CN101557813A - Liposome treatment of viral infections - Google Patents

Abstract

One can treat a viral infection such as hepatitis B (HBV), hepatitis C (HCV), and bovine viral diarrhea virus (BVDV) infections via the delivery of pH sensitive liposomes directly into the endoplasmic reticulum (ER) membrane. Two exemplary liposome formulations are DOPE/CHEMS (DC liposomes) and DOPE/CHEMS/PEG-PE (DCPP liposomes). DC and DCPP liposomes can optimize the intracellular delivery of N-butyl deoxynojirimycin (NB-DNJ), and consequently increase the in vivo activity of this iminosugar several orders of magnitude, and could be used in combination with other therapeutic agents such as interferon and/or ribavirin. The optimized release of NB-DNJ directly into the ER can be also applied for the treatment of other viruses, for which NB-DNJ is known to be an effective antiviral, such as human immunodeficiency virus (HIV).

Description

The liposome therapeutic of viral infection

Related application

[0001] the application requires the U.S. Provisional Application 60/834 in submission on August 2nd, 2006 by people such as Dwek, 797 and the U.S. Provisional Application 60/846 submitted in 22nd in JIUYUE in 2006 by people such as Dwek, 344 priority, two pieces of documents are incorporated this paper into as a reference in full.

Technical field

[0002] the application generally relates to the method and composition that is used for the treatment of viral infection, more particularly, relates to and uses liposome to treat the method and composition of viral infection.

Background technology

[0003] hepatitis B virus.(HBV HepB) is the paathogenic factor that comprises the acute and chronic hepatopathy of hepatic fibrosis, liver cirrhosis, inflammatory hepatopathy and the hepatocarcinoma that can cause some deaths, for example to hepatitis B virus, referring to, Joklik, Wolfgang K., Virology, the third edition, Appleton ﹠amp; Lange, Norwalk, Conn., 1988 (ISBN0-8385-9462-X).Although obtained effective vaccine, the whole world surpasses 280,000,000 people,, accounts for 5% of world population that is, still infects virus for a long time, and for example, referring to Locarnini, S.A. waits the people, Antiviral Chemistry ﹠amp; Chemotherapy (1996) 7 (2): 53-64.This vaccine does not have therapeutic value for the people who infects virus.In Europe and North America, 0.1% of population infects to 1%.According to estimates, 15% to 20% of the individuality that to infect infects from HBV and to develop into liver cirrhosis or other long-term disability (chronic disability).In case formation liver cirrhosis, M ﹠ M are quite big, have about 5 years patient's life span, for example, and referring to Blume, H., E. waits the people, Advanced Drug Delivery Reviews (1995) 17:321-331.

[0004] hepatitis C virus.About 170,000,000 people in the whole world promptly, accounts for 3% of world population, for example, referring to WHO, J.Viral.Hepat.1999; 6:35-47 and about 4,000,000 people of the U.S. infect hepatitis C virus (HCV, HepC).About 80% of the individuality of HCV becomes chronic infection in the actute infection.Therefore, HCV is the main paathogenic factor of chronic hepatitis.In case the generation chronic infection is if be eliminated hardly without treatment virus.In rare case, HCV infects and causes clinical acute illness and or even liver failure.Chronic HCV infection can be significantly different because of the difference between the individuality, a some of them cognition is suffered from hepatopathy clinical non-significance or atomic, and never develop into complication, and other cognition is suffered from clinical significant chronic hepatitis and may then be developed into liver cirrhosis.HCV infection and develop into really liver cirrhosis individuality about 20% can develop into hepatopathy and have the risk that develops into primary hepatocarcinoma of increase in late period.

[0005] antiviral drugs interferon for example, it unites use separately or with ribavirin, is effective in up to 80% patient.(Di Bisceglie, A.M, and Hoofnagle, J.H.2002, Hepatology 36, and S121-S127), but many patients do not tolerate this therapeutic alliance form.

[0006] bovine viral diarrhea virus.Bovine viral diarrhea virus (BVDV) is distributed in the worldwide and ubiquity in most of cows.BVDV also is often used as tissue culture's succedaneum of HCV.The viral organism type that two kinds of BVDV are arranged: non-cytopathogenic effect type (ncp) and cytopathogenic effect type (cp).The classification of viral organism type is based on the cytopathic effect in the cultured cell and irrelevant with virulence.Ncp BVDV is common in cattle, and the cp biotype is rare relatively, and takes place to produce from the ncp strain behind the specific mutations in viral genome.Using cp BVDV strain infection cell in tissue culture is feature to form apoptotic cell collection bunch (speckle) on cell monolayer, can easily monitor this feature at microscopically.

[0007] HIV (human immunodeficiency virus).HIV (human immunodeficiency virus) (HIV) is the paathogenic factor of acquired immune deficiency syndrome (AIDS) (AIDS) and associated conditions.Have distinct two class HIV:HIV-1 and HIV-2 at least.In addition, a large amount of genetic heterogeneitys are present in the colony of every kind of these types.Because the epiphytotics morbidity of AIDS, about 2,000 ten thousand people are dead, and according to estimates, surpass 4,000 ten thousand people and still carry HIV-1/AIDS at present, and have 14 000 people infected every day in the whole world.

[0008] developed multiple antiviral therapy agent and diagnostic means, made and for those people that obtain described means, improved widely quantity and quality of life at least.Most of viral interference protein or such as the process of reverse transcription and proteinase activity in these medicines.Unfortunately, these therapies fail eliminate to infect, and the unwanted effect of many therapies is serious, all have drug resistance HIV strain for every kind of antiviral type of present application.

[0009] as the N-butyl deoxynojirimycin (NB-DNJ) of therapeutic agent.NB-DNJ, claim N-butyl-1 again, 5-dideoxy-1,5-imino group-D-glucitol, the process that inhibition is participated in by ER glucosidase I and II, and shown by causing that HIV (human immunodeficiency virus) (HIV) and hepatitis virus particularly bring into play effective antivirus action such as the misfolding and/or the ER-delay of the glycoprotein of hepatitis B virus, hepatitis C virus, bovine viral diarrhea virus or the like virus.The method of the deoxidization nojirimycin derivative that synthetic NB-DNJ and other N-replace has been described, for example, at United States Patent (USP) 5,622, in 972,4,246,345,4,266,0254,405,714 and 4,806,650.The antiviral effect of NB-DNJ has been discussed, for example in United States Patent (USP) 6,465,487; 6,545,021; 6,689,759; Relate to hepatitis virus in 6,809,083 and at United States Patent (USP) 4,849, relate to HIV virus in 430.

[0010] alpha-glucosidase inhibitors such as NB-DNJ have been presented in the cell culture and have treated HBV effectively and infect in using the marmot animal model, for example, referring to T.Block, X.Lu, A.S.Mehta, B.S.Blumberg, B.Tennant, M.Ebling, B.Korba, D.M.Lansky, G.S.Jacob and R.A.Dwek, Nat Med.1998May; 4 (5): 610-4.NB-DNJ suppresses the secretion of HBV particle and causes interior delay of born of the same parents of HBV DNA.

[0011] NB-DNJ has shown it is the strong antiviral substance of antagonism BVDV (cell culture model of a kind of HCV of being used for), for example, and referring to Branza-Nichita N, DurantelD, Carrouee-Durantel S, Dwek RA, Zitzmann N., J Virol.2001Apr; 75 (8): 3527-36; Durantel, D. waits the people, J.Virol., 2001,75,8987-8998; N.Zitzmann waits the people, PNAS, 1999,96,11878-11882.Use NB-DNJ treats the infectivity that causes viral offspring and reduces, to less by the influence of the actual quantity of excretory virus.

[0012] NB-DNJ has shown it is the antiviral agent of anti-HIV; Treatment causes the influence of the virion subnumber that discharges from the HIV infection cell lower, yet the amount of d/d infectious virus is greatly diminished, and for example, referring to P.B.Fischer, M.Collin waits people (1995), J.Virol.69 (9): 5791-7; P.B.Fischer, G.B.Karlsson, T.Butters, R.Dwek and F.Platt, J.Virol.70 (1996a), pp.7143-7152, P.B.Fischer, G.B.Karlsson, R.Dwek and F.Platt .J.Virol.70 (1996b), pp.7153-7160.Carried out involving the clinical trial of NB-DNJ in the HIV-1 infected patient, the result shows that the required concentration of antiviral activity is too high and produce serious adverse in the patient, for example, referring to Fischl M.A., Resnick L., Coombs R., Kremer A.B., Pottage J.C.Jr, Fass R.J., Fife K.H., Powderly W.G., Collier A.C., Aspinall R.L., Deng the people, J.Acquir.Immune.Defic.Syndr.1994 Feb; .7 (2): 139-47.There is not at present the sudden change HIV strain of antagonism NB-DNJ treatment.

[0013] ER protein folding and glucosidase I and II.The antiviral effect that is suppressed to show by glucosidase is considered to the misfolding of viral glycoprotein in ER or the result of delay, mainly enters calnexin/calreticulin circulation by blocking-up and carries out.With three glucosylation oligosaccharide (Glc ₃Man ₉GlcNAc ₂) transfer to after the Asn-X-Ser/Thr consensus sequence in the growth polypeptide chain, necessary is that the glucose residue that three α-connections can take place was released before further being processed into ripe carbohydrate unit.In addition, two glucose residues in the outer part must be used for suitably folding to be allowed to entering calnexin/calreticulin circulation through finishing, for example, referring to Bergeron, people such as J.J., TrendsBiochem.Sci., 1994,19,124-128; Peterson, people such as J.R., Mol.Biol.Cell, 1995,6,1173-1184.Initial processing is positioned at the influence of inherent film (integral membrane) enzyme (glucosidase I) of the catalyst structure domain with inner chamber orientation of ER, the glucose residue that this enzyme spcificity cracking α 1-2 connects; Then be that glucosidase II plays a role, this enzyme II discharges two in the glucose component that α 1-3 connects.

[0014] liposome.Liposome can directly be sent water soluble compound in cell, walks around the cell membrane as the molecule barrier.PH sensitive liposome body preparation can comprise PHOSPHATIDYL ETHANOLAMINE (PE) or derivatives thereof (for example DOPE) and the combination that contains the chemical compound (it can be used as stabilizing agent under neutral pH) of acidic-group.It can be the good stable chemoattractant molecule that Cholesteryl hemisuccinate (CHEMS) is compared with amphiphatic molecule stabilizing agent in other the body because its cholesteryl give comprise PE vesicle with higher stability.Can depend on consumingly and the interaction that can influence its pharmacokinetics and chorologic serum component (opsonin) by rendeing a service in the liposome-mediated body of sending.PH sensitive liposome body can promptly be eliminated from blood circulation, accumulate in liver and the spleen, yet the inclusions of lipid and covalently bound Polyethylene Glycol (PEG) can be by stablizing DOPE: the net negative charge on the CHEMS liposome overcomes the removing of being undertaken by reticuloendothelial system (RES).DOPE-CHEMS and DOPE-CHEMS-PEG-PE liposome and preparation method thereof are described in for example V.A.Slepushkin, S.Simoes, P.Dazin, M.S.Newman, L.S.Guo and M.C.P.de Lima, J.Biol.Chem.272 (1997) 2382-2388; And S.Simoes, V.Slepushkin, N.Duzgunes and M.C.Pedroso de Lima, among Biomembranes 1515 (2001) 23-37, two pieces of documents are incorporated this paper into as a reference in full.

[0015] the sending of NB-DNJ (mol ratio is 6: 4) that is encapsulated among the DOPE-CHEMS is disclosed among the U.S. Patent application US2003/0124160.

Summary of the invention

[0016] embodiment provides the method for treatment viral infection, this method comprises host's administration composition of these needs is arranged, said composition comprises that (a) comprises the liposome of DOPE and CHEMS lipid, (b) be encapsulated in intravital one or more therapeutic agents of lipid, wherein viral infection is ER film viral infection or the plasma membrane viral infection that sprouts that sprouts; Wherein one or more therapeutic agents comprise N-butyl deoxynojirimycin (NB-DNJ), and wherein said administration causes sending one or more therapeutic agents and enters to infect in the endoplasmic reticulum that the cell that causes the virus that infects is arranged and with one or more lipids of liposome and incorporate in the endoplasmic reticulum of cell.

[0017] another embodiment of the invention provides the method for treatment viral infection, this method comprises host's administration composition of these needs is arranged, said composition comprises that (a) comprises the liposome of DOPE, CHEMS and PEG-PE lipid and (b) be encapsulated in intravital one or more therapeutic agents of lipid.These one or more therapeutic agents can comprise N-butyl deoxynojirimycin (NB-DNJ).

[0018] another embodiment provides a kind of method, this method comprises host's administration composition of these needs is arranged, said composition comprises (a) pH sensitive liposome body, (b) be encapsulated in the intravital antigen of lipid, wherein administration causes the antigen presentation that undertaken by the main histocompatibility molecule 1 class of antigen presenting cell to increase.

[0019] another embodiment provides the method that treatment HIV infects, and this method comprises that said composition comprises and the bonded liposome of gp120/gp41 complex targeting moiety to host's administration composition of these needs is arranged.

[0020] another embodiment provides a kind of compositions, and said composition comprises the liposome that comprises DOPE, CHEMS and PEG-PE lipid and is encapsulated in intravital at least a therapeutic agent of lipid such as N-butyl deoxynojirimycin (NB-DNJ).

[0021] another embodiment provides a kind of compositions, and said composition comprises pH sensitive liposome body and is encapsulated in the intravital antigen of lipid.

[0022] another embodiment provides a kind of compositions, and said composition comprises and the bonded liposome of gp120/gp41 complex targeting moiety.

