CN101570758A - Method for marking bifluorescence protein molecule cell - Google Patents

Abstract

The invention provides a recombinant plasmid for a method for marking a bifluorescence protein molecule and a method for marking a bifluorescence protein molecule cell. The recombinant plasmid comprises a segment A coding tag protein A, a segment B coding tag protein B and a promoter at the upper stream of a segment AC, wherein the 5' end or the 3' end of the segment A merges a sequence C coding protein C to be detected; the 5' end or the 3' end of the segment B merges a sequence D coding protein D to be detected; and segments A-C and B-D are connected by an IRES sequence E. The marking method comprises the steps of constructing the recombinant plasmid for the method for marking the bifluorescence protein molecule, cell transfection and fluorescence marking. The recombinant plasmid and the marking method can express two target genes in all in the same carrier, marks two kinds of different proteins in the same cell, has simple and rapid marking process and greatly saves the marking time than that of a traditional antibody fluorescence marking method.

Description

The method of a kind of pair of fluorescin molecular cell mark

Technical field

The invention belongs to biological technical field, specifically, relate to the method for a kind of pair of fluorescin molecular cell mark.

Background technology

Fluorescence microscopy provides an extremely useful instrument for the research of cytobiology, and by intuitive image, the research protein molecular is in intracellular dynamic behaviour.As the secretion of protein molecular, endocytosis, transportation, the location proteinicly goes out nuclear and goes into nuclear, the interaction of intracellular protein molecule etc.Traditional method is (as GFP by protein molecular and label protein, YFP, Flag, the be stimulated fluorescence of the various different wave lengths that the back sent of amalgamation and expression such as HA.....), the autofluorescence by GFP in cell or the corresponding antibodies link coupled fluorescence molecule of various label proteins reaches the purpose of observation.

But because the method antibody of antibody can not freely enter or cell so be not suitable for doing the mark of viable cell, though and the method for GFP can be used for the mark of viable cell, but since the albumen that GFP merges can be on emission wavelength continuous emitting fluorescence, this is influence to some extent concerning the research of some dynamicss, therefore, necessaryly provide a kind of new marking method, to overcome the defective that exists in the above-mentioned traditional method.

Summary of the invention

The objective of the invention is to, a kind of pair of fluorescin molecular recombination plasmid is provided, to carry out two fluorescin molecular cell marks.

A further object of the invention is, the method for a kind of pair of fluorescin molecular cell mark is provided.

The recombinant plasmid that is used for two fluorescin molecular labeling method methods provided by the invention, comprise: 1) the dna fragmentation A of coded polypeptide A (being label protein A), this label protein can be specifically and the combining of its fluorogenic substrate covalency, and its 5 ' end or 3 ' end can merge the dna sequence dna C of one section coding PROTEIN C to be detected; 2) the dna fragmentation B of coded polypeptide B (being label protein B), this label protein can be specifically and the combining of its fluorogenic substrate covalency, and its 5 ' end or 3 ' end can merge the dna sequence dna D of one section coding protein D to be detected; 3) be to link together between Segment A-C and the B-D by bicistronic mRNA ORF expression system sequence (IRES) the dna sequence dna E that an intersegmental part rrna inserts the site element; 4) at a section responsible dna fragmentation AC, E of the correct position of the upstream of Segment A C and the DNA element of transcribing control (being promotor) of BD.

According to a preferred embodiment of the present invention, described label protein comprises SNAP, Halo.

The method of provided by the invention pair of fluorescin molecular cell mark may further comprise the steps: make up the recombinant plasmid, cell transfecting and the fluorescent mark that are used for two fluorescin molecular labeling method methods.

According to a preferred embodiment of the present invention, use the marking method provided by the invention can be at arbitrary time image of cell, for example m period carries out mark.

Use recombinant plasmid provided by the invention, can in same carrier, work in coordination with two goal gene of coexpression, need not to worry issuable problem in the efficient of cotransfection and other cotransfection process, can be well with two different albumen in the same cell of tense marker, utilize different fluorescence on the substrate band separately, under the same visual field, can observe two kinds of protein molecular location in cell simultaneously, two kinds of marking methods can not disturbed each other to some extent, can carry out mark simultaneously, can not influence the specificity of mark, can not influence the correct location of protein molecular; And labeling process is simple, fast, can in 15-30 minute, finish mark, save time of mark greatly than traditional antibody fluorescence labeling method, simultaneously, its marking method can be carried out mark at arbitrary time image of cell, therefore can observe the situation of cell at the target protein of different time images.

Description of drawings

Figure 1A is the recombinant plasmid synoptic diagram that is used for two fluorescin molecule marking methods.

Figure 1B is an example pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid synoptic diagram.

Fig. 2 is that internal ribosome inserts site (IRES) bicistronic mRNA ORF expression system synoptic diagram.

Fig. 3 is electrophoresis detection figure as a result, and wherein Fig. 3 A is the segmental PCR product of amplification LEF1 electrophoresis result, and Fig. 3 B is the segmental PCR product of amplification SNAP Tag electrophoresis result, and Fig. 3 C is the segmental PCR product of amplification TOM20 electrophoresis result.

