CN101573377A - Molecules and methods of using same for treating CCR5/CCR5 ligands associated diseases - Google Patents

Abstract

Soluble molecules are provided. Thus, for example, provided is a soluble molecule which comprises a heterologous amino acid sequence conjugated to a CCR5 amino acid sequence being capable of binding aCCR5 ligand, and wherein the molecule is devoid of an N-terminus domain of CCR5. Also provided are pharmaceutical compositions which comprise the above molecules and methods and uses of same.

Description

The molecule of treatment CCR5/CCR5 part relative disease and with the method for this this disease of molecular therapy

Invention field and background

The present invention relates to new molecule, relate to the method for the treatment of CCR5/CCR5 part relative disease such as autoimmunization inflammatory diseases in particular.

Chemokine be little (～8-14kDa), the secretory protein of similar cytokine on the structure, can regulate cell transportation (trafficking).They are to respond early stage inflammatory mediator such as IL-1 β or TNF-α by the various kinds of cell type to produce and excretory with responding bacterium or virus infection.Chemokine mainly plays the effect of leukocytic chemoattractant, and monocyte, neutrophilic granulocyte and other effector cells are raised the position of infecting or damaging from blood.They can be discharged by many different cell types (for example scavenger cell), can mediates multiplely to leukocytic short scorching effect, synthesize and the integrin activation as chemotaxis initiation, threshing, lipid medium.

Chemokine can be subdivided into C-C, C-X-C, C and C-X3-C four class chemokines according to the position of preceding two halfcystines in its protein sequence.The interaction energy of these soluble proteins and its specific receptors (superfamily that belongs to seven-transmembrane structural domain g protein coupled receptor (GPCRs)) mediates its biological effect, cause multiple replying, comprise that cellular calcium concentration raises fast, cell shape changes, cell adhesion molecule is expressed increase, threshing and promotion cell migration.

In recent years, chemokine is very clear as the keying action of important medium in inflammatory and autoimmunization pathology (disorder) and disease (disease).Pointed out that chemokine is the important medium in multiple sclerosis (MS), anaphylaxis, asthma, atherosclerosis, glomerulonephritis, pancreatitis, restenosis, rheumatoid arthritis (RA), diabetic nephropathy, pulmonary fibrosis, transplant rejection and the cancer.

The most significant chemokine that is mentioned in pathology and disease is the C-C chemokine: MIP-1 α (macrophage inflammatory protein 1 α, CCL3) and RANTES (regulated during activation, normal T cell expressing and secretion, CCL5).MIP-1 α is produced by scavenger cell, is the activator of human granulocyte (neutrophilic granulocyte, eosinophilic granulocyte and basophilic granulocyte).MIP-1 α can induce pro-inflammatory cytokine such as interleukin 1 (IL-1), IL-6 and TNF-α synthesizing and release from inoblast and scavenger cell.RANTES is the chemokine of T cell, eosinophilic granulocyte and basophilic granulocyte by peripheral blood lymphocytes (PBMC) secretion.RANTES with leukocyte recruitment on inflamed sites and inducing the propagation of some natural killer (NK) cell and activate play a part positive.

C-C chemokine receptor 5 (CCR5) is expressed on several cell types, comprises peripheral blood deutero-dendritic cell, CD34+ hemopoietic progenitor cell and some activation/memory T h1 lymphocyte.CCR5 has several C-C chemokine ligands, comprise CCL2 (MCP-1), CCL3 (MIP-1 α), CCL4 (MEP-1 β), CCL5 (RANTES), CCL11 (eosinophil chemotactic protein) and CCL16[Blanpain et al., Blood. (1999) 94:1899-905; Nomiyama et al., Int Immunol (2001) (8): 1021-9], great majority play an important role in pathogeny in them.

Therefore, nearest CCR5 acceptor and the importance of part in inflammatory diseases such as rheumatoid arthritis (RA) and multiple sclerosis (MS) of having studies have shown that.In RA, proved on the scavenger cell of CCR5 in similar rheumatism synovia and synovial membrane and most of T lymphocytes on specific expressed [Pokorny et al., Ann Rheum Dis (2005) 64:487-490; Wangand Liu, Clin Exp Immunol (2003) 132:371-8; Nissinen et al., JRheumatol (2003) 30:1928-34; Mack et al., Arthritis Rheum (1999) 42:981-8], and in the RA synovia, confirmed high-caliber chemokine, comprise MIP-1 α (CCL3) and RANTES (CCL5) [Hayashida et al., Arthritis Res (2001) 3 (2): 118-126; Loetscher and Moser, Arthritis Res (2002) 4 (4): 233-236].MS is feature with inflammatory cell (mainly being the CD4+Th1 cell) to the infiltration of central nervous system (CNS).Confirmed that inflammatory T cell can be to RANTES and MIP-1 α migration [Zang et al., Brain (2000) 123 (9): 1874-1882] because of its acceptor (CCR5) overexpression in its surface.

Therefore, the potential therapeutic value of this way of antagonizing CCR 5/part axle center (axis) has obtained proof.

Attempted multiple blocking-up CCR5 activated method, the some of them method is summarized hereinafter.

PCT prospectus WO05078097 discloses multi-functional short interfering nucleic acid (multi-functional siNA) molecule, this molecular energy disturbs (RNAi) regulatory gene such as CCR5 expression of gene by RNA, can be used for the treatment of any disease or illness that can respond genetic expression or active adjusting potentially.Though known RNAi is highly sequence-specific, the speed that reduces gradually that genetic expression and protein disappear depends on the type of target cell, fissional speed and protein half life.In addition, siRNA may not can the fully expression of arrestin matter, some molecules may still be transcribed, therefore preferably target final product (protein target itself) rather than gene.

United States Patent (USP) the 6th, 930 discloses CCR5 Chemokine Receptors monoclonal antibody specific No. 174, this antibody capable competition receptors bind, thereby by disturbing ligand-receptor interaction to block natural replying.The imagination purposes of these antibody comprises and treats and/or prevents inflammatory diseases, comprises that rheumatoid arthritis, virus infection (comprise human immunodeficiency virus 1 and 2 (HIV-I and 2), cancer and autoimmunization pathology.This invention has the shortcoming of using the monoclonal antibody aspect: 1) they can be replied by induced anti-idiotype in the host; 2) they can compete receptors bind, however they do not understand in and part, make part may still transmit the activity signal.The extracellular segment of having imagined acceptor produces for carrying out antibody, comprises N-terminal and first born of the same parents' outer shroud (EC1).Do not mention EC2.

United States Patent (USP) disclose for No. 20030166870 can specificity in conjunction with CCR5 (anti-CCR5) and therefore can suppress the monoclonal antibody of CCR5 function, this CCR5 function comprises the stimulation (for example chemotactic stimulation) of CCR5 in conjunction with active (for example part combination comprises RANTES, MIP-1 α and/or MIP-1 β), signal transduction activity (for example proteic activation of Mammals G) and/or cell response.This anti-CCR5 monoclonal antibody can be used for the treatment intervention of inflammatory diseases and be used for HIV-1 and 2.This invention has the shortcoming of use monoclonal antibody aspect mentioned above.In addition, the contriver of this application clearly mentions, and in conjunction with all being important, this point obtains proof by their the proposed epi-position that is used for producing bi-specific antibody for the CCR5 part for the EC2 structural domain of CCR5 and N-terminal structural domain.The receptor chimera body of second extracellular domain that comprises CCR5 has been described in this invention, yet these mosaics are to be the CCR5/CCR2 mosaic that the restriction fragment of flank makes up by shifting with common BamHI, AfIII between people CCR5 and the people CCR2b, ClaI, EcoRI and XbaI site.But these acceptors can only be incorporated on the film, and are not suitable as solubility therapeutic acceptor.

For overcoming these restrictions, the method based on soluble receptors has been proposed.Mainly say, use the soluble receptors that comprises ligand binding domain to lure thing (decoy) to completely cut off all ligand-mediated receptor activations.This method based on soluble receptors has several tangible advantages than the therapy based on monoclonal antibody.At first, they not can as antibody easy in the host induced anti-idiotype reply; In addition,, the determinant (this part obviously can transmit the activity signal in the natural receptor) of function is arranged on the biology that their can binding partner according to their characteristic, therefore can be highly effectively in and compound; At last, their safety issue is minimum.

United States Patent (USP) the 6th, 800 discloses the CCR5 variant (also claiming HDGNR10) that can be used for treating the disease that comprises chronic infection, leukemia and the cell-mediated autoimmune disease of T No. 729.Total length (full size) the CCR5 albumen of 352 amino-acid residues has been described in this invention, and itself and people MCP-1 acceptor have the homology of height.The CCR5 that describes of soluble form it is said can be in conjunction with physiology part (as MCP-1), thereby can prevent that part from combining CCR5 with film and interacting.What this invention was instructed is extremely huge total length CCR5 albumen, and it can not be applicable to treatment because of low bioavailability and degraded.

PCT prospectus WO05106489 discloses the people CCR5 fusion rotein that can be used for the diagnosis and the treatment of C-C chemokine diseases associated (comprising inflammatory diseases, dysemia and cancer).This fusion rotein comprises the CCR5 albumen with the tilactase meromixis.This invention also provides the method for using the CCR5 polypeptide to screen therapeutical agent.Thus, can and make the compound of CCR5 mediation signal transduction inactivation be accredited as the potential therapeutical agent in conjunction with CCR5.But the instruction content of this invention does not point out which structural domain should be included in the CCR5 syzygy.As previously mentioned, CCR5 is huge protein, has some ectodomains.Complete solubility ectodomain is difficult to make up very much, because its bioavailability and degraded, it is not suitable for treatment fully.

Therefore existing the widely demand of approval, is very favorable if such treatment plan can be arranged, this treatment plan target be CCR5 and part thereof, can be used for the treatment of all its cause of diseases and relate to these proteinic inflammatory diseases and autoimmune diseases.

Summary of the invention

One aspect of the present invention provides such shla molecule, and it comprises and the allogeneic amino acid sequence that can put together in conjunction with the CCR5 aminoacid sequence of CCR5 part, and wherein this molecule does not have the N-terminal structural domain of CCR5.

Another aspect of the present invention provides such shla molecule, and it comprises the CCR5 aminoacid sequence that partly is connected with nonprotein, and wherein this CCR5 aminoacid sequence can be in conjunction with the CCR5 part, and this molecule does not have immunogenicity in the experimenter.

Another aspect more of the present invention provides such shla molecule, and it comprises at least two the non-CCR5 of adjoining aminoacid sequences, and each sequence can both be in conjunction with the CCR5 part.

Also another aspect of the present invention provides such molecule, and it comprises the label (tag) that is connected with the CCR5 aminoacid sequence of the N-terminal structural domain that does not have CCR5, and this CCR5 aminoacid sequence can be in conjunction with the CCR5 part.

Another aspect of the present invention provides the molecule shown in SEQ ID NO:2 or 4.

Another one more of the present invention aspect provides the separation polynucleotide of the nucleotide sequence that comprises the described molecule of encoding.

Also another one aspect of the present invention provides and comprises as the described molecule of activeconstituents and the pharmaceutical composition of drug acceptable carrier.

Aspect in addition of the present invention is provided at the method for this disease of treatment among the experimenter of the treatment that need carry out CCR5 and/or CCR5 part relative disease, described method comprises and gives the described molecule that this experimenter treats significant quantity, thus treatment experimenter's CCR5 and/or CCR5 part relative disease.

Of the present invention more in addition aspect provide described molecule to be used to make to be intended to the purposes of the medicine for the treatment of CCR5 and/or CCR5 part relative disease.

Of the present invention also in addition an aspect provide from the method for biological sample separation of C CR5 part, described method comprises:

(a) biological sample is contacted with the molecule of claim 4, make the molecule forming composite of CCR5-part and claim 4; (b) separate this mixture, thereby isolate the CCR5 part from biological sample.

According to the further feature of hereinafter described the preferred embodiment of the invention, the CCR5 part is selected from CCL2, CCL3, CCL4, CCL5, CCL11 and CCL16.

According to the also further feature of described preferred embodiment, wherein said molecule does not have immunogenicity.

According to the also further feature of described preferred embodiment, wherein the binding affinity of CCR5 and CCR5 part surpasses K _D=10 ^-6M.

According to the also further feature of described preferred embodiment, wherein said allogeneic amino acid sequence comprises the immunoglobulin amino acid sequence.

According to the also further feature of described preferred embodiment, wherein said CCR5 aminoacid sequence is shown in SEQ ID NO:10 or 18.

According to the also further feature of described preferred embodiment, wherein said disease is selected from multiple sclerosis, rheumatoid arthritis and type i diabetes.

According to the also further feature in the described preferred embodiment, wherein said label is the epi-position label.

According to the also further feature in the described preferred embodiment, wherein said molecule is connected with solid phase carrier.

According to the also further feature in the described preferred embodiment, wherein said molecule partly is connected with nonprotein.

According to the also further feature in the described preferred embodiment, wherein said nonprotein partly is selected from polyoxyethylene glycol (PEG), polyvinylpyrrolidone (PVP), Zelan 338 (SMA), and divinyl ether and copolymer-maleic anhydride (DIVEMA).

According to the also further feature in the described preferred embodiment, wherein said drug acceptable carrier is mixed with for parenteral admin.

According to the also further feature in the described preferred embodiment, wherein said drug acceptable carrier does not have immunogenicity basically.

According to the also further feature in the described preferred embodiment, wherein said drug acceptable carrier comprises fat amino acid (lipoamine acid).

According to the also further feature in the described preferred embodiment, wherein said drug acceptable carrier comprises carbohydrate.

According to the also further feature in the described preferred embodiment, wherein said drug acceptable carrier comprises microsphere.

According to the also further feature in the described preferred embodiment, wherein said drug acceptable carrier comprises liposome.

According to the also further feature in the described preferred embodiment, wherein said drug acceptable carrier comprises polymeric microspheres.

The method of the present invention by providing these shla molecules of shla molecule, composition and use and composition to treat CCR5/CCR5-part relative disease successfully solved the shortcoming of treatment plan known today (configuration).

All technology and scientific terminology that this paper uses, unless otherwise defined, otherwise its implication is identical with the implication of general technical staff of the technical field of the invention's common sense.Described below is method and the material that is fit to the invention process or test, but also can be used for enforcement of the present invention or test with methods described herein and materials similar or the method that is equal to and material.If any conflict, then be as the criterion with patent specification (comprise be defined in).In addition, material, method and embodiment are for purpose of explanation, and are not intended to restriction the present invention.

The accompanying drawing summary

This paper in conjunction with the accompanying drawings, only with exemplary approach, present invention is described.Before specifically at length present invention is described with reference to the accompanying drawings, what emphatically point out is, shown detail content only is an example, purpose is the preferred embodiment of the invention is carried out illustrative argumentation, proposes these detail content and be to it is believed that it is description to the most useful and easy understanding of the principle of the invention and design in order to provide.For this reason, do not attempt CONSTRUCTED SPECIFICATION of the present invention is illustrated that the description content of this paper can make those skilled in the art understand several form of the present invention in conjunction with the accompanying drawings and how can obtain in practice embodying above the present invention is carried out the required degree of basic understanding.

In the accompanying drawing:

This synoptic diagram of Fig. 1 has illustrated the generation of the expression constructs of code book contriver Ig-CCR5-EC2 peptide (SEQ IDNO:4).

These histograms of Fig. 2 A-C show EC1, EC2, EC3 and the N structural domain of mouse CCR5-IgG fusion rotein and the binding specificity of following various commercially available mouse recombinant C-C chemokine: MIP-1 α (CCL3), MIP-1 β (CCL4) and RANTES (CCL5).The specificity combination is to measure by direct ELISA.The result shows with the O.D. reading at 450nm place.Fig. 2 A shows mCCR5 (EC1, EC2, EC3 or N)-IgG and combines with the dose-dependently of mCCL3.Fig. 2 B shows mCCR5 (EC1, EC2, EC3 or N)-IgG and combines with the dose-dependently of mCCL4.Fig. 2 C shows mCCR5 (EC1, EC2, EC3 or N)-IgG and combines with the dose-dependently of mCCL5.

These histograms of Fig. 3 A-B show the ability of soluble receptors mCCR5 (EC2)-IgG in conjunction with following different mouse chemokines: MIP-1 α (CCL3), MIP-1 β (CCL4), RANTES (CCL5), ITAC, MCP-1 (CCL2), CXCL 16, MIG and IL-4.The specificity combination is to measure by direct ELISA.The result shows with the O.D. reading at 450nm place.This figure of Fig. 3 A has shown that solubility mCCR5 (the EC2)-IgG of different concns combines with above-mentioned cytokine.This figure of Fig. 3 B has shown combine (the single concentration) of 1000ng solubility mCCR5 (EC2)-IgG with above-mentioned cytokine.

This histogram of Fig. 4 shows the cross reactivity between mCCR5 (EC2)-IgG and people CCL3, CCL4 and the CCL5.Mouse CCL3 is as the positive control of receptors bind, and mITAC is as negative control.The specificity combination is to measure by direct ELISA.The result shows with the O.D. reading at 450nm place.

These histograms of Fig. 5 A-C show in EC2, the EC3 of mCCR5-Ig and the N structural domain specificity and the ability of CCL3, CCL4 and CCL5 inductive THP-1 cell migration.Having carried out external commentaries on classics hole (transwell) migration measures.In brief, will change hole and 15ng/ hole mouse CCL3,10ng/ hole mouse CCL4 and 50ng/ hole mouse CCL5 together with different mCCR5-IgG extracellular domain (as mentioned above) incubation in 1 μ g/ hole or 10 μ g/ holes 30 minutes.Make the THP-1 cell hungry 24 hours, and be added to the last cell (upper chamber) that changes orifice plate then.After 3 hours, count the THP-1 cell of migration at 37 ℃ of following incubations by FACS.This figure of Fig. 5 A has shown mouse CCL3 institute inductive chemotaxis.This figure of Fig. 5 B has shown mouse CCL4 institute inductive chemotaxis.This figure of Fig. 5 C has shown mouse CCL5 institute inductive chemotaxis.

This histogram of Fig. 6 shows the ability that people CCR5-IgG suppresses the migration of MIP-1 α (CCL3) inductive THP-1 cell.Having carried out the migration of external commentaries on classics hole measures.In brief, with THP-1 cell (10 ⁶/ hole) be added to the last chamber of changeing orifice plate, CCL3 (recombinant human MIP-1 α) or contrast CCL2 (recombinant human MCP-1) are added to and are supplemented with or do not replenish in the following hole (lower well) of the hCCR5-IgG shown in the figure.After 3 hours, count the THP-1 cell of migration at 37 ℃ of following incubations by FACS.The result shows with three replicate(determination) mean value ± SE.

This illustrates the ability that CCR5 (EC2)-Ig suppresses the ongoing experimental autoimmune encephalomyelitis of mouse (EAE) Fig. 7.In brief, with MOGp35-55 (active induction) induced in the active that three groups of C57/B mouse (every group of 4 mouse) carry out EAE.In seizure of disease (the 12nd day) beginning one day after, CCR5 (the EC2)-IgG (square expression), the IgG (trilateral is represented) or the PBS (circle is represented) of isotype coupling that give (every other day) 300 μ g/ mouse for these mouse repeated intravenous handle.Every day the clinical manifestation of EAE disease is marked by an observer who does not know experimental arrangement.

These several mCCR5-Ig of illustrating of Fig. 8 A-C change the derive cell in vitro factor excretory ability of splenocyte of EAE.In brief, with MOGp35-55 the active that three groups of C57/B mouse (every group of 4 mouse) carry out EAE is induced.At the 9th day results splenocyte, with 50 μ g/mlMOGp35-55 together with the isotype of different concns coupling IgG (mIgG) (rhombus is represented), contrast CCR5[CCR5 (EC3)-IgG (square is represented)] or CCR5 (EC2)-IgG (trilateral is represented) stimulated again 72 hours.By the elisa assay supernatant liquor, to know the cytokine production.This figure of Fig. 8 A has shown the derive TNF-α secretion of splenocyte of EAE.This figure of Fig. 8 B has shown the derive IFN-γ secretion of splenocyte of EAE.This figure of Fig. 8 C has shown the derive IL-12 secretion of splenocyte of EAE.

Preferred embodiment is described

The present invention relates to shla molecule and the pharmaceutical composition that comprises shla molecule, these shla molecules and pharmaceutical composition are used for treating CCR5/CCR5 part relative disease, as the autoimmunization inflammatory diseases.

With following description content, can better understanding be arranged with reference to the accompanying drawings to the principle and the operation of the inventive method.