[0023] another embodiment provides the method for treatment or prophylaxis of viral infections, this method comprises host's administration composition of these needs is arranged, said composition comprises that (a) comprises the liposome of PI lipid, (b) be encapsulated in the intravital at least a antiviral therapy agent of lipid, wherein said contact causes sending at least a therapeutic agent and enters the ER intracavity that infects the cell that the virus that causes infection is arranged, and one or more lipids of liposome is incorporated in the ER film of cell.

[0024] another embodiment provides a kind of compositions, and said composition comprises the liposome that comprises the PI lipid and is encapsulated in the intravital at least a antiviral therapy agent of lipid.

[0025] another embodiment provides the method for treatment viral infection, this method comprises host's administration composition of these needs is arranged, said composition comprises that (a) comprises the liposome of PI lipid, (b) at least a antiviral protein in the lipid layer of embedding liposome, wherein said contact causes one or more lipids of liposome are incorporated in the endoplasmic reticulum that infects the cell that the virus that causes infection is arranged.

[0026] another embodiment provides a kind of compositions, and said composition comprises that (a) comprises the liposome of PI lipid and (b) embed at least a antiviral protein in the lipid layer of liposome.

[0027] another embodiment provides a kind of compositions, and said composition comprises the liposome that comprises the PI lipid and is encapsulated in the intravital at least a therapeutic agent of lipid.

[0028] another embodiment provides the method for the treatment or the prevention physiology patient's condition, and this method comprises that said composition comprises the liposome that comprises the PI lipid and is encapsulated in the intravital at least a therapeutic agent of lipid to experimenter's administration composition of these needs is arranged.

[0029] another embodiment provides a kind of compositions, and said composition comprises at least a protein in liposome that comprises the PI lipid and the lipid bilayer that embeds liposome.

[0030] another embodiment provides the method for the treatment or the prevention physiology patient's condition, this method comprises that said composition comprises at least a protein in liposome that comprises the PI lipid and the lipid bilayer that embeds liposome to experimenter's administration composition of these needs is arranged.

Description of drawings

[0031] Fig. 1 is illustrated in endoplasmic reticulum (ER) location via calcein that goes cancellation after the DCPP-Rh liposome delivery and fluorescent labeling lipid (Rh-PE).

[0032] Fig. 2 is illustrated in the toxicity of DCPP liposome in CHO and the MDBK cell.The DCPP liposome of sealing PBS is that 0-500 μ M is added in the Chinese hamster ovary celI with final lipid concentration, is added in the MDBK cell with the concentration of 0-150 μ M.Cell and liposome were cultivated 5 days, measured the cells survival rate by trypan blue staining then.The result uses the percent of the living cells of comparing with untreated contrast to represent.

[0033] Fig. 3 is illustrated under the condition that is encapsulated with deoxynojirimycin (DNJ), N-butyl deoxynojirimycin (NB-DNJ) and N-nonyl deoxynojirimycin (NN-DNJ) chemical compound that the picked-up and the yellowish green element of intracellular Ca2+ of DCPP-Rh liposome removes the chart of cancellation in Chinese hamster ovary celI.Prepared the DCPP-Rh liposome that is encapsulated with each chemical compound under two kinds of variable concentrations.The liposome picked-up of measuring by the Rh-PE that incorporates in the cell membrane and go cancellation to measure after 5 fens clocks carry out following the trail of in 30 minutes then in fresh culture medium carrying out with liposome as discharging the calcein of measuring in the cell.

[0034] Fig. 4 represents to comprise the pH sensitivity of the DCPP liposome of various DNJ molecules.

[0035] Fig. 5 is illustrated in the excretory chart with NB-DNJ treatment back BVDV: free sending with respect to liposome-mediated the sending of DCPP.In order to free form or via liposome be with final lipid concentration during 50 μ M are added into NB-DNJ treatment in the culture medium from the BVDV particle of infected MDBK emiocytosis, cultivated the back at 3 days and measure by PCR in real time.The result uses the percent of comparing with untreated contrast by the RNA copy number of PCR in real time detection to represent.

[0036] Fig. 6 represents that NB-DNJ is to the infective effect of ncp BVDV: free sending with respect to liposome-mediated the sending of DCPP.With free form or via liposome be the infectivity that 50 μ M are added into the ncp BVDV particle that is produced by infected MDBK cell under the condition that the NB-DNJ in the culture medium exists, by measuring in 3 days with MDBK cell culture originally with final lipid concentration.Use the DAPI counterstain to detect infected cell by the proteic immunofluorescence dyeing of non-structure BVDV that is present in the MDBK cell in contrast.Derive from the excretory data of BVDV (Fig. 2) and be used for the infective normalization calculating of final percentage.

[0037] Fig. 7 represents the antiviral effect of NB-DNJ at cp BVDV: free sending with respect to liposome-mediated the sending of DC.The MDBK cell that infection has a cp BVDV exists free or had been included under the condition of the intravital NB-DNJ of DC lipid growth 3 days.Comprise by the supernatant of excretory virus and be used for infector MDBK just.After 3 days, the speckle (yield mensuration) that counts to get at microscopically.

[0038] Fig. 8 is illustrated under the condition that NB-DNJ exists the inhibition to the polysaccharide processing of the HIV envelope protein gp120 that expresses: free sending with respect to liposome-mediated the sending of DCPP.The Chinese hamster ovary celI and the NB-DNJ that express the gp120 of soluble form cultivate, and NB-DNJ is added in the culture medium with the little 100 μ M of final lipid concentration with free form or via liposome.Following the carrying out of the active measurement of NB-DNJ that the inhibition of the glucose finishing by being undertaken by the ER glucosidase is measured: monoclonal antibody 2G12 and b12 and combining in prize law ELISA with the gp120 of NB-DNJ processing.

[0039] the free NB-DNJ of Fig. 9 (A-C) expression is to the antiviral effect of eight independent first separators of HIV-1.Fig. 9 A represents that the NB-DNJ with variable concentrations handles the average p24 secretion of eight separators all around.Error bar shows for the standard deviation of every kind of treatment between separator to be determined.Fig. 9 B is presented at the secretion that free NB-DNJ with 0-1mM concentration carries out each first separator after the preliminary treatment.Fig. 9 C is illustrated in and handles the sensitivity of the discrete first separator in back to NB-DNJ three weeks.All values is represented with the percent of untreated contrast, and data representation is from the meansigma methods of three repeat samples acquisitions of two independent experiments.Approximate IC50 and IC90 about every kind of processing represent by the Lycoperdon polymorphum Vitt in the chart (point-like) line.

[0040] how the data show liposome that provides of Figure 10 A-H increases the antiviral activity of NB-DNJ at the first separator of eight HIV-1.Infection has around liposome (L) processing of PBMC (representing to H with graph A) with the NB-DNJ that is encapsulated with various concentration of each separator.The processing that is used in the free NB-DNJ (F) of 500 μ M in the culture medium is shown as the reference about antiviral activity.Legend is pointed out the ultimate density for every kind of processing NB-DNJ.All values is represented with the percent of untreated contrast, and data representation is from the meansigma methods of three repeat samples acquisitions of two independent experiments.

[0041] Figure 11 represents by infection the sCD4-liposome that the cell of a large amount of HIV-1 separators carries out and the picked-up of immunoliposome are arranged.The sCD4-liposome has the PBMCs of nine different first separators (being clade in the bracket) to cultivate with MAb-liposome conjugate and infection.The picked-up that increases is measured by the increase of the fluorescent lipid in cell after cultivating.All values is normalized to the contrast of " non-infection only have liposome ", and the data represented Mean +/-SE that obtains from three repetition values of an experiment.For each infect to use a series of one way analysis of variance be then after this Tukey test with the difference of check between the effectiveness of different target molecules, detect picked-up data relatively.At the liposome conjugate with only there is the significant difference (P＜0.0001) of the picked-up between the liposome contrast to represent with asterisk.

[0042] Figure 12 A-H represents to seal the synergistic corrosion virus activity of brute force of the sCD4-liposome of NB-DNJ.Infection has around sCD4-liposome (CD4-L) processing of PBMC (representing to H with graph A) with the NB-DNJ that is encapsulated with various concentration of each separator.The processing that is used in the free NB-DNJ (F) of 500 μ M in the culture medium is shown as the reference about antiviral activity.Legend is pointed out the ultimate density for every kind of processing NB-DNJ.All values is represented with the percent of untreated contrast, and data representation is from the meansigma methods of three repeat samples acquisitions of an experiment.

[0043] Figure 13 A-E is illustrated in various Liposomal formulation pulses typical fluoroscopic image at the intracellular rhodamine labelling of MDBK PE after 15 minutes.Especially, Figure 13 A represents DOPE: CHEMS: the data of Rh-PE (6: 4: 0.1); Figure 13 B represents DOPC: CHEMS: the data of Rh-PE (6: 4: 0.1); Figure 13 C represents DOPE: CHEMS: PI: Rh-PE (6: 4: 1: data 0.1); Figure 13 D represents DOPE: CHEMS: PI: (6: 4: 2: data 0.1) and Figure 13 E represented DOPE to Rh-PE: CHEMS: PI: Rh-PE (6: 4: 3: data 0.1).At time point: 0, observed in 1,2,5,24 and 48 hour in the cell of Rh-PE of every kind of Liposomal formulation and locate.Use the DAPI counterstain to estimate all cells.

[0044] Figure 14 MDBK cell representing to use the Liposomal formulation of the PE of the various Rh of comprising labellings to handle to be infected and not infected MDBK cell and in the excretory effect of cultivation measure R h-PE lipid after 3 days by cp-BVDV-.At infected cell of handling with identical liposome composition and the excretory increase of Rh-PE between the not infected cell is that this virion is sprouted from the ER film owing to the secretion that comprises the virion of Rh-PE lipid causes.

Detailed Description Of The Invention

[0045] unless otherwise indicated, otherwise " one " or " a kind of " expression " one or more ".

The definition of term:

[0046] term used herein " virus infections " refers to such disease state, the cell of Virus entry health wherein, use the regeneration sector of cell to breed or copy and finally make lysis cause cell death, releasing virus particle and the progeny virus by new generation infect other cell. Some viral latent infection also is possible virus infections result.

[0047] term used herein " treatment or pre-preventing virus infection " refers to suppress copying of specific virus, suppresses virus and propagates, or prevent that virus oneself in its host from creating, and improve or alleviate the symptom of the disease that is caused by virus infections. If viral load decline, the death rate and/or the incidence of disease reduce, then this treatment is considered to have therapeutic.

[0048] term " therapeutic agent " refers to any reagent, and such as molecule or compound, it can help to treat the physiology patient's condition, such as virus infections or by its disease that causes.

[0049] term used herein " cooperative effect " refers to combined effect, and its adduction effect than any or multiple single therapeutic agent is more effective. Cooperative effect used herein refers to use arbitrary monotherapy (either single therapy) of low amount (dosage) to treat or prevent the physiology patient's condition such as virus infections or by the ability of its disease that causes. More low dosage can cause the toxicity for the treatment of lower and render a service and do not reduce. In addition, cooperative effect can cause rendeing a service improvement, for example improvement of antiviral activity. At last, for virus infections, cooperative effect can cause avoiding or reduce virus for the improvement of the resistance of single therapeutic agent or single therapy.

[0050] can be defined as be the organic compound that comprises the lipid of spherical bilayer structure to liposome. The liposome that this paper discusses can comprise one or more lipids that represented by following abbreviation:

CHEMS represents the Cholesteryl hemisuccinate lipid.

DOPE represents the DOPE lipid.

DOPC represents the DOPC lipid.

PE represents the phosphatidyl-ethanolamine lipid.

PEG-PE represents polyethylene glycol (2000)-DSPE lipid.

Rh-PE represents lissamine rhodamine (lissamine rhodamine) B-phosphatidyl-ethanolamine lipid.

MCC-PE represents DAG-3-phosphatide monoethanolamine-N-[4-(p-maleimide ylmethyl) cyclohexane-formamide] lipid.

PI represents the phosphatidylinositols lipid.

Term " is sent in the born of the same parents " and is meant that entrapped material enters in any born of the same parents in the compartment from liposome delivery.

IC50 or IC90 (inhibition concentration 50 or 90) are meant to realizing that viral infection reduces the concentration of 50% or 90% employed therapeutic agent respectively.

The DC liposome is meant and comprises that mol ratio is 6: 3 the DOPE and the liposome of CHEMS lipid.

The DCPP liposome is meant and comprises that mol ratio is 6: 4: 0.3 DOPE, the CHEMS and the liposome of PEG-PE lipid.

PBMC represents peripheral blood lymphocytes.

SCD4 represents solubility CD4 molecule." solubility CD4 " or " sCD4 " or " D1D2 " are meant CD4 molecule or its fragment, and it is arranged in the activity that aqueous solution and its can imitate natural film grappling CD4 by the structure that changes HIV Env, and this can be understood by those of ordinary skills.The example of solubility CD4 is the double structure territory solubility CD4 (sCD4 or D1D2) that for example describes in people .J.Virol.74:326 333,2000 such as Salzwedel.

MAb represents monoclonal antibody.

DNJ represents deoxynojirimycin.

NB-DNJ represents N-butyl deoxynojirimycin.

NN-DNJ represents N-nonyl deoxynojirimycin.

BVDV represents bovine viral diarrhea virus.

HBV represents hepatitis B virus.

HCV represents hepatitis C virus.

HIV represents HIV (human immunodeficiency virus).

Ncp represents non-cytopathogenic effect type.

Cp represents the cytopathogenic effect type.

ER represents endoplasmic reticulum.