Fig. 4 is the common marker detection result of Two Colour Fluorescence, wherein, 4A and 4B be respectively TOM20-SNAP (SNAP-cellTMR-Star) and LEF1-Halo (

DiAcFAM Ligand) positioning result, 4C be TOM20-SNAP (SNAP-cell TMR-Star) and LEF1-Halo ( DiAcFAM Ligand) common positioning result.

Fig. 5 is the common marker detection result of Two Colour Fluorescence, wherein, 5A and 5B be respectively TOM20-SNAP0 (SNAP-cellBG505) and LEF1-Halo (

TMR Ligand) positioning result, 5C be TOM20-SNAP0 (SNAP-cellBG505) and LEF1-Halo (

TMR Ligand) common positioning result.

Embodiment

Below in conjunction with specific embodiment, the invention will be further described.Should be understood that following examples only are used to the present invention is described but not are used to limit scope of the present invention.

The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, the condition described in " molecular cloning: laboratory manual " (New York:Cold Spring Harbor Laboratory Press, 1989) is carried out.

Embodiment 1, construction of recombinant plasmid

In the present embodiment, the contriver has made up the pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid, in this plasmid, the contriver has cloned into the pTOM20-SNAP-IRES-LEF1-Halo fragment, wherein, albumen LEF1 is the protein molecular in the Wnt signal path, mainly is positioned in the nucleus, albumen TOM20 is the albumen on the mitochondrial outer membrane, and it is positioned on the plastosome; IRES is the bicistronic mRNA ORF expression system that internal ribosome inserts the site element, make to work in coordination with under the same promotor of two genes in a carrier and express two ORF efficiently, first cistron expression cassette has merged SNAP at the C end, and second then is amalgamation and expression Halo.

The segmental structure of pTOM20-SNAP-IRES-LEF1-Halo comprises following 4 steps: 1, will be connected to by the LEF1 that PCR obtains in the pFC14A carrier with Halo, and obtain the pFC14A-LEF1 recombinant plasmid; 2, cut by enzyme LEF1-Halo is joined in the pIRES carrier, obtain the IRES-LEF1-Halo recombinant plasmid; 3, will join by the SNAP tag that PCR obtains in the IRES-LEF1-Halo recombinant plasmid, obtain the SNAP-IRES-LEF1-Halo recombinant plasmid; 4, will join by the TOM20 that PCR obtains in the SNAP-IRES-LEF1-Halo recombinant plasmid, and obtain the TOM20-SNAP-IRES-LEF1-Halo recombinant plasmid, concrete steps are as follows:

1.1, design of primers

Designed respectively and be used to make up the segmental PCR primer of pTOM20-SNAP-IRES-LEF1-Halo, be respectively the primer a1 and the a2 that are used for step 1, be used for the primer c1 and the c2 of step 3 and be used for the primer d1 and the d2 of step 4, shown in its sequence is specific as follows:

a1：AATAGGGCTAGCGATCGCCATGCCCCAACTTTCCGGAGG

a2：GAATTCGGTCTCCTCGAGGATGTAGGCAGCTGTCATTC

c1：AATAGGGCTAGCAGAATTCGCGGCCGCATGGACAAAGACTGCGAAAT

c2：TTCGACGCGTCTTAAACTTGACCCAGCCCAGGC

d1：AATAGGGCTAGCGATCGCCATGGTGGGTCGGAACAGCGC

d2：GAATTCACTCGAGCTTGTCGTCATCGTCTTTGTAGTCTTCCACATCATCTTCAGCCA

1.2, preparation pFC14A-LEF1 recombinant plasmid

1.2.1, amplification LEF1 fragment

The reference product service manual uses SuperScript ^TMIII test kit (available from Invitrogen), the construction cDNA library.

With the cDNA library that builds is template, is that primer is right with primer a1 and a2, carries out pcr amplification, obtains the LEF1 fragment, and concrete steps are as follows:

Reaction system (50ul): cNDA 2ul; Each 1ul of primer a1 and a2; Pfu enzyme 1ul; 10 * Pfu buffer 5ul; DNTP 1ul; H ₂O 39ul.

Response procedures: 94 ℃ of 2min; 94 ℃ of 30sec, 58 ℃ of 30sec, 72 ℃ of 2min; 30 circulations, 72 ℃ of 10min.

The Agrose glue of PCR product race 0.8% is detected, and the result has band at the 1.2kb place as shown in Figure 3A.

Then, the reference product service manual uses QIAEX II Gel Extraction Kit 150 test kits (available from Qiagen) to carry out glue and reclaims, and will reclaim product and check order, and sequencing result shows that reclaiming product is the LEF1 fragment.

1.2.2, the pFC14A-LEF1 construction of recombinant plasmid

Use NheI and XhoI enzyme to cut the LEF1 fragment, enzyme is cut the product gel electrophoresis detection, and carries out glue with QIAEX II GelExtraction Kit 150 test kits and reclaim, and obtains the endonuclease bamhi of LEF1; Then with the endonuclease bamhi that obtains be connected the acquisition recombinant plasmid equally with the pFC14A carrier (available from Promega) that the XhoI enzyme is cut through NheI.

With this recombinant plasmid transformed escherichia coli DH5a, incubated overnight, little sampling observation is tested, and the plasmid that will take out acquisition for a short time checks order, and the result shows and comprises required purpose fragment in this recombinant plasmid, called after pFC14A-LEF1 recombinant plasmid.

