CN101544973A

CN101544973A - Directed gene recombination technology based on screening after connection

Info

Publication number: CN101544973A
Application number: CN200810102902A
Authority: CN
Inventors: 张永钢
Original assignee: Individual
Current assignee: Individual
Priority date: 2008-03-28
Filing date: 2008-03-28
Publication date: 2009-09-30

Abstract

The invention relates to a novel gene recombination technology in the field of biotechnology. On the basis of the traditional non-directional gene recombination technology, a new enzyme site is formed between a directed recombination carrier and a directed target gene in backward connection, and a corresponding enzyme site can not be formed between a target gene in forward connection and the directed recombination carrier; corresponding restriction endonuclease is utilized to process the enzyme site formed by fault connection so that the target gene in backward connection is difficult to enter host cells or difficult to clone and amplify after entering the host cells, thereby reaching the aim of directed cloning. The directed gene recombination technology is formed by the reconstruction on the basis of the traditional technology, has the advantages of simple technology, short period, low cost, simple operation, and the like and is suitable for laboratory expression research and large-scale gene expression operation.

Description

To connect the directed gene recombination technology of back screening

Technical field

The present invention is a kind of novel directed gene recombination method of biological technical field.Goal gene at first is connected with corresponding recombinant vectors in the non-directional mode, and the specific selection site that incorrect link is formed connects aftertreatment afterwards, is difficult to duplicate after making the goal gene of incorrect link be difficult to enter host cell or enter host cell.Present method can be used for the small-scale general science research in laboratory, is more suitable for especially having very high using value in proteinic production or screening in batches in information biology research.

Background technology

Since the seventies in last century, round pcr and restriction enzyme were found, gene recombination technology has formed the perfect system of a cover, wherein mainly comprise the separation of goal gene, the restricted cutting of goal gene and recombinant vectors, goal gene is connected with the orientation of recombinant vectors, the conversion of host cell, the screening of positive colony etc.Goal gene and carrier be connected with forward and reverse dual mode, the gene that has only forward to connect can obtain correct expression, being based upon therefore that orientation on the double digestion basis connects is the core of traditional recombinant technology.

The cutting of goal gene and carrier is that operation is the most loaded down with trivial details in the gene recombination process with being connected, and the work period is the longest, and the highest step of failure probability.Lot of domestic and international biotech company has all developed the test kit product that is used to simplify the operation successively at present, reclaim test kit such as gel, the PCR fragment reclaims test kit, and endonuclease bamhi reclaims test kit, connect fast test kit etc., but still be difficult to avoid losing of gene fragment in the operating process.Therefore seek the selection that is inevitable of more simple method.

People mainly realize by following dual mode the transformation of directed recombinant technology at present:

1, the principle of biological gene reorganization under the simulating natural condition.Such as the In-fusion system of Clontech company based on homologous recombination, Invitrogen company is reassembled as basic Gateway system with locus specificity, the patented technology of F.A. Stewart etc.---use the method and composition (number of patent application 00812739.5) of homologous recombination clone and subclone etc.The nature recombinant technology does not need the user that goal gene is cut and is connected, and gets final product transformed host cell as long as carrier, goal gene and reorganization system are mixed the processing reasonable time.But natural recombinant technology needs to have 20～40bp homologous sequence between carrier end and the goal gene end, needs special recombinase system, has improved the running cost of gene recombination greatly.And homologous recombination is a dynamic two-way process, and reassembling into power generally can be too not high, is not adapted at that common lab is conventional to be used.

2, realize directed reorganization with the body inner connection mode.Such as NEB company on uracil dna glycosylase (UDG) basis, set up USER Friendly system etc., and two patented technologies---a kind of method (number of patent application 01133158.1) of Zero-background high-flux directed cloning expression and the method (number of patent application 200410060972.6) of the direct directed cloning structure of a kind of high-throughput recombinant adenovirus etc. of application such as Ma Lixin.Connection generally needs to have between goal gene and the carrier complementary sequence of 4～12bp in the body, and aforesaid method is exactly to set up such complementary sequence by different modes between carrier and goal gene.The former need synthesize special primer, and needs specific toolenzyme, and job costs are higher; The latter a kind of toolenzyme of routine, to primer sequence require relatively lowly, be a kind of method that is worthy to be popularized.But recombinant technology requires carrier must possess one section free single stranded sequence in the above-mentioned body, and these free sequences are easy to occur base and come off in freezing molten process repeatedly, influence joint efficiency, are not suitable for prolonged application, are difficult to commercialization production.

Above-mentioned technology respectively never with angle developed recombinant technology, but be subjected to the influence that the too high or joint efficiency of the cost that defective caused of technology itself is crossed factor such as low, can not substituting previously, traditional recombinant technology carries out the routine application.