CHO represents Chinese hamster ovary cell

MDBK represents the Madin-Darby bovine kidney cells.

PCR represents polymerase chain reaction.

FOS represents free oligosaccharide.

HPLC represents high performance liquid chromatography.

PHA represents phytohemagglutinin.

FBS represents hyclone.

TCID50 represents 50% TCID.

ELISA represents enzyme-linked immunosorbent assay.

IgG represents immunoglobulin (immunoglobuline).

DAPI represents 4 ', 6-diamidino-2-phenylindone.

PBS represents phosphate buffered saline (PBS).

The liposome therapeutic of viral infection

[0051] inventor has been found that, when exposing cell, the pH sensitive liposome body that comprises DOPE, CHEMS and/or PEG-PE lipid, such as DC liposome or DCPP liposome, can walk around the endosome approach of the cell after the endocytosis of cell and send and be encapsulated in the endoplasmic reticulum (ER) that the intravital material of lipid directly enters cell, that is ER chamber.One or more lipids of liposome can also be incorporated in the ER film of cell.This discovery can provide about viral infection (for this viral infection, virus need be sprouted from the ER film, infect such as HBV, HCV and BVDV) the main inferential conclusion of treatment: because the lipid of liposome is incorporated the tunicle that the ER film that infects virulent cell can change the virion of sprouting into, and therefore reduce infectivity.

[0052] inventor has found that also N-butyl deoxynojirimycin (NB-DNJ) is encapsulated in the DCPP liposome, seal with the DCPP of other deoxynojirimycin chemical compound such as deoxynojirimycin (DNJ) or N-nonyl deoxynojirimycin (NN-DNJ) and to compare, can provide in the cell of increase and send.Sending the activity in vivo that can cause NB-DNJ in the cell of the increase of this NB-DNJ strengthens.

[0053] in addition, the inventor has had been found that the liposome that comprises DOPE, CHEMS and/or PEG-PE lipid, such as the DCPP liposome, self can have antiviral effect, promptly, the intravital any therapeutic agent of lipid is irrelevant with being encapsulated in, and the DCPP liposome and be encapsulated in the intravital therapeutic agent of lipid can co-action such as NB-DNJ at virus.

[0054] therefore, embodiment is that treatment ER film virus is sprouted and infected promptly virus viral infection such as HBV, HCV or the BVDV that can occur in ER film place that sprout and infect.This method can comprise making to infect the cells contacting compositions that causes the virus that infects, and in said composition, NB-DNJ is encapsulated in the liposome that comprises DOPE and CHEMS lipid.This contact can provide Synergistic treatment, cause sending one or more lipids of liposome to the ER film that is touched cell, thereby change the infectivity that this film reduces progeny virus, and by discharging the ER intracavity realization Synergistic treatment that entrapped NB-DNJ directly enters cell.

[0055] another embodiment is to have the cells contacting compositions that causes the virus that infects to treat the method for viral infection by making to infect, said composition comprises 1) comprise the liposome and 2 of DOPE, CHEMS and PEG-PE lipid) be encapsulated in the intravital therapeutic agent of lipid.Viral infection can be, for example, and HCV, HBV, BVDV, HIV, Moloney Muridae leucovirus, the Muridae hepatitis virus, 1 type and herpes simplex types 2 virus, cytomegalovirus, sindbis alphavirus, Xi Menli restrains forest virus, herpes stomatitis virus, influenza A virus, Measles virus, dengue virus or Japanese encephalitis virus, such as at R.A.Dwek, wait the people, Nat.Rev.Drug Discov.2002 Jan; 1 (1): disclosed among the 65-75.

[0056] in some embodiments, being encapsulated in the intravital therapeutic agent of lipid can be Alpha-glucosidase inhibitor.In some embodiments, Alpha-glucosidase inhibitor can be the ER Alpha-glucosidase inhibitor.Usually, any depending on calnexin and/or calreticulin is used for its virus be can be used as the ER Alpha-glucosidase inhibitor by the suitably folding virus of membrane glycoprotein target.

[0057] Alpha-glucosidase inhibitor can be such reagent, compares with the enzymatic activity of alpha-Glucosidase under the condition that does not have this reagent, and this reagent suppresses the enzymatic activity of host's alpha-Glucosidase at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or it is at least about 90%, or higher.Term " Alpha-glucosidase inhibitor " comprises the reagent of naturally occurring and synthetic inhibition host alpha-glucosidase activity.

[0058] suitable Alpha-glucosidase inhibitor includes but not limited to the deoxynojirimycin that deoxynojirimycin and N-replace, such as chemical compound and the officinal salt thereof of following formula II:

[0059] R wherein ₁Be selected from: substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted oxa alkyl is selected from but is not limited to aryl alkyl, cycloalkyl-alkyl, the alkyl of side chain or straight chain, and oxa alkyl; And wherein W, X, Y and Z are selected from hydrogen independently of one another, alkanoyl, aroyl and alkyl halide acyl group.

[0060] in this embodiment of some, R1 is selected from: ethyl, propyl group, isopropyl, butyl, isobutyl group, the tert-butyl group, amyl group, neopentyl, isopentyl, hexyl ,-(CH ₂) ₂O (CH ₂) ₅CH ₃,-(CH ₂) ₂O (CH ₂) ₆CH ₃,-(CH ₂) ₆OCH ₂CH ₃And-(CH ₂) ₂OCH ₂CH ₂CH ₃In other this embodiment, R ₁Be butyl, and W, X, Y and Z are hydrogen.

[0061] in some embodiments, the chemical compound of formula II is selected from but is not limited to: N-(n-hexyl-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(n-heptyl-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(n-octyl-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(n-octyl-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(n-nonyl-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(positive decyl-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(n-undecane base-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(n-nonyl-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(positive decyl-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(n-undecane base-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(dodecyl-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(2-ethylhexyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(4-ethylhexyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(5-methyl hexyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(3-propyl group hexyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(1-amyl group amyl group hexyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(1-butyl butyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(7-Methyl Octyl-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(8-methyl nonyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(9-methyl decyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(10-methyl undecyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(6-cyclohexyl hexyl-)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(4-cyclohexyl butyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(2-cyclohexyl ethyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(1-cyclohexyl methyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(1-phenyl methyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(3-phenyl propyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(3-(4-methyl)-phenyl propyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(6-phenyl hexyl)-1,5-dideoxy-1,5-imino group-D-glucitol; N-(n-nonyl-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(positive decyl-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(n-undecane base-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(dodecyl-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(2-ethylhexyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(4-ethylhexyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(5-methyl hexyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(3-propyl group hexyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(1-amyl group amyl group hexyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(1-butyl butyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(7-Methyl Octyl-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(8-methyl nonyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(9-methyl decyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(10-methyl undecyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(6-cyclohexyl hexyl-)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(4-cyclohexyl butyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(2-cyclohexyl ethyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(1-cyclohexyl methyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(1-phenyl methyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(3-phenyl propyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(3-(4-methyl)-phenyl propyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; N-(6-phenyl hexyl)-1,5-dideoxy-1,5-imino group-D-glucitol, four butyrates; Its officinal salt; With any two or more mixture in them.

[0062] suitable Alpha-glucosidase inhibitor also comprises N-oxa alkyl deoxynojirimycin, such as the N-hydroxyethyl DNJ that in US patent 4,639,436, describes (miglitol (Miglitol) or

).

[0063] suitable Alpha-glucosidase inhibitor also comprises castanospermine and castanospermine derivant; chemical compound and officinal salt thereof such as disclosed formula (I) in U.S. Patent application 2006/0194835; comprise 6-O-bytyry castanospermine (celgosivir (celgosivir)), and in PCT communique WO01054692 chemical compound and the officinal salt thereof of disclosed formula II.

[0064] in some embodiments, Alpha-glucosidase inhibitor can be acarbose (O-4,6-dideoxy-4-[[(1S, 4R, 5S, 6S)-4,5,6-trihydroxy-3-(hydroxymethyl)-2-cyclohexene-1-yl] amino]-α-D-glucopyranosyl-(1 → 4)-O-→-D-glucopyranosyl-(1 → 4)-D-glucose), or

Acarbose is disclosed in United States Patent (USP) 4,904, in 769.In some embodiments, Alpha-glucosidase inhibitor can be the acarbose (for example, referring to United States Patent (USP) 4,904,769) of highly purified form.

[0065] in some embodiments, being encapsulated in the intravital therapeutic agent of lipid can be inhibitors of ion channels.In some embodiments, inhibitors of ion channels can be to suppress the reagent of HCVp7 protein active.Inhibitors of ion channels and authentication method thereof describe in detail in U.S. Patent bulletin 2004/0110795.Suitable inhibitors of ion channels comprises chemical compound and the officinal salt thereof of formula I, comprise N-(7-oxa--nonyl)-1,5,6-three deoxidations-1,5-imino group-D-galactitol (N-7-oxa--nonyl 6-MeDGJ or UT231B) and N-10-oxa-undecyl (undecul)-6-MeDGJ.Suitable inhibitors of ion channels also includes but not limited to N-nonyl deoxynojirimycin, N-nonyl galactose deoxynojirimycin (deoxynogalactonojirimycin) and N-oxa-nonyl galactose deoxynojirimycin (deoxynogalactonojirimycin).

[0066] in some embodiments, be encapsulated in the intravital therapeutic agent of lipid and can comprise iminosugar.Suitable iminosugar comprises naturally occurring iminosugar and synthetic iminosugar.

[0067] in some embodiments, iminosugar can be the deoxidization nojirimycin derivative that deoxynojirimycin or N-replace.The example of the deoxidization nojirimycin derivative that suitable N-replaces includes but not limited to the chemical compound of the application's formula II, United States Patent (USP) 6,545, the chemical compound of 021 formula I, and N-oxa alkyl deoxynojirimycin, such as at United States Patent (USP) 4,639, the N-hydroxyethyl DNJ that describes in 436 (miglitol or

).

[0068] in some embodiments, iminosugar can be castanospermine or castanospermine derivant.Suitable castanospermine derivant includes but not limited to the chemical compound and the officinal salt thereof of disclosed formula (I) in U.S. Patent application 2006/0194835, and in PCT communique WO01054692 chemical compound and the officinal salt thereof of disclosed formula II.

[0069] in some embodiments, iminosugar can be the derivant that galactose deoxynojirimycin (nogalactojirimycin) or its N-replace, such as those disclosed in PCT communique WO99/24401 and WO01/10429.The example of galactose deoxynojirimycin (deoxynogalactojirimycin) derivant that suitable N-replaces includes but not limited to N-alkylation galactose deoxynojirimycin (deoxynogalactojirimycin) (N-alkyl-1,5-dideoxy-1,5-imino group-D-galactitol), such as N-nonyl galactose deoxynojirimycin, with N-oxa--alkylation galactose deoxynojirimycin (N-oxa--alkyl-1,5-dideoxy-1,5-imino group-D-galactitol), such as N-7-oxa-nonyl galactose deoxynojirimycin.

[0070] in some embodiments, iminosugar can be 1,5 of N-replacement, 6-three deoxidations-1, and 5-imino group-D-galactitol (MeDGJ that N-replaces) includes but not limited to following formula I chemical compound:

[0071] wherein R is selected from: substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocyclic radical, substituted or unsubstituted oxa alkyl.In some embodiments, substituted or unsubstituted alkyl and/or substituted or unsubstituted oxa alkyl comprise 1 to 16 carbon atom or 4 to 12 carbon atoms or 8 to 10 carbon atoms.In some embodiments, substituted or unsubstituted alkyl and/or substituted or unsubstituted oxa alkyl comprise 1 to 4 oxygen atom, and comprise 1 to 2 oxygen atom in other embodiments.In other embodiment, substituted or unsubstituted alkyl and/or substituted or unsubstituted oxa alkyl comprise 1 to 16 carbon atom and 1 to 4 oxygen atom.Therefore, in some embodiments, R is selected from but is not limited to :-(CH ₂) ₆OCH ₃,-(CH ₂) ₆OCH ₂CH ₃,-(CH ₂) ₆O (CH ₂) ₂CH ₃,-(CH ₂) ₆O (CH ₂) ₃CH ₃,-(CH ₂) ₂O (CH ₂) ₅CH ₃,-(CH ₂) ₂O (CH ₂) ₆CH ₃With-(CH ₂) ₂O (CH ₂) ₇CH ₃The MeDGJs that N-replaces for example is disclosed among the PCT communique WO01/10429.

In some embodiments, be encapsulated in the intravital therapeutic agent of lipid and can comprise nitrogen-containing compound or its officinal salt of facial VIII down:

R wherein ¹²For alkyl such as C ₁-C ₂₀Or C ₁-C ₆Or C ₇-C ₁₂Or C ₈-C ₁₆And can comprise 1 to 5 or 1 to 3 or 1 to 2 oxygen, R ¹²The alkyl derivative that can be replaced by oxa-.The example of the alkyl derivative that is replaced by oxa-comprises: 3-oxa-nonyl, 3-oxa-decyl, 7-oxa-nonyl and 7-oxa-decyl.

R ²Be hydrogen, R ³Be carboxyl or C ₁-C ₄Alkoxy carbonyl group, perhaps R ²And R ³Be together

Or-(CXY) _n-, wherein n is 3 or 4, each X is hydrogen independently, hydroxyl, amino, carboxyl, C ₁-C ₄Alkyl carboxyl, C ₁-C ₄Alkyl, C ₁-C ₄Alkoxyl, C ₁-C ₄Hydroxy alkyl, C ₁-C ₆Acyloxy, or aryl acyloxy, and each Y is hydrogen independently, hydroxyl, amino, carboxyl, C ₁-C ₄Alkyl carboxyl, C ₁-C ₄Alkyl, C ₁-C ₄Alkoxyl, C ₁-C ₄Hydroxy alkyl, C ₁-C ₆Acyloxy, aryl acyloxy, or deleted (that is, not existing);

R ⁴Be hydrogen or disappearance (that is, not existing); With

R ⁵Be hydrogen, hydroxyl, amino, substituted amino, carboxyl, alkoxy carbonyl group, amino carbonyl, alkyl, aryl, aralkyl, alkoxyl, hydroxy alkyl, acyloxy, or aryl acyloxy, perhaps R ³And R ⁵Form phenyl and R together ⁴Disappearance (that is, not existing).