1.3, the pIRES-LEF1-Halo construction of recombinant plasmid

The reference product service manual, reclaim the pFC14A-LEF1 recombinant plasmid with QIAprep Spin Miniprep Kit 250 test kits (available from Qiagen), use the NheI/XbaI enzyme to cut the pFC14A-LEF1 recombinant plasmid then, obtain the LEF1-Halo fragment after enzyme is cut, itself and the pIRES carrier of cutting through the XbaI/SalI enzyme were carried out for one sticking one flat flat connection of benefit, obtain recombinant plasmid.

With this recombinant plasmid transformed escherichia coli DH5a, incubated overnight, little sampling observation is tested, and the plasmid that will take out acquisition for a short time checks order, and the result shows in the plasmid of acquisition and comprises required purpose fragment, called after pIRES-LEF1-Halo recombinant plasmid.

1.4, the SNAP-IRES-LEF1-Halo construction of recombinant plasmid

With pSEMS1-26m-NLS (available from Covalys) is template, is that primer is right with primer c1 and c2, presses the condition of embodiment 1.2.1, carries out pcr amplification, then the PCR product is carried out detected through gel electrophoresis, and the result has located band about 500bp shown in Fig. 3 B.And the reference product handbook, use QIAEX II Gel Extraction Kit 150 test kit glue to reclaim SNAP Tag fragment.

Use NheI and XhoI enzyme to cut SNAP Tag fragment, then with the endonuclease bamhi that obtains be connected the acquisition recombinant plasmid equally with the pIRES-LEF1-Halo recombinant plasmid that the XhoI enzyme is cut through NheI.

With this recombinant plasmid transformed escherichia coli DH5a, incubated overnight, little sampling observation is tested, and the plasmid that will take out acquisition for a short time checks order, and the result shows in the plasmid of acquisition and comprises required purpose fragment, called after SNAP-IRES-LEF1-Halo recombinant plasmid.

1.5, the pTOM20-SNAP-IRES-LEF1-Halo construction of recombinant plasmid

With human cDNA library is template, is that primer is right with primer d1 and d2, presses the condition of embodiment 1.2.1, carries out pcr amplification, then the PCR product is carried out detected through gel electrophoresis, and the result has located band about 500bp shown in Fig. 3 C.And the reference product handbook, use QIAEX II Gel Extraction Kit 150 test kit glue to reclaim the TOM20 fragment.

Use NheI and XhoI enzyme to cut the TOM20 fragment, then with the endonuclease bamhi that obtains be connected the acquisition recombinant plasmid equally with the SNAP-IRES-LEF1-Halo recombinant plasmid that the XhoI enzyme is cut through NheI.

With these recombinant plasmid transformed intestinal bacteria, after the incubated overnight, little sampling observation is tested, and the plasmid that will take out acquisition for a short time checks order, sequencing result is shown in SEQ ID NO:1, according to sequencing result, comprise required pTOM20-SNAP-IRES-LEF1-Halo fragment in the recombinant plasmid of acquisition, called after pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid.

Embodiment 2, transfectional cell and fluorescent mark

2.1, cell transfecting

Use the Lipo-plus method, transfection Hela cell, concrete steps are as follows:

(1) the medical alcohol washing and sterilizing is good slide is put into 24 orifice plates, and by behind the 30min, with sterilization washing 3-5 time, flush away does not wrap the PLL of quilt, dries on super clean bench with poly-lysine PLL (Poly-L-Lysine) bag;

(2) the Hela cell in wrapping by 24 orifice plates of good slide, was cultivated 24 hours PLL;

(3) get 250ng pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid and join in the EP pipe that contains 25ul serum-free DMEM nutrient solution, and mixing;

(4) get transfection reagent plus, be diluted in the DMEM nutrient solution with 1: 20, mixing adds in the EP pipe of going up the step with the amount of 21ul/ pipe, and mixing left standstill 15 minutes;

(5) get transfection reagent lipo, be diluted in the DMEM nutrient solution with 1: 20, mixing adds in the EP pipe of going up the step with the amount of 21ul/ pipe, and mixing left standstill 15 minutes;

Repeating step (3)-(5), the nutrient solution that contains plasmid and transfection reagent of configuration capacity;

(6) absorb original fluid, and add 200ul DMEM nutrient solution to each hole;

After (7) one hours, drip the nutrient solution that contains plasmid that 67ul obtains respectively in step 6 to every hole;

After (8) 3 hours, absorb original nutrient solution, add the nutrient solution that 500ul contains 10% foetal calf serum; Cultivate and be used for following fluorescent mark after 24 hours.

2.2, fluorescent mark

Divide two groups during the culturing cell that obtains in embodiment 2.1 is cultivated, one group of cell adds

DiAcFAMLigand (available from Promega) and SNAP-cell TMR-Star (available from Covalys), another group cell adds TMR Ligand (available from Promega) and SNAP-cell BG505 (available from Covalys) carry out fluorescent mark and detect, wherein,

To be diluted to jointly in 1: 500 and 1: 100 in 37 ℃ the DMEM substratum that contains 10%FBS, concrete steps are as follows respectively for Ligand and SNAP-cell ligand:

(1) the former substratum in each hole among the embodiment 2.1 is siphoned away to the remaining 100ul of I, drip in each hole then that 100ul is above-mentioned to be contained

The DMEM substratum of Ligand and SNAP-cell ligand;

(2) place 37 ℃, 5%CO ₂In the incubator, lucifuge was cultivated 15-30 minute.