Before elaborating at least one embodiment of the present invention, will be appreciated that the present invention is not limited to following description detail content given or embodiment institute example on using.The present invention can also have other embodiments, perhaps can implement or carries out in various mode.Equally, it will also be appreciated that word and term purpose that this paper uses are to be described, and should not be considered to limit the present invention.

This C-C Chemokine Receptors member of CCR5 obtains expressing in many cell types, comprises the Th1 lymphocyte.Several C-C chemokine ligands are arranged, comprise CCL3 (MIP-1 α) and CCL5 (RANTES), can be in conjunction with CCR5.Recently, studies have shown that CCR5 and part thereof the importance in the pathogeny of inflammatory diseases such as rheumatoid arthritis (RA) and multiple sclerosis (MS).

Proposed to use the neutrality part to block the CCR5 Mediated Signal Transduction, still, the use of antibody therapy involves harmful that antiidiotype is replied among the host and induces.In addition, (entire repertoire of) CCR5 part that antibody therapy can not effectively neutralize whole makes the CCR5 part be caused the activity signal.

The method of alternative relates to the use soluble receptors.There is various publication to mention this method, but do not imagine or once made up concrete CCR5 molecule.

The inventor finds when the present invention is put into practice, the extracellular domain 2 (EC2) of CCR5 (the amino acid coordinate of CCR5GenBank accession number NP_000570 (amino acidcoordinate) 165-195; SEQ ID NO:18) exclusively with high-affinity in conjunction with the CCR5 part, and other extracellular domains EC1 (amino acid coordinate 88-102 of CCR5GenBank accession number NP_000570; SEQ ID NO:16), EC3 (the amino acid coordinate 261-291 of CCR5GenBank accession number NP_000570; SEQ ID NO:20) and N (the amino acid coordinate 1-34 of CCR5GenBank accession number NP_000570; SEQ ID NO:14) with extremely low avidity in conjunction with CCR5 part (see below embodiment part embodiment 2).Therefore be susceptible to, can use the shla molecule of the EC2 structural domain that comprises CCR5, come by catching CCR5 part (for example CCL3, CCL4 and CCL5) treatment CCR5 relative disease clearly.The solubility bait protein of Chan Shenging (decoy protein) activity is enough high in accordance with the teachings of the present invention, molecule is enough little and bioavailability is enough high, is available for the human treatment.

As hereinafter reaching as described in the embodiment part subsequently, the inventor has made up people and mouse solubility CCR5 fusion polypeptide, and in eukaryotic cell system, express they (embodiment 1 of the embodiment part that sees below).Embodiment 2-3 has proved the exclusive avidity of CCR5-EC2 structural domain and various CCR5 parts.Proved cross reactivity (seeing embodiment 4) between mouse CCR5-EC2 and the people CCR5 part by ELISA.The molecule of Chan Shenging proves and has function in accordance with the teachings of the present invention, and this point obtains proof (seeing embodiment 5 and 6) by the inhibition of CCR5 part inductive cell migration.Suppress the generation (seeing embodiment 8) of pro-inflammatory cytokine among (ex vivo) inhibition EAE in ongoing encephalomyelitis (seeing embodiment 7) and the earlier external back body by (in vivo) in the body, these results have obtained further confirmation.

In a word, the present invention's therapeutic value of shla molecule of the present invention of having instructed content displaying.

Therefore, the present invention has imagined the EC2 structural domain of any CCR5 of comprising and has not preferably had the CCR5 aminoacid sequence of the N-terminal structural domain of CCR5, and/or comprises the composition of this sequence, is used for the treatment of the purposes of CCR5/CCR5 part relative disease such as MS.Importantly, composition of the present invention does not have immunogenicity, to realize maximum therapeutic efficiency.Therefore, the present invention for example is susceptible to the CCR5 sequence is included in the mixture, the CCR5 sequence is to be connected with protein portion (for example allogeneic amino acid sequence) or nonprotein part (for example PEG) in this mixture, and described protein portion or nonprotein part can both prolong the half life of composition in circulation.

Therefore, one aspect of the present invention provides such shla molecule, and it comprises and the allogeneic amino acid sequence that can put together in conjunction with the CCR5 aminoacid sequence of CCR5 part, and wherein this molecule does not have the N-terminal structural domain of CCR5.

Term used herein " solubility " is meant molecule of the present invention dissolving in physiological water solution (pH is about 7, for example the level of dissolution in water-bearing media＞100 μ g/ml), and obvious accumulative ability do not occur.

Word used herein " CCR5 aminoacid sequence " is meant that Mammals (for example people) chemokine C-C acceptor is 5 proteinic, has the peptide moiety to the binding affinity of CCR5 part.It should be noted, can comprise single CCR5 aminoacid sequence in the molecule of the present invention, but preferably comprise at least two kinds of CCR5 aminoacid sequences (for example they have similar avidity), every kind of sequence can both be in conjunction with CCR5 (preferably with the high-affinity combination).Because the increase of avidity (avidity), these polypeptide can be used as the potent inhibitor of CCR5 ligand activity, therefore can give lower dosage.The example of CCR5 aminoacid sequence is seen GenBank accession number NP_000570 (by GenBank accession number NM_000579 coding) or GenBank accession number NP_034047 (by GenBank accession number NM_009917 coding).

CCR5 aminoacid sequence of the present invention comprises the EC2 structural domain of this receptor, but the N-terminal (N-ter) that does not preferably have a this receptor partly (code name of people and mouse structural domain sees the following form 1).Shown in hereinafter embodiment embodiment 2 partly, CCR5 combines by the mediation separately of EC2 structural domain with its part, and N-ter and EC3 structural domain only play insignificant effect in the part combination.

Table 1

" binding affinity " used herein is meant at least 10 ^-6M, 10 ^-7M, 10 ^-8M, 10 ^-9M, 10 ^-10M... minimum K _DValue.

Term used herein " peptide " is contained native peptides (degraded product, the synthetic peptide (synthetically synthesized peptide) of synthesis method or recombinant peptide), peptide mimics (being generally the synthetic peptide of synthesis method) and peptide analogs plan peptide (peptoid) and is partly intended peptide, and can for example have the modification that makes it have more stability in vivo or can penetrate into cell more.This modification includes but not limited to: N-terminal is modified; C-terminal is modified; Peptide bond is modified, and includes but not limited to CH ₂-NH, CH ₂-S, CH ₂-S=O, O=C-NH, CH ₂-O, CH ₂-CH ₂, S=C-NH, CH=CH and CF=CH; Backbone modification and residue are modified.The method for preparing peptide mimics is well known in the art, at for example Ramsden, C.A., ed. (1992), Quantitative Drug Design, Chapter 17.2, among the F.Choplin Pergamon Press detailed description arranged, the document is attached to this paper by reference, as complete proposition in this article.The more details of this respect hereinafter are provided.

Peptide bond in the middle of the peptide (CO-NH-) can for example be replaced by following key and derivative: the N-key (N (CH3)-CO-) that methylates; Ester bond (C (R) H-C-O-O-C (R)-N-); The ketone methene key (CO-CH2-); α-azepine key (NH-N (R)-CO-), wherein R is any alkyl group, for example methyl; Methene amido (carba) key (CH2-NH-); Hydroxy ethylene key (CH (OH)-CH2-); The thioamides key (CS-NH-); Olefinic double bonds (CH=CH-); Key (NH-CO-) for contrary acid amides (retro amide); And peptide derivant (N (R)-CH2-CO-), wherein R is natural " normally " side chain on the carbon atom that is present in.These modifications can occur at any key place on peptide chain, even (2-3 place) occurs at several places simultaneously.

The acid of non-natural that natural aromatic amino acid Trp, Tyr and Phe can be synthesized replaces, and these acid are the ring-methylated derivative, halide derivative and the o-methyl-Tyr of Phe of tetrahydroisoquinoline-3-formic acid (TIC), naphthyl L-Ala (Nol), Phe for example.

Except above, peptide of the present invention also can comprise one or more modified amino acids or one or more non-amino acid monomer (for example lipid acid, compounding sugar etc.).

Term " amino acid " is understood to include: 20 natural amino acids; Often carry out the amino acid of posttranslational modification in vivo, comprise for example oxyproline, phosphoserine and phosphothreonine; With other uncommon amino acid, include but not limited to 2-aminoadipic acid, hydroxylysine, isodesmosine, norvaline, nor-leucine and ornithine.In addition, term " amino acid " had both comprised that D-amino acid also comprised L-amino acid.

Following table 2 and 3 has been listed and can be used for natural amino acid of the present invention (table 2) and amino acid (table 3) unconventional or that modify.

Table 2

Amino acid	The trigram abbreviation	One-letter symbol
			L-Ala	Ala	A
Arginine	Arg	R
			L-asparagine	Asn	N
Aspartic acid	Asp	D
			Halfcystine	Cys	C
Glutamine	Gln	Q
			L-glutamic acid	Glu	E
Glycine	Gly	G
			Histidine	His	H
Isoleucine	Ile	I
			Leucine	Leu	L
Methionin	Lys	K
			Methionine(Met)	Met	M
Phenylalanine	Phe	F
			Proline(Pro)	Pro	P
Serine	Ser	S
			Threonine	Thr	T
Tryptophane	Trp	W
			Tyrosine	Tyr	Y
Xie Ansuan	Val	V
			More than any amino acid	Xaa	X

Table 3

Unconventional amino acid	Code name	Unconventional amino acid	Code name
				Butyrine	Abu	The L-N-methylalanine	Nmala
Alpha-amino group-α-Jia Jidingsuan salt	Mgabu	The L-N-methylarginine	Nmarg
				Amino-cyclopropane-	Cpro	The L-N-methylasparagine	Nmasn
Formate		The L-N-methylaspartic acid	Nmasp
				Aminoisobutyric acid	Aib	L-N-methyl halfcystine	Nmcys
Amino norcamphyl-	Norb	L-N-methyl glutamine	Nmgln
				Formate		L-N-methyl L-glutamic acid	Nmglu
Cyclohexylalanine	Chexa	The L-N-methylhistidine	Nmhis
				The cyclopentyl L-Ala	Cpen	L-N-methyl Isoleucine	Nmile
The D-L-Ala	Dal	The L-N-methylleucine	Nmleu
				The D-arginine	Darg	The L-N-methyllysine	Nmlys
The D-aspartic acid	Dasp	The L-N-methylmethionine	Nmmet
				The D-halfcystine	Dcys	L-N-methyl nor-leucine	Nmnle
The D-glutamine	Dgln	L-N-methyl norvaline	Nmnva
				D-L-glutamic acid	Dglu	L-N-methyl ornithine	Nmorn
The D-Histidine	Dhis	L-N-methylbenzene L-Ala	Nmphe
				The D-Isoleucine	Dile	The L-N-methylproline	Nmpro
The D-leucine	Dleu	L-N-methyl Serine	Nmser
				D-Methionin	Dlys	The L-N-methylthreonine	Nmthr
The D-methionine(Met)	Dmet	The L-N-methyl tryptophan	Nmtrp
				The D-ornithine	Dorn	The L-N-methyltyrosine	Nmtyr
The D-phenylalanine	Dphe	The L-N-methylvaline	Nmval
				The D-proline(Pro)	Dpro	L-N-methylethyl glycine	Nmetg
The D-Serine	Dser	L-N-methyl tertbutyl glycine	Nmtbug
				The D-Threonine	Dthr	The L-nor-leucine	Nle
The D-tryptophane	Dtrp	The L-norvaline	Nva
				D-tyrosine	Dtyr	Alpha-Methyl aminoisobutyric hydrochlorate	Maib
The D-Xie Ansuan	Dval	Alpha-Methyl-γ-An Jidingsuan salt	Mgabu
				D-Alpha-Methyl L-Ala	Dmala	The Alpha-Methyl Cyclohexylalanine	Mchexa
D-Alpha-Methyl arginine	Dmarg	Alpha-Methyl cyclopentyl L-Ala	Mcpen
				D-Alpha-Methyl l-asparagine	Dmasn	Alpha-Methyl-Alpha-Naphthyl L-Ala	Manap
D-Alpha-Methyl aspartate	Dmasp	The Alpha-Methyl Trolovol	Mpen
				D-Alpha-Methyl halfcystine	Dmcys	N-(the amino butyl of 4-) glycine	Nglu

D-Alpha-Methyl glutamine	Dmgln	N-(2-amino-ethyl) glycine	Naeg
				D-Alpha-Methyl Histidine	Dmhis	N-(3-aminopropyl) glycine	Norn
D-Alpha-Methyl Isoleucine	Dmile	N-amino-α-Jia Jidingsuan salt	Nmaabu
				D-Alpha-Methyl leucine	Dmleu	The Alpha-Naphthyl L-Ala	Anap
D-Alpha-Methyl Methionin	Dmlys	N-benzyl glycine	Nphe
				D-Alpha-Methyl methionine(Met)	Dmmet	N-(2-formamyl ethyl) glycine	Ngln
D-Alpha-Methyl ornithine	Dmorn	N-(carbamyl ylmethyl) glycine	Nasn
				D-Alpha-Methyl phenylalanine	Dmphe	N-(2-carboxy ethyl) glycine	Nglu
D-Alpha-Methyl proline(Pro)	Dmpro	N-(carboxyl methyl) glycine	Nasp
				D-Alpha-Methyl Serine	Dmser	N-cyclobutyl glycine	Ncbut
D-Alpha-Methyl Threonine	Dmthr	N-suberyl glycine	Nchep
				D-Alpha-Methyl tryptophane	Dmtrp	The N-Cyclohexylglycine	Nchex
The D-alpha-methyltyrosine	Dmtyr	N-ring decyl glycine	Ncdec
				D-Alpha-Methyl Xie Ansuan	Dmval	N-cyclo-dodecyl glycine	Ncdod
The D-N-methylalanine	Dnmala	N-ring octyl group glycine	Ncoct
				The D-N-methylarginine	Dnmarg	N-cyclopropyl glycine	Ncpro
The D-N-methylasparagine	Dnmasn	N-ring undecyl glycine	Ncund
				D-N-methylaspartic acid salt	Dnmasp	N-(2, the 2-diphenyl-ethyl) glycine	Nbhm
D-N-methyl halfcystine	Dnmcys	N-(3, the 3-diphenyl-ethyl) glycine	Nbhe
				The D-N-methylleucine	Dnmleu	N-(3-indyl ethyl) glycine	Nhtrp
The D-N-methyllysine	Dnmlys	N-methyl-γ-An Jidingsuan salt	Nmgabu
				N-methylcyclohexyl L-Ala	Nmchex	The D-N-methylmethionine	Dnmmet
D-N-methyl ornithine	Dnmorn	N-methylcyclopentyl L-Ala	Nmcpen
				Sarcosine	Nala	D-N-methylbenzene L-Ala	Dnmphe
N-methylamino isobutyrate	Nmaib	The D-N-methylproline	Dnmpro
				N-(1-methyl-propyl) glycine	Nile	D-N-methyl Serine	Dnmser
N-(2-methyl-propyl) glycine	Nile	D-N-methyl Serine	Dnmser
				N-(2-methyl-propyl) glycine	Nleu	The D-N-methylthreonine	Dnmthr
The D-N-methyl tryptophan	Dnmtrp	N-(1-methylethyl) glycine	Nva
				The D-N-methyltyrosine	Dnmtyr	N-methyl naphthyl L-Ala	Nmanap
The D-N-methylvaline	Dnmval	N-methyl penicillanate amine	Nmpen
				γ-An Jidingsuan	Gabu	N-(p-hydroxybenzene) glycine	Nhtyr
L-tertiary butyl glycine	Tbug	N-(sulphomethyl) glycine	Ncys
				The L-ethyl glycine	Etg	Trolovol	Pen
The L-hyperphenylalaninemia	Hphe	L-Alpha-Methyl L-Ala	Mala
				L-Alpha-Methyl arginine	Marg	L-Alpha-Methyl l-asparagine	Masn

L-Alpha-Methyl aspartate	Masp	L-Alpha-Methyl tertiary butyl glycine	Mtbug
				L-Alpha-Methyl halfcystine	Mcys	L-methylethyl glycine	Metg
L-Alpha-Methyl glutamine	Mgln	L-Alpha-Methyl glutaminate	Mglu
				L-Alpha-Methyl Histidine	Mhis	L-Alpha-Methyl hyperphenylalaninemia	Mhphe
L-Alpha-Methyl Isoleucine	Mile	N-(2-methyl thio-ethyl) glycine	Nmet
				D-N-methyl glutamine	Dnmgln	N-(3-guanidine radicals propyl group) glycine	Narg
D-N-methyl glutaminate	Dnmglu	N-(1-hydroxyethyl) glycine	Nthr
				The D-N-methylhistidine	Dnmhis	N-(hydroxyethyl) glycine	Nser
D-N-methyl Isoleucine	Dnmile	N-(imidazolyl ethyl) glycine	Nhis
				The D-N-methylleucine	Dnmleu	N-(3-indyl ethyl) glycine	Nhtrp
The D-N-methyllysine	Dnmlys	N-methyl-γ-An Jidingsuan salt	Nmgabu
				N-methylcyclohexyl L-Ala	Nmchex	The D-N-methylmethionine	Dnmmet
D-N-methyl ornithine	Dnmorn	N-methylcyclopentyl L-Ala	Nmcpen
				Sarcosine	Nala	D-N-methylbenzene L-Ala	Dnmphe
N-methylamino isobutyrate	Nmaib	The D-N-methylproline	Dnmpro
				N-(1-methyl-propyl) glycine	Nile	D-N-methyl Serine	Dnmser
N-(2-methyl-propyl) glycine	Nleu	The D-N-methylthreonine	Dnmthr
				The D-N-methyl tryptophan	Dnmtrp	N-(1-methylethyl) glycine	Nva
The D-N-methyltyrosine	Dnmtyr	N-methyl naphthyl L-Ala	Nmanap
				The D-N-methylvaline	Dnmval	N-methyl penicillanate amine	Nmpen
γ-An Jidingsuan	Gabu	N-(p-hydroxybenzene) glycine	Nhtyr
				L-tertiary butyl glycine	Tbug	N-(sulphomethyl) glycine	Ncys
The L-ethyl glycine	Etg	Trolovol	Pen
				The L-hyperphenylalaninemia	Hphe	L-Alpha-Methyl L-Ala	Mala
L-Alpha-Methyl arginine	Marg	L-Alpha-Methyl l-asparagine	Masn
				L-Alpha-Methyl aspartate	Masp	L-Alpha-Methyl tertiary butyl glycine	Mtbug
L-Alpha-Methyl halfcystine	Mcys	L-methylethyl glycine	Metg
				L-Alpha-Methyl glutamine	Mgln	L-Alpha-Methyl glutaminate	Mglu
L-Alpha-Methyl Histidine	Mhis	L-Alpha-Methyl hyperphenylalaninemia	Mhphe
				L-Alpha-Methyl Isoleucine	Mile	N-(2-methyl thio-ethyl) glycine	Nmet
L-Alpha-Methyl leucine	Mleu	L-Alpha-Methyl Methionin	Mlys
				L-Alpha-Methyl methionine(Met)	Mmet	L-Alpha-Methyl nor-leucine	Mnle
L-Alpha-Methyl norvaline	Mnva	L-Alpha-Methyl ornithine	Morn
				L-Alpha-Methyl phenylalanine	Mphe	L-Alpha-Methyl proline(Pro)	Mpro
L-Alpha-Methyl Serine	Mser	L-Alpha-Methyl Threonine	Mthr
				L-Alpha-Methyl Xie Ansuan	Mval	The L-alpha-methyltyrosine	Mtyr

L-Alpha-Methyl leucine	Mleu	L-N-methyl hyperphenylalaninemia	Nmhphe
				N-(N-(2, the 2-diphenyl-ethyl) formamyl methylglycine	Nnbhm	N-(N-(3, the 3-diphenyl propyl) formamyl methylglycine	Nnbhe
1-carboxyl-1-(2,2-diphenyl-ethyl amino) cyclopropane	Nmbc

Peptide of the present invention preferably uses with linear form, but it should be understood that in cyclic action and can seriously not disturb in the situation of peptide characteristic, also can use the peptide of ring form.

The generation of the peptide mimics that hereinafter is described to can use multiple diverse ways to realize, comprises for example display technique.

Therefore, the display libraries that comprises a plurality of display carriers (as phage, virus or bacterium) is contained in the present invention, and each displaying is spread out from 5,7,11,15,20,25 continuous amino acids of the peptide sequence of the EC2 of CCR5 (for example SEQ ID NO:10 or 18) at least at least at least at least at least at least.