In some embodiments, nitrogen-containing compound has the following formula structure:

R wherein ⁶-R ¹⁰Be selected from independently of one another: hydrogen, hydroxyl, amino, carboxyl, C ₁-C ₄Alkyl carboxyl, C ₁-C ₄Alkyl, C ₁-C ₄Alkoxyl, C ₁-C ₄Hydroxy alkyl, C ₁-C ₄Acyloxy, and aryl acyloxy; And R ¹¹Be hydrogen or C ₁-C ₆Alkyl.Nitrogen-containing compound can be the N-alkylated piperidines, N-oxa--alkylated piperidines, N-alkylation pyrrolidine, N-oxa--alkylation pyrrolidine, N-alkylation phenyl amine, N-oxa--alkylation phenyl amine, N-alkylation pyridine, N-oxa--alkylation pyridine, N-alkylation pyrroles, N-oxa--alkylation pyrroles, N-alkylation aminoacid, or N-oxa--alkylation aminoacid.In certain embodiments, the N-alkylated piperidines, N-oxa--alkylated piperidines, N-alkylation pyrrolidine, or N-oxa--alkylation pyrrolidine compound can be iminosugar.For example, in some embodiments, nitrogen-containing compound can be for having the N-alkyl-1 of following formula structure, 5-dideoxy-1,5-imino group-D-galactitol (N-alkyl-DGJ) or N-oxa--alkyl-1,5-dideoxy-1,5-imino group-D-galactitol (N-oxa--alkyl-DGJ):

Or the N-alkyl-1,5 with following formula structure, 6-three deoxidations-1,5-imino group-D-galactitol (N-alkyl-MeDGJ) or N-oxa--alkyl-1,5,6-three deoxidations-1,5-imino group-D-galactitol (N-oxa--alkyl-MeDGJ):

[0072] group used herein has following feature, unless stipulate carbon number in addition.Alkyl have 1 to 20 carbon atom and be straight or branched, substituted or unsubstituted.Alkoxyl have 1 to 16 carbon atom and be straight or branched, substituted or unsubstituted.Alkoxy carbonyl group is the ester group with 2 to 16 carbon atoms.Thiazolinyl oxygen base have the two keys of 2 to 16 carbon atoms, 1 to 6 and be straight or branched, substituted or unsubstituted.The alkynyloxy base have 2 to 16 carbon atoms, 1 to 3 triple bond and be straight or branched, substituted or unsubstituted.Aryl has 6 to 14 carbon atoms (for example phenyl) and is substituted or unsubstituted.Aralkyl oxy (as benzyl oxygen base) and aryl acyloxy (as benzoyl oxygen base) have 7 to 15 carbon atoms and are substituted or unsubstituted.Amino can be for primary, secondary, uncle or season amino (being substituted amino).Amino carbonyl is the acylamino-(as substituted acylamino-) with 1 to 32 carbon atom.Substituted group can comprise and is selected from following substituent group: halogen, hydroxyl, C _1-10Alkyl, C _2-10Thiazolinyl, C _1-10Acyl group, or C _1-10Alkoxyl.

[0073] N-alkylation aminoacid can be for the alkylating naturally occurring aminoacid of N-, such as the alkylating aminoacid of N-.Naturally occurring aminoacid is 20 common a-amino acids (Gly, Ala, Val, Leu, Ile, Ser, Thr, Asp, Asn, Lys, Glu, Gln, Arg, His, Phe, Cys, Trp, Tyr, Met and Pro) and as other aminoacid such as the nor-leucine of natural product, ethyl glycine, ornithine, one of methyl butene base-methylthreonine and phenylglycine.Amino acid side chain is (as R ⁵) example comprise H (glycine), methyl (alanine) ,-CH ₂C (O) NH ₂(asparagine) ,-CH ₂-SH (cysteine) and-CH (OH) CH ₃(threonine).

[0074] the N-alkylated compound can be by the reductive alkylation preparation of amino (or imino group) chemical compound.For example, amino or imino-compound can be exposed under the aldehyde so that amine is carried out the N-alkylation with Reducing agent (as sodium cyanoborohydride).Similarly, N-oxa--alkylated compound can be by the reductive alkylation preparation of amino (or imino group) chemical compound.For example, amino or imino-compound can be exposed under oxa--aldehyde so that amine is carried out N-oxa--alkylation with Reducing agent (as sodium cyanoborohydride).

[0075] nitrogen-containing compound can comprise one or more protecting groups.Various protecting groups are known.Usually, the kind of protecting group is not conclusive, condition be this protecting group under the condition of any reaction of carrying out subsequently on other position of chemical compound be stable and in due course between point be removed and can influence the remainder of molecule sharply.In addition, protecting group can substitute other protecting group substantially after finishing synthetic conversion.Obviously, when chemical compound and unique difference of chemical compound disclosed herein only were that one or more protecting groups of the chemical compound of the disclosure have been substituted by different protecting groups, then this chemical compound place within the scope of the invention.Other example and condition be referring to Greene, Protective Groups in Organic Chemistry, (1 ^StEd., 1981, Greene ﹠amp; Wuts, 2 ^NdEd., 1991).

[0076] nitrogen-containing compound can carry out purification by for example crystallization process or chromatography.Chemical compound can adopt stereospecific amino or imino-compound to be synthesized by stereospecificity as raw material.

[0077] amino and the imino-compound that is used as raw material in preparation long-chain N-alkylated compound is commercially available (Sigma, St.Louis, MO; Cambridge ResearchBiochemicals, Norwich, Cheshire, United Kingdom; TorontoResearch Chemicals, Ontario, Canada), perhaps can be by known synthetic method preparation.For example, chemical compound can be the alkylating imino sugar compounds of N-or its derivant that is replaced by oxa-.Iminosugar can be for example deoxy-galactose nojirimycin (deoxygalactonojirmycin, DGJ), 1-methyl-deoxy-galactose nojirimycin (MeDGJ), deoxynojirimycin (DNJ), altrostatin, 2R, 5R-dihydroxy methyl-3R, 4R-dihydroxy pyrrolidine (DMDP), or derivatives thereof, enantiomer or stereoisomer.

[0078] the synthetic of many imino sugar compounds is described.For example, the method for synthetic DNJ derivant is known and for example is described in the following document: United States Patent(USP) Nos. 5,622,972,5,401,645,5,200,523,5,043,273,4,994,572,4,246,345,4,266,025,4,405,714 and 4,806,650.The method of synthetic other iminosugar derivant is known and for example is described in the following document: United States Patent(USP) Nos. 4,861,892,4,894,388,4,910,310,4,996,329,5,011,929,5,013,842,5,017,704,5,580,884,5,286,877 and 5,100,797 and PCT communique WO 01/10429.2R, 5R-dihydroxy methyl-3R, the stereospecificity of 4R-dihydroxy pyrrolidine (DMDP) is synthetic by Fleet ﹠amp; Smith (Tetrahedron Lett.26:1469-1472,1985) describes.

[0079] being touched cell can be the cell that derives from mammal such as people.In some cases, infected cells contacting liposome composition can be carried out to the experimenter who comprises infected cell by the administration said composition.The experimenter can be a mammal, such as the people.In some embodiments, liposome composition can be by the intravenous injection administration.Yet in some embodiments, liposome composition can pass through the parenteral route administration except that the intravenous injection approach, and is subcutaneous such as intraperitoneal, Intradermal, and in the epidermis, intramuscular or percutaneous approach.Yet in some embodiments, liposome composition can be by the surperficial administration of mucomembranous surface such as eye, intranasal, lung, intestinal, rectum and urinary tract.The route of administration of liposome composition for example is disclosed in A.S.Ulrich, Biophysical Aspects of Using Liposomesas Delivery Vehicles, and Bioscience Reports, the 22nd volume, the 2nd phase, Apr2002 is among the 129-150.

[0080] therapeutic agent such as NB-DNJ enters the ER chamber via liposome delivery, compares with non-liposome method, can reduce the effective dose that suppresses the required therapeutic agent of ER-glucosidase.For example, for NB-DNJ, IC90 has reduced at least 100, or has reduced at least 500 and reduced at least 1000, or has reduced at least 5000, or has reduced at least 10000, or has reduced at least 50000 or reduced at least 100000.The minimizing of effective antiviral amount of this NB-DNJ can cause mammal particularly among the people by the ultimate density of the NB-DNJ of administration than the low one or more orders of magnitude of toxic level.

[0081] in some cases, the liposome composition that comprises therapeutic agent such as NB-DNJ can contact infected cell with one or more other therapeutic agent such as antiviral agents combinations.In some cases, this other therapeutic agent can be encapsulated in the liposome jointly with NB-DNJ.Yet in some cases, using this other therapeutic agent to contact infected cell can be the result of the other therapeutic agent of administration to the experimenter who comprises cell.The administration of other therapeutic agent can be undertaken by additional treatment agent to compositions.Yet in some cases, the administration of other therapeutic agent can separate with the liposome composition that administration comprises NB-DNJ to be carried out.This separate administration can be carried out via certain route of administration, and this route of administration can be identical or different with the used route of administration of liposome composition.

[0082] therapeutic alliance not only reduces the effective dose of the required reagent of antiviral activity, thereby reduces its toxicity, but also because can improve absolute antiviral effect by the mechanism and multiple challenge virus.For example, the lipid of DCPP liposome and NB-DNJ can 1) work at the tunicle place of virus, wherein using the treatment of the liposome comprise NB-DNJ can change tunicle and form 2 by the adding of external lipid) misfolding by viral glycoprotein works, thereby reduces infectious.Therefore, be different from the liposome of sealing NB-DNJ that the agent combination of NB-DNJ uses with one or more targets that have or mechanism of action adduction effect or synergy can be provided.

[0083] in addition, therapeutic alliance can provide the means of chance of evading or reducing the development of viral resistance.

[0084] can unite different and different that the specific other therapeutic agent of use can be according to by the viral infection of being treated with the liposome that comprises NB-DNJ.For example, for virus infection, infect such as HBV, HCV or BVDV, this therapeutic agent can be ucleosides or ucleotides antiviral agent and/or immunostimulant/immunomodulator.Can unite the multiple ucleosides medicament, ucleotides medicament and the immunostimulant/immunomodulator that are used for the treatment of hepatitis with NB-DNJ and be to license on February 10th, 2004 people's such as Jacob U.S. Patent No. 6,689,759 illustrated.For example, treatment for hepatitis C infection, NB-DNJ can with the 1-b-D-ribofuranosyl-1H-1 as the ucleosides medicament, 2,4-triazole-3-Methanamide (ribavirin) and unite as the interferon of immunostimulant/immunomodulator such as interferon-ALPHA is encapsulated in the liposome.Use ribavirin and/or interferon therapy virus infection for example in United States Patent(USP) Nos. 6,172,046; 6,177,074; 6,299,872; 6,387,365; 6,472,373; Come into question in 6,524,570 and 6,824,768.

[0085] infects for treatment HIV, can unite the therapeutic agent that uses with the liposome that comprises NB-DNJ and can be anti-hiv agent, it can be for example nucleoside reverse transcriptase (RT) inhibitor, such as (-)-2 '-deoxidation-3 '-the sulfo-Cytidine-5 '-triguaiacyl phosphate (3TC); (-)-cis-5-fluoro-1-[2-(hydroxyl-methyl)-[1,3-oxathiolane-5-yl] cytosine (FTC); 3 '-azido-3 '-deoxyribosylthymine (AZT) and dideoxy-inosine (ddI); Non-nucleoside rt inhibitor, such as N11-cyclopropyl-4-methyl-5,11-dihydro-6H-two pyridos [3,2-b:2 ' 3 '-e]-[1,4] diazepine-6-ketone (nevirapine), protease inhibitor or its combination.Anti-HI V therapeutic agent can be used for that two joint groups close or three joint groups close, such as AZT, DDI and nevirapine combination.

With the bonded lipid of gp120/gp41 targeting moiety

[0086] the present invention also provides and has comprised with the compositions of the bonded liposome of gp120/gp41 targeting moiety and by making to infect having this compositions of cells contacting of HIV infection to treat the method that HIV infects.The gp120/gp41 targeting moiety can comprise sCD4 molecule or monoclonal antibody, such as IgG 2F5 or IgG b12 antibody.In some embodiments, liposome can comprise DOPE and CHEMS lipid.In some embodiments, liposome can further comprise the PEG-PE lipid.In some embodiments, liposome can further comprise the MCC-PE lipid.For the treatment that HIV infects, said composition can further comprise and is encapsulated in the intravital other therapeutic agent of lipid, such as NB-DNJ.

The liposome that comprises the PI lipid

[0087] inventor has also found to comprise the liposome of phosphatidylinositols (PI) lipid, such as pH sensitive liposome body, compares with the liposome that does not contain the PI lipid, more effectively the ER film of targeted cells.In addition, the liposome that comprises the PI lipid can increase the vital stage of being sent the cell of one or more lipids via liposome.Therefore, in some embodiments, the invention provides a kind of compositions, it comprises the liposome that comprises the PI lipid and is encapsulated in the intravital at least a therapeutic agent of lipid such as the antiviral therapy agent, and provide the method that is used for targeted delivery, this method comprises this compositions of administration to the experimenter, and the experimenter can be a mammal, such as the people.This targeted delivery method can be used for treating or prevent to be subjected to the physiology's patient's condition among the experimenter that physiology's patient's condition influences, such as viral infection or by its disease that causes.

