CN101555486A - Application of human transcription factor HMBOX1 gene - Google Patents

Abstract

The invention relates to an application of a human transcription factor HMBOX1 gene, in particular to an application of the HMBOX1 gene to the regulation and control of a natural killer cell after over-expression, which belongs to the technical field of the functional genomics. The invention utilizes a molecular cloning method to construct a eukaryotic over-expression vector of the HMBOX1 gene; the plasmid is introduced into an NK cell by an electrotransfection method, and the stable NK-HMBOX1 over-expression cell strains are screened through a G418 and established; and the functional regulation action of the HMBOX1 to the NK cell is studied. Due to the importance of the protein family, the studies to the concrete functions of the HMBOX1 not only disclose the function of the new gene, but also lay a foundation for further understanding the development of the NK cell and the function adjusting process.

Description

The application of human transcription factor HMBOX 1 gene

Technical field

The present invention relates to the application of human transcription factor HMBOX 1 gene, particularly the application of behind the HMBOX1 gene overexpression natural killer cell being regulated and control belongs to the functional genomics technical field.

Background technology

Natural killer (NK) cell is one of three major types lymphoidocyte, belong to natural immune system, be described as is anticancer, the antiviral outpost of body always, and activatory NK cell can also be by modes such as secrete cytokines, regulate the specificity and the nonspecific immune reaction of other cells, therefore being otherwise known as connects the bridge of the natural immunity and acquired immunity.Whether the activation of NK cell, and its follow-up functionally active, be that reactivity acceptor and inhibition acceptor by its expression determined, for example most important NKG2 family, at present more to the functional study of NK cell receptor, but the mechanism of relevant NK cell receptor expression regulation is illustrated as yet so far.

HMBOX1 (homeobox containing 1) gene is positioned at the intersection of human chromosome 8p12.3 and 8p21.1, and total length 1263bp is one of homeobox family member.By its classical H omeobox DNA binding domains and reporter gene experiment tentative prediction is transcription inhibition factor.Other members of this family play a crucial role in NK cells whose development ripening process.But the concrete function of HMBOX1 does not appear in the newspapers as yet, belongs to new Unknown Function albumen.

Summary of the invention

The present invention is directed to the deficiencies in the prior art, the application of a kind of human transcription factor HMBOX 1 gene and proteins encoded thereof is provided.And, illustrate the function of human transcription factor HMBOX 1 in the NK cell based on the functional experiment of NK cell.Because the importance of its place protein family to the research of HMBOX1 concrete function, not only discloses the function of this new gene, and for further understanding NK cell development and function regulate process lay the foundation.

Summary of the invention

The present invention utilizes molecular cloning method to make up HMBOX1 gene eukaryotic over-expression vector.By electric shifting method plasmid is imported the NK cell, set up stable NK-HMBOX1 overexpressing cell strain through the G418 screening.Use mtt assay, flow cytometry, Real-time round pcr, respectively to the propagation of NK cell, kill and wound, take off the particle ability and activation/inhibition acceptor, cytokine and mu particle expression level detect.Research HMBOX1 is to the function regulating effect of NK cell.

Detailed Description Of The Invention

The application of human transcription factor HMBOX 1 gene aspect regulation and control natural killer (NK) cell function made up expression vector as follows, and expression vector expressed realize:

(1) HMBOX1 gene cDNA clone and expression vector establishment excessively:

Extract the RNA of NK-92 cell, reverse transcription becomes cDNA, amplification HMBOX1 cDNA total length 1263bp, the design primer, during design of primers according to pcDNA3.1-myc/his (-) carrier specification sheets, add the KOZAK sequence before the initiator codon and strengthen protein expression, terminator codon is TGA by the TAA point mutation, makes follow-up myc and his label energy normal expression.Pcr amplification, the PCR product gel connects into the T carrier after reclaiming, and is entirely true through order-checking proof sequence; With restriction enzyme BamHI and EcoRI full length fragment is downcut then, gel is linked on pcDNA3.1-myc/his (-) carrier after reclaiming, through sequence verification, promptly get HMBOX1 gene overexpression carrier pcDNA3.1-HMBOX1, sequence is shown in SEQ ID NO.1; (Fig. 1)

(2) Western blot identifies the expression of HMBOX1 expression vector in HEK293:

Step (1) is made HMBOX1 gene overexpression carrier pcDNA3.1-HMBOX1 to be transfected in the HEK293 cell by liposome Liptofectamin2000, extract total protein of cell after 24 hours, and be SDS-PAGE and Western blot, with the proteic expression of anti-label protein myc antibody test HMBOX1.(Fig. 2)

Primer sequence in the above-mentioned steps (1) is: 5 ' CGGCTAGCGCACCATGGCGATGCTTAGTTCCTTTCCAGTG 3 ' and 5 ' CCGAAGCTTGAGTCATCATCCAGGGCCT 3 '.

