CN101586130A - Method for preparing L-arginine - Google Patents

Abstract

A method for preparing a L-arginine is completed by culturing fermenting a modified bacillus coli, wherein a method for modifying the bacillus coli including the following steps: (1) constructing an expression carrier containing an acetyl aminoglutaric acid synthetase gene; (2) translating the expression carrier containing the acetyl aminoglutaric acid synthetase gene into the bacillus coli, and screening positive transformants. By means of inserting and integrating acetyl aminoglutaric acid synthetase gene expression unit fixed points into argR gene sites of the bacillus coli, such that the argR gene is knocked to remove when integrating exogenous genes. By means of the modified bacillus coli to ferment, it is capable of generating and accumulating the L-arginine in a culture medium, and collecting the L-arginine through a separating and purifying steps. The modifying method for the bacillus coli of the invention is capable of preventing a gene copy number caused by leading the whole expression carrier into the bacillus coli from being very large, so as to express the gene excessively, thereby the expressions of other enzyme genes are interfered in a metabolic pathway. It is capable of improving an inheritance stability of a strain.

Description

The arginic preparation method of a kind of L-

Technical field

The present invention relates to the arginic preparation method of a kind of L-, relate in particular to and a kind ofly improve intestinal bacteria by gene recombination technology and accumulate arginic ability, and utilize improved Escherichia coli fermentation to produce the arginic method of L-.

Background technology

The L-arginine is a kind of important amino acid in the biological metabolism approach, also be a kind of industrial broad-spectrum amino acid, can be used for industries such as food and pharmacy, produce amino acid injection, liver protecting agent etc., have and anti-improve body immunity, prevent and treat effect such as cardiovascular disorder, and might be a kind of potential drug composition of treatment tumour.

The used bacterial classification of L-arginine fermentative production mainly contains Corynebacterium glutamicum, yellow excellent bacillus, Corynebacterium crenatum, intestinal bacteria, Bacillus subtilus etc.These bacterial classifications generally obtain by the bacterial classification and the mutagenesis of screening anti-arginine analog, and also some uses the mutant of anti-other medicines or the bacterial strain that gene recombination technology is transformed.

The arginine biosynthetic pathway of bacterium is to be begun by L-L-glutamic acid, finally generates the L-arginine through eight step enzymic catalytic reactions.The enzyme of arginine route of synthesis generally all is subjected to strict regulation and control, and the enzyme gene transcription can be subjected to checking of arginine or arginine and repressor mixture, and the catalytic activity of zymoprotein also can be subjected to arginic feedback inhibition.

Genetic engineering modified bacterial classification adopts intestinal bacteria more, the gene that wherein generally is the enzyme of a kind of bacterium arginine biosynthetic pathway of encoding of introducing in the intestinal bacteria of reorganization is to improve the activity of certain enzyme, perhaps introduce enzyme gene through artificial mutation, wherein enzyme and arginine bonded site obtain changing, arginic restraining effect is weakened or eliminate, thereby the arginic ability of intestinal bacteria accumulation L-is improved.

In the metabolic process of bacterium, the enzyme in each step of route of synthesis all can be subjected to arginic feedback inhibition in various degree usually.In intestinal bacteria, the key enzyme that arginine suppresses its route of synthesis is the acetylglutamate synthetase of the first step, and it is subjected to arginine to check expression and active the inhibition simultaneously, and the enzymes in all the other each steps are subjected to arginic restraining effect less.

In Corynebacterium glutamicum, the key enzyme of arginine route of synthesis is the acetylglutamate kinase in second step, and it is subjected to arginicly checking and suppressing.And the acetylglutamate synthetase of the first step and the ornithine acetyltransferase in the 5th step are actually by same enzyme and finish in Corynebacterium glutamicum, and it is not checked is not basically yet suppressed.

Go back the regulatory gene argR of an arginine operon of ubiquity in bacterium, different functions is arranged in different bacteriums, in intestinal bacteria, argR is a negative regulator gene, and it can suppress arginic synthetic in the cell.