[0088] inventor further believes at least a antiviral protein incorporated in the ER target liposomes and can reduce viral infection synergistically, reason has: the lipid of 1) directly sending liposome enters in the ER film, can reduce viral infection when making in the ER film is merged in viral tunicle, with 2) directly to send at least a antiviral protein and enter the ER film, the ER film can be merged in the viral tunicle of the particle that sprouts and reduce infectious independently.Agent is encapsulated in the liposome other synergy can be provided at least a therapeutic agent such as antiviral therapy, former because: 3) directly delivering therapeutic agents enters in the cell compartment such as the ER intracavity.

[0089] therefore, in some embodiments, the invention provides a kind of compositions, it comprises that the interior at least a protein of liposome that comprises the PI lipid and the lipid bilayer that embeds liposome is such as antiviral protein, and provide the method that is used for targeted delivery, this method comprises this compositions of administration to the experimenter, and the experimenter can be a mammal, such as the people.This targeted delivery method can be used for treating or prevent to be subjected to the physiology's patient's condition among the experimenter that physiology's patient's condition influences, such as viral infection or by its disease that causes.

[0090] however in some embodiments, the invention provides a kind of compositions, it comprises the liposome that comprises the PI lipid, be encapsulated in the intravital at least a therapeutic agent of lipid such as antiviral composition and embed at least a protein in the lipid bilayer of liposome such as antiviral protein, and provide the method that is used for targeted delivery, this method comprises that this compositions of administration is to the experimenter, the experimenter can be a mammal, such as the people.

[0091] viral infection can be for example ER film viral infection that sprouts, that is, virus is sprouted and occurred in the viral infection at ER film place, infect such as HBV, HCV or BVDV, or be the plasma membrane viral infection that sprouts, promptly, virus is sprouted and is occurred in the viral infection at plasma membrane place, infects such as HIV.

[0092] liposome that comprises the PI lipid can further comprise one or more lipids such as DOPE, CHEMS and/or PEG-PE lipid.The molar concentration of the intravital PI lipid of lipid can be about 3% to about 60%, or about 5% to about 50%, or about 10% to about 30%.

[0093] in some embodiments, being encapsulated in the intravital therapeutic agent of the lipid that comprises the PI lipid can be Alpha-glucosidase inhibitor, any in all Alpha-glucosidase inhibitors as discussed above.

[0094] in some embodiments, being encapsulated in the intravital therapeutic agent of the lipid that comprises the PI lipid can be ion channel activity inhibitor discussed above.

[0095] in some embodiments, being encapsulated in the intravital therapeutic agent of the lipid that comprises the PI lipid can be iminosugar, any in all iminosugar as discussed above.

[0096] in some embodiments, being encapsulated in the intravital therapeutic agent of the lipid that comprises the PI lipid can be the nitrogen-containing compound of formula VIII.

[0097] in some embodiments, embedding the intravital protein of lipid that comprises the PI lipid can be antiviral protein.Suitable antiviral protein includes but not limited to: the mutant form of known and the bonded virus receptor of virus enveloped protein and/or virus enveloped protein and/or known interference virus tunicle interacting proteins.For example, infect for HIV, antiviral protein can be a CD4 albumen.Infect for HCV, BVDV or HBV, antiviral protein can be that one of its virus enveloped protein separately is such as E1 or the proteic mutant form of E2 about HCV/BVDV.

[0098] the present invention further is illustrated by following examples, yet never is limited to following examples.

Liposome preparation

[0099] following being produced of liposome of using in all experiments: the chloroformic solution of lipid is placed in the glass tubing, evaporating solvent under blanket of nitrogen, reduced vacuum is centrifugal then.Lipid film (10 micromolar TL) passes through at 1ml PBS buffer, and pH 7.4 (having or do not have medicine and/or 80mM calcein, in PBS) at room temperature eddy current carried out hydration in 1 hour.The multilamellar vesicle of gained supersound process 15 minutes in bath type sonic apparatus is pressed through the polycarbonate filter 21 times of 80 nano apertures then.

Seal the optimization of concentration

[0100] the fluorescence molecule calcein is encapsulated in the DCPP liposome with 80mM concentration, under this concentration, its fluorescence oneself cancellation.Calcein from the seepage of liposome and around the dilution the medium cause the increase of cancellation (dequenching) and measurable/observable fluorescence.By the final Liposomal formulation that comprises calcein of dilution in MES-buffer saline (pH 7.4) to the final phospholipid concentration computational envelope % of 0.5 μ M, and before the ultimate density that adds Triton X-100 to 0.1% and under λ ex=490nm and λ em=520nm, measure calcein afterwards.Fluorescence difference after adding cleaning agent is as the intravital % that seals of lipid, and the amount that is used for estimating the DNJ-chemical compound is tested the ultimate density of chemical compound to determine each.

The lipid encapsulated ER film that enters

[0101] the entrapped material of liposome transmissibility directly enters the ER intracavity, and lipid is merged in the ER film simultaneously.Primary evidence is from having fluorescently-labeled labelling liposome, wherein being merged in the DCPP liposome (1% molar content) with the bonded rhodamine of PE (Rh-PE), is 6: 4: 0.3 so that lipid content is a mol ratio: 0.1 DOPE: CHEMS: PEG-PE: Rh-PE (DCPP-Rh).The MDBK cell was with the pH sensitive liposome body pulse Rh-PE-labelling and that comprise calcein (pulsed) 30 minutes.Remove the liposome of not absorption and followed up cell 3 hours.In the latter stage of following the trail of the period, cell and ER-tracker (ER label) incubation 30 minutes, washing and range estimation.Combined diagram shown in Fig. 1 has shown the co of calcein, Rh labelling lipid and ER tracker.Based on this, can reach a conclusion: with the initial fusion steps of ER film after, its moisture content of liposome delivery is to ER, described initial fusion steps is shown liposome lipid co by ER-tracker, the dyestuff incorporated in the ER film.

Liposome toxicity

[0102] toxicity of liposome is measured in two different cell lines: Chinese hamster ovary (CHO) cell and Madin-Darby Ren Bovis seu Bubali (MDBK) cell.

[0103] with cell inoculation in 6 orifice plates to surpassing 80% converge, with the DCPP liposome of sealing PBS to be the final lipid concentration scope of 0-500 μ M for Chinese hamster ovary celI and to be that the final lipid concentration scope of 0-150 μ M joins in the medium for the MDBK cell.Make cell and liposome down place incubations 5 days at 37 ℃, harvesting then, and after with trypan blue staining, count.The result is expressed as: compares with undressed contrast (on X-axis=100%), and the percent of the living cells that in treated sample, exists, and the result derives from three meansigma methods ± S.D. of the repeated experiments values of experiment separately.

[0104] result is shown in Figure 2, and wherein the cytotoxicity in Chinese hamster ovary celI is showing behind the incubation under the condition that has 150 μ M lipid concentrations gradually.As if the MDBK cell is more responsive to the DCPP liposome, and shows serious cytotoxicity at lipid concentration under greater than 75 μ M.

Iminosugar is from the release of DCPP liposome

[0105] uses in the experiment of Chinese hamster ovary celI and MDBK cell at all, add DCPP liposome to final lipid concentration and be respectively 100 μ M and 50 μ M (the two all is＞95% cell survival rate).

[0106] in following examples, the butyl chain of NB-DNJ shows as that to cause that directly encapsulated material discharges in the born of the same parents of DCPP liposome cumulative.

[0107] in the time of in being encapsulated in the DCPP liposome, in picked-up of different DNJ chemical compound pair cell and the cell influence of release by foregoing in the 80-mM calcein diluted compounds and Rh-PE incorporated in the liposome membrane measure, final liposome consists of DOPE: CHEMS: PEG-PE: Rh-PE (DCPP-Rh, 6: 4: 0.3: 0.1).The independent liposome of sealing calcein, 10-μ M DNJ, 1-mM DNJ, 10-μ M NB-DNJ, 1-mM NB-DNJ, 10-μ M NN-DNJ or 1-mM NN-DNJ and Chinese hamster ovary celI incubation 45 minutes, weeding of grease plastid then is with cell usefulness 1x PBS washed twice.Analysis of cells removes cancellation (λ to measure calcein in exometer then _Ex=490nm and λ _Em=520nm) and rhodamine fluorescence (λ _Ex=584nm and λ _Em=612nm).Data represented meansigma methods ± the S.D. that obtains from the in triplicate experiment value of four independent experiments, the combination and the picked-up of wherein average rhodamine fluorescent value reflection liposome, and go cancellation (that is, dyestuff discharges into compartment in the cell from liposome) in the cell of average calcein fluorescence reflection dyestuff.The result is expressed as, and compares with the independent liposome of calcein/PBS-contrast (on the x axle=100%), with the fluorescence % that measures behind the liposome incubation that comprises DNJ.

[0108] as shown in Figure 3, DNJ and NN-DNJ the two go the amount of cancellation not have influence to calcein, and therefore discharge not influence in the pair cell.Yet NB-DNJ display density dependency in removing the calcein of cancellation increases, and wherein the preparation of 10 μ M and 1mM causes about 1.8 times and 2.3 times of increases respectively.

[0109] calcein of Ji Suaning is the measuring of the amount of the moisture label that discharges in each and the bonded liposome of cell to likening to of rhodamine fluorescence, and represents delivery efficiency in the cell.The efficient of calculating about each encapsulated material is listed in the table 1.The result shows that the liposome that comprises NB-DNJ of 10 μ M and 1mM increases that delivery efficiency is respectively about 2 times and 3 times in the cell of DCPP liposome.

The efficient that discharges in the cell of DCPP liposome that table 1. is measured by the fluorescence measurement that goes cancellation calcein and Rh-PE to incorporate into that derives from Fig. 4.

Encapsulated material	Efficient (calcein/rhodamine, AU)
		Calcein only	10.5±2.1
10μM DNJ	10.4±1.8
		1mM DNJ	10.8±2.0
10μM NB-DNJ	21.7±1.5
		1mM NB-DNJ	28.4±2.4
10μM NN-DNJ	4.4±1.3
		1mM NN-DNJ	3.2±1.1

[0110] although the present invention is not subjected to the constraint of its theory of operation, the mechanism that increase relied on that the butyl chain of NB-DNJ promotes encapsulated material to send in the cell of DCPP liposome might be to make in the lipid bilayer due to the liposome instability by the butyl chain is embedded.The 9 carbon alkyl chains of NN-DNJ also can embed himself in the lipid bilayer of liposome; Yet under this length, in fact this molecule may make double-decker stable, as provided the result hinted.Although the NN-DNJ liposome causes cellular uptake to increase, the amount of the calcein of release remain can with compare, show that liposome stability increases in cell.

The stability of DCPP liposome

[0111] in following examples, the alkyl chain of NB-DNJ and NN-DNJ is through showing by making the character of the DCPP liposome more stable DCPP of change liposome under lower pH condition.

[0112] the DCPP liposome of sealing 1mM DNJ, NB-DNJ or NN-DNJ in 80mM calcein buffer compares with empty (calcein is only arranged) liposome, with the influence to pH sensitivity of the alkyl chain of measuring NB-DNJ and NN-DNJ.The DCPP liposome (final phospholipid concentration 5 μ M) of the load calcein of 10 μ l is joined in the MES-buffer saline of the 2ml under the multiple pH value that is in 5.0-7.4, and 37 ℃ of following jolting incubations 15 minutes.Behind the incubation, be before 0.1% and measure calcein fluorescence afterwards to ultimate density adding Triton.The fluorescence intensity that obtains under acid ph value is made pH to the correction aspect the slight effect of calcein fluorescence.Calcein discharges the calculating of percent use following formula under each pH: leak %=((I _n-I ₀)/(I ₁₀₀-I ₀)) * 100, I wherein ₀Be the fluorescence under neutral pH, I _nBe the correction intensity under acid pH before adding Triton, and I ₁₀₀It is the total cancellation calcein that goes under neutral pH.

[0113] result is shown in Figure 4, does not observe stability difference in Fig. 4 between liposome that calcein is only arranged and the entrapped liposome of DNJ.Yet the pH sensitivity of observing NB-DNJ and NN-DNJ liposome significantly reduces, and shows that stability increases under low pH because alkyl chain causes.Although NB-DNJ and NN-DNJ the two all at the external DCPP liposome of giving with bigger stability, in fact in vivo only NN-DNJ inhibition calcein is sent (as observed among Fig. 4 and the table 1), has given prominence to this factor affecting of existence of the factor that is different from pH sensitivity or the process that control cell internal loading discharges.

[0114] based on the discovery of Fig. 3, Fig. 4 and table 1, can reach a conclusion: in the time of in being encapsulated in liposome, be not only the existence of alkyl chain on the DNJ molecule, and be the length of alkyl chain on the DNJ molecule, can influence the character of liposome.These observations are likely because the interior lipid composition institute that also changes effectively of the lipid bilayer of alkyl chain embedding liposome causes.Although in these researchs, only used 4 carbochains (NB-DNJ) and 9 carbochains (NN-DNJ), as if shorter seemingly chain can make the liposome instability discharging in the cell that increases the load molecule in vivo, thereby and longer chain can make identical lipid form stable make to discharge be subjected to press down.