Pcr amplification in the above-mentioned steps (1), reaction conditions is as follows: 95 ℃, 5 minutes, 1 circulation; 94 ℃, 1 minute, 60 ℃, 1 minute, 72 ℃, 90 seconds, 35 circulations; 72 ℃, 10 minutes, 1 circulation.

After crossing and express, above-mentioned after testing expression vector do not influence the propagation (Fig. 4) of NK cell in the NK cell.

After above-mentioned after testing expression vector was crossed in the NK cell and expressed, the NK cell significantly descended to the kill capability of target cell HepG2 and K562, and the particle ability of taking off of NK cell is obviously decline (Fig. 5,6) also.

After above-mentioned after testing expression vector was crossed in the NK cell and expressed, NK cell surface activated receptor NKG2D expressed decline, and the mRNA level of NKG2D and its joint protein D AP10 also has decline.But its homicidal wound associated receptor NKG2A of NK cell surface expression, CD54, FasL, NKp46, TRAIL do not have considerable change (Fig. 7,8,9).

After above-mentioned after testing expression vector was crossed in the NK cell and expressed, the mRNA level of NK cell expressing cytokine TNF-α and IFN γ descended, and the protein level decline of IFN γ is (Figure 10,11) significantly.

After above-mentioned after testing expression vector is crossed in the NK cell and is expressed, and NK cell killing associated molecule perforin, Grazymefamily (A, B, K, M, mRNA level H) has different variations, and perforin and Grazyme K have remarkable decline.The protein level of perforin also has slight decline (Figure 12,13).

Can learn that by above-mentioned detection the HMBOX1 gene can suppress NK cell degranulation ability and cytokine secretion by the expression of the important activation identification receptor NKG2D of downward modulation NK cell surface, realizes the inhibition to the killing ability of NK cell.Therefore can be used for gene diagnosis and gene therapy to mankind itself's immunological disease and tumour.Can also carry out the new drug design and development at the HMBOX1 gene.

Description of drawings

Fig. 1 .pcDNA3.1-HMBOX1-myc/his vector construction mode chart.

Fig. 2 .Western blot identifies and makes up the expression of recombinant vectors in the HEK293 cell.

Fig. 3. change carrier over to NK clone, after stable screening, the expression level excessively of HMBOX1 gene.

NK-3.1 has represented the NK cell transfecting control group of empty carrier pcDNA3.1; NK-HM represents the experimental group of transfection expression carrier pcDNA3.1-HMBOX1.

Fig. 4. after detecting HMBOX1 and cross expression with mtt assay, the propagation situation of NK cell.

The A.NK-92 cell

The B.NKL cell

Fig. 5. after detecting HMBOX1 and cross expression with mtt assay, the NK cell is to the kill capability of target cell HepG2 and K562.

The A.NK-92 cell

The B.NKL cell

After Fig. 6 .HMBOX1 crosses expression, the particle ability of taking off of NK cell.

Fig. 7. after Flow cytometry HMBOX1 crosses expression, NKL cell surface NKG2D expression of receptor situation.

A. streaming histogram.

B. four statistical study figure of average fluorescent strength (MFI).

Fig. 8. after Flow cytometry HMBOX1 crosses expression, its homicidal wound associated receptor expression of NKL cell surface.

After Fig. 9 .Real-time PCR detection HMBOX1 crossed expression, NKL cell NKG2D, DAP10mRNA level changed.

After Figure 10 .Real-time PCR detection HMBOX1 crosses expression, the mRNA level of NKL cell antitumor cell factor TNF-α and IFN-γ.

Figure 11. after Flow cytometry HMBOX1 crosses expression, the protein level of IFN-γ in the born of the same parents behind the NKL cell activation.

After Figure 12 .Real-time PCR detection HMBOX1 crosses expression, NKL cell killing associated molecule perforin, Grazymefamily (A, B, K, M, mRNA level H).