The method that makes up this display libraries is well known in the art.This method is described in for example following document: Young AC, et al, " The three-dimensional structures of apolysaccharide binding antibody to Cryptococcus neoformans and itscomplex with a peptide from a phage display library:implications for theidentification of peptide mimotopes (three-dimensional structure of the polysaccharide binding antibody of anti-Cryptococcus neoformans (Cryptococcusneoformans) and with mixture from the peptide of phage display library: for the meaning of the evaluation of peptide mimic epitopes) " J MoI Biol 1997 Dec12; 274 (4): 622-34; Giebel LB et al. " Screening of cyclic peptide phagelibraries identifies ligands that bind streptavidin with high affinities (can identify the screening of cyclic peptide phage library can be with the part of high-affinity in conjunction with Streptavidin) " Biochemistry 1995 Nov 28; 34 (47): 15430-5; Davies EL et al, " Selectionof specific phage-display antibodies using libraries derived from chickenimmunoglobulin genes (selecting specific phage to show antibody from the library of chicken immune globulin gene) " J Immunol Methods 1995 Oct 12 with spreading out; 186 (1): 125-35; JonesC RT al. " Current trends in molecular recognition and bioseparation (the current progress of molecular recognition and bioseparation) " J Chromatogr A 1995M 14; 707 (1): 3-22; Deng SJ et al " Basis for selection of improved carbohydrate-bindingsingle-chain antibodies from synthetic gene libraries (selecting the ultimate principle of improved carbohydrate from the synthetic gene library) " Proc Natl Acad Sci US A 1995 May 23 in conjunction with single-chain antibody; 92 (11): 4992-6; With Deng SJ et al " Selection of antibodysingle-chain variable fragments with improved carbohydrate binding byphage display (select by phage display with improved carbohydrate binding ability antibody single chain variable fragment) " J Biol Chem 1994 Apr 1; 269 (13): 9533-8, these documents are attached to herein by reference.

Peptide mimics also can be found with the calculating biological method.Can use the software program that can be used for showing 3 d structure model, as RIBBONS (Carson, M., 1997.Methods inEnzymology 277,25), O (Jones, TA.et al, 1991.Acta Crystallogr.A47,110), DINO (DINO:Visualizing Structural Biology (2001) http://www.dino3d.org); And QUANTA, INSIGHT, SYBYL, MACROMODE, ICM, MOLMOL, RASMOL and GRASP (summarize in Kraulis, J., 1991.Appl Crys tallogr.24,946), simulate the interaction between the peptide mimics of MCP-1 and expection, the highest peptide that combines possibility is arranged thereby identify to show with specific MCP-1 zone.The computation model of protein-peptide interaction successfully has been used for the rational drug design, and more details are referring to Lam et al., and 1994.Science 263,380; Wlodawer et al., 1993.Ann Rev Biochem.62,543; Appelt, 1993.Perspectives in DrugDiscovery and Design 1,23; Erickson, 1993.Perspectives in DrugDiscovery and Design 1,109 and Mauro MJ.et al., 2002.J Clin Oncol.20,325-34.

As previously mentioned, the chimeric molecule of this aspect of the present invention comprises the allogeneic amino acid sequence.

Word used herein " allogeneic amino acid sequence " is meant the non-immunogenic aminoacid sequence of a part that does not constitute the CCR5 aminoacid sequence.This sequence preference gives solvability for the molecule of this aspect of the present invention, preferably increases the half life of chimeric molecule in serum.

The allogeneic amino acid sequence is usually located at the amino or the C-terminal of CCR5 peptide of the present invention.

As previously mentioned, this at least one allogeneic amino acid sequence and CCR5 aminoacid sequence of the present invention can be puted together.For example, this at least one CCR5 aminoacid sequence can be embedded between two heterologous sequences, as described in Hoogenboom (1991) Mol.Immunol.28:1027-1037.Can the allogeneic amino acid sequence be connected with the CCR5 aminoacid sequence by any peptide bond or non-peptide bond.The CCR5 aminoacid sequence is connected with the allogeneic amino acid sequence, can close (peptide bond of peptide bond or replacement) by direct covalent bonds or indirectly realizes in conjunction with (as have the joint of functional group by use).Functional group includes but not limited to free carboxy acid (C (=O) OH), free amine group (NH ₂), ester group (C (=O) OR, wherein R is alkyl, cycloalkyl or aryl), acyl halide group (C (=O) A, wherein A is fluorine, chlorine, bromine or iodine), halogen (fluorine, chlorine, bromine or iodine), hydroxyl (OH), sulfydryl (SH), itrile group (C ≡ N), free C-carboxylamine group (NR " C (=O)-OR ', wherein R ' and R " independence is hydrogen, alkyl, cycloalkyl or aryl separately).

An example of the allogeneic amino acid sequence that can use according to this aspect of the present invention is the immunoglobulin amino acid sequence, as hinge area and Fc district (referring to the United States Patent (USP) the 6th, 777, No. 196) of heavy chain immunoglobulin structural domain.Immunoglobulin part in the mosaic of this aspect of the present invention can obtain from IgG1 hypotype, IgG2 hypotype, IgG3 hypotype or IgG4 hypotype, IgA, IgE, IgD or IgM, and this does further argumentation hereinafter.

Be connected with suitable immunoglobulin (Ig) constant domain sequence and the mosaic (immunoadhesin) that constructs is well known in the art by receptor sequence.The immunoadhesin of reporting in the document comprises the syzygy [Gascoigne et al., Proc.NatLAcad.Sci.USA, 84:2936-2940 (1987)] of TXi Baoshouti; CD4[Capon et al., Nature 337:525-531 (1989); Traunecker et al., Nature, 339:68-70 (1989); Zettmeissl et al., DNA CellBiol.USA, 9:347-353 (1990); Byrn et al., Nature, 344:667-670 (1990)]; L-selectin (homing receptor) [(Watson et al., J.Cell.Biol., 110:2221-2229 (1990); Watson et al., Nature, 349:164-167 (1991)]; CD44[Aruffo et al., Cell, 61:1303-1313 (1990)]; CD28 and B7 (Linsley et al., J.Exp.Med., 173:721-730 (1991)]; CTLA-4[Lisley et al., J.Exp.Med.174:561-569 (1991)]; CD22[Stamenkovic et al., Cell, 66:1133-1144 (1991)]; TNF acceptor [Ashkenazi et al., Proc.Natl.Acad.Sci.USA, 88:10535-10539 (1991); Lesslauer et al., Eur.J.Immunol., 27:2883-2886 (1991); Peppel et al., J.Exp.Med., 174:1483-1489 (1991)]; NP acceptor [Bennett et al., J.Biol.Chem.266:23060-23067 (1991)]; With IgE acceptor α [Ridgway et al., J.Cell.Biol., 115:abstr.1448 (1991)].

Usually, in this syzygy, chimeric molecule can keep activated hinge arrangement territory and CH2 and CH3 structural domain on the function of immunoglobulin heavy chain constant region at least.Also can form syzygy in the Fc of constant domain partial C end, the N-terminal place of the CH1 that perhaps closelys follow at heavy chain or the respective regions of light chain forms syzygy.

The accurate site of merging (puting together) between heterologous sequence and the CCR5 aminoacid sequence is not crucial.Specific site is well known in the art, can be selected so that the biological activity of the chimeric molecule of this aspect of the present invention, secretion or binding characteristic optimization (embodiment 1 of the embodiment part that vide infra).

Though whole CH and CCR5 aminoacid sequence of the present invention can be puted together, preferably merge short sequence.For example such sequence is used for syzygy, it originates in the just in time similar site of residue 216 (first residue of CH is used as 114) or other immunoglobulin (Ig)s in the hinge area of papoid cleavage site (it is chemically defining IgG Fc) upstream.In particularly preferred embodiments, hinge area and CH2 and the fusion of CH3 structural domain with CCR5 aminoacid sequence and IgG1, IgG2 or IgG3 heavy chain, perhaps merge (referring to United States Patent (USP) the 6th, 777, No. 196) with CH1 structural domain, hinge arrangement territory and CH2 and CH3 structural domain.The accurate site of merging not is crucial, can determine best site by normal experiment.

As previously mentioned, be used to make up the immunoglobulin sequences of the chimeric molecule of this aspect of the present invention, can be from IgG heavy chain immunoglobulin constant domain.Preferred end user IgG1 and IgG3 immunoglobulin sequences (for example shown in the SEQ ID NO.21,22,25 and 26).Use the major advantage of IgG1 to be that IgG1 can obtain purifying effectively on immobilization A albumen.Contrast therewith, the purifying of IgG3 needs G albumen, and G albumen is a kind of obviously medium easily inadequately.But,, should be taken into account other 26S Proteasome Structure and Function characteristics of immunoglobulin (Ig) making up when selecting the Ig fusion partner for carrying out specific mosaic.For example, the IgG3 hinge is longer and more pliable and tougher, so it can hold bigger CCR5 aminoacid sequence, and these big CCR5 aminoacid sequences then may not correctly fold or bring into play function as merging with IgG1.Another Consideration may be a valency; IgG is the divalence homodimer, and Ig hypotype such as IgA and IgM may produce dimerization or five poly structures respectively by basic I g homodimer unit.Other Considerations when selecting the immunoglobulin part of the chimeric molecule of the present invention aspect this at United States Patent (USP) the 6th, 77, have description in No. 196.

The more examples that are usually used in the allogeneic amino acid sequence that fusion rotein makes up include but not limited to the C-terminal peptide and the E.C. 2.3.1.28 (CAT) of tilactase, glucuronidase, glutathione-S-transferase (GST), chorionic-gonadotropin hormone (CG β).

Word used herein " CCR5 part " be meant any can be with K _D=10 ^-6Thereby the minimum avidity of M is in conjunction with the molecule of CCR5 activation signal transduction (for example pro-inflammatory cytokine generation).The example had both comprised the natural of solubility or non-solubility or synthetic chemokines part, also comprise infectious agent to the nutritious effect of CCR5 positive cell [for example virus as HIV (Princen andSchols, Cytok Growth Factor Rev. (2005) 16 (6): 659-77)].The example of CCR5 chemokine ligand includes but not limited to C-C chemokine such as CCL2 (MCP-1), CCL3 (MIP-1 α), CCL4 (M1P-1 β), CCL5 (RANTES), CCL11 (eosinophil chemotactic protein) and CCL16[Blanpain et al., Blood. (1999) 94:1899-905; Nomiyama et al., Int Immunol (2001) (8): 1021-9].

The preferred embodiment of this aspect according to the present invention, the shla molecule of this aspect of the present invention is shown in SEQ ID NO:2 or 4.

Therefore, the molecule of this aspect of the present invention can comprise aforesaid allogeneic amino acid sequence.

In addition or or, as indicated above, CCR5 aminoacid sequence of the present invention partly can be connected with nonprotein, this molecule preferably be chosen in do not have among the experimenter immunogenic.

Therefore, another aspect of the present invention provides such shla molecule, it comprises the CCR5 aminoacid sequence (as mentioned above) that partly is connected with nonprotein, and wherein this CCR5 aminoacid sequence can be in conjunction with the CCR5 part, and this molecule does not have immunogenicity in the experimenter.

This molecule is high stability (can separate activity by the opposed body endoproteinase, this may be because the sterically hindered cause that the nonprotein part is given), the common solid phase synthesis process production of available Cheap highly effective, and this is further described hereinafter.But it should be understood that recombinant technology or operable, the recombinant peptide product can carry out external modification (as PEGization, this is further described hereinafter) thus.

Word used herein " nonprotein part " be meant be connected with above-mentioned CCR5 aminoacid sequence, do not comprise the amino acid whose molecule of peptide linkage.According to currently preferred embodiments, the nonprotein of this aspect of the present invention partly is polymkeric substance or multipolymer (synthetic or natural).The limiting examples of nonprotein part of the present invention comprises polyoxyethylene glycol (PEG), polyvinylpyrrolidone (PVP), divinyl ether copolymer-maleic anhydride (DIVEMA; Referring to for example KanedaY, et al., 1997, Biochem.Biophys.Res.Commun.239:160-5) and Zelan 338 (SMA; Referring to for example Mu Y, et al., 1999, Biochem BiophysRes Commun.255:75-9).

It should be understood that also and this nonprotein part can be connected with above-mentioned fusion molecule (fusion molecule that promptly comprises the allogeneic amino acid sequence),, perhaps also promote solvability to promote the stability of these molecules.

The biology of this nonprotein part is puted together to the CCR5 aminoacid sequence and has been given stability (for example protease inhibitor activity) and/or solvability (for example in the middle of biofluid such as blood, Digestive system), keeps the biological activity of this sequence simultaneously and prolongs the half life of this sequence.Especially short and remove the situation of fast therapeutic protein from blood in half life, it is favourable that biology is puted together.The increase of the protein that biology is puted together half life in blood plasma is to be caused by the increase (this has limited their glomerular filtration) of protein conjugate size and the reduction of the proteolysis due to the polymkeric substance steric hindrance.Usually, each peptide connects many more polymer chains, and the prolongation of half life is big more.But, take measures to make the activity specific (being the combination of CCR5 part) of CCR5 aminoacid sequence of the present invention not reduce.

The biology of CCR5 aminoacid sequence and PEG puts together that (for example PEGization) is available to be realized such as following PEG derivative: the N-hydroxy-succinamide of PEG carboxylic acid (NHS) ester, a methoxyl group PEG ₂The benzotriazole carbonic acid ester derivative of the succinimide ester of-NHS, carboxymethylation PEG (SCM-PEG), PEG, the glycidyl ether of PEG, PEG p-nitrophenyl carbonic ether (PEG-NPC is as methoxyl group PEG-NPC), PEG aldehyde, the adjacent pyridyl-disulphide of PEG-, carbonyl dimidazoles activated PEG, PEG-mercaptan, PEG-maleimide.This PEG derivative can have various molecular weight for commercially available acquisition [referring to for example Catalog, Polyethylene Glycol and Derivatives, 2000 (Shearwater Polymers, Inc., Huntsvlle, Ala.)].If desired, many said derivatives can obtain with unifunctional methoxyl group PEG (mPEG) form.In general, its molecular weight of PEG (MW) that is added to CCR5 aminoacid sequence of the present invention should arrive between about 100kDa (for example 3-30kDa) hundreds of dalton.Can be to use the PEG of larger molecular weight, but may cause the yield of PEGization peptide that certain loss is arranged.Should also be noted that the purity of big PEG molecule, because will obtain the PEG of larger molecular weight, and its purity is the same high with the obtainable purity of lower molecular weight PEG again, and this may be inconvenient.Preferably use at least 85% purity, more preferably at least 90% purity, 95% purity or more highly purified PEG.The PEGization of molecule is for example having further argumentation: Hermanson in the following document, Bioconjugate Techniques, Academic PressSan Diego, Calif. (1996) the 15th chapters, with Zalipsky et al., " SuccinimidylCarbonates of Polyethylene Glycol; " Dunn and Ottenbrite, eds., Polymeric Drugs and Drug Delivery Systems, American Chemical Society, Washington, D.C. (1991).

Can be expediently by site-specific mutagenesis PEG be connected to select location in the CCR5 aminoacid sequence, (be CCR5 part in conjunction with) is maintained as long as the activity of conjugate.The target of PEGization can be the N-terminal of CCR5 aminoacid sequence or any cysteine residues at C-terminal place.In addition or or, other halfcystines can be added to CCR5 aminoacid sequence (for example at N-terminal or C-terminal), thereby serve as the target of PEGization.Can carry out computational analysis, can not undermine active preferred mutagenesis position to select.

The various chemical processes of puting together of activated PEG such as PEG-maleimide, PEG-vinyl sulfone(Remzaol (VS), PEG-acrylate (AC), the adjacent pyridyl disulfide of PEG-all can adopt.The method for preparing activatory PEG molecule is well known in the art.For example, can prepare PEG-VS like this: under argon gas, make methylene dichloride (DCM) solution and the NaH reaction of PEG-OH, then with divinyl sulfone reaction (mol ratio: OH 1: NaH 5: divinyl sulfone 50,0.2 gram PEG/mLDCM).PEG-AC prepares like this: under argon gas, make DCM solution and acrylate chloride and triethylamine reaction (mol ratio: the OH 1: acrylate chloride 1.5: triethylamine 2,0.2 gram PEG/mL DCM) of PEG-OH.This chemical group can be connected to the PEG molecule of linearity, 2 arms, 4 arms or 8 arms.

Though be conjugated on the cysteine residues is a kind of facilitated method that can carry out the amino acid whose PEGization of CCR5 of the present invention, also can use other residues if needed.For example, diacetyl oxide can be used to and NH ₂With the SH radical reaction, rather than COOH, S--S or--SCH ₃Group, and hydrogen peroxide can be used to--SH and-SCH ₃Radical reaction, rather than NH ₂Can adopt and can bring into play reactive chemical process of having established, be suitable for peptide in the required residue condition of puting together under, react.

Biology for CCR5 aminoacid sequence of the present invention and PVP is puted together, the PVP of end of tape COOH is by with 4,4 '-azo is two-and (4-cyanopentanoic acid) be chain-transfer agent for radical initiator and 3-thiohydracrylic acid, in dimethyl formamide, carry out radical polymerization, from N-ethene-2-Pyrrolidone synthetic.The molecular-weight average that is produced is the PVPs of Mr 6,000, can separate and purifying by high performance liquid chromatography, and the terminal COOH group of synthetic PVP activates by N-hydroxy-succinamide/dicyclohexylcarbodiimide method.Basically as Haruhiko Kamada, et al., 2000, Cancer Research 60:6416-6420 (this document is attached to herein by reference) is described, with the activation PVP reaction of CCR5 aminoacid sequence and 60 times of molar excess, this reaction stops with hexosamine (amino caploic acid) (5 times of molar excess are in activation PVP).

Produced put together CCR5 molecule (for example PEGization or that PVP puts together CCR5) with for example high performance liquid chromatography (HPLC) separate, purifying and qualitative.In addition, basically as to described [the MIP-1 α for example of other chemokines, referring to for example Hesselgesser J, 1998 (ibid), this document is attached to herein by reference fully], the purifying of this aspect of the present invention is puted together molecule can be with for example the external test work be further qualitative, and external test is in CCR5 conjugate existence of the present invention or not, and the binding specificity of CCR5 part and its acceptor (for example CCR5) is tested.

The molecule of this aspect of the present invention can for example carry out biochemical process by the solid phase technique that uses standard and synthesize.These methods comprise that independent solid phase synthesis, part solid phase synthesis process, fragment condensation and classical solution are synthetic.Use when these methods preferably can not produce (can't help nucleic acid sequence encoding, " label " as described further below) by recombinant technology when peptide is relatively lacked (being 10kDa) and/or at peptide, therefore relate to different chemical reactions.

The solid-phase peptide synthesis program is well known in the art, John Morrow Stewart and JanisDillaha Young, and Solid Phase Peptide Syntheses (2nd Ed., Pierce ChemicalCompany, 1984) has done further description.

The synthetic peptide can pass through preparative high performance liquid chromatography purifying [Creighton T. (1983) Proteins, structures and molecular principles.WH Freeman and Co.N.Y.], the composition of this peptide can be proved conclusively by amino acid sequencing.

In the situation of a large amount of peptide of the present invention of needs, available recombinant technology produces peptide of the present invention, and these technology for example have description in following document: Bitter et al. (1987) Methods inEnzymol.153:516-544; Studier et al. (1990) Methods in Enzymol.185:60-89; Brisson et al. (1984) Nature 310:511-514; Takamatsu et al. (1987) EMBO J.6:307-311; Coruzzi et al. (1984) EMBO J.3:1671-1680; Brogli et al. (1984) Science 224:838-843; Gurley et al. (1986) Mol.Cell.Biol.6:559-565 and Weissbach ﹠amp; Weissbach, 1988, Methods for PlantMolecular Biology, Academic Press, NY, Section VIII, pp 421-463.

In brief, in host cell, introduce such expression constructs (being expression vector), it comprises isolating polynucleotide, and (promptly the natural origin from these polynucleotide separates, SEQID NO:1 for example, 3,9,17), and these polynucleotide comprise the nucleotide sequence (choosing nucleotide sequence such as SEQ ID NO:21 or 25 frame endomixis with coding allogeneic amino acid sequence wantonly) of coding CCR5 aminoacid sequence of the present invention, and this nucleotide sequence places transcribing under the control of regulatory element such as promotor.