(3) after above-mentioned DMEM substratum is removed in suction,, in each hole, add 400ul PBS and wash in 37 ℃;

(4) after PBS is removed in suction, fix 10 minutes with the formaldehyde lucifuge of freshly prepared 400ul 4%;

(5) after stationary liquid is removed in suction, with the PBS that contains 400ul 0.1%TritonX-100, penetrating 30 minutes;

(6) drop of resin that mounting is used is on slide glass, and the cover glass that mark is good on 24 orifice plates is placed resin on the slide glass, carries out the observation of Confocal fluorescent microscope after drying.

Observed result such as Fig. 4, shown in Figure 5, plastosome among Fig. 4 A and Fig. 5 A respectively on the mark red and green fluorescence, on the nucleus among Fig. 4 B and Fig. 5 B on the mark green and red fluorescence, two kinds of fluorescence of Fig. 4 C and Fig. 5 C are localized result altogether.According to Fig. 4, the result of Fig. 5, LEF1-Halo accurately navigates on the nucleus; TOM20-SNAP also accurately is positioned on the plastosome, and LEF1-Halo and TOM20-SNAP also are positioned in the cell well altogether.

According to The above results, use the pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid, carry out cell transfecting and fluorescent mark and detect, the result of acquisition can not disturb each other to some extent.

Though; in pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid of the present invention; what use is that IRES expresses pTOM20-SNAP to reach on same carrier; two proteic purposes of LEF1-Halo; but for a person skilled in the art; the method and the spirit that disclose according to the present invention; utilization two promotors on same carrier are expressed pTOM20-SNAP respectively; two albumen of LEF1-Halo reach identical effect; this is conspicuous; therefore, also be the content that the present invention needs protection.

Though; in pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid of the present invention; SNAP and Halo all place separately after the albumen; but place proteic separately front and back to its active nothing influence SNAP and Halo; selected according to proteic characteristic separately; therefore, also be the content that the present invention needs protection.

Though; in pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid of the present invention; the detected albumen that uses is respectively pTOM20 and LEF1; but the method and the spirit that disclose according to the present invention; use other detected albumen, the detected proteic recombinant plasmid that structure can be expressed simultaneously, this is conspicuous for a person skilled in the art; therefore, also be the content that the present invention needs protection.

Though; in an embodiment of the present invention; the small molecules substrate adds; but two kinds of markers are that the order that can add simultaneously or add respectively and add can not distinguished to some extent; can be selected easily by experimental needs on the contrary; this is conspicuous for a person skilled in the art, therefore, also is the content that the present invention needs protection.

In sum, use method provided by the invention, can in same carrier, work in coordination with two goal gene of coexpression, need not to worry issuable problem in the efficient of cotransfection and other cotransfection processes, can be well with two different albumen in the same cell of tense marker, utilize different fluorescence on the substrate band separately, under the same visual field, can observe two kinds of protein molecular location in cell simultaneously, two kinds of marking methods can not disturbed each other to some extent, can carry out mark simultaneously, can not influence the specificity of mark, can not influence the correct location of protein molecular; And labeling process is simple, fast, can in 15-30 minute, finish mark, save time of mark greatly than traditional antibody fluorescence labeling method, simultaneously, its marking method can be carried out mark at arbitrary time image of cell, therefore can observe the situation of cell at the target protein of different time images.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉method of a kind of pair of fluorescin molecular cell mark

