is used the 10mM sodium acetate, pH4.2, and being diluted to final concentration is 69 μ g/ml, with 5 μ L/min flow velocity sample introductions.At last, use the 1M diethanolamine hydrochloride, pH 8.5 is with 5 μ L/min flow velocity sample introductions 7 minutes, the sealing chip surface, and the final proteic coupling amount of FP-2 is about 9300RU.
(5) screening compound
Substrate Z-Phe-Arg-pNA HCl (Bachem AG) is as positive control.I
A-1 usefulness 100%DMSO dissolving, mother liquid concentration is 10mM.With HBS-EP damping fluid diluted compounds, to final concentration be 1 μ M and 10 μ M, the final concentration of DMSO is 0.1%.According to I
A-1 with chip on the proteic bonded RU of FP-2 (Response Unit, resonance units) value, judge whether compound has the activity of combination.There is the active compound of combination can carry out detailed dynamic experiment.The result proves I
A-1 has tangible the combination with FP-2 albumen.
(6) kinetic determination
I
A-1 usefulness work damping fluid HBS-EP (containing 0.1%DMSO) is made into the different concentration gradient respectively, and with 30 μ l/min sample introduction 1min, the 2min that dissociates stablizes 2min with same buffer then.Obtain I
A-1 with the sensing figure of FP-2 protein-interacting, use 1: 1 (Langmuir) combination model or steady-state model in the Biacore analysis software to carry out match again, obtain definite kinetics and thermodynamic equilibrium constant.
(7) test-results: see table 1 positive control and I
A-1 with the test result of FP-2 protein binding constant.
Table 1
Embodiment 24
The compounds of this invention suppresses active mensuration to falcipain-2 proteolytic enzyme percentage
(1) renaturation of proteic expression and purification of Falcipain-2 (FP-2) and FP-2 inclusion body protein
Referring to embodiment 16
(2) The compounds of this invention is to the mensuration of FP-2 enzyme inhibition activity
100mM NaOAc at 197 μ L; 10mM DTT; Add FP-2 albumen (final concentration 10 μ g/ml) in the buffer system of pH 5.5 and be dissolved in the testing compound solution of DMSO; Final concentration 10 μ M and 0 μ M (negative control) are hatched under the room temperature behind the 30min with MD SpectraMax M5 ELIASA in excitation 355nm; Emission 460nm place surveys the RFU value in the 15min continuously, calculates speed of reaction K
m, draw testing compound percent inhibition under 10 μ M with formula,
Calculation formula is:
(control group K
mValue-experimental group K
mValue)/control group K
mValue * 100%
(3) compound activity test result: table 2.4-(N-replaces sulfamyl) benzene alkyl amides compound is to falcipain-2 inhibiting rate data
Table 2.
Embodiment 25
Part of compounds of the present invention is to falcipain-2 proteolytic enzyme half effective inhibition concentration (IC
50) mensuration
Choose 10 μ M inhibiting rates and survey IC at the compound more than 40%
50, select the suitable compound concentration gradient, experimental technique and system such as embodiment 17.According to the compound speed of reaction K that the FP-2 enzyme is lived under different concns
m, the inhibiting rate that the computerized compound is lived to the FP-2 enzyme under different concns uses the Sigmoidal formula to carry out the IC that match obtains compound with origin software
50Value, result are seen table 3, and (N-(4-replaces aminoacyl)-5-substituted furan-2-Carbox amide is lived to the falcipain-2 enzyme and is suppressed IC
50) and Fig. 2.
Table 3.
4-of the present invention (N-replaces sulfamyl) benzene alkyl amides compound combines all to have shown positive findings in test and the enzyme inhibition test in the computer virtual screening and at falcipain-2 proteolytic enzyme.Should demonstrate,prove its pharmacological mechanism.Therefore, compound of the present invention can be used as the suppressor factor of falcipain-2.
Claims (5)
1. a 4-(N-replaces sulfamyl) benzene alkyl amides compound, it has structure shown in the formula I:
Among the formula I: R
1Be group shown in substituted-phenyl or the formula (1):
Wherein: A is a phenyl, and m is 1 or 2; The substituting group of said substituted-phenyl is halogen or C
1-C
3Alkoxyl group, substituent number are 1-3;
n＝0～3；
R
2Be substituted-phenyl, substituted 5-6 unit heterocyclic radical, and group shown in 5-6 unit's heterocyclic radical or the formula (1) of phenyl is arranged,
Wherein: A is a 5-6 unit heterocyclic radical, and the substituting group in described substituted-phenyl and the substituted 5-6 unit heterocyclic radical is selected from: halogen, C
1-C
3Alkoxyl group, C
1-C
3A kind of or more than two kinds, substituent number is 1-3 in alkyl, hydroxyl or the phenyl, the heteroatoms in the described 5-6 unit heterocyclic radical is selected from: a kind of or more than two kinds, the heteroatoms number is 1-3 in oxygen, sulphur or the nitrogen, m is 1 or 2.
2. compound as claimed in claim 1 is characterized in that, wherein R
1Be benzyl, styroyl, 3,4-Dimethoxyphenyl or 4-fluorophenyl.
3. compound as claimed in claim 1 is characterized in that, wherein R
2Be benzo [1,4] dioxane-6-base, benzo [1,3] dioxolane-5-base, benzo [d] thiazol-2-yl; Thiazole-2-methyl, pyridine-2-methyl, 5-ethyl-1,3,4-thiadiazoles-2-base; 3,4-dimethoxy phenyl, 3-hydroxyl-4-methoxyphenyl, 3-chloro-4-fluorophenyl or 4-phenyl thiazole-2-base.