For example, the nucleotide sequence (for example SEQ ID NO:9 or 17) with coding CCR5 peptide of the present invention is connected with immunoglobulin (Ig) cDNA sequence (for example SEQ ID NO:21 or 25) frame is interior.It should be understood that the connection that also can adopt the genome immunoglobulin fragment.In this case, syzygy needs immunoglobulin (Ig) and regulates the sequence existence to express.The cDNA of coding IgG CH can separate from the cDNA library of spleen or peripheral blood lymphocyte from spreading out according to the sequence of announcing by hybridization technique or by polymerase chain reaction (PCR) technology.The nucleotide sequence of coding CCR5 aminoacid sequence and immunoglobulin (Ig) can be connected in series in the expression constructs (carrier), this expression constructs can instruct the efficient expression in selected host cell, and this is further described hereinafter.For the expression in mammalian cell, can use based on pRK5 carrier [Schall et al., Cell, 61:361-370 (1990)] and based on the carrier [Seed, Nature, 329:840 (1989)] of CDM8.Deletion mutagenesis [Zoller et al, Nucleic Acids Res., the 10:6487 (1982) that can use oligonucleotide to instruct; Capon et al., Nature, 337:525-531 (1989)], by removing the designed unnecessary sequence that respectively connects between boundary's codon (junction codon), produce and meet boundary (junction) accurately.Can use the synthetic oligonucleotide, the sequence complementation on wherein per half part and the required either side that meets the boundary; Ideally, these synthetic oligonucleotides are 11-mer to 48-mer.Perhaps, can use round pcr to be connected with in two parts of molecule and the appropriate carriers frame.

The method that expression constructs is incorporated in the host cell is well known in the art, comprises electroporation, lipofection and chemical conversion (for example calcium phosphate).Other is the vide infra embodiment 1 of embodiment part.

" by transforming " cell is cultivated under appropriate condition, and this can allow the coded chimeric molecule of nucleotide sequence obtain expressing.

After having spent predetermined for some time, the chimeric molecule of expressing is reclaimed from cell or cell culture, and carry out purifying according to the end-use of recombinant polypeptide.

In expression vector, can use multiple suitable any in the element transcribed and translate, this depends on the host/vector system that is adopted, describedly transcribe and translate element and comprise [referring to for example Bitter et al., (1987) Methods in Enzymol.153:516-544] such as composing type and inducible promoter, transcriptional enhancer element, transcription terminators.

Expression constructs of the present invention is inserted the transcribing and translate the required element of encoding sequence (mosaic is encoded) to some extent except containing, and also can comprise stability, production, purifying, yield or toxic sequence that engineering design becomes can optimize expressed fusion rotein.

There are multiple prokaryotic organism or eukaryotic cells to can be used as host expression system and come the expressed fusion protein encoding sequence.These cells include but not limited to microorganism, as have transformed the bacterium of the recombinant phage dna, plasmid DNA or the glutinous grain DNA expression vector that contain the mosaic encoding sequence; Transformed the yeast of the recombinant yeast expression vector that contains the mosaic encoding sequence; Infect the recombinant virus expression vector (for example cauliflower mosaic virus CaMV, tobacco mosaic virus (TMV) TMV) that contains the mosaic encoding sequence or transformed the recombinant plasmid expression vector that contains the mosaic encoding sequence such as the vegetable cell system of Ti-plasmids.The preferred mammalian expression system that uses is expressed mosaic of the present invention.

For expressing molecule the selection that host cell system carries out is depended primarily on expression vector.Preferred eukaryotic expression system (for example Mammals and insect) is because they can allow posttranslational modification (for example glycosylation).Another Consideration is needed proteinic amount.Of short duration transfection often can produce a milligram number of stages.For example, can adopt the amendment scheme of calcium phosphate method, use carrier that the 293 human embryonic kidney cells system that adenovirus EIA transforms is carried out of short duration transfection, to carry out efficient expression based on pRK5.Available carrier based on CDM8 passes through DEAE-dextran method rotaring redyeing COS cell (Aruffo et al., Cell, 61:1303-1313 (1990); Zettmeissl et al., DNA Cell Biol.US, 9:347-353 (1990)].More substantial if desired protein can carry out the expression (seeing the embodiment 1 of embodiment part) of molecule after stable transfection host cell system.The N-terminal that it should be understood that molecule exists the hydrophobicity leader sequence can guarantee processing and the secretion of transfectional cell to molecule.

It should be understood that preferred use bacterium or yeast host system, to reduce production costs.But,, may need to produce the back glycosylation because the host bacterium system does not have Protein Glycosylation Overview mechanism.

In any situation, transformant all is to make recombinant polypeptide be able to cultivate under the condition for validity of great expression.Effectively culture condition includes but not limited to allow that protein produces that effective culture medium, bio-reactor, temperature, pH and oxygen condition are arranged.There is effective culture medium to be meant that any cell is therein cultivated to produce the substratum of recombinant chimeric of the present invention.This substratum generally include have assimilable carbon, the aqueous solution of nitrogen and phosphoric acid salt source and suitable salt, mineral substance, metal and other nutrition such as VITAMIN.Cell of the present invention can be at conventional fermenting organism reactor, shake in bottle, test tube, microtitration ware and the flat board and cultivate.Cultivation can be carried out under the temperature of reconstitution cell, pH and the oxygen level being suitable for.This culture condition falls in those of ordinary skills' the skill.

Depend on the carrier and the host system that are used to produce, the protein of the present invention that is produced can be to remain in the middle of the reconstitution cell, be secreted in the fermention medium, be secreted into two spaces (as the periplasmic space in the intestinal bacteria) between the cytolemma, or remain on the outside surface of cell or viromembrane.

After having carried out the cultivation of the scheduled time, just carry out the recovery of recombinant protein.Word " recovery recombinant protein " is meant that collection contains this proteinic whole fermention mediums, and needn't comprise other isolated or purified step.Protein of the present invention can carry out purifying with the purified technology of protein of multiple standards, and these technology are such as but not limited to affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel permeation chromatography, reversed phase chromatography, concanavalin A chromatography, chromatofocusing and difference dissolving.

Molecule of the present invention preferably reclaims with " pure basically " form." pure basically " used herein is meant the purity that can allow this protein effectively be used in actual applications, and this has description hereinafter.

Recombinant molecule of the present invention can carry out purifying by affinity chromatography expediently.Whether A albumen is suitable as affinity ligand, depend on species and the isotype of the immunoglobulin Fc domain used in mosaic.A albumen can be used to the chimeric molecule [Lindmark et al., J.Immunol.Meth., 62:1-13 (1983)] of purifying based on people γ 1, γ 2 or γ 4 heavy chains.G albumen is preferred for all mouse isotypes and is used for people γ 3[Guss et al., EMBO J., 5:1567-1575 (1986)].The solid phase carrier that affinity ligand connected is modal to be agarose, but other solid phase carriers are also available.Mechanically stable solid phase carrier such as controlled pore glass or poly-(SDVB), can make flow velocity faster than be shorter than flow velocity and the process period that agarose can reach process period.Make chimeric molecule and A albumen or G albumen affinity column generation bonded condition, be limited by the characteristic of Fc structural domain fully; That is to say its species and isotype.Usually, when selecting suitable part, directly from non-condition (unconditioned) nutrient solution effective combination just takes place.A distinguishing characteristics of the chimeric molecule of this aspect of the present invention is for people γ 1 molecule, the proteic binding ability of A to be had decline slightly with respect to the antibody of identical Fc type.This aspect of the present invention in conjunction with chimeric molecule, can under acid pH (3.0 or more than), perhaps in containing the neutral pH damping fluid of gentle chaotropic salt, carry out effective wash-out.This affinity chromatography step can produce purity greater than 95% chimeric molecule goods.It is essential that medical grade purity is used for treatment.

Can use other methods well known in the art---or replace based on A albumen or the proteic affinity chromatography of G, or replenishing as this affinity chromatography---come purifying to comprise the chimeric molecule of immunoglobulin part.This chimeric molecule is at close sulphur gel chromatography [Hutchens et al., Anal.Biochem., 159:217-226 (1986)] and immobilization metal inner complex chromatography [Al-Mashikhi et al., J.Dairy Sci., 71:1756-1763 (1988)] in behavior be similar to antibody.But forming correlated with antibody is that their behaviors on ion exchange column not only are limited by their iso-electric point, and are limited by the electric charge dipole that may exist therein owing to the chimeric property of chimeric molecule.

Therefore, can be thereby the invention provides in conjunction with the multiple configuration (configuration) of the shla molecule of CCR5 part neutralisation signals transduction.

Above-mentioned molecule does not preferably have immunogenicity and makes the therapeutic efficiency maximization.

Term used herein " does not have (non-) immunogenicity " and is meant such material, and it can not produce immunne response basically in the experimenter that it is administered to.For example, in human body, there is not immunogenicity to be meant, the chimeric molecule of this aspect of the present invention is contacted with the suitable tissue of human body, spent suitable latent period and given this chimeric molecule once more after (for example 8-14 days), do not demonstrate sensitivity or resistance state this moment this chimeric molecule.

Shown in hereinafter embodiment embodiment 5 and 6 partly, the cell migration of the enough molecules in inhibiting CCR5 mediations of the present invention of inventor's energy and containment ongoing Immunological diseases (embodiment 7), this has confirmed the purposes of this molecule in treatment.

Therefore, another aspect of the present invention is provided at the method for this disease of treatment among the experimenter of the treatment that need carry out CCR5 and/or CCR5 part relative disease.Described method comprises and gives any above-mentioned molecule that this experimenter treats significant quantity, thus treatment experimenter's CCR5 and/or CCR5 part relative disease.

Term used herein " experimenter " is meant Mammals, preferred people experimenter.

Term used herein " treatment " is meant prevention, cures, reverses, weakens, alleviates, minimizes, contains or stops the deleterious effect of CCR5 and/or CCR5 part relevant medical situation.

Term used herein " CCR5 and/or CCR5 part relevant medical situation " is meant that its outbreak or progress depend on the interactional medical condition (for example disease, syndrome or the patient's condition) between CCR5 part and the CCR5.

This area reference example of CCR5 and/or CCR5 part relevant medical situation includes but not limited to inflammatory diseases, autoimmune disease, allergy (for example asthma), inflammatory bowel (for example Crohn disease and ulcerative colitis), scleroderma, psoriasis, inflammatory dermatosis (for example dermatitis), sacroiliitis [rheumatoid arthritis (Pokorny et al., Ann Rheum Dis (2005) 64:487-490 for example; Wang and Liu, Clin Exp Immunol (2003) 132:371-8; Nissinen et al., J Rheumatol (2003) 30:1928-34; Mack et al., ArthritisRheum (1999) 42:981-8)], multiple sclerosis [Zang et al., Brain (2000) 123 (9): 1874-1882], systemic lupus erythematous, myasthenia gravis, the diabetes of teenager's type, ephritis (for example glomerulonephritis), the autoimmunization thyroiditis, shellfish Sai Teshi disease, cancer (as leukocyte infiltration) with skin and organ, some hematologic malignancies, the toxicity of cytokine induction (septic shock for example, endotoxin shock), atherosclerosis, immunosuppression (for example because immunodeficiency syndrome such as AIDS), virus disease [for example HIV 1 and 2 (Liuet al., Cell (1996) 86:367-377)].

Each example of the inflammatory diseases that is included in the scope of the present invention includes but not limited to,

Word used herein " inflammatory lesion " includes but not limited to chronic inflammatory disease and pathology and acute inflammation disease and pathology.Hereinafter sum up the example of this disease and the patient's condition.

The inflammatory diseases relevant with hypersensitivity

The example of hypersensitivity includes but not limited to I type hypersensitivity, II type hypersensitivity, III type hypersensitivity, IV hypersensitivity, the speed property sent out hypersensitivity, antibody-mediated hypersensitivity, immunocomplex mediation hypersensitivity, T cell mediated hypersensitivity and DTH.

I type or the speed property sent out hypersensitivity such as asthma.

II type hypersensitivity includes but not limited to rheumatism, rheumatoid autoimmune disorder, rheumatoid arthritis (Krenn V.et al.Histol Histopathol 2000Jul; 791), spondylitis, ankylosing spondylitis (Jan Voswinkel et al.Arthritis Res 2,001 15 (3):; 189), systemic disease, systemic autoimmune disorder, systemic lupus erythematous (EriksonJ.et al.Immunol Res 1,998 3 (3):; 49), sclerosis, systemic sclerosis (Renaudineau Y.et al.Clin Diagn Lab Immunol.1999 Mar 17 (1-2):; 6 (2): 156); Chan OT.et al.Immunol Rev 1999Jun; 169:107), body of gland disease, body of gland autoimmune disorder, pancreas autoimmune disorder, diabetes, type i diabetes (Zitnmet P.Diabetes Res Clin Pract 1996 Oct; 34 Suppl:S125), thyroid disease, autoimmune thyroid disease, Graves' disease (Orgiazzi J.Endocrinol Metab ClinNorth Am 2000 Jun; 339), thyroiditis, SAT (Braley-Mullen H.and Yu S, J Immunol 2000 Dec 15 29 (2):; 7262), Hashimoto thyroiditis (Toyoda N.et al.Nippon Rinsho 1999 Aug 165 (12):; 1810), solid edema, special property solid edema (the Mitsuma T.Nippon Rinsho.1999 Aug that sends out 57 (8):; 57 (8): 1759); Autoimmunity reproductive disease, disease of ovary, ovary autoimmunity (GarzaKM.et al.J Reprod Immunol 1998 Feb; 87), the anti-sperm infertility of autoimmunity (Diekman AB.et al.Am J Reprod Immunol.2000 Mar 37 (2):; 134), habitual abortion (Tincani A.et al.Lupus 1,998 43 (3):; 7 Suppl 2:S107-9), neurodegenerative disease, nervous system disease, nervosa autoimmune disorder, multiple sclerosis (Cross AH.et al.J Neuroimmunol 2001 Jan 1; 1), alzheimer disease (Oron L.etal.J Neural Transm Suppl.1997 112 (1-2):; 49:77), myasthenia gravis (Infante AJ.AndKraig E, Int Rev Immunol 1999; 83), motor neuron (Kornberg AJ.J Clin Neurosci.2000 May 18 (1-2):; 191), Guillain-Barre syndrome, neuropathy and autoimmunity neuropathy (Kusunoki S.Am J Med Sci.2000 Apr 7 (3):; 234), myasthenia disease, Lambert-Eaton myasthenic syndrome (Takamori M.Am J Med Sci.2000 Apr 319 (4):; 204), the outer nervous system disease of knurl, cerebellar atrophy, the outer cerebellar atrophy of knurl, the outer stiff man syndrome of non-knurl, cerebellar atrophy, carrying out property cerebellar atrophy, encephalitis, Rasmussen encephalitis, amyotrophic lateral sclerosis, Sydeham chorea, Gilles de La Tourette syndrome, multiple endocrine glands disease, autoimmunity multiple endocrine glands disease (Antoine JC.andHonnorat J.Rev Neurol (Paris) 2000 Jan 319 (4):; 156 (1): 23); Neuropathy, dysimmunity (dysimmune) neuropathy (Nobile-Orazio E.et al.Electroencephalogr ClinNeurophysiol Suppl 1999; 50:419); Neuromyotonia, acquired neuromyotonia, arthrogryposis multiplex congenita (Vincent A.et al.Ann N Y Acad Sci.1998May 13; 841:482), cardiovascular disorder, cardiovascular autoimmune disorder, atherosclerosis (Matsuura E.et al.Lupus.1998; 7 Suppl 2:S135), myocardial infarction (VaaralaO.Lupus.1998; 7 Suppl 2:S132), thrombosis (Tincani A.et al.Lupus 1998; 7Suppl 2:S 107-9), granulomatosis, Wegner granulomatosis, arteritis, Takayasu arteritis and Kawasaki syndrome (Praprotnik S.et al.Wien Klin Wochenschr 2000Aug 25; 660), anti-VIII factor autoimmune disorder (Lacroix-Desmazes S.et al.Semin Thromb Hemost.2000 112 (15-16):; 26 (2): 157); Vasculitis, the little blood vessel vasculitis of gangrenosum acne, the many vasculitises of microscope, Churg and Strauss syndrome, glomerulonephritis, few immunity focal necrosis glomerulonephritis, crescent glomerulonephritis (Noel LH.Ann Med Interne (Paris) .2000 May; 178), antiphospholipid syndrome (Flamholz R.et al.J Clin Apheresis 1,999 151 (3):; 171), agonist-like receptor, antibody (the Wallukat G.et al.Am J Cardiol.1999 Jun 17 in heart failure, the heart failure 14 (4):; 83 (12A): 75H), thrombopenic purpura (Moccia F.Ann Ital Med Int.1999Apr-Jun; 14 (2): 114); Hemolytic anemia, autoimmune hemolytic anemia (Efremov DG.et al.Leuk Lymphoma1998 Jan; 285), gastrointestinal illness, GI autoimmune disorder, enteropathy, chronic inflammatory bowel disease (Garcia Herola A.et al.Gastroenterol Hepatol.2000 Jan 28 (3-4):; 16), celiac disease (Landau YE.and Shoenfeld Y.Harefuah 2000 Jan 16 23 (1):; 122), the autoimmune disorder of muscle tissue, myositis, autoimmunity myositis, Sjogren syndrome (Feist E.et al.Int Arch Allergy Immunol 2000 Sep 138 (2):; 92), unstriated muscle autoimmune disorder (Zauli D.et al.Biomed Pharmacother 1999 Jun 123 (1):; 234), hepatopathy, liver autoimmune disorder, autoimmune hepatitis (Manns MP.JHepatol 2000 Aug 53 (5-6):; 326) and primary biliary cirrhosis (Strassburg CP.etal.Eur J Gastroenterol Hepatol.1999 Jun 33 (2):; 11 (6): 595).

The cell-mediated hypersensitivity of IV type or T includes but not limited to rheumatism, rheumatoid arthritis (Tisch R, McDevitt HO.Proc Natl Acad Sci U S A 1994 Jan 18; 91 (2): 437), systemic disease, systemic autoimmune disorder, systemic lupus erythematous (DattaSK., Lupus 1998; 591), body of gland disease, body of gland autoimmune disorder, pancreatic disease, pancreas autoimmune disorder, type i diabetes (Castano L.and Eisenbarth GS.Ann.Rev.Immunol.8:647), thyroid disease, autoimmune thyroid disease, Graves' disease (Sakata S.et al.Mol Cell Endocrinol 1993Mar 7 (9):; 77), disease of ovary (Garza KM.et al.J Reprod Immunol 1998 Feb 92 (1):; 87), prostatitis, autoimmunity prostatitis (Alexander RB.et al.Urology 1997 Dec 37 (2):; 893), polyglandular syndrome, autoimmune polyglandular syndrome, I type autoimmune polyglandular syndrome (Hara T.et al.Blood.1991 Mar 1 50 (6):; 1127), nervous system disease, autoimmunity nervous system disease, multiple sclerosis, neuritis, optic neuritis (Soderstrom M.et al.J Neurol Neurosurg Psychiatry 1994 May 77 (5):; 544), myasthenia gravis (Oshima M.et al.Eur J Immunol 1990 Dec 57 (5):; 2563), stiff man syndrome (Hiemstra HS.et al.Proc Natl Acad Sci U S A2001 Mar 27 20 (12):; 3988), heart autoimmunity (Cunha-Neto E.et al.J Clin Invest 1996 Oct 15 in the cardiovascular disorder, Chagas disease 98 (7):; 1709), autoimmune thrombocytopenic purpura (Semple JW.et al.Blood 1996 May 15 98 (8):; 4245), anti-helper T lymphocyte autoimmunity (Caporossi AP.et al.ViralImmunol 1,998 87 (10):; 9), hemolytic anemia (Sallah S.et al.Ann Hematol 1997Mar 11 (1):; 139), hepatopathy, liver autoimmune disorder, hepatitis, chronic active hepatitis (Franco A.et al.Clin Immunol Immunopathol 1990 Mar 74 (3):; 382), cholehepatocirrhosis, primary biliary cirrhosis (Jones DE.Clin Sci (Colch) 1996Nov 54 (3):; 551), ephrosis, kidney autoimmune disorder, ephritis, interstitial nephritis (KellyCJ.J Am Soc Nephrol 1990 Aug 91 (5):; 140), connective tissue disease, otopathy, autoimmunity connective tissue disease, autoimmunity otopathy (Yoo TJ.et al.Cell Immunol1994 Aug l (2):; 249), disease of inner ear (Gloddek B.et al.Ann N Y Acad Sci1997 Dec 29 157 (1):; 830:266), dermatosis (skin disease), dermatosis (cutaneousdisease), dermal disorder, bleb dermatosis, pemphigus vulgaris, bullous pemphigoid and pemphigus foliaceus.

The example of delaying type hypersensitivity includes but not limited to contact dermatitis and drug rash.

The example of the hypersensitivity type of T cell mediated includes but not limited to helper T lymphocyte and cytotoxic lymphocyte.

The example of the hypersensitivity of helper T lymphocyte mediation includes but not limited to T _hThe hypersensitivity of 1 cell mediated and T _hThe hypersensitivity of 2 cell mediated.

Autoimmune disorder

Include but not limited to cardiovascular disorder, rheumatism, body of gland disease, gastrointestinal illness, dermatosis, hepatopathy, nervous system disease, muscle disease, ephrosis, reproduction relative disease, connective tissue disease and systemic disease.