<130>P5081018

<160>1

<170>PatentIn?version?3.1

<210>1

<211>9233

<212>DNA

＜213〉intestinal bacteria

<400>1

tcaatattgg?ccattagcca?tattattcat?tggttatata?gcataaatca?atattggcta 60

ttggccattg?catacgttgt?atctatatca?taatatgtac?atttatattg?gctcatgtcc 120

aatatgaccg?ccatgttggc?attgattatt?gactagttat?taatagtaat?caattacggg 180

gtcattagtt?catagcccat?atatggagtt?ccgcgttaca?taacttacgg?taaatggccc 240

gcctggctga?ccgcccaacg?acccccgccc?attgacgtca?ataatgacgt?atgttcccat 300

agtaacgcca?atagggactt?tccattgacg?tcaatgggtg?gagtatttac?ggtaaactgc 360

ccacttggca?gtacatcaag?tgtatcatat?gccaagtccg?ccccctattg?acgtcaatga 420

cggtaaatgg?cccgcctggc?attatgccca?gtacatgacc?ttacgggact?ttcctacttg 480

gcagtacatc?tacgtattag?tcatcgctat?taccatggtg?atgcggtttt?ggcagtacac 540

caatgggcgt?ggatagcggt?ttgactcacg?gggatttcca?agtctccacc?ccattgacgt 600

caatgggagt?ttgttttggc?accaaaatca?acgggacttt?ccaaaatgtc?gtaacaactg 660

cgatcgcccg?ccccgttgac?gcaaatgggc?ggtaggcgtg?tacggtggga?ggtctatata 720

agcagagctc?gtttagtgaa?ccgtcagatc?actagaagct?ttattgcggt?agtttatcac 780

agttaaattg?ctaacgcagt?cagtgcttct?gacacaacag?tctcgaactt?aagctgcagt 840

gactctctta?aggtagcctt?gcagaagttg?gtcgtgaggc?actgggcagg?taagtatcaa 900

ggttacaaga?caggtttaag?gagaccaata?gaaactgggc?ttgtcgagac?agagaagact 960

cttgcgtttc?tgataggcac?ctattggtct?tactgacatc?cactttgcct?ttctctccac 1020

aggtgtccac?tcccagttca?attacagctc?ttaaggctag?agtacttaat?acgactcact 1080

ataggctagc?gatcgccatg?gtgggtcgga?acagcgccat?cgccgccggt?gtatgcgggg 1140

cccttttcat?tgggtactgc?atctacttcg?accgcaaaag?acgaagtgac?cccaacttca 1200

agaacaggct?tcgagaacga?agaaagaaac?agaagcttgc?caaggagaga?gctgggcttt 1260

ccaagttacc?tgaccttaaa?gatgctgaag?ctgttcagaa?gttcttcctt?gaagaaatac 1320

agcttggtga?agagttacta?gctcaaggtg?aatatgagaa?gggcgtagac?catctgacaa 1380

atgctattgc?tgtgtgtgga?cagccacagc?agttactgca?ggtcttacag?caaactcttc 1440

caccaccagt?gttccagatg?cttctgacta?agctcccaac?aattagtcag?agaattgtaa 1500

gtgctcagag?cttggctgaa?gatgatgtgg?aatgcggccg?catggacaaa?gactgcgaaa 1560

tgaagcgcac?caccctggat?agccctctgg?gcaagctgga?actgtctggg?tgcgaacagg 1620

gcctgcacga?gatcaagctg?ctgggcaaag?gaacatctgc?cgccgacgcc?gtggaagtgc 1680

ctgccccagc?cgccgtgctg?ggcggaccag?agccactgat?gcaggccacc?gcctggctca 1740

acgcctactt?tcaccagcct?gaggccatcg?aggagttccc?tgtgccagcc?ctgcaccacc 1800

cagtgttcca?gcaggagagc?tttacccgcc?aggtgctgtg?gaaactgctg?aaagtggtga 1860

agttcggaga?ggtcatcagc?taccagcagc?tggccgccct?ggccggcaat?cccgccgcca 1920

ccgccgccgt?gaaaaccgcc?ctgagcggaa?atcccgtgcc?cattctgatc?ccctgccacc 1980

gggtggtgtc?tagctctggc?gccgtggggg?gctacgaggg?cgggctcgcc?gtgaaagagt 2040

ggctgctggc?ccacgagggc?cacagactgg?gcaagcctgg?gctgggtcaa?gtttaagacg 2100

cgtcgagcat?gcatctaggg?cggccaattc?cgcccctctc?cctccccccc?ccctaacgtt 2160

actggccgaa?gccgcttgga?ataaggccgg?tgtgcgtttg?tctatatgtg?attttccacc 2220

atattgccgt?cttttggcaa?tgtgagggcc?cggaaacctg?gccctgtctt?cttgacgagc 2280

attcctaggg?gtctttcccc?tctcgccaaa?ggaatgcaag?gtctgttgaa?tgtcgtgaag 2340

gaagcagttc?ctctggaagc?ttcttgaaga?caaacaacgt?ctgtagcgac?cctttgcagg 2400

cagcggaacc?ccccacctgg?cgacaggtgc?ctctgcggcc?aaaagccacg?tgtataagat 2460

acacctgcaa?aggcggcaca?accccagtgc?cacgttgtga?gttggatagt?tgtggaaaga 2520

gtcaaatggc?tctcctcaag?cgtattcaac?aaggggctga?aggatgccca?gaaggtaccc 2580

cattgtatgg?gatctgatct?ggggcctcgg?tgcacatgct?ttacatgtgt?ttagtcgagg 2640

ttaaaaaaac?gtctaggccc?cccgaaccac?ggggacgtgg?ttttcctttg?aaaaacacga 2700

tgataagctt?gccacaaccc?gggatcctct?agcgatcgcc?atgccccaac?tttccggagg 2760

aggcggcggg?ggggacccgg?aactctgcgc?caccgatgag?atgatcccct?tcaaggacga 2820

aggcgatccc?cagaaggaga?agatcttcgc?cgagatcagt?catcccgaag?aggagggcga 2880

cttagccgac?atcaagtcat?ctttggttaa?cgagtccgaa?atcatcccag?ccagcaacgg 2940