Summary of the invention

The technical problem to be solved in the present invention provides a kind of weak point consuming time, safe and reliable, environment-friendly type, process is simple, output the is high arginic preparation method of L-.

The technical problem to be solved in the present invention is achieved through the following technical solutions:

The present invention has knocked out the argR gene in the intestinal bacteria by intestinal bacteria are carried out the gene recombination modification, and the intestinal bacteria after the modification can produce the L-arginine by bulk fermentation.Described colibacillary method of modifying comprises the steps:

(1) structure contains the acetylglutamate synthetase expression carrier:

(2) will contain the acetylglutamate synthetase expression carrier and be transformed in the intestinal bacteria, the screening positive transformant.

In above-mentioned preparation method, the colibacillary culture condition of described modification preferably: cultivated under aeration condition 16-72 hour, the pH value is controlled at 6.5-7.5, temperature 30-37 ℃.

In above-mentioned preparation method, step (1) specifically comprises the steps:

Utilize the method for polymerase chain reaction PCR, with Corynebacterium glutamicum DNA is template, amplification acetylglutamate synthetase gene, the upstream primer that PCR uses: CTACATATGGCAGAAAAAGGCATTAC (SEQ NO:1), wherein 5 ' end has added the NdeI restriction site; Downstream primer: CTAGGATCCTTAAGTGCTGTACGCGGAGT (SEQ NO:2), wherein 5 ' end has added the BamHI restriction site; The PCR condition: 94 ℃ 30 seconds; 60 ℃ 30 seconds; 72 ℃ 90 seconds; 30 circulations of increasing obtain the acetylglutamate synthetase gene;

The acetylglutamate synthetase gene with NdeI and BamHI double digestion, is connected with plasmid vector pET-9a with same double digestion, obtains containing the acetylglutamate synthetase expression carrier, be called pET-argJ.

In above-mentioned preparation method, step (2) specifically comprises the steps:

Choose kalamycin resistance gene on the expression vector pET-argJ as selective marker, acetylglutamate synthetase gene and kalamycin resistance gene are incorporated into recomposition unit in the bacillus coli gene group together;

PCR upstream primer sequence is (SEQ NO:3):

GTCACTGGAGCGATATCATACAGAGAGAGTTCTGAACCTGAAGGCAGTTGGGTTTTTAACAGTAGTGCAAATAGCTCACGCTGTAGGTATCTCAG；

PCR downstream primer sequence is (SEQ NO:4):

TGGCAGGCAGTAAACCATTTCCATTTTGGCATTGCGTGTACGTACAGCACCAAACTTGGTCAACATCCGCGCGAAATTAATACGACTCACTATAGG；

With expression vector pET-argJ is template, carries out pcr amplification with above two sequences; The PCR reaction conditions is: 94 ℃ 30 seconds; 72 ℃ 4 minutes; 30 circulations of increasing must be arrived the recomposition unit that two ends have argR dna homolog recombination sequence, comprise acetylglutamate synthetase gene and kalamycin resistance gene;

Recomposition unit is imported in the competent escherichia coli cell;

The screening recomposition unit is inserted into the positive transformant of intestinal bacteria argR gene locus.

For the intestinal bacteria after the modification, can adopt and produce the similar method of arginine and carry out fermentation culture, and in nutrient solution the smart ammonia of purifying L-.Cultivate required carbon source and generally can use carbohydrate, as glucose, sucrose, fructose, lactose and starch hydrolysate etc.Nitrogenous source can use inorganic nitrogen-sourced as ammonium salt, ammoniacal liquor etc., also can use organic nitrogen source such as peptone, soybean hydrolyzate, corn steep liquor etc.Also need an amount of microelement kind material in addition, as magnesium ion, iron ion, calcium ion, yeast extract and VITMAIN B1 etc.

The arginic method of separation and purification L-can adopt condensing crystal method, ion exchange resin absorption method and other known method from fermented liquid.