The example of autoimmunity cardiovascular disorder includes but not limited to atherosclerosis (Matsuura E.et al.Lupus.1998; 7 Suppl 2:S135), myocardial infarction (Vaarala O.Lupus.1998; 7 Suppl 2:S132), thrombosis (Tincani A.et al.Lupus 1998; 7Suppl 2:S 107-9), Wegner granulomatosis, Takayasu arteritis, Kawasaki syndrome (Praprotnik S.et al.Wien Klin Wochenschr 2000 Aug 25; 660), anti-VIII factor autoimmune disorder (Lacroix-Desmazes S.et al.Semin Thromb Hemost.2000 112 (15-16):; 157), the little blood vessel vasculitis of gangrenosum acne, the many vasculitises of microscope, Churg and Strauss syndrome, few immunity focal necrosis and crescent glomerulonephritis (Noel LH.Ann Med Interne (Paris) .2000 May 26 (2):; 178), antiphospholipid syndrome (Flamholz R.et al.J Clin Apheresis 1,999 151 (3):; 171), heart failure (the Wallukat G.et al.Am J Cardiol.1999 Jun17 of antibody induction 14 (4):; 83 (12A): 75H), thrombopenic purpura (Moccia F.Ann Ital Med Int.1999Apr-Jun; 14 (2): 114; Semple JW.et al.Blood 1996 May 15; 4245), autoimmune hemolytic anemia (Efremov DG.et al.Leuk Lymphoma1998 Jan 87 (10):; 28 (3-4): 285; Sallah S.et al.Ann Hematol 1997 Mar; 139), heart autoimmunity (the Cunha-Neto E.et al.J Clin Invest1996 Oct 15 in the Chagas disease 74 (3):; 1709) and anti-helper T lymphocyte autoimmunity (CaporossiAP.et al.Viral Immunol 1,998 98 (8):; 11 (1): 9).

The example of autoimmunity rheumatism includes but not limited to rheumatoid arthritis (Krenn V.et al.Histol Histopathol 2000 M; 15 (3): 791; Tisch R, McDevitt HO.Proc Natl Acad Sci units S A 1994 Jan 18; 437) and ankylosing spondylitis (Jan Voswmkel et al.Arthritis Res 2,001 91 (2):; 3 (3): 189).

The example of autoimmunity body of gland disease includes but not limited to pancreatic disease, type i diabetes, thyroid disease, Graves' disease, thyroiditis, SAT, Hashimoto thyroiditis, the special property sent out solid edema, the ovary autoimmunity, the anti-sperm infertility of autoimmunity, autoimmunity prostatitis and I systemic autoimmune polyglandular syndrome, the autoimmunity of pancreas, type i diabetes (Castano L.and Eisenbarth GS.Ann.Rev.Immunol.8:647; Zimmet P.Diabetes Res Clin Pract 1996 Oct; 34Suppl:S125), autoimmune thyroid disease, Graves' disease (Orgiazzi J.Endocrinol Metab Clin North Am 2000 Jun; 29 (2): 339; Sakata S.et al.Mol Cell Endocrinol 1993 Mar; 77), SAT (Braley-Mullen H.and Yu S, J Immunol 2000 Dec 15 92 (1):; 7262), Hashimoto thyroiditis (Toyoda N.et al.Nippon Rinsho 1999 Aug 165 (12):; 1810), special property solid edema (the Mitsuma T.Nippon Rinsho.1999 Aug that sends out 57 (8):; 1759), ovary autoimmunity (Garza KM.et al.J Reprod Immunol 1998 Feb 57 (8):; 87), the anti-sperm infertility of autoimmunity (Diekman AB.et al.Am J Reprod Immunol.2000 Mar 37 (2):; 134), autoimmunity prostatitis (Alexander RB.et al.Urology 1997 Dec 43 (3):; 893) and I type autoimmune polyglandular syndrome (Hara T.et al.Blood.1991 Mar 1 50 (6):; 77 (5): 1127).

The example of autoimmunity gastrointestinal illness includes but not limited to chronic inflammatory bowel disease (GarciaHerola A.et al.Gastroenterol Hepatol.2000 Jan; 16), celiac disease (Landau YE.and Shoenfeld Y.Harefuah 2000 Jan 16 23 (1):; 122), colitis, ileitis and Crohn disease 138 (2):.

The example of autoimmunization dermatosis includes but not limited to autoimmunity bleb dermatosis, as but be not limited to pemphigus vulgaris, bullous pemphigoid and pemphigus foliaceus.

The example of autoimmune liver disease includes but not limited to hepatitis, ACAH (Franco A.et al., Clin Immunol Immunopathol 1990 Mar; 382), primary biliary cirrhosis (Jones DE.Clin Sci (Colch) 1996 Nov 54 (3):; 91 (5): 551; Strassburg CP.et al., Eur J Gastroenterol Hepatol.1999 Jun; 595) and autoimmune hepatitis (Manns MP.J Hepatol 2000 Aug 11 (6):; 33 (2): 326).

The example of autoimmunity nervous system disease includes but not limited to multiple sclerosis (CrossAH.et al., J Neuroimmunol 2001 Jan 1; 1), alzheimer disease (OronL.et al., J Neural Transm Suppl.1997 112 (1-2):; 49:77), myasthenia gravis (Infante AJ.And Kraig E, Int Rev Immunol 1999; 18 (1-2): 83; Oshima M.et al, Eur JImmunol 1990 Dec; 2563), neuropathy, motor neuron (Romberg AJ.JClin Neurosci.2000 May 20 (12):; 191), Guillain-Barre syndrome and autoimmunity neuropathy (Kusunoki S.Am J Med Sci.2000 Apr 7 (3):; 234), myasthenia, Lambert-Eaton myasthenic syndrome (Takamori M.Am J Med Sci.2000 Apr 319 (4):; 319 (4): 204); The outer nervous system disease of knurl, cerebellar atrophy, the outer cerebellar atrophy of knurl and stiff man syndrome (Hiemstra HS.et al., Proc Natl Acad Sci units S A 2001 Mar 27; 3988), the outer stiff man syndrome of non-knurl, carrying out property cerebellar atrophy, encephalitis, Rasmussen encephalitis, amyotrophic lateral sclerosis, Sydeham chorea, Gilles de La Tourette syndrome and autoimmunity multiple endocrine glands disease (Antoine JC.and Honnorat J.RevNeurol (Paris) 2000 Jan 98 (7):; 156 (1): 23); Dysimmunity neuropathy (Nobile-Orazio E.et al., Electroencephalogr Clin Neurophysiol Suppl 1999; 50:419); Acquired neuromyotonia, arthrogryposis multiplex congenita (Vincent A.et al., Ann N YAcad Sci.1998 May 13; 841:482), neuritis, optic neuritis (Soderstrom M.et al., J Neurol Neurosurg Psychiatry 1994 May; 544) and neurodegenerative disease 57 (5):.

The example of autoimmunity muscle disease includes but not limited to myositis, autoimmunity myositis and primary Sjogren syndrome (Feist E.et al., Int Arch Allergy Immunol 2000Sep; 92) and unstriated muscle autoimmune disorder (Zauli D.et al., BiomedPharmacother 1999 Jun 123 (1):; 53 (5-6): 234).

The example of autoimmune nephrosis includes but not limited to ephritis and autoimmunity interstitial nephritis (Kelly CJ.J Am Soc Nephrol 1990 Aug; L (2): 140).

The example that relates to the autoimmune disorder of reproduction includes but not limited to habitual abortion (Tincani A.et al.Lupus 1998; 7 Suppl 2:S107-9).

The example of autoimmunity connective tissue disease includes but not limited to otopathy, autoimmunity otopathy (Yoo TJ.et al.Cell Immunol 1994 Aug; 249) and the autoimmune disorder of inner ear (Gloddek B.et al.Ann N Y Acad Sci 1997 Dec 29 157 (1):; 830:266).

The example of autoimmunity systemic disease includes but not limited to systemic lupus erythematous (Erikson J.et al.Immunol Res 1998; 49) and systemic sclerosis (Renaudineau Y.et al.Clin Diagn Lab Immunol.1999 Mar 17 (1-2):; 6 (2): 156); Chan OT.et al.Immunol Rev 1999 Jun; 169:107).

Communicable disease

The example of communicable disease includes but not limited to chronic infection disease, subacute infection disease, acute infectious disease, virus disease, bacteriosis, protozoon property disease, parasitic diseases, fungal disease, mycoplasma disease and Protein virus property disease.

The transplant rejection disease

Include but not limited to transplant rejection, chronic transplant rejection, subacute transplant rejection, super acute transplant rejection, acute transplant rejection and graft versus host disease (GVH disease) with the example of the transplanting diseases associated of graft.

Anaphylactic disease

The example of anaphylactic disease includes but not limited to asthma, measles, rubella, pollen hypersensitivity, dust mite allergy, snake venom allergy, cosmetic allergic contact dermatitis, latex allergy, chemical allergy, drug allergy, insect bite allergy, animal soft flocks allergy, seta plant allergy, poison ivy allergy and food anaphylaxis.

Cancerous disease

The example of cancer includes but not limited to cancer, lymphoma, blastoma, sarcoma and leukemia.The specific examples of Cancerous disease includes but not limited to myelogenous leukemia such as chronic myelogenous leukemia, acute festering type myelogenous leukemia, acute promyelocytic leukemia, acute non-lymph gland leukemia companion basophilia, acute monocytic leukemia, acute myelomonocytic leukemia companion eosinophilia; The non-Hodgkin lymphoma of malignant lymphoma such as Birkitt lymphoma; Lymphocytic leukemia such as acute lymphoblastic leukemia, lymphocytic leukemia; Myeloproliferative diseases such as solid tumor, optimum meningioma, the mixed tumor of glandula, adenoma of colon; Gland cancer such as small cell lung cancer, sarcoma of kidney, sarcoma of uterus, sarcoma of prostate, sarcoma of bladder, ovarian sarcoma, colon sarcoma, liposarcoma, mucoid knurl, synovial sarcoma, rhabdosarcoma (vesicle), the outer mucoid chondrosarcoma of bone, Ewing knurl; Other comprise testis Testicular and dysgerminoma of ovary, retinoblastoma, Wilms knurl, neuroblastoma, malignant melanoma, mesothelioma, mastadenoma, skin tumour, prostate tumor and oophoroma.

But molecule former state of the present invention gives the experimenter, perhaps gives the experimenter in pharmaceutical composition, it in pharmaceutical composition be with suitable carriers or mixed with excipients together.

Therefore, another aspect of the present invention provides pharmaceutical composition and drug acceptable carrier.

" pharmaceutical composition " used herein is meant the preparation that suitable carriers is become with vehicle on one or more activeconstituentss as herein described and other chemical ingredientss such as the physiology.The purpose of pharmaceutical composition is to promote compound giving to organism.Preferably, pharmaceutical composition does not have immunogenicity.

Term used herein " activeconstituents " is meant the molecule of the present invention that causes predetermined biological effect.

Word hereinafter " physiologically acceptable carrier " and " medicine acceptable carrier " can be used mutually, are meant not to cause significant stimulation and can not eliminate the carrier or the thinner of the biological activity and the characteristic of institute's administered compound organism.Adjuvant falls in the scope of these words.

Therefore for example, drug acceptable carrier of the present invention can comprise the fat amino acid.

Perhaps, the used drug acceptable carrier of the present invention can comprise embedded material such as polyol (being carbohydrate).The limiting examples that is suitable for the carbohydrate of making vehicle comprises Star Dri 5 (for example Glucidex Roquette), trehalose (for example trehalose of Merck company), cellobiose, glucose, fructose, maltulose, Palatinose, milk ketose, maltose, gentiobiose, lactose, isomaltose, maltose alcohol (for example Maltisorb of Roquette company), Saccharum lactis, erythritol, Parakin alditol, Xylitol, mannitol, Sorbitol Powder, galactitol and ribitol, sucrose, raffinose, gentianose, planteose, verbascose, stachyose, melizitose, dextran and inositol.

Again or, the used drug acceptable carrier of the present invention is the microsphere that is suitable for oral administration.For example, basically as the United States Patent (USP) the 6th of Vaghefi etc., 849, No. 271 (its integral body be attached to herein) by reference is described, and microsphere can comprise the water-insoluble matrix that organic materials became that dissolving or acid degradation takes place by resisting in stomach pH level (for example being lower than 4 pH level) down.This organic substrate material can be for example triglyceride level, hydrogenated vegetable oil, wax or wax mixture, poly-alkoxyalkyl ether, poly-alkoxy alkyl and water-insoluble part degrade proteins.

It should be understood that biology puts together polymkeric substance (PEGization CCR5 peptide for example of the present invention) and can be used in the drug acceptable carrier as its part, therefore when serving as the composition of delivery media, serve as the carrier molecule of sending the CCR5 aminoacid sequence.The preferred embodiment of this dual purpose is the liposome medium described in No. the 20030186869th, the U.S. Patent application (its integral body be attached to herein) by reference of for example Poiani, George etc., for example PEG conjugated lipid plastid.

Term herein " vehicle " is meant the inert substance that gives that adds in the pharmaceutical composition with further promotion activeconstituents.The example of vehicle includes but not limited to lime carbonate, potassiumphosphate, various carbohydrate and each kind of starch, derivatived cellulose, gelatin, vegetables oil and polyoxyethylene glycol.

The preparation of medicine and medicine-feeding technology can be at " Remington ' s PharmaceuticalSciences, " of latest edition Mack Publishing Co., and Easton finds among the PA, and document integral body by reference is attached to herein.

That suitable route of administration can for example comprise is oral, in the internal rectum, saturating mucous membrane (particularly saturating nose), intestines or parenteral delivery, comprise injection in intramuscular, the subcutaneous and marrow, and in the sheath, directly in the ventricle, in the intravenously, intraperitoneal, nose or intra-articular injection.

Perhaps, pharmaceutical composition can be given with local mode rather than system mode, for example give by the tissue regions that pharmaceutical composition is injected directly into the patient.

Pharmaceutical composition of the present invention can be made by means commonly known in the art, for example by routine mixing, dissolving, granulation, make drageeing, pulverizing, emulsification, packing, embedding or freeze drying process and make.

Therefore can use one or more physiologically acceptable carriers (comprising vehicle and auxiliary agent) to prepare in the usual way for the pharmaceutical composition that uses according to the present invention, these carriers can help activeconstituents is processed into pharmaceutically useful preparation.Correct preparation depends on selected route of administration.

For injection, active ingredient in pharmaceutical is prepared in the aqueous solution, preferably prepares in the damping fluid of physical compatibility such as Hank solution, Ringer's solution or physiology salt buffer.For saturating mucosal drug delivery, in preparation, use the permeate agent of the barrier that is suitable for mistake to be infiltrated.This permeate agent is well known in the art.

For oral administration, pharmaceutical composition can be easily prepared by active compound and drug acceptable carrier well known in the art are combined.This carrier makes pharmaceutical composition can be mixed with tablet, pill, dragee (dragee), capsule, liquid agent, gelifying agent, syrup, slurries agent (slurry), suspensoid etc., for patient's orally ingestible.Pharmacology preparation for oral use can prepare like this: use solid excipient, after adding proper auxiliary agent as required, optional mixture with gained grinds and the processing granular mixture, to obtain tablet or dragee core.Suitable vehicle has weighting agent such as carbohydrate specifically, comprises lactose, sucrose, mannitol or Sorbitol Powder; Cellulosics such as W-Gum, wheat starch, Starch rice, yam starch, gelatin, tragacanth gum, methylcellulose gum, Vltra tears and Xylo-Mucine; And/or physiologically acceptable polymkeric substance such as polyvinylpyrrolidone (PVP).If desired, can add disintegrating agent, as cross-linked polyvinylpyrrolidone, agar or Lalgine or its salt such as sodium alginate.

The dragee core is surrounded by suitable dressing.For this purpose, can use concentrated sugar solution, this solution can be chosen wantonly and contain Sudan Gum-arabic, talcum powder, polyvinylpyrrolidone, card ripple Bo Er (carbopol) gel, polyoxyethylene glycol, titanium dioxide, lacquer solution and appropriate organic solvent or solvent mixture.Can add dyestuff or pigment to tablet or dragee dressing,, perhaps distinguish the various combination of active compound doses so that discern.

The pharmaceutical composition that can orally use comprises the capsule of being made by gelatin of slippaging (push-fitcapsule), and by gelatin and softening agent such as glycerine or the sealing soft capsule made the sorb Tang Dynasty.The capsule of slippaging can contain activeconstituents and blended weighting agent such as lactose, tamanori such as starch, lubricant such as talcum powder or Magnesium Stearate and optional stabilizer with it.In soft capsule, the activeconstituents solubilized or be suspended in suitable liquid such as fatty oil, whiteruss or liquid macrogol in.In addition, also can add stablizer.The preparation that all oral administrations are used all should be the formulation of the route of administration that is suitable for selecting.

For orally administering, composition can be taked the tablet prepared in the usual way or the form of lozenge.

For passing through inhalation in the nose, confession activeconstituents is used according to the present invention sent with spray form expediently, and this sprays is that for example Refrigerant 12, trichlorofluoromethane, dichloro tetrafluoro ethane or carbonic acid gas spray from pressurized package (pressurized pack) or atomizer with suitable propelling agent.In the situation of pressurized aerosol, can determine dosage by providing valve to send the amount of metering.For the capsule and the cartridge case (cartridge) of for example gelatin that in divider, uses, can be mixed with and contain The compounds of this invention and the suitable powder binder such as the powdered mixture of lactose or starch.

Pharmaceutical composition described herein can be mixed with for parenteral admin, for example by large bolus injection or continuous infusion administration.Injection preparation can unit dosage forms present, and for example in ampoule or in multi-dose container, chooses wantonly and is added with sanitas.Said composition can be the emulsion in suspensoid, solution or oily medium or the water medium, and can contain blender (formulatoryagent) as suspension agent, stablizer and/or dispersion agent.

The parenteral admin pharmaceutical composition comprises the aqueous solution of the active ingredient of water-soluble form.In addition, the suspensoid of activeconstituents can be prepared into suitable oil base or water base injection suspensoid.Suitable lipophilic solvent or medium comprise fatty oil such as sesame oil, perhaps Acrawax such as ethyl oleate, Witepsol W-S 55 or liposome.Moisture injection suspensoid can contain the material of the viscosity that can increase suspensoid, as Xylo-Mucine, Sorbitol Powder or dextran.Randomly, suspensoid also can contain stablizer and can increase the material of the solubleness of activeconstituents, makes to prepare highly enriched solution.

Perhaps, activeconstituents can be powder type, for redissolving facing with preceding usefulness suitable medium such as aseptic apirogen water based sols.

The also available for example conventional suppository base of pharmaceutical composition of the present invention such as theobroma oil or other glyceryl ester are mixed with rectum composition such as suppository or enema,retention.

The pharmaceutical composition that is applicable to situation of the present invention comprises such composition, and wherein the amount of contained activeconstituents can effectively realize predetermined purpose.In particular, " treatment significant quantity " is meant the symptom that can effectively prevent, alleviate or improve pathology (for example local asphyxia) or prolongs by the amount of the activeconstituents (for example nucleic acid construct thing) of treatment experimenter's survival time.

Determining fully in those skilled in the art's skill of treatment significant quantity is particularly according to the words of detailed disclosure provided herein.

For any preparation that uses in the methods of the invention, dosage or treatment significant quantity at first are to estimate from external test and cell cultures mensuration.For example, can be in animal model allocating dosage (embodiment 7,9,10 of the embodiment part that vide infra), to reach required concentration or titre.This information can be used to determine more accurately the useful dosage in human body.

The toxicity of activeconstituents described herein and therapeutic efficiency, can by the standard pharmaceutical program external, in cell culture or laboratory animal, determine.These external and cell cultures measure and zooscopy in the data that obtain, can be used for allocating multiple dosage for being used for human body.Different with employed formulation and the route of administration that is adopted, dosage can be different.Preparation, route of administration and dosage can be selected according to patient's the state of an illness by doctor individual accurately.(referring to for example Fingl, E.et al. (1975), " The Pharmacological Basis ofTherapeutics, " Ch.1, p.1).

Dosage and delivery time can be by individual and different the adjustment, so that activeconstituents has enough blood plasma and cerebral levels, induce or suppress biological effect (being minimum effective concentration MEC).For every kind of preparation, MEC has difference, but this can estimate from vitro data.For the dosage that reaches MEC and need will depend on individual feature and route of administration.Can use the detection assay method to determine plasma concentration.