gcatgaggtg?gtcagacaag?ccccgtcctc?tcaggagccc?taccacgaca?aggccagaga 3000

acaccctgat?gaaggaaagc?atccagacgg?aggcctgtac?aacaagggac?cctcctactc 3060

cagttactct?ggctacataa?tgatgcccaa?tatgaacagc?gacccgtaca?tgtcaaatgg 3120

gtccctttct?ccacccatcc?cgaggacatc?aaataaagtg?cccgtggtgc?agccctctca 3180

cgcggtccac?ccgctcaccc?ccctcatcac?ctacagcgac?gagcactttt?ctccgggatc 3240

ccacccgtca?cacatcccgt?cagatgtcaa?ctccaagcaa?ggcatgtcca?gacaccctcc 3300

agctcctgaa?atccccacct?tctaccccct?gtctccgggc?ggcgttggac?agatcacccc 3360

acccattggc?tggcaaggtc?agcctgttta?tcccatcacg?ggtggattca?ggcaacccta 3420

cccatcctca?ctgtcaggcg?acacttccat?gtccaggttt?tcccatcata?tgattcctgg 3480

tccccctggc?ccccacacaa?ctggcatccc?tcatccagct?attgtaacac?ctcaggtcaa 3540

acaggagcac?ccccacacgg?acagtgacct?aatgcacgtg?aagcctcaac?acgaacagag 3600

aaaggagcag?gagcccaaaa?gacctcatat?taagaagcct?ctgaatgctt?tcatgttata 3660

tatgaaagaa?atgagagcga?atgtcgtagc?tgagtgcacg?ctaaaggaga?gtgcagctat 3720

caaccagatc?ctgggcagaa?gatggcacgc?cctctcccgg?gaagagcagg?ccaaatacta 3780

tgaactagca?cggaaagaga?gacagctaca?catgcagctt?tatccaggct?ggtcagcgcg 3840

agacaattat?ggcaagaaga?agaagaggaa?gagagagaag?ctacaggagt?cgacttcagg 3900

tacaggtccc?agaatgacag?ctgcctacat?cctcgagcca?accactgagg?atctgtactt 3960

tcagagcgat?aacgatggat?ccgaaatcgg?tactggcttt?ccattcgacc?cccattatgt 4020

ggaagtcctg?ggcgagcgca?tgcactacgt?cgatgttggt?ccgcgcgatg?gcacccctgt 4080

gctgttcctg?cacggtaacc?cgacctcctc?ctacgtgtgg?cgcaacatca?tcccgcatgt 4140

tgcaccgacc?catcgctgca?ttgctccaga?cctgatcggt?atgggcaaat?ccgacaaacc 4200

agacctgggt?tatttcttcg?acgaccacgt?ccgcttcatg?gatgccttca?tcgaagccct 4260

gggtctggaa?gaggtcgtcc?tggtcattca?cgactggggc?tccgctctgg?gtttccactg 4320

ggccaagcgc?aatccagagc?gcgtcaaagg?tattgcattt?atggagttca?tccgccctat 4380

cccgacctgg?gacgaatggc?cagaatttgc?ccgcgagacc?ttccaggcct?tccgcaccac 4440

cgacgtcggc?cgcaagctga?tcatcgatca?gaacgttttt?atcgagggta?cgctgccgat 4500

gggtgtcgtc?cgcccgctga?ctgaagtcga?gatggaccat?taccgcgagc?cgttcctgaa 4560

tcctgttgac?cgcgagccac?tgtggcgctt?cccaaacgag?ctgccaatcg?ccggtgagcc 4620

agcgaacatc?gtcgcgctgg?tcgaagaata?catggactgg?ctgcaccagt?cccctgtccc 4680

gaagctgctg?ttctggggca?ccccaggcgt?tctgatccca?ccggccgaag?ccgctcgcct 4740

ggccaaaagc?ctgcctaact?gcaaggctgt?ggacatcggc?ccgggtctga?atctgctgca 4800

agaagacaac?ccggacctga?tcggcagcga?gatcgcgcgc?tggctgtcta?ctctggagat 4860

ttccggttaa?tagaattcta?gcccccggga?ggccgcttcc?ctttagtgag?ggttaatgct 4920

tcgagcagac?atgataagat?acattgatga?gtttggacaa?accacaacta?gaatgcagtg 4980

aaaaaaatgc?tttatttgtg?aaatttgtga?tgctattgct?ttatttgtaa?ccattataag 5040

ctgcaataaa?caagttaaca?acaacaattg?cattcatttt?atgtttcagg?ttcaggggga 5100

gatgtgggag?gttttttaaa?gcaagtaaaa?cctctacaaa?tgtggtaaaa?tccgataagg 5160

atcgatccgg?gctggcgtaa?tagcgaagag?gcccgcaccg?atcgcccttc?ccaacagttg 5220

cgcagcctga?atggcgaatg?gacgcgccct?gtagcggcgc?attaagcgcg?gcgggtgtgg 5280

tggttacgcg?cagcgtgacc?gctacacttg?ccagcgccct?agcgcccgct?cctttcgctt 5340

tcttcccttc?ctttctcgcc?acgttcgccg?gctttccccg?tcaagctcta?aatcgggggc 5400

tccctttagg?gttccgattt?agagctttac?ggcacctcga?ccgcaaaaaa?cttgatttgg 5460

gtgatggttc?acgtagtggg?ccatcgccct?gatagacggt?ttttcgccct?ttgacgttgg 5520

agtccacgtt?ctttaatagt?ggactcttgt?tccaaactgg?aacaacactc?aaccctatct 5580

cggtctattc?ttttgattta?taagggattt?tgccgatttc?ggcctattgg?ttaaaaaatg 5640

agctgattta?acaaatattt?aacgcgaatt?ttaacaaaat?attaacgttt?acaatttcgc 5700

ctgatgcggt?attttctcct?tacgcatctg?tgcggtattt?cacaccgcat?acgcggatct 5760

gcgcagcacc?atggcctgaa?ataacctctg?aaagaggaac?ttggttaggt?accttctgag 5820

gcggaaagaa?ccagctgtgg?aatgtgtgtc?agttagggtg?tggaaagtcc?ccaggctccc 5880

cagcaggcag?aagtatgcaa?agcatgcatc?tcaattagtc?agcaaccagg?tgtggaaagt 5940

ccccaggctc?cccagcaggc?agaagtatgc?aaagcatgca?tctcaattag?tcagcaacca 6000