Be encapsulated in minimizing BVDV secretion in the DCPP liposome by NB-DNJ

[0115] in following examples, is encapsulated in the intravital NB-DNJ of DCPP lipid and reduces of the secretion of BVDV particle from the MDBK cell through showing.

[0116] the combination anti-viral effect that is merged in DC and the intravital NB-DNJ of DCPP lipid has demonstration in infection has the MDBK cell of the cp strain of BVDV or ncp strain.

[0117] in first research of the ncp strain of adopting BVDV, NB-DNJ is joined in the culture medium with free form, so that ultimate density is 0 to 750nM.In independent cultivation, add NB-DNJ DCPP liposome so that final lipid concentration is that 50 μ M and final NB-DNJ concentration are 0 to 750nM.In 6 orifice plates, experimentize in duplicate.After cultivating 3 days, measure the amount of excretory BVDV virion.By being carried out quantitative PCR (PCR in real time), the viral RNA that extracts carries out the viral secretory analysis from the supernatant of 500 μ l.PCR in real time is used the primer at ncp BVDV RNA, and wherein the forward primer sequence is that TAGGGCAAACCATCTGGAAG and reverse primer sequence are ACTTGGAGCTACAGGCCTCA.The result is expressed as, and compares with undressed contrast (on the x axle=100%), is present in the percent of the RNA copy in the treated sample.

[0118] Fig. 5 represents free NB-DNJ and in the result of the intravital NB-DNJ of DCPP lipid to the excretory influence of ncp BVDV.Use the NB-DNJ of ultimate density as 750nM, under the liposome-mediated condition of sending, the number of excretory virion has reduced by 2 times, and does not have influence down free sending.Further optimization Test to be reducing viral secretory, even further by increasing the concentration of liposome or encapsulated NB-DNJ.

[0119] although the present invention is not subjected to the constraint of its theory of operation, it may be because due to the retention of viral glycoprotein such as E1 that the glucosidase inhibition is caused in the ER and E2 that the BVDV secretion is suppressed the mechanism that is relied on.

The BVDV infectivity

[0120] in following examples, empty DCPP liposome and the DCPP liposome of sealing NB-DNJ are through showing the infectivity of the BVDV particle that reduces the MDBK cell.DCPP liposome and NB-DNJ also show co-action.

[0121] uses the BVDV virion of collecting, measure the infectivity of the excretory BVDV that handles through NB-DNJ to identify BVDV protein in the infected cell by carrying out immunofluorescence dyeing after natural with MDBK cell incubation originally 3 from previous experiment (supernatant that comprises the 500 μ l of excretory BVDV).Cell uses anti-BVDV NS2-NS3 monoclonal antibody dyeing after infection, use the dyeing of FITC labelling second antibody then.Use 6 orifice plates to experimentize in duplicate.By calculating viral infection % divided by the determined total cell count that dyes by nuclear DAPI with the proteinic infected cell number of being discerned that exists of non-structure BVDV.Also with result standardization, thereby the reduction or the increase (from BVDV secretion result of experiment) of virus titer in each sample are described.

[0122] Fig. 6 represents free NB-DNJ and in the result of the intravital NB-DNJ of DCPP lipid to infective influence of ncp BVDV.The BVDV that these results have shown undressed BVDV and used the free NB-DNJ up to the 750nM ultimate density to handle produces viral offspring, and it can infect about 20% the cell of MDBK originally.Yet, significantly reduce viral offspring's infectivity (naive cell less than 1% is infected) with the infected cell of 750nM via the NB-DNJ incubation of DCPP liposome delivery.Be that all infected MDBK cells of handling with DCPP liposome (have or do not have entrapped NB-DNJ) make by the cell number of viral progeny infection and reduced about 7% surprisingly.Therefore, the DCPP liposome of only sealing 1x PBS is compared with undressed virus and is made the BVDV infectivity reduce almost 3 times, yet when making up with 750nM NB-DNJ, antiviral effect is increased to and is higher than 20 times of contrasts.The NB-DNJ that is added in the culture medium with free form under the same concentrations of 750nM has influence hardly.Further optimization Test is to eliminate viral infection fully by the concentration that increases liposome or encapsulated NB-DNJ.

[0123] although the present invention is not subjected to the constraint of its theory of operation, it can be to be merged in DCPP lipid in the ER film and antiviral agent NB-DNJ are caused the misfolding of increased activity and viral glycoprotein to its site of action by direct targeted delivery combined effect that viral infection is used the mechanism that influence relied on of the DCPP liposome-treated that is encapsulated with NB-DNJ.The result is, also can have the DCPP lipid with the viral offspring of these liposome-treated except viral glycoprotein in its viral tunicle, and described viral glycoprotein is owing to lack polysaccharide processing but defective in ER.

Antiviral effect with liposomal encapsulated NB-DNJ

[0124] also tested the antiviral effect that is included in the intravital NB-DNJ antagonism of lipid cp BVDV, used yield to reduce (yield reduction) test, this method utilization can form the cp strain of speckle on the monolayer of infected cell.

[0125] Fig. 7 represents free NB-DNJ with respect to the excretory influence of using the liposomal encapsulated NB-DNJ of DC to infectious cp BVDV.Infection has the MDBK cell of cp BVDV to handle 3 days with free NB-DNJ or with the liposomal encapsulated NB-DNJ of DC, is 100 μ M so that final NB-DNJ concentration is 0 to 500 μ M and TL concentration.Obtain supernatant then and be used in six orifice plates, infecting fresh MDBK monolayer.At microscopically counting speckle (speckle method), and the result is used as the percent that the supernatant that does not contain medicine infects the patch number of (=100%) (x axle) gained and represents after 3 days.The y axle is illustrated in the concentration of the free NB-DNJ that uses in the speckle method or is included in the concentration of the intravital NB-DNJ of DC lipid.IC50 is indicated in the bottom of curve.The result has shown that being comprised in the intravital NB-DNJ of DC lipid causes the excretory inhibition of infectious BVDV high 8 times (IC50 is 20 μ M, is that 175 μ M compare with free drug IC50).Can be by NB-DNJ being incorporated into the test that optimization is carried out in the DCPP liposome on cp BVDV, NB-DNJ is more stable and therefore have an antiviral effect of improvement in cell culture medium.

The activity of the increase of the NB-DNJ that is sealed by DCPP by the free oligosaccharides analysis to measure

[0126] free oligosaccharides (FOS) that produces under free NB-DNJ or liposomal encapsulated NB-DNJ exists by DCPP condition is characterized and the cell marker that suppresses as glucosidase with the enhancing of the pharmaceutically active due to sending in measuring by cell.Shown that FOS passes through the cytosol peptide: N-dextranase (PNGase) produces the effect from the misfolding glycoprotein of ER output, is used for the Proteolytic enzyme enzymatic degradation via the passage that comprises Sec61 in the ER film.The evaluation that is present in the polysaccharide among the FOS has disclosed protein folding and in what stage has been prevented from.In this experiment, the distribution of glycosylation FOS is used as by measuring that the NB-DNJ glucosidase suppresses, wherein Glc ₁Man _n-FOS and Glc ₂Man _n-FOS form is the result that glucosidase II suppresses, and Glc ₃Man _n-FOS is the result that glucosidase I suppresses.

[0127] Chinese hamster ovary celI is to carry out incubation under the condition that exists of the free NB-DNJ of 0.5mM in antiviral concentration, or with 100 μ M be to carry out incubation under the 0-75nM with the liposomal encapsulated NB-DNJ of DCPP in ultimate density.The August 1 J.2004 as people such as Mellor (2004) .Biochem place to be cultivated 5 days and used to cell; The described cell homogenates that is normalized into the total protein of 500 μ g of 381 (Pt 3): 861-866 carries out the separation of FOS.After with 2-aminobenzamide labelling oligosaccharide, detect FOS by positive HPLC.Composition to FOS further characterizes and measures by digesting with the glycosidase that comprises endoglycosidase H, Semen Canavaliae alpha-Mannosidase and alpha-Glucosidase I and II.The percent of non-glucosyl and Oligomeric manna sugar FOS glucosyl that calculates each sample is (by Man _n-FOS, Glc ₁Man _n-FOS, Glc ₂Man _n-FOS and Glc ₃Man _n-FOS represents), and the result is as shown in table 2.The result represents the meansigma methods ± S.D. of four independent experiments.

The distribution of the FOS that table 2. produces under the condition that free NB-DNJ or the NB-DNJ by the DCPP liposome delivery exist in Chinese hamster ovary celI.

[0128] is the tri-glucose base form that the Chinese hamster ovary celI that carries out incubation under the condition that exists of the free NB-DNJ of 0.5mM mainly produces FOS in antiviral concentration, shows the inhibition of glucosidase I under this concentration.This can hint out that the inhibition of glucosidase I is determining the antiviral effect of the NB-DNJ of previous report to HIV.Isolating FOS has disclosed the distribution of glucosyl FOS from being mainly Glc from the sample with liposome-treated under the condition that NB-DNJ concentration increases ₁Man-FOS is to Glc ₃Man-FOS moves gradually, respectively with the inhibition of glucosidase II and I.When via the DCPP liposome delivery, the sample of handling for 750nM NB-DNJ with ultimate density has shown and the suitable level of inhibition of the glucosidase I that cultivates for dissociating that hint is because the antiviral activity due to sending in the cell strengthens about 600 to 700 times under 0.5mM.

[0129], realizes that the NB-DNJ activity increases the mechanism that is relied on and can be undertaken by directly sending this antiviral agent to its site of action (being the ER chamber) although the present invention is not subjected to the constraint of its theory of operation.Directly ER send can allow antiviral agent walk around blood plasma and ER film the two, they the two when NB-DNJ is added in the surrounding medium in the mode of dissociating, can serve as barrier.The increase of sending level when NB-DNJ is used to seal in the viewed cell also can promote because NB-DNJ is higher than active enhancing due to other chemical compound in the concentration of ER intracavity.

The activity of the NB-DNJ that seals with DCPP that measures by the 2G12 antibodies increases

[0130] in following examples, under the condition of free NB-DNJ or liposomal encapsulated NB-DNJ existence, after in Chinese hamster ovary celI, expressing, by measuring the activity that NB-DNJ is measured in the inhibition that the polysaccharide of HIV envelope protein gp120 is processed with DCPP.

[0131] concentration of Chinese hamster ovary celI in culture medium of expressing the HIV gp120 of soluble form is under the condition that exists of the free NB-DNJ of 0-5mM or ultimate density is to cultivate under the condition of the liposomal encapsulated NB-DNJ existence of 0 to 750nM usefulness.Cell is placed cultivation 5 days, collect the cell conditioned medium liquid that comprises processed gp120 then.In order to measure under the condition that NB-DNJ (free or in liposome) exists inhibition, measure the combination of MAb 2G12 by catching ELISA to the polysaccharide processing of the gp120 that expresses.The lip-deep mannose residue collection that is rich in carbohydrate of 2G12 identification gp120 bunch is in the retention of bonded forfeiture under the condition that NB-DNJ exists owing to the glucose on the Oligomeric manna sugar polysaccharide that is forming epi-position.Yet the forfeiture of binding affinity also is attributable to proteinic misfolding, and in order to distinguish this two kinds of probabilities, also measured all samples in and MAb, the affinity of b12.B12 antibody recognition conformation sensitization epi-position-CD4 binding site, it is overlapping with 2G12 not.The solvable gp120 that is arranged in cell conditioned medium liquid is trapped in the elisa plate that adopts D7324 antibody (in conjunction with the C5 domain of gp120) and also handles with 2G12 or the b12 of 10 μ g/ml.Two kinds of antibody is relevant with combination to undressed gp120 to the combination of the sample handled with NB-DNJ, and wherein data are used in conjunction with % and represented and represent the meansigma methods ± S.D. that tests acquisition from four independent experiments in triplicate.

[0132] Fig. 8 has shown that handling the back with the free NB-DNJ of 0.5mM in culture medium combines forfeiture (1.2 ± 0.1% combination) with the gp120 of 2G12, and maintenance simultaneously is combined into 100% with b12's.By liposome-mediated ultimate density be 7.5nM NB-DNJ send cause with 2G12 be combined into 9.8 ± 4.8%, to b12 in conjunction with do not make significant difference (96.3 ± 3.2%), shown because the IC90 due to sending in the cell has 60,000 to 70,000 multiplications strong.

The liposome delivery of mucin peptide

[0133] inventor has also found by antigen-presenting cell contact compositions can be increased by presenting that main histocompatibility molecule 1 class is carried out, and described compositions comprises pH sensitive liposome body as the liposome that comprises DOPE, CHEMS and/or PEG-PE lipid and be encapsulated in the intravital antigen of lipid such as mucin peptide.This contact can be the result of administration said composition to the experimenter who comprises antigen-presenting cell.Compositions is administered to the experimenter and can be used for inoculating to the experimenter.

[0134] example of mucin peptide can be tryrosinase peptide-YMDGTMSQV, and it is found to be by the main histocompatibility molecule 1 class HLA-A0201 on the cell of expressing the total length tryrosinase and is presented.It is by corresponding to tryrosinase aminoacid 369-377 and comprise the conversion peptide that the tryrosinase peptide YMNGTMSQV of the glycosylation site 6 that N-connects produces.Although the present invention is not subjected to the constraint of its theory of operation, transforming peptide may occur, and this is owing to pass through the enzyme peptide from cytosol: due to the deglycosylated result of N-dextranase.N-dextranase peptide and antigen processing relevant transport protein (TAP) combination that the peptide transhipment is entered in the ER.The encapsulated DCPP of the entering liposome of YMDGTMSQV peptide is sent the ER of peptide to have reduced an order of magnitude.

The PBMCs that uses free NB-DNJ and infected by HIV-1 with liposomal encapsulated NB-DNJ treatment.