The severity and the responsiveness that depend on the illness that will treat, dispensing scheme can be that single or multiple is given medicament, continue a couple of days the course of treatment to several weeks, perhaps up to realizing curing or reaching alleviating of morbid state.

The amount of composition that gives will depend on by the severity of treatment experimenter, illness, administering mode, prescriber's judgement etc. certainly.

Composition of the present invention can provide in the medicine box of packing or distribution device such as FDA approval if needed, and this packing or distribution device can be equipped with one or more unit dosage that contain activeconstituents.Packing can for example comprise metal or plastic tab, as blister.Packing or distribution device can have the medication instruction book.Packing or distribution device also can be with the bulletins that government bodies opened of manufacturing, use or the sale of managing medicine, and this bulletin illustrates the approval of this office to the form of the composition of confession people or beastly administration.This bulletin for example can comprise that FDA is the label of prescription drugs approval, the label of perhaps granted product inset.The composition of preparing in drug acceptable carrier, comprise goods of the present invention also can be prepared, and is placed in the proper container, and is marked the appointment illness that is above described in detail for treatment.

The molecule (for example chimeric protein molecule) that it should be understood that this aspect of the present invention can offer the experimenter by gene therapy.Therefore, can adopt above-described any suitable administering mode, give the experimenter (being the vivo gene therapy) above-mentioned Mammals expression constructs.Perhaps, by suitable gene delivery medium/method (transfection, transduction, homologous recombination etc.) and required expression system, the nucleic acid construct thing is incorporated in the suitable cell, will be modified then and return experimenter's (promptly earlier external back vivo gene therapy) after cell is cultivated amplification.

At present preferred nucleic acid in vivo transfer techniques comprises with viral or non-virus formulation thing such as adenovirus, slow virus, herpes simplex I virus or adeno associated virus (AAV) and the transfection carried out based on the system of lipid.The useful lipid that is used for the lipid mediation transfer of gene for example has DOTMA, DOPE and DC-Choi[Tonkinson et al., Cancer Investigation, 14 (1): 54-65 (1996)].The most preferably construction that is used for gene therapy is virus, most preferably adenovirus, AAV, slow virus or retrovirus.Virus formulation thing such as retrovirus construction comprise that at least one transcripting promoter/enhanser or locus define element (locus-defining element), perhaps other elements of expressing by other modes such as other road montage, nuclear RNA output or courier's posttranslational modification controlling gene.This vector construct also comprises packaging signal, long terminal repeat (LTR) or its part and is suitable for the normal chain and the minus strand primer binding site of used virus, unless it has been present in the described virus formulation thing.In addition, this construction generally includes signal sequence, so that peptide is secreted from the host cell that comprises it.Preferably, signal sequence for this purpose is mammalian signal sequence such as Ig κ leader sequence (for example SEQ ID NO.3).Randomly, construction also can comprise signal and one or more restriction site and the translation termination sequence that instructs polyadenylation.For example, this construction can comprise 5 ' LTR, tRNA binding site, packaging signal, the second chain DNA synthetic starting point and 3 ' LTR or its part usually.Also can use other non-virus carriers, as cation lipid, polylysine and dendrimer (dendrimer).

The avidity of CCR5 peptide of the present invention and CCR5 part makes the CCR5 peptide can be used for the purifying and the detection of CCR5 part.

Therefore, another aspect of the present invention provides the molecule that comprises the label that is connected with the CCR5 aminoacid sequence of the N-terminal structural domain that does not have CCR5, and this CCR5 aminoacid sequence can be in conjunction with the CCR5 part.

Term used herein " label (tag) " is meant the part of combined companion such as the identification of antibody, sequestrant or avidin (vitamin H) molecular specificity.Label can place the C-terminal or the N-terminal of CCR5 peptide, as long as it does not disturb the biological activity (for example part combination) of CCR5 peptide.

For example, labelled peptide have enough residues epi-position (being the epi-position label) is provided thus can prepare its antibody, yet enough short again and make it can not disturb the biological activity of CCR5 peptide.The epi-position label is preferably also considerably unique, thus its antibody basically not can with other epi-position generation cross reactions.Suitable label polypeptide has at least six amino-acid residues usually, about usually 8-50 amino-acid residue (preferably about 9-30 amino-acid residue).Polyhistidyl sequence preferably, it can make tagged albumen mass-energy separate by Ni-NTA chromatography (for example Lindsay etal.Neuron 17:571-574 (1996) is described) in conjunction with nickel.

This CCR5 that is added with the epi-position label is desirable, because the traget antibody of available anti-label polypeptide detects its existence.And, the epi-position label is provided, also make CCR5 Toplink of the present invention easily carry out purifying by affinity purification with anti-tag antibody.The affinity purification technology and the diagnostic assay that relate to antibody are described hereinafter.

Label polypeptide and their antibody separately are well known in the art.Example comprise flu HA label polypeptide and antibody 12CA5 thereof (Field et al., Mol.Cell.Biol., 8:2159-2165 (1988)]; C-myc label and 8F9 thereof, 3C7,6E10, G4, B7 and 9E10 antibody (Evanet al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; With herpes simplex virus glycoprotein D (gD) label and antibody [Paborsky et al., Protein Engineering, 3 (6): 547-553 (1990)] thereof.Other label polypeptide is also existing open.Example comprises Flag-peptide [Hopp et al., BioTechnology, 6:1204-1210 (1988)]; KT3 epitope peptide [Martin etal., Science, 255:192-194 (1992)]; Alpha-tubulin epitope peptide [Skinner et al., J.Biol.Chem., 266:15163-15166 (1991)]; With T7 gene 10 protein peptide tags [Lutz-Freyermuth et al., Proc.Natl.Acad.Sci.USA, 87:6393-6397 (1990)].In case selected the label polypeptide, available method well known in the art produces its antibody.This antibody is commercially available, for example available from Sigma, and St.Louis.USA.

An embodiment of this aspect of the present invention provides the method that whether has the CCR5 part from biological sample separation of C CR5 part or detection of biological sample.

Word used herein " biological sample " is meant the biomaterial that wherein has the CCR5 part, as cell, tissue and fluid such as blood, serum, blood plasma, lymph, bile, urine, saliva, sputum, synovia, seminal fluid, tear, celiolymph, bronchoalveolar lavage fluid, ascites, fester, conditioned medium etc.

The separation of the CCR5 part of this aspect is achieved in that biological sample is contacted with the molecule of this aspect of the present invention according to the present invention, make that (use can make molecule and CCR5 part bonded damping fluid, temperature condition for CCR5 part and molecule forming composite, referring to for example Datta-Mannan and Stone 2004, ibid); With isolated complex, thereby from biological sample separation of C CR5 part.

For isolated complex, preferably molecule is fixed on the solid phase carrier.Word used herein " solid phase carrier " is meant the non-aqueous matrix that purpose reagent (for example molecule of this aspect of the present invention) can be attached to it.The example of solid phase carrier includes but not limited to the solid phase carrier that part goes up or formed by glass (for example controlled pore glass), polysaccharide (for example agarose), polyacrylamide, polystyrene, polyvinyl alcohol and silicone fully.In certain embodiments, depend on situation, solid phase carrier can comprise the hole of assay plate; In other embodiments, solid phase carrier is purification column (a for example affinity column).This term also comprises the discontinuous solid phase that discrete particle (as United States Patent (USP) the 4th, 275, the discrete particle described in No. 149) is become.

Perhaps, this molecule can be used to the CCR5 ligand level in the detection of biological sample.For diagnostic use, but molecule is wanted test section on the mark usually.But the test section can be any part that can directly or indirectly produce detectable signal.For example, but the test section can be radio isotope, fluorescence or chemiluminescence compound, perhaps label (as indicated above with traget antibody can bonded label).Molecule of the present invention can use in any known measuring method, and described method is competitive binding assay for example, direct and indirect sandwich assay and immune precipitation determination.[Zola，Monoclonal Antibodies：A Manual of Techniques，pp.147-158(CRC Press，Inc.，1987)]。

The molecule of this aspect of the present invention can be included in the diagnostic kit, and this molecule and optional solid phase carrier and imaging agents (for example antibody, chromophoric substrate etc.) can be packaged in the suitable vessel of suitable buffer reagent and sanitas therein, are used to diagnose.

Therefore, the invention provides molecule, composition and they are used for the clinical method for example diagnosing and treat.

Term " about " used herein is meant ± 10%.

Those of ordinary skills can understand other targets of the present invention, advantage and new feature after the following non-limiting example of research.In addition, above-described and each of each embodiment of the desired the present invention of claims part and aspect hereinafter all obtains experiment support in following examples.

Embodiment

Now referring to following examples, these embodiment illustrate the present invention with above description with non-limiting way.

In general, term used herein and experimental arrangement of the present invention comprise molecular engineering, Measurement for Biochemistry, microbiological technique and recombinant DNA technology.These technology have abundant elaboration in the literature.Referring to for example " Molecular Cloning:A laboratory Manual " Sambrook et al., (1989); " Current Protocols in Molecular Biology " Volumes I-III Ausubel, R.M., ed. (1994); Ausubel et al., " CurrentProtocols in Molecular Biology ", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, " A Practical Guide to Molecular Cloning ", JohnWiley ﹠amp; Sons, New York (1988); Watson et al., " Recombinant DNA ", Scientific American Books, New York; Birren et al. (eds) " GenomeAnalysis:A Laboratory Manual Series ", Vols.1-4, Cold Spring HarborLaboratory Press, New York (1998); United States Patent (USP) 4,666, the method that proposes in 828,4,683,202,4,801,531,5,192,659 and 5,272,057; " Cell Biology:ALaboratory Handboo k ", Volumes I-III Cellis, J.E., ed. (1994); " CurrentProtocols in Immunology " Volumes I-III Coligan J.E., ed. (1994); Stiteset al. (eds), " Basic and Clinical Immunology " (8th Edition), Appleton ﹠amp; Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), " Selected Methodsin Cellular Immunology ", W.H.Freeman and Co., New York (1980); Having described in a large number in patent and scientific and technical literature can be for the immunoassay that obtains, referring to for example United States Patent (USP) 3,791,932,3,839,153,3,850,752,3,850,578,3,853,987,3,867,517,3,879,262,3,901,654,3,935,074,3,984,533,3,996,345,4,034,074,4,098,876,4,879,219,5,011,771 and 5,281,521; " OligonucleotideSynthesis " Gait, M.J., ed. (1984); " Nucleic Acid Hybridization " Hames, B.D., and Higgins S.J., eds. (1985); " Transcription and Translation " Hames, B.D., and Higgins S.J., Eds. (1984); " Animal Cell Culture " Freshney, R.I., ed. (1986); " Immobilized Cells and Enzymes " IRL Press, (1986); " A Practical Guide to Molecular Cloning " Perbal, B., (1984) and " Methods in Enzymology " Vol.1-317, Academic Press; " PCR Protocols:A Guide To Methods And Applications ", Academic Press, San Diego, CA (1990); Marshak et al., " Strategies for Protein Purification andCharacterization-A Laboratory Course Manual " CSHL Press (1996); All these documents are attached to herein by reference, as complete proposition in this article.Other general reference also are provided in the middle of presents.Program technic in these documents it is believed that it is well known in the art, provides for the purpose of helping reader.The all information that comprises in these documents is attached to herein by reference.

Embodiment 1

The generation of recombinant human and mouse CCR5-Fc fusion rotein (CCR5-Ig) and the stably express in clone

Recombinant human (h) or mouse (m) CCR5-Ig fusion rotein are produced for therepic use.

Material and experimental arrangement

The generation of people CCR5-Ig construction

Fig. 1 shows the structure of the nucleic acid carrier of code book invention CCR5-Ig fusion rotein.The IgG1 construction is according to the general planning that before was used for producing CTLA4-Ig [VanOosterhout et al., Am J Respir Cell MoI Biol (1997) 17:386] produce, and done following change: (cDNA of hinge-CH2-CH3) is cloned into pSecTag2/HygroB (Invitrogen from LPS and IL-4 activated peripheral blood lymphocytes (PBMC) to coding human IgG1 CH, San Diego, CA) on.With with outer 2 (the EC2 nucleic acid coordinate 493-585 of CCR5 of the born of the same parents of acceptor; SEQ ID NO:17) structural domain complementary primer, from LPS activated human PBMC subclone people CCR5 (GenBank accession number NM_000579, SEQ ID NO:33), described primer is as follows: justice is arranged, cccaagcttaccagatctcaaaaagaagg (SEQ ID NO.35), antisense, ccgctcgagattcttccagaattgatact (SEQ ID NO.36).After carrying out sequence checking, with amplification PCR products be cloned into the pSec-Tag2 carrier (Invitrogen, San Diego, CA).Hinge-CH2-CH3 (SEQ ID NO:21) of human IgG Fc γ is connected with the plasmid (pSec-CCR5) in CCR5 downstream, to produce fusion rotein hCCR5 (EC2)-IgG (SEQ ID NO.4).

The generation of mouse CCR5-Ig construction

With with different ectodomain complementary primers, from LPS activated mouse PBMC subclone mouse CCR5 (GenBank accession number NM_009917), described primer is as follows: outer 1 (E1 of CCR5 or the EC1 amino acid coordinate 271-336 of the born of the same parents of acceptor; SEQ ID NO:7) structural domain: justice is arranged, cccaagctttatgctgcaaatgagtgggt (SEQ ID NO.39), antisense, ccgctcgagaatgtgatagagccctgtga (SEQ ID NO.40); Outer 2 (E2 of CCR5 or the EC2 amino acid coordinate 508-597 of the born of the same parents of acceptor; SEQ ID NO:9) structural domain: justice is arranged, cccaagcttagatctcagaaagaaggttt (SEQ ID NO.31), antisense, ccgctcgagctttaatgtttggaaactct (SEQ ID NO.32); Outer 3 (E3 of CCR5 or the EC3 amino acid coordinate 790-864 of the born of the same parents of acceptor; SEQ ID NO:11) structural domain: justice is arranged, cccaagcttgaattctttggactgaataa (SEQ ID NO.41), antisense, ccgctcgagcattccaagagtctctgttg (SEQ ID NO.42); N-terminal (the N amino acid coordinate 1-81 of CCR5 with acceptor; SEQ ID NO:5) structural domain: justice is arranged, cccaagcttatggattttcaagggtcagt (SEQ ID NO.37), antisense, ccgctcgagcacattgattttttggcagg (SEQ ID NO.38).After carrying out sequence checking, with amplification PCR products be cloned into the pSec-Tag2 carrier (Invitrogen, San Diego, CA).Hinge-CH2-CH3 (SEQ ID NO:25) of mouse IgG Fc γ is connected with the plasmid (pSec-CCR5) in CCR5 downstream, to produce fusion rotein mCCR5 (EC2)-IgG (SEQ ID NO:2).

The generation of stable people CCR5-IgG express cell system

With DG44 Chinese hamster ovary (CHO) cell (the DG44 CHO DHFR of pSec-CCR5-IgG plasmid co-transfection to dual disappearance with Tetrahydrofolate dehydrogenase (DHFR) gene ^-/-Cell, the Dr.Lawrence Chasin of Columbia Univ USA provides, ATCC accession number CRL-9096) in, this cotransfection is to use jet PEI (Polyphasetransfection-Illkirch Cedex according to manufacturer's specification sheets, France), carry out with the CHO DHFR minigene carrier of the Chinese hamster ovary celI of energy transfection DHFR defective.In the substratum (MEM-alpha) of the Rheumatrex (2.5nM-0.1mM) that contains Totomycin (200 μ g/ml) and ascending-dose, select the cell of stable transfection.Use (Uppsia available from Amersham Biosciences, Sweden) A albumen-Sepharose post, from the positive transfectant supernatant liquor purifying hCCR5 (EC2) of DHFR-IgG fusion rotein, and with mouse anti myc (Santa cruz, lot number d0306) carries out the western blot analysis checking as first antibody and goat anti-mouse IgG-HRP (Jackson ImmunoResearch, lot number 58734) as second antibody.

The generation of stable mouse CCR5-IgG express cell system

With DG44 Chinese hamster ovary (CHO) cell (the DG44 CHO DHFR of pSec-CCR5-IgG plasmid co-transfection to dual disappearance with Tetrahydrofolate dehydrogenase (DHFR) gene ^-/-Cell, the Dr.Lawrence Chasin of Columbia Univ USA provides, ATCC accession number CRL-9096) in, this cotransfection is to use jet PEI (Polyphasetransfection-Illkirch Cedex according to manufacturer's specification sheets, France), carry out with the CHO DHFR minigene carrier of the Chinese hamster ovary celI of energy transfection DHFR defective.In the substratum (MEM-alpha) of the Rheumatrex (2.5nM-0.1mM) that contains Totomycin (200 μ g/ml) and ascending-dose, select the cell of stable transfection.Use (Uppsia available from Amersham Biosciences, Sweden) A albumen-Sepharose post, from the positive transfectant supernatant liquor purifying mCCR5 (EC2) of DHFR-IgG fusion rotein, and with mouse anti myc (Santa cruz, lot number d0306) carries out the western blot analysis checking as first antibody and goat anti-mouse IgG-HRP (Jackson ImmunoResearch, lot number 58734) as second antibody.

Embodiment 2

The binding characteristic of different CCR5-IgG ectodomains and CCR5 part

With EC1, EC2, EC3 and the N structural domain specificity of ELISA assay method research mCCR5-Ig ability in conjunction with CCR5 native ligand (CCL3, CCL4 and CCL5).

Material and experimental arrangement

ELISA

The different ectodomains of mouse CCR5-IgG fusion rotein (EC1, EC2, EC3 and N) and various commercially available mouse recombinant C-C chemokine (R﹠amp; D Systems, Minneapolis, NM, comprise MIP-1 α (CCL3), MIP-1 β (CCL4) and RANTES (CCL5)) binding specificity, measure by the following direct ELISA that carries out: with 96 hole elisa plate (Nunc, Roskilde, Denmark) wrap by mouse CCL3, CCL4 or the CCR5 in last 10ng/ hole, with the PBS solution sealing of 1%BSA.With each hole washing, be incubated overnight with 10ng/ml, 100ng/ml or 1000ng/ml CCR5-IgG (EC1, EC2, EC3, N).With each hole washing, detect the existence of CCR5-IgG with goat anti-mouse IgG-HRP (Jackson ImmunoResearch, lot number 58734).The result shows with the O.D. reading at 450nm place.

The result

EC1, EC2, EC3 and the N structural domain of mCCR5-IgG and combining of CCR5 native ligand (CCL3, CCL4 and CCL5) have been measured by direct ELISA.Shown in Fig. 2 A-C, have only mCCR5 (EC2)-IgG specificity in conjunction with all three kinds of parts, and mCCR5 (EC1)-IgG and mCCR5 (N)-any part of IgG debond.Under increased protein concentration (1000ng), mCCR5 (EC2)-IgG is binding partner to a certain extent also.

Embodiment 3

MCCR5 (EC2)-IgG can selective binding CCL3, CCL4 and CCL5

By the ability of ELISA assay method research soluble receptors mCCR5 (EC2)-IgG in conjunction with different chemokines.

Material and experimental arrangement

ELISA

Mouse CCR5-IgG soluble receptors and various commercially available mouse reorganization chemokine (R﹠amp; DSystems, Minneapolis, NM, comprise MIP-1 α (CCL3), MIP-1 β (CCL4), RANTES (CCL5), ITAC, MCP-1 (CCL2), CXCL 16, MIG and IL-4) binding specificity, measure by the following direct ELISA that carries out: with 96 hole elisa plate (Nunc, Roskilde, Denmark) wrap by mouse CCL3, CCL4, CCL5, ITAC, MCP-1, CXCL16, MIG or the IL-4 in last 10ng/ hole, with the PBS solution sealing of 1%BSA.With each hole washing, be incubated overnight with 1 μ g/ hole CCR5 (EC2)-IgG.With each hole washing, detect the existence of CCR5 (EC2)-IgG with goat anti-mouse IgG-HRP (Jackson ImmunoResearch, lot number 58734).The result shows with the O.D. reading at 450nm place.

The result

MCCR5 (EC2)-IgG has confirmed the specificity of mCCR5 (EC2)-IgG to its native ligand with the combination of different chemokines.Shown in Fig. 3 A-B, mCCR5 (EC2)-IgG with high-affinity in conjunction with CCL5 (Fig. 3 A-B) and in conjunction with CCL3 and CCL4 (Fig. 3 B).Under higher protein concentration (1000ng, Fig. 3 A-B), detect mCCR5 (EC2)-IgG and combine with slightly not remarkable, the low-affinity of MCP-1 and CXCL16.

Embodiment 4

Cross reactivity between mCCR5 (Ed)-IgG and people CCL3, CCL4 and the CCL5

By the ability of ELISA assay method research soluble receptors mCCR5 (EC2)-IgG in conjunction with people C-C chemokine.