tagtcccgcc?cctaactccg?cccatcccgc?ccctaactcc?gcccagttcc?gcccattctc 6060

cgccccatgg?ctgactaatt?ttttttattt?atgcagaggc?cgaggccgcc?tcggcctctg 6120

agctattcca?gaagtagtga?ggaggctttt?ttggaggcct?aggcttttgc?aaaaagcttg 6180

attcttctga?cacaacagtc?tcgaacttaa?ggctagagcc?accatgattg?aacaagatgg 6240

attgcacgca?ggttctccgg?ccgcttgggt?ggagaggcta?ttcggctatg?actgggcaca 6300

acagacaatc?ggctgctctg?atgccgccgt?gttccggctg?tcagcgcagg?ggcgcccggt 6360

tctttttgtc?aagaccgacc?tgtccggtgc?cctgaatgaa?ctgcaggacg?aggcagcgcg 6420

gctatcgtgg?ctggccacga?cgggcgttcc?ttgcgcagct?gtgctcgacg?ttgtcactga 6480

agcgggaagg?gactggctgc?tattgggcga?agtgccgggg?caggatctcc?tgtcatctca 6540

ccttgctcct?gccgagaaag?tatccatcat?ggctgatgca?atgcggcggc?tgcatacgct 6600

tgatccggct?acctgcccat?tcgaccacca?agcgaaacat?cgcatcgagc?gagcacgtac 6660

tcggatggaa?gccggtcttg?tcgatcagga?tgatctggac?gaagagcatc?aggggctcgc 6720

gccagccgaa?ctgttcgcca?ggctcaaggc?gcgcatgccc?gacggcgagg?atctcgtcgt 6780

gacccatggc?gatgcctgct?tgccgaatat?catggtggaa?aatggccgct?tttctggatt 6840

catcgactgt?ggccggctgg?gtgtggcgga?ccgctatcag?gacatagcgt?tggctacccg 6900

tgatattgct?gaagagcttg?gcggcgaatg?ggctgaccgc?ttcctcgtgc?tttacggtat 6960

cgccgctccc?gattcgcagc?gcatcgcctt?ctatcgcctt?cttgacgagt?tcttctgagc 7020

gggactctgg?ggttcgaaat?gaccgaccaa?gcgacgccca?acctgccatc?acgatggccg 7080

caataaaata?tctttatttt?cattacatct?gtgtgttggt?tttttgtgtg?aatcgatagc 7140

gataaggatc?cgcgtatggt?gcactctcag?tacaatctgc?tctgatgccg?catagttaag 7200

ccagccccga?cacccgccaa?cacccgctga?cgcgccctga?cgggcttgtc?tgctcccggc 7260

atccgcttac?agacaagctg?tgaccgtctc?cgggagctgc?atgtgtcaga?ggttttcacc 7320

gtcatcaccg?aaacgcgcga?gacgaaaggg?cctcgtgata?cgcctatttt?tataggttaa 7380

tgtcatgata?ataatggttt?cttagacgtc?aggtggcact?tttcggggaa?atgtgcgcgg 7440

aacccctatt?tgtttatttt?tctaaataca?ttcaaatatg?tatccgctca?tgagacaata 7500

accctgataa?atgcttcaat?aatattgaaa?aaggaagagt?atgagtattc?aacatttccg 7560

tgtcgccctt?attccctttt?ttgcggcatt?ttgccttcct?gtttttgctc?acccagaaac 7620

gctggtgaaa?gtaaaagatg?ctgaagatca?gttgggtgca?cgagtgggtt?acatcgaact 7680

ggatctcaac?agcggtaaga?tccttgagag?ttttcgcccc?gaagaacgtt?ttccaatgat 7740

gagcactttt?aaagttctgc?tatgtggcgc?ggtattatcc?cgtattgacg?ccgggcaaga 7800

gcaactcggt?cgccgcatac?actattctca?gaatgacttg?gttgagtact?caccagtcac 7860

agaaaagcat?cttacggatg?gcatgacagt?aagagaatta?tgcagtgctg?ccataaccat 7920

gagtgataac?actgcggcca?acttacttct?gacaacgatc?ggaggaccga?aggagctaac 7980

cgcttttttg?cacaacatgg?gggatcatgt?aactcgcctt?gatcgttggg?aaccggagct 8040

gaatgaagcc?ataccaaacg?acgagcgtga?caccacgatg?cctgtagcaa?tggcaacaac 8100

gttgcgcaaa?ctattaactg?gcgaactact?tactctagct?tcccggcaac?aattaataga 8160

ctggatggag?gcggataaag?ttgcaggacc?acttctgcgc?tcggcccttc?cggctggctg 8220

gtttattgct?gataaatctg?gagccggtga?gcgtgggtct?cgcggtatca?ttgcagcact 8280

ggggccagat?ggtaagccct?cccgtatcgt?agttatctac?acgacgggga?gtcaggcaac 8340

tatggatgaa?cgaaatagac?agatcgctga?gataggtgcc?tcactgatta?agcattggta 8400

actgtcagac?caagtttact?catatatact?ttagattgat?ttaaaacttc?atttttaatt 8460

taaaaggatc?taggtgaaga?tcctttttga?taatctcatg?accaaaatcc?cttaacgtga 8520

gttttcgttc?cactgagcgt?cagaccccgt?agaaaagatc?aaaggatctt?cttgagatcc 8580

tttttttctg?cgcgtaatct?gctgcttgca?aacaaaaaaa?ccaccgctac?cagcggtggt 8640

ttgtttgccg?gatcaagagc?taccaactct?ttttccgaag?gtaactggct?tcagcagagc 8700

gcagatacca?aatactgtcc?ttctagtgta?gccgtagtta?ggccaccact?tcaagaactc 8760

tgtagcaccg?cctacatacc?tcgctctgct?aatcctgtta?ccagtggctg?ctgccagtgg 8820

cgataagtcg?tgtcttaccg?ggttggactc?aagacgatag?ttaccggata?aggcgcagcg 8880

gtcgggctga?acggggggtt?cgtgcacaca?gcccagcttg?gagcgaacga?cctacaccga 8940

actgagatac?ctacagcgtg?agctatgaga?aagcgccacg?cttcccgaag?ggagaaaggc 9000