Figure 13. after Flow cytometry HMBOX1 crosses expression, the protein level of perforin in the born of the same parents behind the NKL cell activation.

Embodiment

1, HMBOX1 gene cDNA clone and expression vector establishment excessively.

With the RNA of invitrogen company's T rizol extraction NK-92 cell, reverse transcription becomes cDNA.With TAKARA high-fidelity Taq enzymatic amplification HMBOX1 cDNA total length 1263bp, primer sequence: 5 ' CGGCTAGCGCACCATGGCGATGCTTAGTTCCTTTCCAGTG 3 ' and 5 ' CCGAAGCTTGAGTCATCATCCAGGGCCT 3 '.

The PCR product gel connects into the T carrier after reclaiming, and is entirely true through order-checking proof sequence.With restriction enzyme BamHI and EcoRI full length fragment is downcut then, gel is linked on pcDNA3.1-myc/his (-) carrier after reclaiming, and correct through sequence verification again, HMBOX1 gene overexpression carrier pcDNA3.1-HMBOX1 successfully constructs.PcDNA3.1-HMBOX1-myc/his carrier sequencing result as shown in Figure 2.

2, Western blot identifies the expression of HMBOX1 expression vector in HEK293.

Expression vector pcDNA3.1-HMBOX1 is transfected in the HEK293 cell by liposome Liptofectamin2000, extract total protein of cell after 24 hours, and be SDS-PAGE and Western blot, with the proteic expression of anti-label protein myc antibody test HMBOX1, verify whether constructed recombinant vectors can express HMBOX1 albumen.

3, RNA extracts and Real-time PCR detection mrna expression.

Press the reagent specification sheets, extract the total RNA that respectively organizes the NK cell, again with the synthetic cDNA of the invitrogen M-MLV of company reversed transcriptive enzyme with invitrogen company's T rizol.After diluting 10 times, cDNA is used for step PCR reaction down.Real-time PCR agents useful for same is TransStart SYBR qPCR Kit (available from TransGen company), and reaction system 20 μ l contain SYBR Greenmix 10 μ l, cDNA 2 μ l, passive enhancer 0.4 μ l, each 1 μ l of upstream and downstream primer, water 6.6 μ l.Primer sequence sees attached list 1.Detect with the myiQ PCR of Bio-Rad company instrument, obtain relative expression's intensity of each gene.As shown in Figure 3.HMBOX1 changes in the NK cell, but through the screening after stably express.As Figure 10, shown in 11,13.After the NK cell is crossed expression HMBOX1, the mRNA level of the joint protein D AP10 of its activated receptor NKG2D and NKG2D reduces, cytokine IFN-γ, TNF-α and the mRNA expression level decline that kills and wounds associated molecule Perforin, Grazyme K, Grazyme A, GrazymeB, Grazyme M, Grazyme H does not have significant change.

4, mtt assay detects cell proliferation.

Each is organized the NK cell centrifugation and collects, counting, and 6000 cells/well, 4 multiple holes are inserted in the 96 porocyte culture plates.37 ℃, 5%CO ₂Cultivate 0h, 24h, 48h, 72h under the condition.2h adds 10 μ l MTT (50ug/ml)/holes before each time point, after continuing to cultivate 4h, and the centrifugal 25min of 2500rpm, remove clean substratum, add 200ul dimethyl sulfoxide (DMSO) (DMSO) dissolving first a ceremonial jade-ladle, used in libation particle, detect the OD570/680nm light absorption value with microplate reader behind the mixing, do growth curve, as shown in Figure 4.As seen from Figure 4, do not influence the propagation of NK cell after HMBOX1 crosses and expresses in the NK cell.

5, mtt assay detects NK cell killing ability

Target cell HepG2 and K562 are inserted in 96 orifice plates 10 * 105/ holes.After treating that HepG2 is adherent, collect and respectively to organize the NK cell, to imitate target than (E: T) ratio of 10: 1 and 5: 1 adds in the target cell, establishes only to add the effector cell and only add the target cell control group.After cultivating 6h, add 20 μ l MTT (50ug/ml)/holes, continue to cultivate 4h, detect viable cell quantity, same cell proliferation method.Institute's value is pressed the row formula and is calculated: kill rate (%)=[1-(ODE+T-ODE)/ODT] * 100%.ODE+T kills and wounds group for effector cell and target cell blended, and ODE is for only adding effector cell's control group, and ODT only adds the target cell control group, as shown in Figure 5.