Material and experimental arrangement

ELISA

Mouse CCR5-IgG soluble receptors and the various commercially available people chemokine (R﹠amp that recombinates; DSystems, Minneapolis, NM) MIP-1 α (CCL3), MIP-1 β (CCL4) and RANTES and mouse reorganization chemokine (R﹠amp; D Systems, Minneapolis, NM) binding specificity of MIP-1a (CCL3) and ITAC, measure by the following direct ELISA that carries out: with 96 hole elisa plate (Nunc, Roskilde, Denmark) bag is by people CCL3, the CCL4 in last 10ng/ hole, CCL5 and mouse CCL3 or ITAC, with the PBS solution sealing of 1%BSA.With each hole washing, be incubated overnight with 1 μ g/ hole CCR5 (EC2)-IgG.With each hole washing, detect the existence of CCR5 (EC2)-IgG with goat anti-mouse IgG-HRP antibody (Jackson ImmunoResearch, lot number 58734).The result shows with the O.D. reading at 450nm place.

The result

As shown in Figure 4, mCCR5 (EC2)-IgG with high-affinity in conjunction with people CCL3, CCL4 and CCL5.There is not notable difference between the mouse of mouse soluble receptor CCR 5 (EC2)-IgG or the combination of people's part.

Embodiment 5

In mCCR5 (EC2)-IgG energy and the cell migration of CCR5 part inductive

In EC2, EC3 by chemotactic assay method research mouse CCR5-Ig or the N structural domain specificity and the ability of CCL3, CCL4 and the cell migration of CCL5 inductive.

Material and experimental arrangement

Clone

The THP-1 cell (people's acute monocytic leukemia clone) of expressing CCR5 and CCR2 is available from American Type Culture Collection (ATCC, Rockville, MD, ATCC accession number TIB-202), and grows according to manufacturer's specification sheets.

Cell migration assay

Tested the ability of the migration of mCCR5 (EC2, EC3 and N)-IgG inhibition mouse CCL3, CCL4 and CCL5 inductive THP-1 cell.(Corning Costar, Cambridge MA) have carried out chemotactic assay with changeing the hole cell.To change hole and 15ng/ hole mouse CCL3,10ng/ hole mouse CCL4 and 50ng/ hole mouse CCL5 (R﹠amp; D Systems, Minneapolis is NM) together with different mCCR5-IgG ectodomain (as mentioned above) incubation in 10 μ g/ holes 30 minutes.The THP-1 cell hungry 24 hours of the substratum (RPMI contains L-Glu, Na-Pyr and penicillin-Streptomycin sulphate) of no culture, is put into (1 * 10 then ⁶Individual cells/well) changes in the last cell in hole.To change the hole then and contain 7.5%CO ₂Humidifying air in 37 ℃ of following incubations 3 hours.Collect the monocyte of migration from following cell, carry out the FACS counting.

The result

Fig. 5 A-C shows that soluble receptors mCCR5 (EC2)-IgG has greatly suppressed CCL3 (Fig. 5 A), CCL4 (Fig. 5 B) and all the THP-1 migrations of CCL5 (Fig. 5 C) inductive.In addition, mCCR5 (EC3)-IgG has greatly suppressed CCL4 and CCL5 inductive THP-1 migration (reaching about 50%), and mCCR5 (N)-IgG does not have the cell migration of chemokine inhibiting inductive.

Embodiment 6

In hCCR5 (EC2)-IgG energy and the cell migration of CCL3 inductive

By in chemotactic assay method research fusion rotein hCCR5 (EC2)-Ig specificity and the ability of CCL3 inductive cell migration.

Material and experimental arrangement

Clone

The THP-1 cell (people's acute monocytic leukemia clone) of expressing CCR5 and CCR2 is available from American Type Culture Collection (ATCC, Rockville, MD, ATCC accession number TIB-202), and grows according to manufacturer's specification sheets.

Cell migration assay

Tested the ability of the migration of hCCR5 (EC2)-IgG inhibition CCL3 inductive THP-1 cell.(Corning Costar, Cambridge MA) have carried out chemotactic assay with changeing the hole cell.With substratum or with recombinant human MIP-1 α (CCL3, R﹠amp; D Systems, Minneapolis is after NM) balance is changeed the following cell (being supplemented with or not being supplemented with solubility hCCR5 (EC2)-IgG200ng/ hole) in hole, with the THP-1 cell (1 * 10 of band substratum ⁶Individual cells/well) is added to the last cell that changes the hole.For assessment chemokine specificity, with MCP-1 (CCL2, R﹠amp; D Systems, Minneapolis is NM) with comparing.To change the hole then and contain 7.5%CO ₂Humidifying air in 37 ℃ of following incubations 3 hours.Collect the monocyte of migration from following cell, count.

The result

Fig. 6 shows soluble receptors hCCR5 (EC2)-IgG (50%) and optionally suppressed MIP-1 α (CCL3) inductive THP-1 migration significantly, and does not suppress the migration of MCP-1 (CCL2, p＜0.001) inductive.

Embodiment 7

CCR5 (EC2)-IgG can suppress ongoing experimental autoimmune encephalomyelitis

The EC2 structural domain of mouse soluble receptor CCR 5-Ig confirms to suppress ongoing experimental autoimmune encephalomyelitis (EAE) in the mouse (multiple sclerosis (MS) animal model) highly effectively.

Material and experimental arrangement

In the mouse EAE induce and with the inhibition of CCR5 (EC1)-IgG to ongoing disease

By previous document description [Kassiotis and Kollias, J Exp Med (2001) 193 (4): 427-434], the active that three groups of C57/B mouse (4 every group) carry out EAE is induced with MOGp35-55 (myelin oligodendroglia glycoprotein).In seizure of disease (the 12nd day) beginning one day after, CCR5 (the EC2)-IgG, the IgG or the PBS of isotype coupling that give (every other day) 300 μ g/ mouse for these mouse repeated intravenous handle.Every day the clinical manifestation of EAE disease is marked by an observer who does not know experimental arrangement.

The result

Give the EAE mouse with the EC2 structural domain of mCCR5-IgG and caused EAE and disappear, do not have the remaining sign of disease, and developed serious EAE (Fig. 7) with the mouse that PBS or contrast IgG handle.

Embodiment 8

CCR5 (EC2)-IgG can change the cytokine spectral pattern (cytokine profile) that external primary EAE replys

Analyzed the cell in vitro factor excretory ability of mouse soluble receptor CCR 5-Ig change EAE splenocyte.

Material and experimental arrangement

EAE's induces to activate with external EAE splenocyte again and carries out cytokine and produce in the mouse

By previous document description [Kassiotis and Kollias, J Exp Med (2001) 193 (4): 427-434], the active that three groups of C57/B mouse (4 every group) carry out EAE is induced with MOGp35-55 (myelin oligodendroglia glycoprotein).At the 9th day results splenocyte, with 50 μ g/ml MOGp35-55 together with the isotype of different concns coupling IgG (mIgG), contrast CCR5[CCR5 (EC3)-IgG] or CCR5 (EC2)-IgG stimulated again 72 hours.By the elisa assay supernatant liquor, to know the cytokine production.

ELISA carries out to specifications with Eli-pair test kit (Diaclone, Fleming, France).

The result

CCR5-Ig (E2) has suppressed TNF-α significantly and has produced (Fig. 8 A) and reduced external IL-12 generation (p＜0.01, Fig. 8 C) significantly the stimulation of antigen-specific primary culture (EAE deutero-splenocyte).But CCR5-Ig (E2) does not influence IFN-γ and produces (Fig. 8 B).Isotype mates the stimulation of IgG or contrast mCCR5 (EC3)-IgG, demonstrates the high-level cytokine secretion (Fig. 8 A-C) of EAE deutero-splenocyte.TNF-α and IL-12 participate in the particularly main inflammatory cytokine of EAE of inflammatory diseases.Use CCR5-Ig (E2) to cause TNF-α and IL-12 to produce obviously and reduce, this has shown therapeutic action.

Embodiment 9

Prove that in the NOD mouse CCR5 (EC2)-IgG can treat type i diabetes

Measure the ability of the EC2 structural domain treatment type i diabetes (T1DM) of CCR5-Ig in the NOD mouse, this mouse is the establishment animal model of this disease.

Material and experimental arrangement

Animal

Non-non-insulin-dependent diabetes mellitus (NOD) mouse can be developed spontaneous autoimmune diabetes, is often used as experimental model [Miazaki A., Clin.Exp.Immunol. (1998) 60:622 of insulin human's dependent diabetes mellitus; Harada, M., Exp.Clin.Endocrinol. (1987) 89:251].Give the laboratory animal food of the random feeding standard of 6-12 week NOD/Ltj female mice in age, close and support in specific pathogen free (SPF) animal booth facility.

Handle mouse with CCR5 (EC2)-IgG

Three groups of (6 every group) NOD mouse in 20 day age have carried out subcutaneous treatment.First group gives CCR5 (EC2)-IgG (100 μ g/ mouse/sky) repeatedly.Second group of PBS that gives the coupling amount, the 3rd group of contrast IgG that gives the isotype coupling.

The result

The EC2 structural domain expection that gives NOD mouse CCR5-IgG can reduce insulitis (for example measuring by pancreatic cell is dead).The purposes of present composition treatment T1DM has been supported in these discoveries.

Embodiment 10

CCR5 (EC2)-IgG can treat rheumatoid arthritis

The EC2 structural domain of human soluble receptor CCR 5-Ig confirms that can suppress ongoing adjuvant highly effectively induces sacroiliitis (AA), and AA is the animal model of rheumatoid arthritis (RA).

Material and experimental arrangement

In mouse, induce collagen-induced sacroiliitis and suppress ongoing disease with CCR5 (EC2)-IgG

As [Williams et.al. such as Williams, Proc Natl Acad Sci USA (1992) 89:9784-9788] described, in order to reduce the sacroiliitis of mouse, inject 200 μ g II Collagen Type VIs at root of the tail place intradermal for male DBA/1 mouse (8-12 age in week), this collagen is from ox joint cartilage purifying and at complete Freund's adjuvant (CFA; Difco Laboratories, Detroit, MI, USA) middle emulsification.In three weeks behind first time dosage, mouse is accepted the booster shots of emulsive II Collagen Type VI among the 200 μ gCFA again.Every day mouse is checked, there is the mouse of erythema and/or swelling to be assigned randomly to a group in 3 groups with every at one or more limbs, accepts human IgG (IgG1) or PBS that intraperitoneal (i.p.) injection CCR5 (EC2)-IgG (100 μ g/ mouse/sky), isotype mate.Every mouse carries out this injection in the seizure of disease same day (the 0th day), injects 100 μ g soluble receptorss (among the 500 μ l PBS) in continuous then 10 days every other day.Interim treatment in 10 days, by measuring claw swelling condition monitoring sacroiliitis.

In order to measure claw swelling situation, measure the thickness that each is subjected to the hind foot of sickness influence with micrometer.The result represents with the direct observed value of claw width (millimeter).

The result

Give AA mouse with the EC2 structural domain of CCR5-IgG, subject mouse is compared with the mouse of injection PBS or IgG, and expection can be alleviated collagen-induced sacroiliitis and therefore can reduce claw swelling.The purposes of present composition treatment RA has been supported in these discoveries.

It should be understood that for clarity sake some feature branch of the present invention is described in each embodiment, but these features also can be combined in together and provide in single embodiment.On the contrary, for for purpose of brevity each different characteristics of the present invention being described in single embodiment, but these features also can provide separately or provide with any suitable time combination (subcombination).

Though invention has been described in conjunction with specific embodiment, obviously those skilled in the art can expect having many scheme, modification and variation schemes selected of selecting.Therefore, think that the present invention contains scheme, modification and the variation scheme selected of selecting in all these spirit that fall into claims and the broad range.The publication of mentioning in all these specification sheetss, patent and patent application and GenBank accession number, all by reference and integral body is attached in this specification sheets, the bonded degree all is attached to herein by reference just as ad hoc and individually pointing out each independent publication, patent or patent application or GenBank accession number.In addition, to the quoting or confirm of any reference, should not be interpreted as admitting that this reference can be provided as prior art of the present invention among the application.

Sequence table

＜110〉Rappaport Family Inst For Res

N. block woods

G. Wilder Bao nurse

＜120〉molecule of treatment CCR5/CCR5 part relative disease and with the method for this this disease of molecular therapy

<130>32709

<160>42

<170>PatentIn version 3.4

<210>1

<211>951

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mouse CCR5 (EC2)-IgG1 construct encoding sequence

<400>1

atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60

gacgcggccc agccggccag gcgcgcgcgc cgtacgaagc ttagatctca gaaagaaggt 120

tttcattata catgcagtcc tcattttcca cacactcagt atcatttctg gaagagtttc 180

caaacattaa agctcgaggt gcccagggat tgtggttgta agccttgcat atgtacagtc 240

ccagaagtat catctgtctt catcttcccc ccaaagccca aggatgtgct caccattact 300

ctgactccta aggtcacgtg tgttgtggta gacatcagca aggatgatcc cgaggtccag 360

ttcagctggt ttgtagatga tgtggaggtg cacacagctc agacgcaacc ccgggaggag 420

cagttcaaca gcactttccg ctcagtcagt gaacttccca tcatgcacca ggactgcctc 480

aatggcaagg agttcaaatg cagggtcaac agtgcagctt tccctgcccc catcgagaaa 540

accatctcca aaaccaaagg cagaccgaag gctccacagg tgtacaccat tccacctccc 600

aaggagcaga tggccaagga taaagtcagt ctgacctgca tgataacaga cttcttccct 660

gaagacatta ctgtggagtg gcagtggaat gggcagccag cggagaacta caagaacact 720

cagcccatca tggacacaga tggctcttac ttcgtctaca gcaagctcaa tgtgcagaag 780

agcaactggg aggcaggaaa tactttcacc tgctctgtgt tacatgaggg cctgcacaac 840

caccatactg agaagagcct ctcccactct cctggtaaag ggcccgaaca aaaactcatc 900

tcagaagagg atctgaatag cgccgtcgac catcatcatc atcatcattg a 951

<210>2

<211>316

<212>PRT

＜213〉artificial sequence

<220>

＜223〉mouse CCR5 (EC2)-IgG1 polypeptide

<400>2

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ser Thr Gly Asp Ala Ala Gln Pro Ala Arg Arg Ala Arg Arg Thr

20 25 30

Lys Leu Arg Ser Gln Lys Glu Gly Phe His Tyr Thr Cys Ser Pro His

35 40 45

Phe Pro His Thr Gln Tyr His Phe Trp Lys Ser Phe Gln Thr Leu Lys

50 55 60

Leu Glu Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val

65 70 75 80

Pro Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val

85 90 95

Leu Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile

100 105 110

Ser Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val

115 120 125

Glu Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser

130 135 140

Thr Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Cys Leu

145 150 155 160

Asn Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala

165 170 175

Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro

180 185 190

Gln Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys

195 200 205

Val Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr

210 215 220

Val Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr

225 230 235 240

Gln Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu

245 250 255

Asn Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser

260 265 270

Val Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser

275 280 285

His Ser Pro Gly Lys Gly Pro Glu Gln Lys Leu Ile Ser Glu Glu Asp

290 295 300

Leu Asn Ser Ala Val Asp His His His His His His

305 310 315

<210>3

<211>966

<212>DNA

＜213〉artificial sequence

<220>

＜223〉people CCR5 (EC2)-IgG1 construct encoding sequence

<400>3

atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60

gacgcggccc agccggccag gcgcgcgcgc cgtacgaagc ttatctttac cagatctcaa 120

aaagaaggtc ttcattacac ctgcagctct cattttccat acagtcagta tcaattctgg 180

aagaatttcc agacactcga gcccaaatct tgtgacaaaa ctcacacatg cccaccgtgc 240

ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa acccaaggac 300

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 360

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 420

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 480

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 540

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 600

accctgcccc catcccggga ggagatgacc aagaaccagg tcagcctgac ctgcctggtc 660

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 720

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctatagcaag 780

ctcaccgtgg acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat 840

gaggctctgc acaaccacta cacgcagaag agcctctccc tgtccccggg taaagggccc 900

gaacaaaaac tcatctcaga agaggatctg aatagcgccg tcgaccatca tcatcatcat 960

cattga 966

<210>4

<211>321

<212>PRT

＜213〉artificial sequence

<220>

＜223〉people CCR5 (EC2)-IgG1 polypeptide

<400>4

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ser Thr Gly Asp Ala Ala Gln Pro Ala Arg Arg Ala Arg Arg Thr

20 25 30

Lys Leu Ile Phe Thr Arg Ser Gln Lys Glu Gly Leu His Tyr Thr Cys

35 40 45

Ser Ser His Phe Pro Tyr Ser Gln Tyr Gln Phe Trp Lys Asn Phe Gln

50 55 60

Thr Leu Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys

65 70 75 80

Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro

85 90 95

Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys

100 105 110

Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp

115 120 125

Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu

130 135 140

Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu

145 150 155 160

His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn

165 170 175

Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly

180 185 190

Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu

195 200 205

Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr

210 215 220

Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn

225 230 235 240

Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe

245 250 255

Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn

260 265 270

Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr

275 280 285

Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Gly Pro Glu Gln Lys Leu

290 295 300

Ile Ser Glu Glu Asp Leu Asn Ser Ala Val Asp His His His His His

305 310 315 320

His

<210>5

<211>81

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mCCR5 N ' coded polynucleotide

<400>5

atggattttc aagggtcagt tccgacctat agctatgaca tcgattatgg tatgtcagca 60

ccctgccaaa aaatcaatgt g 81

<210>6

<211>27

<212>PRT

＜213〉artificial sequence

<220>

＜223〉mCCR5 N ' polypeptide

<400>6

Met Asp Phe Gln Gly Ser Val Pro Thr Tyr Ser Tyr Asp Ile Asp Tyr

1 5 10 15

Gly Met Ser Ala Pro Cys Gln Lys Ile Asn Val

20 25

<210>7

<211>66

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mCCR5 EC1 structural domain coded polynucleotide

<400>7

tatgctgcaa atgagtgggt ctttgggaac ataatgtgta aagtattcac agggctctat 60

cacatt 66

<210>8

<211>22

<212>PRT

＜213〉artificial sequence

<220>

＜223〉mCCR5 EC1 structural domain polypeptide

<400>8

Tyr Ala Ala Asn Glu Trp Val Phe Gly Asn Ile Met Cys Lys Val Phe

1 5 10 15

Thr Gly Leu Tyr His Ile

20

<210>9

<211>90

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mCCR5 EC2 structural domain coded polynucleotide

<400>9

agatctcaga aagaaggttt tcattataca tgcagtcctc attttccaca cactcagtat 60

catttctgga agagtttcca aacattaaag 90

<210>10

<211>30

<212>PRT

＜213〉artificial sequence

<220>

＜223〉mCCR5 EC2 structural domain polypeptide

<400>10

Arg Ser Gln Lys Glu Gly Phe His Tyr Thr Cys Ser Pro His Phe Pro

1 5 10 15

His Thr Gln Tyr His Phe Trp Lys Ser Phe Gln Thr Leu Lys

20 25 30

<210>11

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉mCCR5 EC3 structural domain coded polynucleotide

<400>11

gaattctttg gactgaataa ctgcagtagt tctaatagac tagaccaggc catgcaggca 60

acagagactc ttgga 75

<210>12

<211>25

<212>PRT

＜213〉artificial sequence

<220>

＜223〉mCCR5 EC3 structural domain polypeptide

<400>12

Glu Phe Phe Gly Leu Asn Asn Cys Ser Ser Ser Asn Arg Leu Asp Gln

1 5 10 15

Ala Met Gln Ala Thr Glu Thr Leu Gly

20 25

<210>13

<211>102

<212>DNA

＜213〉artificial sequence

<220>

＜223〉hCCR5 N ' coded polynucleotide

<400>13

atggattatc aagtgtcaag tccaatctat gacatcaatt attatacatc ggagccctgc 60

caaaaaatca atgtgaagca aatcgcagcc cgcctcctgc ct 102

<210>14

<211>34

<212>PRT

＜213〉artificial sequence

<220>

＜223〉hCCR5 N ' polypeptide

<400>14

Met Asp Tyr Gln Val Ser Ser Pro Ile Tyr Asp Ile Asn Tyr Tyr Thr

1 5 10 15

Ser Glu Pro Cys Gln Lys Ile Asn Val Lys Gln Ile Ala Ala Arg Leu

20 25 30

Leu Pro

<210>15

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉hCCR5 EC1 structural domain coded polynucleotide

<400>15

cactatgctg ccgcccagtg ggactttgga aatacaatgt gtcaa 45

<210>16

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉hCCR5 EC1 structural domain polypeptide