Compared with prior art, the present invention has following beneficial effect: the acetylglutamate synthetase gene that the present invention utilizes round pcr to increase to derive from Corynebacterium glutamicum, made up coli expression carrier, import in the intestinal bacteria, utilize the homologous recombination method, acetylglutamate synthetase genetic expression unit fixed point is inserted be incorporated into colibacillary argR gene locus, make foreign gene when integrating, destroy the structure of argR gene, promptly be equivalent to knock out the argR gene.The acetylglutamate synthetase in Corynebacterium glutamicum source is expressed in the genetic expression unit that inserts, and finishes the arginine route of synthesis the first step and is not subjected to the arginic feedback inhibition of end product L-by L-glutamic acid to the catalysis of acetylglutamate.

Utilize this modification intestinal bacteria to ferment, can produce and in substratum, accumulate the L-arginine, by purification procedures collection L-arginine.

It is too high that intestinal bacteria method of modifying of the present invention has avoided that whole expression vector is imported the gene copy number that intestinal bacteria bring, and makes the gene overexpression, thereby disturb other enzyme expression of gene in the pathways metabolism.Can improve the genetic stability of bacterial classification.

Description of drawings

Fig. 1 is the structure collection of illustrative plates of pET-argJ.

Embodiment

Embodiment 1: the structure that contains the acetylglutamate synthetase expression carrier

Utilize the method for PCR, DNA is a template with Corynebacterium glutamicum (ATCC 13032), amplification acetylglutamate synthetase gene.The upstream primer that PCR uses: CTACATATGGCAGAAAAAGGCATTAC (SEQ NO:1), wherein 5 ' end has added the NdeI restriction site; Downstream primer: CTAGGATCCTTAAGTGCTGTACGCGGAGT (SEQ NO:2), wherein 5 ' end has added the BamHI restriction site.The PCR condition: 94 ℃ 30 seconds; 60 ℃ 30 seconds; 72 ℃ 90 seconds.30 circulations of increasing.Obtain the dna fragmentation that length is 1.2kb, this is the acetylglutamate synthetase gene of Corynebacterium glutamicum.This PCR product is connected with plasmid vector pET-9a (available from Novagen company) with same double digestion with the dna fragmentation behind NdeI and BamHI double digestion, the purifying, and the conversion of connection product is with the bacillus coli DH 5 alpha competent cell of calcium chloride processing.Cell after the conversion is applied on the solid LB plate culture medium that contains 10 μ g/mL kantlex.Solid LB medium component is: 1% peptone, 0.5% yeast powder, 1% sodium-chlor, 2% agar.Cultivate after 16-20 hour for 37 ℃, plasmid DNA is cultivated, extracted to several transformant list bacterium colonies of picking respectively, carries out determined dna sequence with the T7 universal primer.The correct plasmid of screening sequence is and contains the acetylglutamate synthetase expression carrier, with its called after pET-argJ.The structure collection of illustrative plates of pET-argJ is seen Fig. 1.

Embodiment 2: intestinal bacteria are introduced in acetylglutamate synthetase genetic expression unit

Starting strain used among the present invention is intestinal bacteria, is to produce bacterial strain by the L-arginine that mutagenesis screening obtains.Have the complete acetylglutamate synthetase expression of gene unit that can derive from Corynebacterium glutamicum on the expression vector pET-argJ that makes up among the embodiment 1 at expression in escherichia coli.The screening of transformant for convenience, we need a selective marker, therefore choose kalamycin resistance gene on the expression vector pET-argJ as selective marker, with acetylglutamate synthetase gene and kalamycin resistance gene together as the recomposition unit that is incorporated in the bacillus coli gene group.

Kalamycin resistance gene promoter 5 ' terminal sequence is as PCR thing: ATAGCTCACGCTGTAGGTATCTCAG on the employing expression vector; The T7 promoter upstream sequence just can increase out with the recomposition unit that comprises acetylglutamate synthetase gene and kalamycin resistance gene as PCR downstream primer: GCGAAATTAATACGACTCACTATAGG.

For site-directed integration to colibacillary argR gene, need on the primer of PCR upstream and downstream, add the preceding paragraph argR gene upstream and downstream homologous sequence more respectively.