4. compound as claimed in claim 2 is characterized in that, wherein R
2Be benzo [1,4] dioxane-6-base, benzo [1,3] dioxolane-5-base, benzo [d] thiazol-2-yl; Thiazole-2-methyl, pyridine-2-methyl, 5-ethyl-1,3,4-thiadiazoles-2-base; 3,4-dimethoxy phenyl, 3-hydroxyl-4-methoxyphenyl, 3-chloro-4-fluorophenyl or 4-phenyl thiazole-2-base.
5. treat in the medicine that causes malaria by plasmodium in preparation like any described compound in the claim 1～4 and use.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810038065XA CN101591327B (en) | 2008-05-26 | 2008-05-26 | Benzene alkyl amides compound and usage thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810038065XA CN101591327B (en) | 2008-05-26 | 2008-05-26 | Benzene alkyl amides compound and usage thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101591327A CN101591327A (en) | 2009-12-02 |
| CN101591327B true CN101591327B (en) | 2012-07-25 |
Family
ID=41406225
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810038065XA Expired - Fee Related CN101591327B (en) | 2008-05-26 | 2008-05-26 | Benzene alkyl amides compound and usage thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101591327B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106905247B (en) * | 2017-01-17 | 2019-05-17 | 华东理工大学 | Acetamides and application thereof |
| CN106938997B (en) * | 2017-01-17 | 2019-10-11 | 华东理工大学 | N- (4- replaces phenethyl) acetamides and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1170574A (en) * | 1996-06-28 | 1998-01-21 | 弗·哈夫曼-拉罗切有限公司 | Sulfonamides and their use |
| CN1639119A (en) * | 2001-12-04 | 2005-07-13 | 霍夫曼·拉罗奇有限公司 | Substituted 2-amino-cycloalkanecarboxamides and their use as cysteine protease inhibitors |
| CN1798729A (en) * | 2003-06-02 | 2006-07-05 | 霍夫曼-拉罗奇有限公司 | Benzamide nitrile derivatives |
-
2008
- 2008-05-26 CN CN200810038065XA patent/CN101591327B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1170574A (en) * | 1996-06-28 | 1998-01-21 | 弗·哈夫曼-拉罗切有限公司 | Sulfonamides and their use |
| CN1639119A (en) * | 2001-12-04 | 2005-07-13 | 霍夫曼·拉罗奇有限公司 | Substituted 2-amino-cycloalkanecarboxamides and their use as cysteine protease inhibitors |
| CN1798729A (en) * | 2003-06-02 | 2006-07-05 | 霍夫曼-拉罗奇有限公司 | Benzamide nitrile derivatives |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101591327A (en) | 2009-12-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2667488C (en) | Methods of synthesizing pharmaceutical salts of a factor xa inhibitor | |
| US6642252B2 (en) | Acid derivatives useful as serine protease inhibitors | |
| ES2270532T3 (en) | INHIBITORS OF CYSTEINE AND SERINE PROTEASE BASED ON ALPHA-CETOAMIDS CONTAINING QUINOLINE. | |
| EP0822934B1 (en) | Antithrombotic amidinotetrahydropyridylalanine derivatives | |
| CN102216279A (en) | Phenyl pyrimidone compounds, pharmaceutical compositions, preparation methods and uses thereof | |
| CN103864793A (en) | Substituted purin-9-acetamino isohydroxamic acid histone deacetylase inhibitor and preparation method and application thereof | |
| CN101565418B (en) | Amide derivative and purpose thereof | |
| CN101591327B (en) | Benzene alkyl amides compound and usage thereof | |
| CN101684098A (en) | 5-lipoxygenase inhibitor and preparation method, medical composite and application thereof | |
| CN101591285B (en) | Propionamides compound and usage thereof | |
| CN102985407B (en) | 8-hydroxy-quinoline derivatives | |
| CN101544631A (en) | Novel pyrazole 5-lipoxygenase small molecule inhibitors, preparation method, pharmaceutical composition and application thereof | |
| US7524871B2 (en) | Thrombin inhibitors | |
| CN1793120A (en) | Thiourea kind compund with inhibiting virus capsid protain activity and its preparation process and application thereof | |
| CN104136028A (en) | Potent non-urea inhibitors of soluble epoxide hydrolase | |
| CN104262262B (en) | A kind of N, 6 phenylbenzene pyrimidine-4-amine class Bcr-Abl inhibitor and its preparation method and application | |
| CN1446101A (en) | Combination product comprising melagatran and factor VLLa inhibitor | |
| CN106905247A (en) | Acetamides and application thereof | |
| CN103159758A (en) | (1S,3S)-1-p-nitrophenyl-1,2,3,4-tetrahydro-beta-carboline acyl amino acid, and synthesis, antithrombotic activity and application as antithrombotic agent thereof | |
| US6004976A (en) | Thrombin inhibitors | |
| CN112300106B (en) | Protein kinase inhibitor, preparation method and application | |
| CN102086166A (en) | 3-methoxy-4-(N-substituted amino sulfonyl)fenalamide compounds and application thereof | |
| CN106938997B (en) | N- (4- replaces phenethyl) acetamides and application thereof | |
| CN104447500B (en) | Halogen-substituted benzamidocyclohexanecarboxylic acid derivatives and applications thereof | |
| ES2656475T3 (en) | New compounds of indazol and a process for the preparation of these |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120725 Termination date: 20150526 |
|
| EXPY | Termination of patent right or utility model |