[0135] the p24 antigen that uses the activatory peripheral blood lymphocytes of phytohemagglutinin (PHA) (PBMCs) also to measure as terminal point as the indicator cell generates the clearance rate of estimating the first separator of being realized by NB-DNJ of HIV-1 that derives from infected people.

[0136] from four normal (not infecting) donors, separated PBMCs, mix and with PHA (5 μ g/ml) stimulation 48 hours, use PHA+ interleukin II (40U/ml) RPMI 1640 culture medium moderate stimulations 72 hours then, these RPMI 1640 medium comprise 10% heat inactivation hyclone (FBS), penicillin/ml of 100U, streptomycin/the ml of 100 μ g and 2mM L-glutaminate.All experiments are carried out in 96 hole microtitration plates.For infection cell, add the activatory PBMCs (5 * 10 of PHA of 100 μ l to every hole ⁵/ ml), add isopyknic first separation stock solution that comprises 50% TCID (TCID50) of 100 μ l then.After incubated overnight, cell is resuspended in the culture medium that comprises suitable liposome therapeutic agent or free NB-DNJ at last with tissue culture medium (TCM) washing three times.The 7th day, use be used for second comprising of about 10-30% and take turns infection and treatment (volume of transfer is through being calculated as the untreated contrast of this separator with the necessary volume of TCID50=100 infector ancestral cell) by the first PBMCs of the culture volume infector of excretory HIV-1 virion.In 4 weeks, carry out the treatment and the infection of many wheel naive cells, and separate to comprise by the cell conditioned medium liquid of excretory virion and catching at each time point and be used to measure p24 concentration (excretory measuring) among the ELISAs.In addition, be used for infector ancestral cell (TCID50=100) at the isolating supernatant of each time point and reached for two weeks during whole treatment, further do not handle, this is convenient to observe the bounce-back of virus activity.

[0137] PBMCs that infects with 8 first separators (listing in the table 3) cultivates under free MB-DNJ (concentration is 0-1mM) or the condition with liposomal encapsulated NB-DNJ (0-3.75 μ M, final lipid concentration is 50 μ M) existence.

The tabulation of the first separator of HIV-1 that table 3. uses in test comprises clade evaluation and tropism.

First separator	Clade	The tropism	First separator	Clade	The tropism
						92UG037	A	R5	93IN101	C	R5
92RW021	A	R5	97USNG30	C	R5
						JR-FL	B	R5	92UG021	D	X4
92HT599	B	X4	92UG046	D	X4
						89.6	B	R5/X4	93BR020	F	R5/X4

[0138] result who obtains from the PBMCs that handles with free NB-DNJ has confirmed that the antiviral concentration of anti-HIV-1 is 500 μ M.This be around handle in all separators the least concentration of removing virus activity (Fig. 9 a).All separators show that virus activities have at least 90% to reduce (IC90), hinted NB-DNJ effectively targeting in large-scale HIV-1.

[0139] free NB-DNJ can measure from the p24 that handles the back acquisition first week to determine to the effect of viral secretory.Under the NB-DNJ of maximum concentration, in culture medium the free NB-DNJ of 1mM, most of separators are made the viral secretory reaction (Fig. 9 b) that 30-40% reduces of having an appointment.Interestedly especially be three clade b separators: 89.6, JR-FL and 92HT599, wherein secretion has reduced by 50%, and in 89.6 situation, has reduced by 75%.93IN101 as clade c separator, also has 50% secretion reduction.

[0140] NB-DNJ measures from p24 after the processing of three wheels the degree (drug susceptibility) of the antiviral activity of different first separators and estimates.At this point, observed the excretory full curve of p24 of each separator, and therefore can calculate IC50 and IC90.Shown in Fig. 9 c, wherein the IC50 of 6 separators and IC90 are respectively 400 μ M and 500 μ M as calculated for the data of 8 separators of examination, and the IC50 of two separators and IC90 are respectively 250 μ M and 375 μ M.Two demonstrations also are the only separators that is included in the known demonstration amphicheirality (dualtropism) in these tests to NB-DNJ processing the most responsive separator 89.6 and 93BR3020, and other 6 separators are R5 or X4 (list) tropism.

[0141] in 8 same separators, measured and be encapsulated in DOPE: CHEMS: the antiviral activity of the intravital NB-DNJ of PEG-PE lipid, to be determined at the enhanced activity under the condition of sending in the cell.Figure 10 is presented at that (using ultimate density in the curve A-H) is that the NB-DNJ of 0-3.75 μ M handles the interior excretory levels of p24 of 4 weeks for 8 different separators of examination.When virus being reduced when comparing with the result who uses the free NB-DNJ of 500 μ M, all separators are presented under the condition of final NB-DNJ concentration of 3.75-37.5nM has the active pattern of similar antiviral, has an appointment 10 ⁴-10 ⁵Enhancing doubly.In addition, in different separators, there is sensitivity difference, because except drug susceptibility, there is new variable, as delivery efficiency in liposome uptake rate and the cell to using the NB-DNJ liposome to treat.

Use sCD4-liposome and immunoliposome targeting in the PBMCs that is infected by HIV-1

[0142] use solubility CD4 molecule (sCD4) and some known and the bonded monoclonal antibodies of gp120/gp41 complex in 9 different first separators, to estimate the increase of the cellular uptake that is undertaken by the gp120/gp41 complex that the liposome targeting is expressed on the surface of the cell that is being infected by HIV-1.

[0143] the following generation of sCD4-liposome conjugate: at first with the primary amine of sCD4 and N-succinimido-S-acetyl group thiopropionate chemically reactive to obtain protected sulfydryl, carry out deprotection by using oxammonium hydrochloride. to carry out deacetylated effect then.Immunoliposome is prepared as follows: at first with 2 mercapto ethanol amine reduction IgG molecule, the disulfide bond in the hinge region of this 2 mercapto ethanol amine reagent specificity reduction between two heavy chains obtains half IgG molecule of two each self-contained free sulfhydryl groups.The preparation of liposome as previously mentioned, yet the PE lipid (MCC-PE) that will comprise dimaleoyl imino is incorporated in the bilayer so that final liposome consists of DOPE: CHEMS: PEG-PE: MCC-PE: Rh-PE (mol ratio is 6: 4: 0.3: 0.3: 0.1).Not protected sCD4 molecule and the IgG molecule that is reduced and liposome are at room temperature placed and are incubated overnight.The usage space exclusion chromatography is come out liposome from free sCD4 or IgG purification.

[0144] fluorescent labeling lipid (Rh-PE) is incorporated in the liposome bilayer, and calculated the endocytosis that increases in the increase from detected fluorescence cell behind the incubation.As previously mentioned with PBMCs purification, cultivation with in 96 hole microtitration plates, infect.PBMCs was placed incubation 5 days with first separator (TCIC50=100), and cell washs three times with tissue culture medium (TCM) then, and finally is resuspended in the culture medium that comprises suitable liposome therapeutic agent (final lipid concentration is 50 μ M).Behind 24 hours incubations, separate PBMCs,, and be resuspended among the PBS that contains 1% (vol/vol) Empigen of 50 μ l with 200 μ l PBS washed twice.Under λ ex=520nm and λ em=590nm, measure fluorescence.

[0145] introduce 6 independent monoclonal antibodies under study for action: IgGs b6, b12,2G12,2F5, X5 and 4E10, however b6 and 4E10 can not be in conjunction with liposomees, because they all cause the lipid gathering.

[0146] Figure 11 represents to use the result that the sCD4-liposome that is encapsulated with 1mM NB-DNJ and b12 immunoliposome, 2G12 immunoliposome, 2F5 immunoliposome and X5 immunoliposome obtain, and this result uses with respect to the percent of the liposome picked-up of contrast and represents.Infect for each, there were significant differences (P＜0.0001) at target molecule with as the picked-up between the liposome of unique contrast.With the bonded lipid physical ability of sCD4 targeting for the examination all 9 separators and cause significantly increasing with respect to liposome cellular uptake as unique contrast.The 2F5 immunoliposome can increase the liposome picked-up with the b12 immunoliposome in the PBMCs that the first separator different with 6 infects with 5 respectively.2G12 immunoliposome and X5 immunoliposome not targeting and do not have target molecule to cause the picked-up of significant liposome by non-specific interaction in any first separator for examination.

[0147] therefore, the sCD4-liposome may be to be used to make the best molecule of liposome targeting in the cell that is infected by HIV.Not only successfully targeting is in the first separator of large-scale HIV-1 for sCD4, and sCD4 is convenient to be increased in via receptor-mediated endocytosis the picked-up of liposome in the infected cell.

Use is by the liposomal encapsulated NB-DNJ treatment HIV-1PBMCs of sCD4-

[0148] because the sCD4-liposome has the most wide in range targeting ability through demonstration, so this Liposomal formulation is used for p24 secretion test, with the antiviral activity of NB-DNJ with use naked liposome or freely send viewed antiviral activity relatively.Use final NB-DNJ concentration to carry out comprising the test of phase 8 first separators on the same group as 0-375nM.The result as shown in figure 12, wherein the sCD4-liposome provides other neutralising capacity through demonstration, so that all sCD4-liposome therapeutics, or even does not comprise those sCD4-liposome-treated of NB-DNJ, each first separator that neutralizes fully (curve A-H).

The bounce-back of HIV-1 virus activity

[0149] table 4 has been summed up to be illustrated in and has been removed the data that all NB-DNJ handle back virus activity bounce-back.In all cases, when virus activity is reduced to 0 (or approaching 0), when reaching for two weeks, processing do not rebound when removing.

Table 4. use in culture medium with free mode, in liposome or the NB-DNJ that in the sCD4-liposome, sends handle in 4 weeks all average p24 secretion data that from the PBMCs that is infected by HIV-1, obtain.For the bounce-back of measuring virus activity (rb), was removed processing and was reached for two weeks before measuring the p24 secretion.

Incorporate phosphatidylinositols into DOPE: in the CHEMS liposome

[0150] phosphatidylinositols (PI) that will obtain from the Hepar Bovis seu Bubali cell purification is that 10-30% incorporates liposome composition DOPE: the CHEMS that had before tested into final molar concentration: the Rh-PE.DOPC: CHEMS: the Rh-PE liposome is comprised in this research as negative control.The preparation of liposome as previously mentioned.The MDBK cell is grown to 50% converge, culture medium is exchanged and is that the fresh culture of the liposome of 100 μ M is replaced with comprising final lipid concentration then.After cultivating in 15 minutes, the weeding of grease plastid, cell is washed twice in PBS.Cell was cultivated in fresh culture medium 0,1,2,5,24 or 48 hour, will estimate in 2.5% paraformaldehyde of cell fixation and under fluorescence microscope then.Before inspectional analysis with DAPI with cell dyeing.

[0151] Figure 13 has shown typical fluoroscopic image, carries out 15 minutes postimpulse time points at each Liposomal formulation with the MDBK cell and obtains image in 0,1,2,5,24 and 48 hour.The result shows that comprise ultimate density is the liposome of 10 to 30% PI lipid has increase in cell vital stage, this means that the lipid of being sent via this method more effectively is retained in the cell, in other words, is less effectively degraded.At DOPE: CHEMS: the fluoroscopic image of obtaining behind Rh-PE liposome and the MDBK cell culture has shown these lipids, and mainly the some time between 5 hours to 24 hours is degraded and degraded fully before 48 hours.After 48 hours, the liposome that comprises PI still clearly, and is observed the Rh-PE figure of disperse more in processed cell.This result has shown and has been merged in the cell membrane and reconcentration (fluorescent graphic of point-like) in vesicle not at the most of lipids of this time point.

With DOPE: CHEMS liposome and ER-sprout in the tunicle of virion

[0152] whether can merge in order to study liposome, use the liposome that comprises Rh-PE to monitor by the absorption of the virion of sprouting from the ER film with cell membrane such as ER.To infect constantly cytopathogenic effect BVDV will be arranged (NADL, MDBK cell MOI=0.01) and originally (not infected) MDBK at DOPE: CHEMS: Rh-PE, DOPE: CHEMS: PI: Rh-PE or DOPC: CHEMS: be to cultivate two days under the 50 μ M at final lipid concentration under the condition that the Rh-PE liposome exists.After the cultivation, remove the culture medium that comprises liposome, cell is washed twice in PBS, adds fresh culture medium then, and cell was cultivated three days in addition.After three days, obtain the supernatant samples of every group of processed cell (infected and not infected), and use is set in λ _Ex=550nm and λ _EmSpectrofluorometer under the=590nm carries out fluorescence measurement.Test in triplicate, the result is expressed as the meansigma methods of three readings.

[0153] compare with the not infected cells of handling with identical Liposomal formulation, any increase of the fluorescence in the supernatant of infected cell is owing to comprise in its tunicle due to the secretion of virion of Rh-PE lipid.Figure 14 shown and uses three different lipids to form the result who obtains, and these data show that the lipid physical ability that comprises DOPE (PE) incorporates in the ER film, and incorporates the viral tunicle that sprouts subsequently into.The supernatant of the infected cell of the DOPE liposome-treated of must using by oneself has all shown with not infected cell compares the remarkable increase that fluorescence is arranged.The liposome that comprises DOPC (PC) (targeting is not in ER) as negative control does not show fluorescence difference between infected sample and not infected sample.Surprising and according to the data among Figure 13, the lipid physical ability that comprises the 10-30%PI of a part of forming as lipid is incorporated in the viral tunicle with the more effective means that is almost 5 times with respect to the liposome that does not contain PI.This shows that PI causes the increase that liposome is absorbed by the ER film.This result can provide the inferential conclusion of the treatment of the virus of sprouting from ER for treatment such as BVDV, HCV and HBV.