6, Flow cytometry NK cell degranulation ability.

Collect and respectively organize NK cell and target cell K562 cell, the two mixed by 10: 1, added CD107a antibody (BDpharmagene) 20 μ l/ml, 37 ℃, 5%CO ₂Co-cultivation 1h under the condition adds monensin (6 μ g/ml) and cyanein (10 μ g/ml), cultivates 3h again.Collecting cell, the washing of PBS damping fluid, behind CD56 antibody labeling NK cell, with the CD107a developed by molecule situation of flow cytometer detection NK cell, reaction NK cell degranulation ability, i.e. kill capability.As shown in Figure 6.By Fig. 5, Fig. 6 as can be seen, after HMBOX1 crossed in the NK cell and expresses, the NK cell significantly descended to the kill capability of target cell HepG2 and K562, and the particle ability of taking off of NK cell also obviously descends, and the CD107a positive rate drops to 12% from 25%.

7, molecule in Flow cytometry NK cell surface receptor and the born of the same parents.

Surface receptor mark: collect and respectively organize the NK cell,, hang with 100 μ l PBS damping fluids through PBS damping fluid washed twice, add 1 μ l streaming antibody (NKG2D respectively, NKG2A, CD54, FasL, NKp46, Trail), mixing is hatched 30min for 4 ℃, after the PBS damping fluid washed twice, detect the expression of each molecule with flow cytometer.Shown in Fig. 8,9.As seen from Figure 8, after HMBOX1 crossed in the NK cell and expresses, the expression of NK cell surface reactivity acceptor NKG2D descended.Fig. 9 as can be seen, its homicidal wound of NK cell surface and activation associated receptor NKG2A, CD54, FasL, NKp46, Trail do not see considerable change.So HMBOX1 is likely by influencing the activation of NK cell, and then influences its kill capability to target cell.

Molecule marker in the born of the same parents: each is organized the NK cell and connects 12 orifice plates by same concentrations, adding 1-Methoxy-2-propyl acetate (PMA) 50ng/ml and ionomycin 10 μ g/ml activates, add monensin (6 μ g/ml) and cyanein (10 μ g/ml) after cultivating 1h, cultivate 4h again.Collecting cell, PBS damping fluid washed twice is removed clean PBS damping fluid, with Paraformaldehyde 96 stationary liquid fixed cell, hatches 30min for 4 ℃.Saponin is worn film liquid washed twice, wears film liquid with 100 μ l and has hanged cell, hatches 30min for 4 ℃, adds 1 μ l IFN-γ or Perforin antibody, hatches 2h or spends the night for 4 ℃.Behind twice of the PBS damping fluid washed cell, detect the expression of molecule in the born of the same parents with flow cytometer.Shown in Figure 12,14.By Figure 12, Figure 14 as can be seen, after HMBOX1 crossed in the NK cell and expresses, the ability of NK emiocytosis cytokine IFN-γ and murderer Perforin obviously reduced.

The primer among the embodiment, with reference to the prior art design, also can be referring to subordinate list 1.

Table 1

Gene	Primer sequence	Product length (bp)
			GAPDH	forward，GAAGGTGAAGGTCGGAGT reverse，CATGGGTGGAATCATATTGGAA	155
HMBOX1	forward，AACCCTGGCGCTACACTAAG reverse，TCCTTTCTCCAGGTAAATCGAC	140
			NKG2D	forward，TGCATGCAAAGGACTGTGTAAAG reverse，GCAGTGTTACCGCTGGTGTAATC	86
DAP10	forward，TCCATCTGGGTCACATCCTCTTCC reverse，AAGAGCCTGAAGTGCCAGGGTAAAAG	112
			IFN-γ	forward，CTTGGCTTTTCAGCTCTGCATC reverse，CTTCAAAATGCCTAAGAAAAGAGTTCC	151
TNF-α	forward，ATCTTCTCGAACCCCGAGTGA reverse，CGGTTCAGCCACTGGAGCT	83
			Perforin	forward，AGTACAGCTTCAGCACTGACA reverse，ATGAAGTGGGTGCCGTAGTT	175
Grazyme-A	forward，TCAGGTTGATTGATGTGGGACAG reverse，GACCATGTAGGGTCTTGAATGAGGA	163
			Grazyme-B	forward，GCGGTGGCTTCCTGATACAAG reverse，CCCCCAAGGTGACATTTATGG	82
Grazyme-H	forward，TGGCGGCATCCTAGTGAGAA reverse，GCCCCCAAGGTGACATTTATG	81
			Grazyme-K	forward，ATCAACACATTTCATCTGGGCTTC reverse，AAACGTGATGTCCGCCATACTG	197
Grazyme-M	forward，GGACACCCGCATGTGTAACAAC reverse，GATGTCAGTGCAGACCCTGGAG	187