<400>16

His Tyr Ala Ala Ala Gln Trp Asp Phe Gly Asn Thr Met Cys Gln

1 5 10 15

<210>17

<211>93

<212>DNA

＜213〉artificial sequence

<220>

＜223〉hCCR5 EC2 structural domain coded polynucleotide

<400>17

atctttacca gatctcaaaa agaaggtctt cattacacct gcagctctca ttttccatac 60

agtcagtatcaattctggaa gaatttccag aca 93

<210>18

<211>31

<212>PRT

＜213〉artificial sequence

<220>

＜223〉hCCR5 EC2 structural domain polypeptide

<400>18

Ile Phe Thr Arg Ser Gln Lys Glu Gly Leu His Tyr Thr Cys Ser Ser

1 5 10 15

His Phe Pro Tyr Ser Gln Tyr Gln Phe Trp Lys Asn Phe Gln Thr

20 25 30

<210>19

<211>63

<212>DNA

＜213〉artificial sequence

<220>

＜223〉hCCR5 EC3 structural domain coded polynucleotide

<400>19

caggaattct ttggcctgaa taattgcagt agctctaaca ggttggacca agctatgcag 60

gtg 63

<210>20

<211>31

<212>PRT

＜213〉artificial sequence

<220>

＜223〉hCCR5 EC3 structural domain polypeptide

<400>20

Gln Glu Phe Phe Gly Leu Asn Asn Cys Ser Ser Ser Asn Arg Leu Asp

1 5 10 15

Gln Ala Met Gln Val Thr Glu Thr Leu Gly Met Thr His Cys Cys

20 25 30

<210>21

<211>693

<212>DNA

＜213〉people (Homo sapiens)

<400>21

cccaaatctt gtgacaaaac tcacacatgc ccaccgtgcc cagcacctga actcctgggg 60

ggaccgtcag tcttcctctt ccccccaaaa cccaaggaca ccctcatgat ctcccggacc 120

cctgaggtca catgcgtggt ggtggacgtg agccacgaag accctgaggt caagttcaac 180

tggtacgtgg acggcgtgga ggtgcataat gccaagacaa agccgcggga ggagcagtac 240

aacagcacgt accgtgtggt cagcgtcctc accgtcctgc accaggactg gctgaatggc 300

aaggagtaca agtgcaaggt ctccaacaaa gccctcccag cccccatcga gaaaaccatc 360

tccaaagcca aagggcagcc ccgagaacca caggtgtaca ccctgccccc atcccgggag 420

gagatgacca agaaccaggt cagcctgacc tgcctggtca aaggcttcta tcccagcgac 480

atcgccgtgg agtgggagag caatgggcag ccggagaaca actacaagac cacgcctccc 540

gtgctggact ccgacggctc cttcttcctc tatagcaagc tcaccgtgga caagagcagg 600

tggcagcagg ggaacgtctt ctcatgctcc gtgatgcatg aggctctgca caaccactac 660

acgcagaaga gcctctccct gtccccgggt aaa 693

<210>22

<211>231

<212>PRT

＜213〉people (Homo sapiens)

<400>22

Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro

1 5 10 15

Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

20 25 30

Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val

35 40 45

Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp

50 55 60

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr

65 70 75 80

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

85 90 95

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu

100 105 110

Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

115 120 125

Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys

130 135 140

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

145 150 155 160

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

165 170 175

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

180 185 190

Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser

195 200 205

Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser

210 215 220

Leu Ser Leu Ser Pro Gly Lys

225 230

<210>23

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>23

ccgctcgagc ccaaatcttg tgacaaaac 29

<210>24

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>24

ttgttcgggc cctttacccg gggacaggga ga 32

<210>25

<211>681

<212>DNA

＜213〉mouse (Mus musculus)

<400>25

gtgcccaggg attgtggttg taagccttgc atatgtacag tcccagaagt atcatctgtc 60

ttcatcttcc ccccaaagcc caaggatgtg ctcaccatta ctctgactcc taaggtcacg 120

tgtgttgtgg tagacatcag caaggatgat cccgaggtcc agttcagctg gtttgtagat 180

gatgtggagg tgcacacagc tcagacgcaa ccccgggagg agcagttcaa cagcactttc 240

cgctcagtca gtgaacttcc catcatgcac caggactgcc tcaatggcaa ggagttcaaa 300

tgcagggtca acagtgcagc tttccctgcc cccatcgaga aaaccatctc caaaaccaaa 360

ggcagaccga aggctccaca ggtgtacacc attccacctc ccaaggagca gatggccaag 420

gataaagtca gtctgacctg catgataaca gacttcttcc ctgaagacat tactgtggag 480

tggcagtgga atgggcagcc agcggagaac tacaagaaca ctcagcccat catggacaca 540

gatggctctt acttcgtcta cagcaagctc aatgtgcaga agagcaactg ggaggcagga 600

aatactttca cctgctctgt gttacatgag ggcctgcaca accaccatac tgagaagagc 660

ctctcccact ctcctggtaa a 681

<210>26

<211>227

<212>PRT

＜213〉mouse (Mus musculus)

<400>26

Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro Glu

1 5 10 15

Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu Thr

20 25 30

Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser Lys

35 40 45

Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu Val

50 55 60

His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr Phe

65 70 75 80

Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Cys Leu Asn Gly

85 90 95

Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro Ile

100 105 110

Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln Val

115 120 125

Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val Ser

130 135 140

Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val Glu

145 150 155 160

Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln Pro

165 170 175

Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn Val

180 185 190

Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val Leu

195 200 205

His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His Ser

210 215 220

Pro Gly Lys

225

<210>27

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>27

ccgctcgagg tgcccaggga ttgtggttg 29

<210>28

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>28

ttgttcgggc cctttaccag gagagtggga ga 32

<210>29

<211>1065

<212>DNA

＜213〉mouse (Mus musculus)

<400>29

atggattttc aagggtcagt tccgacctat agctatgaca tcgattatgg tatgtcagca 60

ccctgccaaa aaatcaatgt gaaacaaatt gcggctcagc tcctgccccc actctactcc 120

ctggtattca tctttggttt tgtgggtaac atgatggtct tcctcatctt gataagctgc 180

aaaaagctga agagcgtgac tgatatctac ctgctcaacc tggccatctc tgacctgctc 240

ttcctgctca cactaccatt ctgggctcac tatgctgcaa atgagtgggt ctttgggaac 300

ataatgtgta aagtattcac agggctctat cacattggtt attttggtgg aatcttcttc 360

attatcctcc tgacaattga taggtacttg gctattgtcc atgctgtgtt tgctttaaaa 420

gtcagaacgg tcaactttgg ggtgataaca agtgtagtca cttgggcggt ggctgtgttt 480

gcctctctcc cagaaataat ctttaccaga tctcagaaag aaggttttca ttatacatgc 540

agtcctcatt ttccacacac tcagtatcat ttctggaaga gtttccaaac attaaagatg 600

gtcatcttga gcctgatcct gcctctactt gtcatggtca tctgctactc aggaattctc 660

cacaccctgt ttcgctgtag gaatgagaag aagaggcaca gggctgtgag gctcatcttt 720

gccatcatga ttgtctactt tctcttctgg actccctaca acattgtcct cctcctgacc 780

accttccagg aattctttgg actgaataac tgcagtagtt ctaatagact agaccaggcc 840

atgcaggcaa cagagactct tggaatgaca cactgctgcc taaaccctgt catctatgcc 900

tttgttggag agaagttccg gagttatctc tcagtgttct tccgaaaaca catggtcaaa 960

cgcttttgca aacggtgttc aattttccag caagacaatc ctgatcgtgc aagctcagtc 1020

tatacccgat ccacaggaga acatgaagtt tctactggtt tatga 1065

<210>30

<211>354

<212>PRT

＜213〉mouse (Mus musculus)

<400>30

Met Asp Phe Gln Gly Ser Val Pro Thr Tyr Ser Tyr Asp Ile Asp Tyr

1 5 10 15

Gly Met Ser Ala Pro Cys Gln Lys Ile Asn Val Lys Gln Ile Ala Ala

20 25 30

Gln Leu Leu Pro Pro Leu Tyr Ser Leu Val Phe Ile Phe Gly Phe Val

35 40 45

Gly Asn Met Met Val Phe Leu Ile Leu Ile Ser Cys Lys Lys Leu Lys

50 55 60

Ser Val Thr Asp Ile Tyr Leu Leu Asn Leu Ala Ile Ser Asp Leu Leu

65 70 75 80

Phe Leu Leu Thr Leu Pro Phe Trp Ala His Tyr Ala Ala Asn Glu Trp

85 90 95

Val Phe Gly Asn Ile Met Cys Lys Val Phe Thr Gly Leu Tyr His Ile

100 105 110

Gly Tyr Phe Gly Gly Ile Phe Phe Ile Ile Leu Leu Thr Ile Asp Arg

115 120 125

Tyr Leu Ala Ile Val His Ala Val Phe Ala Leu Lys Val Arg Thr Val

130 135 140

Asn Phe Gly Val Ile Thr Ser Val Val Thr Trp Ala Val Ala Val Phe

145 150 155 160

Ala Ser Leu Pro Glu Ile Ile Phe Thr Arg Ser Gln Lys Glu Gly Phe

165 170 175

His Tyr Thr Cys Ser Pro His Phe Pro His Thr Gln Tyr His Phe Trp

180 185 190

Lys Ser Phe Gln Thr Leu Lys Met Val Ile Leu Ser Leu Ile Leu Pro

195 200 205

Leu Leu Val Met Val Ile Cys Tyr Ser Gly Ile Leu His Thr Leu Phe

210 215 220

Arg Cys Arg Asn Glu Lys Lys Arg His Arg Ala Val Arg Leu Ile Phe

225 230 235 240

Ala Ile Met Ile Val Tyr Phe Leu Phe Trp Thr Pro Tyr Asn Ile Val

245 250 255

Leu Leu Leu Thr Thr Phe Gln Glu Phe Phe Gly Leu Asn Asn Cys Ser

260 265 270

Ser Ser Asn Arg Leu Asp Gln Ala Met Gln Ala Thr Glu Thr Leu Gly

275 280 285

Met Thr His Cys Cys Leu Asn Pro Val Ile Tyr Ala Phe Val Gly Glu

290 295 300

Lys Phe Arg Ser Tyr Leu Ser Val Phe Phe Arg Lys His Met Val Lys

305 310 315 320

Arg Phe Cys Lys Arg Cys Ser Ile Phe Gln Gln Asp Asn Pro Asp Arg

325 330 335

Ala Ser Ser Val Tyr Thr Arg Ser Thr Gly Glu His Glu Val Ser Thr

340 345 350

Gly Leu

<210>31

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>31

cccaagctta gatctcagaa agaaggttt 29

<210>32

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>32

ccgctcgagc tttaatgttt ggaaactct 29

<210>33

<211>1059

<212>DNA

＜213〉people (Homo sapiens)

<400>33

atggattatc aagtgtcaag tccaatctat gacatcaatt attatacatc ggagccctgc 60

caaaaaatca atgtgaagca aatcgcagcc cgcctcctgc ctccgctcta ctcactggtg 120

ttcatctttg gttttgtggg caacatgctg gtcatcctca tcctgataaa ctgcaaaagg 180

ctgaagagca tgactgacat ctacctgctc aacctggcca tctctgacct gtttttcctt 240

cttactgtcc ccttctgggc tcactatgct gccgcccagt gggactttgg aaatacaatg 300

tgtcaactct tgacagggct ctattttata ggcttcttct ctggaatctt cttcatcatc 360

ctcctgacaa tcgataggta cctggctgtc gtccatgctg tgtttgcttt aaaagccagg 420

acggtcacct ttggggtggt gacaagtgtg atcacttggg tggtggctgt gtttgcgtct 480

ctcccaggaa tcatctttac cagatctcaa aaagaaggtc ttcattacac ctgcagctct 540

cattttccat acagtcagta tcaattctgg aagaatttcc agacattaaa gatagtcatc 600

ttggggctgg tcctgccgct gcttgtcatg gtcatctgct actcgggaat cctaaaaact 660

ctgcttcggt gtcgaaatga gaagaagagg cacagggctg tgaggcttat cttcaccatc 720

atgattgttt attttctctt ctgggctccc tacaacattg tccttctcct gaacaccttc 780

caggaattct ttggcctgaa taattgcagt agctctaaca ggttggacca agctatgcag 840

gtgacagaga ctcttgggat gacgcactgc tgcatcaacc ccatcatcta tgcctttgtc 900

ggggagaagt tcagaaacta cctcttagtc ttcttccaaa agcacattgc caaacgcttc 960

tgcaaatgct gttctatttt ccagcaagag gctcccgagc gagcaagctc agtttacacc 1020

cgatccactg gggagcagga aatatctgtg ggcttgtga 1059

<210>34

<211>352

<212>PRT

＜213〉people (Homo sapiens)

<400>34

Met Asp Tyr Gln Val Ser Ser Pro Ile Tyr Asp Ile Asn Tyr Tyr Thr

1 5 10 15

Ser Glu Pro Cys Gln Lys Ile Asn Val Lys Gln Ile Ala Ala Arg Leu

20 25 30

Leu Pro Pro Leu Tyr Ser Leu Val Phe Ile Phe Gly Phe Val Gly Asn

35 40 45

Met Leu Val Ile Leu Ile Leu Ile Asn Cys Lys Arg Leu Lys Ser Met

50 55 60

Thr Asp Ile Tyr Leu Leu Asn Leu Ala Ile Ser Asp Leu Phe Phe Leu

65 70 75 80

Leu Thr Val Pro Phe Trp Ala His Tyr Ala Ala Ala Gln Trp Asp Phe

85 90 95

Gly Asn Thr Met Cys Gln Leu Leu Thr Gly Leu Tyr Phe Ile Gly Phe

100 105 110

Phe Ser Gly Ile Phe Phe Ile Ile Leu Leu Thr Ile Asp Arg Tyr Leu

115 120 125

Ala Val Val His Ala Val Phe Ala Leu Lys Ala Arg Thr Val Thr Phe

130 135 140

Gly Val Val Thr Ser Val Ile Thr Trp Val Val Ala Val Phe Ala Ser

145 150 155 160

Leu Pro Gly Ile Ile Phe Thr Arg Ser Gln Lys Glu Gly Leu His Tyr

165 170 175

Thr Cys Ser Ser His Phe Pro Tyr Ser Gln Tyr Gln Phe Trp Lys Asn

180 185 190

Phe Gln Thr Leu Lys Ile Val Ile Leu Gly Leu Val Leu Pro Leu Leu

195 200 205

Val Met Val Ile Cys Tyr Ser Gly Ile Leu Lys Thr Leu Leu Arg Cys

210 215 220

Arg Asn Glu Lys Lys Arg His Arg Ala Val Arg Leu Ile Phe Thr Ile

225 230 235 240

Met Ile Val Tyr Phe Leu Phe Trp Ala Pro Tyr Asn Ile Val Leu Leu

245 250 255

Leu Asn Thr Phe Gln Glu Phe Phe Gly Leu Asn Asn Cys Ser Ser Ser

260 265 270

Asn Arg Leu Asp Gln Ala Met Gln Val Thr Glu Thr Leu Gly Met Thr

275 280 285

His Cys Cys Ile Asn Pro Ile Ile Tyr Ala Phe Val Gly Glu Lys Phe

290 295 300

Arg Asn Tyr Leu Leu Val Phe Phe Gln Lys His Ile Ala Lys Arg Phe

305 310 315 320

Cys Lys Cys Cys Ser Ile Phe Gln Gln Glu Ala Pro Glu Arg Ala Ser

325 330 335

Ser Val Tyr Thr Arg Ser Thr Gly Glu Gln Glu Ile Ser Val Gly Leu

340 345 350

<210>35

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>35

cccaagctta ccagatctca aaaagaagg 29

<210>36

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>36

ccgctcgaga ttcttccaga attgatact 29

<210>37

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>37

cccaagctta tggattttca agggtcagt 29

<210>38

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>38

ccgctcgagc acattgattt tttggcagg 29

<210>39

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>39

cccaagcttt atgctgcaaa tgagtgggt 29

<210>40

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>40

ccgctcgaga atgtgataga gccctgtga 29

<210>41

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>41

cccaagcttg aattctttgg actgaataa 29

<210>42

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single strand dna oligonucleotide

<400>42

ccgctcgagc attccaagag tctctgttg 29

Claims (27)

1. shla molecule, described shla molecule comprise and the allogeneic amino acid sequence that can put together in conjunction with the CCR5 aminoacid sequence of CCR5 part, and wherein said molecule does not have the N-terminal structural domain of CCR5.

2. shla molecule, described shla molecule comprises the CCR5 aminoacid sequence that partly is connected with nonprotein, and wherein said CCR5 aminoacid sequence can be in conjunction with the CCR5 part, but described molecule does not have immunogenicity in the experimenter.

3. shla molecule, described shla molecule comprises at least two the non-CCR5 of adjoining aminoacid sequences, and each sequence can both be in conjunction with the CCR5 part.

4. molecule, described molecule comprises the label that is connected with the CCR5 aminoacid sequence of the N-terminal structural domain that does not have CCR5, and described CCR5 aminoacid sequence can be in conjunction with the CCR5 part.

5. molecule, described molecule is shown in SEQ ID NO:2 or 4.

6. isolating polynucleotide, described isolating polynucleotide comprise the nucleotide sequence of coding claim 1, arbitrary molecule of 4 or 5.

7. pharmaceutical composition, described pharmaceutical composition comprises the claim 1 as activeconstituents, 2 or 3 molecule and drug acceptable carrier.

8. one kind is carried out the method for this disease of treatment among the experimenter of treatment of CCR5 and/or CCR5 part relative disease at needs, described method comprises the claim 1,2 that gives this experimenter and treat significant quantity, 3 and/or 5 molecule, thus treatment experimenter's CCR5 and/or CCR5 part relative disease.

9. claim 1,2,3 and/or 5 molecule are used for making the purposes of the medicine that is intended to treat CCR5 and/or CCR5 part relative disease.

10. method from biological sample separation of C CR5 part, described method comprises:

(a) biological sample is contacted with the molecule of claim 4, make the molecule forming composite of CCR5-part and claim 4; With

(b) separate described mixture, thereby isolate the CCR5 part from biological sample.

11. each molecule, pharmaceutical composition, method and purposes in the claim 1,2,3,4,7,8,9 and 10, wherein said CCR5 part is selected from CCL2, CCL3, CCL4, CCL5, CCL11 and CCL16.

12. each molecule, pharmaceutical composition, method and purposes in the claim 1,2,3,4,5,7,8 and 9, wherein said molecule does not have immunogenicity.

13. each molecule, pharmaceutical composition, method and purposes in the claim 1,2,3,4,7,8,9 and 10, the binding affinity of wherein said CCR5 and described CCR5 part surpasses K _D=10 ^-6M.

14. each molecule, pharmaceutical composition, method and purposes in the claim 1,7,8 or 9, wherein said allogeneic amino acid sequence comprises the immunoglobulin amino acid sequence.

15. each molecule, pharmaceutical composition, method and purposes in the claim 1,4,7,8,9 or 10, wherein said CCR5 aminoacid sequence is shown in SEQ ID NO:10 or 18.

16. each method or purposes in claim 8 or 9, wherein said disease is selected from multiple sclerosis, rheumatoid arthritis and type i diabetes.

17. each molecule or method in claim 4 or 10, wherein said label are the epi-position labels.

18. each molecule or method in claim 4 or 10, wherein the molecule of claim 4 is connected to solid phase carrier.

19. each molecule in the claim 1,3 or 5, described molecule is connected to the nonprotein part.

20. each molecule, pharmaceutical composition, method or purposes in the claim 2,7,8,9 or 19, wherein said nonprotein partly are selected from polyoxyethylene glycol (PEG), polyvinylpyrrolidone (PVP), Zelan 338 (SMA) and divinyl ether copolymer-maleic anhydride (DIVEMA).

21. claim 7 or 8 each pharmaceutical compositions, wherein said drug acceptable carrier is mixed with for parenteral admin.

22. claim 7 or 8 each pharmaceutical compositions, wherein said drug acceptable carrier does not have immunogenicity basically.

23. claim 7 or 8 each pharmaceutical compositions, wherein said drug acceptable carrier comprises the fat amino acid.

24. claim 7 or 8 each pharmaceutical compositions, wherein said drug acceptable carrier comprises carbohydrate.

25. claim 7 or 8 each pharmaceutical compositions, wherein said drug acceptable carrier comprises microsphere.

26. claim 7 or 8 each pharmaceutical compositions, wherein said drug acceptable carrier comprises liposome.

27. claim 7 or 8 each pharmaceutical compositions, wherein said drug acceptable carrier comprises polymeric microspheres.

Images