Choosing the upstream homologous sequence is:

GTCACTGGAGCGATATCATACAGAGAGAGTTCTGAACCTGAAGGCAGTTGGGTTTTTAACAGTAGTGCAA；

Choosing the downstream homologous sequence is:

TGGCAGGCAGTAAACCATTTCCATTTTGGCATTGCGTGTACGTACAGCACCAAACTTGGTCAACATCCGC；

Therefore, the PCR upstream primer sequence that has added the argR homologous sequence is:

GTCACTGGAGCGATATCATACAGAGAGAGTTCTGAACCTGAAGGCAGTTGGGTTTTTAACAGTAGTGCAAATAGCTCACGCTGTAGGTATCTCAG(SEQ NO：3)；

The PCR downstream primer sequence that has added the argR homologous sequence is:

TGGCAGGCAGTAAACCATTTCCATTTTGGCATTGCGTGTACGTACAGCACCAAACTTGGTCAACATCCGCGCGAAATTAATACGACTCACTATAGG(SEQ NO：4)；

Plasmid expression vector pET-argJ with structure among the embodiment 1 is a template, carries out pcr amplification with above two long sequence pcr primer things.Adopt high-fidelity polysaccharase Pyrobest DNApolymerase (Takara company), two-step approach is advanced the PCR reaction.The PCR reaction conditions is: 94 ℃ 30 seconds; 72 ℃ 4 minutes.30 circulations of increasing.Obtain the dna fragmentation that length is 3.3kb, be two ends and have argR dna homolog recombination sequence, comprise the acetylglutamate synthetase gene of Corynebacterium glutamicum and the recomposition unit of kalamycin resistance gene.

The homologous recombination cells D NA that pcr amplification is obtained separates the dna fragmentation of 3.3kb, to remove residual template plasmid DNA with 1% agarose gel electrophoresis separation and purification.Adopt the sharp conversion method of electricity that the homologous recombination unit of purifying is imported in the competent escherichia coli cell.Be coated on the LB plate culture medium that contains kantlex according to method identical among the embodiment 1, cultivated 16-20 hour for 37 ℃.Since transform the recomposition unit of usefulness itself can not be in intestinal bacteria self-replicating, so must be the transformant that homologous recombination is incorporated in the bacillus coli gene group to have taken place just can grow single bacterium colony.Though the efficient of this conversion is very low, but still can obtain a small amount of transformant.

In order to identify whether recombinant expressed unit is properly inserted in colibacillary argR gene locus, adopt colony polymerase chain reaction (PCR) method that all transformants are identified.The sequence that adopts periphery, argR gene two ends is as primer (ATATGGCTCAGATCGACAGC and AGCACCAGATTCTTCAATGG), the transformant bacterium colony that takes a morsel is that template is carried out pcr amplification, the PCR product carries out agarose electrophoresis to be identified, if PCR product size is 0.8kb, show that then foreign gene fails accurately to be inserted in the argR gene; If PCR product size is 3.4kb, prove that then the recombinant expressed unit of the acetylglutamate synthetic gene that has Corynebacterium glutamicum correctly has been inserted into colibacillary argR gene locus, that is to say, knocked out colibacillary argR gene simultaneously.By the PCR evaluation and screening, obtained correct transformant, i.e. modification coli strain, thus finished the present invention.

Embodiment 3: the shake flask fermentation of modification coli strain produces arginine test:

Embodiment 2 gained modification intestinal bacteria and Bacillus coli communis are carried out shake flask fermentation at the same terms, relatively their the arginic ability of product L-.Two bacterial classifications are connect one separately encircle in the 5mL liquid LB substratum, 32 ℃ of shaking culture are spent the night.Next day, seed liquor is inoculated into respectively in the 50mL shake flask fermentation substratum.The shake flask fermentation medium component: glucose 10%, ammonium sulfate 5%, potassium primary phosphate 0.5%, yeast soak powder 0.5%, sal epsom 0.05%, VitB1 0.1g/L, ferrous sulfate 0.02g/L, lime carbonate 1%, pH7.2; Cultivated 72 hours for 32 ℃ in 220-240rpm the inoculation back.The arginic amount 35g/L of the L-that accumulates in the substratum.As shown in table 1.