SEQUENCE LISTING

＜110〉Shandong University

＜120〉application of human transcription factor HMBOX 1 gene

<160>1

<170>PatentIn version 3.5

<210>1

<211>1447

<212>DNA

＜213〉people

<400>1

ggagacccaa gctggctagc gtttaaacgg gccctctaga ctcgagcggc cgccactgtg 60

ctggatatct gcagaattcg attaagtatg cttagttcct ttccagtggt tttgctggaa 120

accatgtctc attatacaga tgagcccaga tttaccatag agcagataga tctgcttcag 180

cgacttcggc gtactggaat gactaaacat gaaattctcc atgccttgga aactttggac 240

cgtcttgatc aagagcatag tgacaagttt ggaagaaggt ccagctatgg aggaagttca 300

tatgggaata gtactaacaa tgtcccagca tcttcctcta cagctacagc ttccacacag 360

acgcagcatt cgggaatgtc cccgtcacct agcaacagtt atgatacttc cccacagcct 420

tgcactacca atcaaaatgg gagggagaat aatgagcgat tatctacatc caatggaaag 480

atgtcaccaa ctcgctacca tgcaaacagc atgggtcaga ggtcatacag ttttgaagcc 540

tcagaagagg acctagatgt agatgataaa gtggaagaat taatgaggag ggacagcagt 600

gtgataaaag aggaaatcaa agcctttctt gccaatcgga ggatttccca agcagttgtt 660

gcacaggtaa caggtatcag tcagagccgg atctctcatt ggctgttgca gcagggatca 720

gacctgagtg aacagaagaa aagagcattt taccgatggt atcaacttga gaagacaaac 780

cctggcgcta cactaagtat gagaccagcc cccattccaa tagaggaccc tgaatggaga 840

caaacgcctc ccccagtctc tgccacatct ggtactttcc gactgcgacg agggagtcga 900

tttacctgga gaaaggagtg cctggctgtt atggaaagtt acttcaatga gaatcaatac 960

ccagatgaag caaagaggga agaaattgca aacgcttgca atgcagttat acagaagcca 1020

ggcaaaaagc tgtcagatct ggaaagagtt acctccctga aagtatataa ttggtttgct 1080

aacagaagga aggagatcaa gaggagagcc aatattgaag cagcaatcct ggagagtcat 1140

gggatagatg tgcagagtcc aggaggccac tcaaacagtg atgatgtcga cgggaatgac 1200

tactctgagc aggatgacag tacgagccat agtgaccacc aagaccccat ctcattagct 1260

gtggaaatgg cagcagtcaa ccacactatc ttggcattgg cccggcaagg agccaacgaa 1320

atcaagacag aggccctgga tgatgactga ggatccgagc tcggtaccaa gctttctaga 1380

acaaaaactc atctcagaag aggatctgaa tagcgccgtc gaccatcatc atcatcatca 1440

ttgagtt 1447

Claims (7)

1, a kind of human transcription factor HMBOX 1 gene is crossed the application of expression to the natural killer cell regulate and control.

2, application according to claim 1 is characterized in that the HMBOX1 gene does not influence the propagation of NK cell after the mistake expression in the natural killer sexual cell.

3, application according to claim 1, it is characterized in that HMBOX1 cross to express in the natural killer sexual cell after, the kill capability of natural killer sexual cell significantly descends.

4, application according to claim 1, it is characterized in that HMBOX1 cross to express in the natural killer sexual cell after, natural killer cell surface activated receptor NKG2D expresses decline.

5, application according to claim 1, it is characterized in that HMBOX1 cross to express in the natural killer sexual cell after, the level of natural killer cell expressing cytokine IFN γ descends.

6, application according to claim 1, it is characterized in that HMBOX1 cross to express in the natural killer sexual cell after, natural killer cell killing molecule perforin expresses decline.

7, a kind of human transcription factor HMBOX1 gene as claimed in claim 1 is by regulation and control natural killer cell, the application in preparing antitumor and anti-autoimmunization medicine.

Images