ggacaggtat?ccggtaagcg?gcagggtcgg?aacaggagag?cgcacgaggg?agcttccagg 9060

gggaaacgcc?tggtatcttt?atagtcctgt?cgggtttcgc?cacctctgac?ttgagcgtcg 9120

atttttgtga?tgctcgtcag?gggggcggag?cctatggaaa?aacgccagca?acgcggcctt 9180

tttacggttc?ctggcctttt?gctggccttt?tgctcacatg?gctcgacaga?tct 9233

Claims (10)

1, a kind of recombinant plasmid that is used for two fluorescence labeling methods is characterized in that described recombinant plasmid comprises:

1) the dna fragmentation A of code tag albumin A, this label protein can be specifically and its fluorogenic substrate covalent attachment, and the dna sequence dna C that its 5 ' end or 3 ' end merge one section coding PROTEIN C to be detected forms Segment A C;

2) the dna fragmentation B of code tag protein B, this label protein can be specifically and its fluorogenic substrate covalent attachment, and the dna sequence dna D that its 5 ' end or 3 ' end merge one section coding protein D to be detected forms fragment BD;

3) described Segment A C is connected by the dna sequence dna E that one section coding internal ribosome inserts the bicistronic mRNA ORF expression system of site element with BD;

4) in one section promotor of transcribing control of being responsible for described Segment A C, E and BD of the correct position of the upstream of described Segment A C.

2, recombinant plasmid as claimed in claim 1 is characterized in that, described label protein comprises SNAP, Halo.

3, recombinant plasmid as claimed in claim 1, it is characterized in that, described fragment C and D can be in the different arbitrarily cell existence or synthetic can be translated as the dna fragmentation of polypeptide, described label protein A, B is SNAP and Halo, and described expression system sequence is IRES.

4. recombinant plasmid as claimed in claim 3 is characterized in that, described albumen to be detected is pTOM20 and LEF1, and described label protein is SNAP and Halo, and described expression system sequence is IRES.

5 recombinant plasmids as claimed in claim 4 is characterized in that, the described recombinant plasmid that is used for two fluorescin molecule marking methods is the pTOM20-SNAP-IRES-LEF1-Halo recombinant plasmid, and its sequence is shown in SEQ ID NO:1.

As each described recombinant plasmid among the claim 1-5, it is characterized in that 6, described carrier is the pIRES carrier.

7, the method for a kind of pair of fluorescin molecular cell mark is characterized in that, may further comprise the steps:

A) make up as each described recombinant plasmid that is used for two fluorescin molecule marking methods among the claim 1-6;

B) cell transfecting;

C) fluorescent mark.

8, method as claimed in claim 7 is characterized in that, described pTOM20-SNAP-IRES-LEF1-Halo construction of recombinant plasmid may further comprise the steps:

A) the LEF1 fragment is connected in the pFC14A carrier with Halo, obtains the pFC14A-LEF1 recombinant plasmid;

B) the LEF1-Halo fragment is joined in the pIRES carrier, obtain the IRES-LEF1-Halo recombinant plasmid;

C) SNAP tag fragment is joined in the IRES-LEF1-Halo recombinant plasmid, obtain the SNAP-IRES-LEF1-Halo recombinant plasmid;

D) the TOM20 fragment is joined in the SNAP-IRES-LEF1-Halo recombinant plasmid, obtain the TOM20-SNAP-IRES-LEF1-Halo recombinant plasmid.

9, method as claimed in claim 8 is characterized in that, described LEF1 fragment, SNAP tag fragment and TOM20 fragment obtain by pcr amplification.

10, method as claimed in claim 9 is characterized in that, described LEF1-Halo fragment is cut the pFC14A-LEF1 recombinant plasmid by enzyme and obtained.

Images