Table 1 modification coli strain and parent produce acid molar ratio

Bacterial strain	L-arginine yield (g/L)
		Bacillus coli communis	26
The modification coli strain	35

As seen, the arginic ability of modification coli strain generation L-obviously improves.

Untitled_ST25

SEQUENCE LISTING

＜110〉Xinghu Biotech Co., Ltd., Zhaoqing City, Guangdong Prov.

＜120〉the arginic preparation method of a kind of L-

<130>

<160>4

<170>PatentIn version 3.5

<210>1

<211>26

<212>DNA

＜213〉artificial sequence

<400>1

ctacatatgg cagaaaaagg cattac 26

<210>2

<211>29

<212>DNA

＜213〉artificial sequence

<400>2

ctaggatcct taagtgctgt acgcggagt 29

<210>3

<211>95

<212>DNA

＜213〉artificial sequence

<400>3

gtcactggag cgatatcata cagagagagt tctgaacctg aaggcagttg ggtttttaac 60

agtagtgcaa atagctcacg ctgtaggtat ctcag 95

<210>4

<211>96

<212>DNA

＜213〉artificial sequence

<400>4

tggcaggcag taaaccattt ccattttggc attgcgtgta cgtacagcac caaacttggt 60

caacatccgc gcgaaattaa tacgactcac tatagg 96

Claims (4)

1, the arginic preparation method of a kind of L-is characterized in that cultivating the Escherichia coli fermentation production L-arginine through modification, and described colibacillary method of modifying comprises the steps:

(1) structure contains the acetylglutamate synthetase expression carrier:

(2) will contain the acetylglutamate synthetase expression carrier and be transformed in the intestinal bacteria, the screening positive transformant.

2, the arginic preparation method of L-as claimed in claim 1 is characterized in that described culture condition is: cultivated 16-72 hour under aeration condition, the pH value is controlled at 6.5-7.5, temperature 30-37 ℃.

3, the arginic preparation method of L-as claimed in claim 1 is characterized in that step (1) comprises the steps:

Utilizing the method for PCR, is template with Corynebacterium glutamicum DNA, amplification acetylglutamate synthetase gene, and the upstream primer that PCR uses: CTACATATGGCAGAAAAAGGCATTAC, wherein 5 ' end has added the NdeI restriction site; Downstream primer: CTAGGATCCTTAAGTGCTGTACGCGGAGT, wherein 5 ' end has added the BamHI restriction site; The PCR condition: 94 ℃ 30 seconds; 60 ℃ 30 seconds; 72 ℃ 90 seconds; 30 circulations of increasing obtain the acetylglutamate synthetase gene;

The acetylglutamate synthetase gene with NdeI and BamHI double digestion, is connected with plasmid vector pET-9a with same double digestion, obtains containing the acetylglutamate synthetase expression carrier, be called pET-argJ.

4, the arginic preparation method of L-as claimed in claim 1 is characterized in that step (2) comprises the steps:

Choose kalamycin resistance gene on the expression vector pET-argJ as selective marker, acetylglutamate synthetase gene and kalamycin resistance gene are incorporated into recomposition unit in the bacillus coli gene group together;

PCR upstream primer sequence is:

GTCACTGGAGCGATATCATACAGAGAGAGTTCTGAACCTGAAGGCAGTTGGGTTTTTAACAGTAGTGCAAATAGCTCACGCTGTAGGTATCTCAG；

PCR downstream primer sequence is:

TGGCAGGCAGTAAACCATTTCCATTTTGGCATTGCGTGTACGTACAGCACCAAACTTGGTCAACATCCGCGCGAAATTAATACGACTCACTATAGG；

With expression vector pET-argJ is template, carries out pcr amplification with above two sequences; The PCR reaction conditions is: 94 ℃ 30 seconds; 72 ℃ 4 minutes; 30 circulations of increasing must be arrived the recomposition unit that two ends have argR dna homolog recombination sequence, comprise acetylglutamate synthetase gene and kalamycin resistance gene;

Recomposition unit is imported in the competent escherichia coli cell;

The screening recomposition unit is inserted into the positive transformant of intestinal bacteria argR gene locus.

Images