[0154] using in the antiviral therapy of ER target liposomes next step in exploitation can be antiviral protein to be incorporated into be used to send in the lipid bilayer of liposome to enter in the ER film.Antiviral protein includes but not limited to mutant form and/or known disturbances virus tunicle interacting proteins known and bonded receptor of virus enveloped protein and/or virus enveloped protein.

[0155] antiviral protein is incorporated into the combination that three kinds of independent antiviral strategies can be provided in the ER targeted liposome preparation that is encapsulated with antiviral drugs, three kinds of strategies can work synergistically and directly send lipid and enter in the ER film to reduce viral infection: 1-, when being merged in viral tunicle, the ER film will reduce viral infection, 2-directly sends protein and enters in the ER film, the ER film will be merged in the interior and reduction infectivity of viral tunicle of the particle that sprouts, and 3-directly sends antiviral agents and enters in the interior compartment of cell.

[0156] although concrete preferred version above has been described, obviously the invention is not restricted to these schemes.Those of ordinary skills can make multiple modification to disclosed embodiment, and these modifications place within the scope of the invention.

[0157] all open, patent application and the full patent texts quoted from this description are incorporated this paper into as a reference.

Claims (106)

1. treat the method for viral infection, this method comprises:

Administration composition is to there being this host who needs, and said composition comprises:

(a) comprise DOPE and CHEMS lipid liposome and

(b) be encapsulated in intravital one or more chemical compounds of lipid,

Wherein viral infection is ER film viral infection or the plasma membrane viral infection that sprouts that sprouts;

Wherein one or more chemical compounds comprise N-butyl deoxynojirimycin (NB-DNJ), and

Wherein said administration causes sending one or more chemical compounds and enters and infect in the endoplasmic reticulum that the cell that causes the virus that infects is arranged and cause one or more lipids of liposome are incorporated in the endoplasmic reticulum of cell.

2. the process of claim 1 wherein that infecting is the ER film viral infection that sprouts.

3. the method for claim 2, wherein infecting is that HBV, HCV or BVDV infect.

4. the process of claim 1 wherein that infecting is the plasma membrane viral infection that sprouts.

5. the method for claim 4, wherein infecting is that HIV infects.

6. the process of claim 1 wherein that liposome is the DC liposome.

7. the process of claim 1 wherein that liposome further comprises the PEG-PE lipid.

8. the method for claim 7, wherein liposome is the DCPP liposome.

9. the process of claim 1 wherein that liposome further comprises the PI lipid.

10. the method for claim 9, wherein the molar concentration of PI lipid is 5 to 50% in the liposome.

11. the method for claim 10, wherein the molar concentration of PI lipid is 10 to 30% in the liposome.

12. the process of claim 1 wherein that one or more chemical compounds further comprise ucleosides/ucleotides antiviral agents, immunostimulant/immunomodulator, or its combination.

13. the method for claim 12, wherein ucleosides/ucleotides antiviral agents is that ribavirin and immunostimulant/immunomodulator are interferon-ALPHA.

14. the process of claim 1 wherein that one or more chemical compounds further comprise at least a anti-HIV-1 compounds.

15. the process of claim 1 wherein that the host is the people.

16. the method for treatment viral infection, this method comprises administration composition to the host that these needs are arranged, and said composition comprises:

(a) comprise DOPE, CHEMS and PEG-PE lipid liposome and

(b) be encapsulated in intravital one or more chemical compounds of lipid, wherein one or more chemical compounds comprise N-butyl deoxynojirimycin (NB-DNJ).

17. the method for claim 16, wherein virus is hepatitis virus.

18. the method for claim 17, wherein virus is hepatitis B virus.

19. the method for claim 17, wherein virus is hepatitis C virus.

20. the method for claim 17, wherein virus is BVDV virus.

21. the method for claim 20, wherein virus is the ncp strain of BVDV virus.

22. the method for claim 20, wherein virus is the cp strain of BVDV virus.

23. the method for claim 18, wherein one or more chemical compounds further comprise ucleosides/ucleotides antiviral agents, immunostimulant/immunomodulator, or its combination.

24. the method for claim 23, wherein ucleosides/ucleotides antiviral agents is that ribavirin and immunostimulant/immunomodulator are interferon.

25. the method for claim 18, wherein virus is HIV virus.

26. the method for claim 25, wherein HIV virus is selected from: 92UG037,92RW021, JR-FL, 92HT599,89.6,93IN101,97USNG30,92UG021, the first HIV-1 separator of 92UG046 and 93BR020.

27. the method for claim 25, wherein one or more chemical compounds further comprise one or more anti-HIV medicines.

28. the method for claim 18, wherein the host is the people.

29. a method comprises:

Administration composition is to there being this host who needs, and said composition comprises (a) pH sensitive liposome body and (b) be encapsulated in the intravital antigen of lipid, and wherein the administration antigen presentation that causes being undertaken by the main histocompatibility molecule 1 class of antigen presenting cell increases.

30. the method for claim 29, wherein antigen is mucin peptide.

31. the method for claim 30, wherein peptide is the YMDGTMSQV peptide.

32. the method for claim 29, wherein said liposome comprises DOPE and CHEMS.

33. the method for claim 32, wherein said liposome further comprises the PEG-PE lipid.

34. the method for claim 29, wherein the host is the people.

35. the method that treatment HIV infects, this method comprises:

Administration composition is to there being this host who needs, and said composition comprises and the bonded liposome of gp120/gp41 complex targeting moiety.

36. the method for claim 35, wherein targeting moiety comprises the sCD4 molecule.

37. the method for claim 35, wherein targeting moiety comprises monoclonal antibody.

38. the method for claim 37, wherein antibody is IgG 2F5 or IgG b12 antibody.

39. the method for claim 35, wherein HIV infects and causes by being selected from the first separator of following HIV-1: 92UG037,92RW021, JR-FL, 92HT599,89.6,93IN101,97USNG30,92UG021, the first HIV-1 separator of 92UG046 and 93BR020.

40. the method for claim 35, wherein liposome comprises DOPE and CHEMS lipid.

41. the method for claim 40, wherein liposome further comprises the PEG-PE lipid.

42. the method for claim 40, wherein liposome further comprises the MCC-PE lipid.

43. the method for claim 40, wherein liposome further comprises the PI lipid.

44. the method for claim 35, wherein compositions further comprises and is encapsulated in the intravital α alpha-glucosidase inhibitors of lipid.

45. the method for claim 44, wherein inhibitor comprises NB-DNJ.

46. the method for claim 35, wherein the host is the people.

47. a compositions, it comprises:

Comprise DOPE, CHEMS and PEG-PE lipid liposome and

Be encapsulated in the intravital N-butyl of lipid deoxynojirimycin (NB-DNJ).

48. the compositions of claim 47, wherein liposome is the DCPP liposome.

49. the compositions of claim 47 further comprises ucleosides/ucleotides antiviral agents, immunostimulant/immunomodulator, or its combination.

50. the compositions of claim 49, wherein ucleosides/ucleotides antiviral agents is that ribavirin and immunostimulant/immunomodulator are interferon.

51. the compositions of claim 47 further comprises one or more anti-HIV medicines.

52. a compositions, it comprises:

PH sensitive liposome body and be encapsulated in the intravital antigen of lipid.

53. the compositions of claim 52, wherein antigen comprises mucin peptide.

54. the compositions of claim 52, wherein liposome comprises DOPE and CHEMS lipid.

55. the compositions of claim 54, wherein liposome further comprises the PEG-PE lipid.

56. the compositions of claim 54, wherein liposome further comprises the PI lipid.

57. a compositions, it comprises:

With the bonded liposome of gp120/gp41 complex targeting moiety.

58. the compositions of claim 57, wherein targeting moiety comprises the sCD4 molecule.

59. the compositions of claim 57, wherein targeting moiety comprises monoclonal antibody.

60. the compositions of claim 57, wherein liposome comprises DOPE and CHEMS lipid.

61. the compositions of claim 60, wherein liposome further comprises the PEG-PE lipid.

62. the compositions of claim 60, wherein liposome further comprises the MCC-PE lipid.

63. the compositions of claim 60, wherein liposome further comprises the PI lipid.

64. the compositions of claim 63, wherein the molar concentration of PI lipid is about 10% to about 30% in the liposome.

65. the compositions of claim 57 further comprises and is encapsulated in the intravital Alpha-glucosidase inhibitor of lipid.

66. the compositions of claim 65, wherein Alpha-glucosidase inhibitor comprises NB-DNJ.

67. the method for treatment viral infection, this method comprises administration composition to the host that these needs are arranged, and said composition comprises:

(a) comprise the PI lipid liposome and

(b) be encapsulated in the intravital at least a antiviral compound of lipid, wherein viral infection is the infection of sprouting of ER film virus;

And

Wherein said contact causes sending at least a chemical compound and enters and infect in the endoplasmic reticulum that the cell that causes the virus that infects is arranged and cause one or more lipids of liposome are incorporated in the endoplasmic reticulum of cell.

68. the method for claim 67, wherein liposome further comprises DOPE and CHEMS lipid.

69. the method for claim 67, wherein the molar concentration of PI lipid is 5 to 50% in the liposome.

70. the method for claim 69, wherein the molar concentration of PI lipid is 10 to 30% in the liposome.

71. the method for claim 67, wherein at least a antiviral compound comprises Alpha-glucosidase inhibitor.

72. the method for claim 71, wherein Alpha-glucosidase inhibitor comprises NB-DNJ.

73. the method for claim 67, wherein the host is the people.

74. a compositions, it comprises:

Comprise the PI lipid liposome and

Be encapsulated in the intravital at least a antiviral compound of lipid.

75. the compositions of claim 74, wherein liposome further comprises DOPE and CHEMS lipid.

76. the compositions of claim 74, wherein the molar concentration of PI lipid is 5 to 50% in the liposome.

77. the compositions of claim 76, wherein the molar concentration of PI lipid is 10 to 30% in the liposome.

78. the compositions of claim 74, wherein at least a antiviral compound comprises Alpha-glucosidase inhibitor.

79. the compositions of claim 78, wherein Alpha-glucosidase inhibitor comprises NB-DNJ.

80. the method for treatment viral infection, this method comprises:

Administration composition is to there being this host who needs, and said composition comprises:

(a) comprise the PI lipid liposome and

(b) at least a antiviral protein in the lipid layer of embedding liposome, wherein said contact causes one or more lipids of liposome are incorporated in the endoplasmic reticulum that infects the cell that the virus that causes infection is arranged.

81. the method for claim 80, wherein liposome further comprises DOPE and CHEMS lipid.

82. the method for claim 81, wherein liposome further comprises the PEG-PE lipid.

83. the method for claim 80, wherein the molar concentration of PI lipid is 5 to 50% in the liposome.

84. the method for claim 83, wherein the molar concentration of PI lipid is 10 to 30% in the liposome.

85. the method for claim 80, wherein compositions comprises that further (c) is encapsulated in the intravital at least a antiviral compound of lipid and wherein said contact and causes sending at least a chemical compound and enter in the endoplasmic reticulum of cell.

86. the method for claim 85, wherein at least a antiviral compound comprises Alpha-glucosidase inhibitor.

87. the method for claim 86, wherein Alpha-glucosidase inhibitor comprises NB-DNJ.

88. the method for claim 80, wherein at least a antiviral protein is selected from: virus receptor, the mutant form of virus enveloped protein and viral interference tunicle interacting proteins.

89. the method for claim 80, wherein viral infection is the ER film viral infection that sprouts.

90. the method for claim 89, wherein the ER viral infection that sprouts is that HBV, HCV or BVDV infect.

91. the method for claim 80, wherein infecting is the plasma membrane infection of sprouting.

92. the method for claim 91, wherein plasma membrane sprouts, and to infect be that HIV infects.

93. the method for claim 80, wherein the host is the people.

94. a compositions, it comprises:

(a) comprise the PI lipid liposome and

(b) at least a antiviral protein in the lipid layer of embedding liposome.

95. the compositions of claim 94, wherein liposome further comprises DOPE and CHEMS lipid.

96. the compositions of claim 95, wherein liposome further comprises the PEG-PE lipid.

97. the compositions of claim 94, wherein the molar concentration of PI lipid is 5 to 50% in the liposome.

98. the compositions of claim 97, wherein the molar concentration of PI lipid is 10 to 30% in the liposome.

99. the compositions of claim 94, wherein compositions further comprises (c) and is encapsulated in the intravital at least a antiviral compound of lipid.

100. the compositions of claim 99, wherein at least a antiviral compound comprises Alpha-glucosidase inhibitor.

101. the compositions of claim 100, wherein Alpha-glucosidase inhibitor comprises NB-DNJ.

102. the compositions of claim 94, wherein at least a antiviral protein is selected from: virus receptor, the mutant form of virus enveloped protein and viral interference tunicle interacting proteins.

103. a compositions, it comprises:

Comprise the PI lipid liposome and

Be encapsulated in the intravital at least a therapeutic agent of lipid.

104. the method for the treatment or the prevention physiology patient's condition, this method comprises administration composition to the experimenter that these needs are arranged, and said composition comprises:

Comprise the liposome of PI lipid and be encapsulated in the intravital at least a therapeutic agent of lipid.

105. a compositions, it comprises:

Comprise the PI lipid liposome and

Embed the interior at least a protein of lipid bilayer of liposome.

106. the method for the treatment or the prevention physiology patient's condition, this method comprises administration composition to the experimenter that these needs are arranged, and said composition comprises:

Comprise the liposome of PI lipid and the interior at least a albumen of lipid bilayer of embedding liposome.

Images