In the clonal expansion stage of goal gene, the direction that goal gene is entered carrier did not have specific requirement in the past, can be connected into carrier by the mode of non-directional reorganization.Can directly connect such as amplified production and to enter the TA cloning vector, very biotech firm also released relevant recombination kit at present based on the Taq enzyme.The smooth end amplified production that obtains with other hot resistant DNA polymerase amplifications can be directly connected in the flat terminal carrier equally in addition, does not need complementary sequence.Along with the ligase enzyme development of technology, the terminal gene that connects of TA clone peace has overcome the problem that connects difficulty, the test kit that is connected that biotech firms such as NEB and Takara release got final product complete operation at 5～10 minutes, present above-mentioned technology is in most of laboratory applications.

The present invention introduces on the basis of traditional non-directional reorganization and connects the back screening process, select the site to process by the specificity that restriction enzyme forms reverse connection product, be difficult to the ability of clonal expansion after making the recombinant products forfeiture of reverse connection enter host cell or enter cell, thereby reach directed purpose of connecting.

Summary of the invention

Technical scheme one

1, prepares linear recombinant vectors

1) extracts plasmid, clay, phage or virus vector, first-selected plasmid vector.

2) with a kind of or two kinds of restriction enzymes carrier is cut the making connection site, first-selected double digestion, the digestion with restriction enzyme product can be cohesive terminus, also can be smooth end, first-selected smooth end.

3) carrier is scabbled, mends the flat half-selected bit point that forms, the first-selected benefit put down

4) carrier is carried out or do not carry out dephosphorylation and modify, first-selected dephosphorylation is handled

* the acquisition of TA cloning vector can obtain by specific restriction enzyme cutting or obtain by the terminal base of adding of smooth end, carries out dephosphorylation afterwards equally and handles.

2, preparation goal gene

1) synthetic primer with half-selected bit point: its amplified production with can form complete restriction enzyme digestion sites after above-mentioned directed carrier oppositely is connected, and when forward connects, do not form corresponding restriction enzyme site.。

2) amplification of goal gene: according to the ordinary method amplifying target genes, TA clonal selection TaqDNA polysaccharase system, the non-TaqDNA polysaccharase of smooth end clonal selection system.

3) goal gene is identified: identify by conventional agarose electrophoresis.

4) goal gene is refining: have non-specific amplification if identify the discovery goal gene, need carry out purifying to goal gene.

3, the directed connection

First kind of mode

1) with goal gene and the recombinant vectors mixed about according to quantity 3:1

2) add suitable ligase enzyme system and finish ligation.

3) behind the high-temperature inactivation ligase enzyme, add the endonuclease enzyme system and cut screening,

The second way

Connection and cleavage reaction carry out in same system, at first finish ligation to connect optimum temperuture, cut optimum temperuture at enzyme then and finish the cutting screening.The reaction also can under same temperature, carry out, but preferably the former.

The third mode

Connect product and change host cell over to, in host cell, utilize natural or induce the restriction endonuclease of generation to finish the cutting screening with modifying enzyme expression activity.

Technical scheme two

1, in conventional recombinant vectors, introduce two restriction enzyme sites that do not have the smooth end restriction enzyme of intersection identification, perhaps introduce two and do not exist and intersect the restriction enzyme site of restriction endonuclease of residual 3 ' T cohesive terminus of identification, form directed recombinant vectors.

2, at the goal gene upstream and downstream half-selected bit point of introducing and carrier downstream and upstream coupling respectively.

3, goal gene mixes with recombinant vectors, adds ligase enzyme, and corresponding two kinds of restriction endonuclease are carried out the orientation connection.At first under enzyme is cut optimum temperuture, carrier is cut, under the connection optimum temperuture, carry out non-directional afterwards and connect, under enzyme is cut optimum temperuture, cut screening at last.The reaction also can carry out at same temperature condition, preferably the former.

The present invention is that the working method of carrying out on original recombinant technology basis is improved, and the user need not change original operating habit, adapts to easily.Operation steps is simple, but the commercialization production of linear fragment and directed recombinase system, and the user generally can directly carry out orientation connection after by gene amplification.Operational cycle is short, comprises the PCR process interior, generally can finish whole operations in a working days.The employed toolenzyme of this technology is the common tool enzyme, and the market price is lower, and the needed primer of system is shorter by 1/4 to 1/3 than conventional primer, and the experiment comprehensive cost can reduce by 50%～60%.

Embodiment

Below with chitinase gene as goal gene, directed cloning enters pUC19 or the pUC18 carrier is that example is specifically described technology. and toolenzyme of selecting for use in the experimentation and nucleic acid extraction kit test kit are respectively precious biotech firm in Dalian or sky, Beijing root company product, and the concrete operations step is referring to the description of product of associated companies. and the user also can select other company's products to replace.

The multiple clone site of pUC19 is as follows: 5 '- CTGCAGGTCGACTCTAGAG GATCC-3 '

The multiple clone site of pUC18 is as follows: 5 '- GGATCCTCTAGAGTCGACCTGCAGGCATGC AAGCTT-3 '

A kind of gene order of chitinase is: ATGCGCAAATTTAATAAA......AGCGCCGGCGTTCAATAA

Specific embodiments one TA connects the directed cloning technology

The preparation of 1 directed recombinant vectors

Add 1 microgram pUC19 plasmid DNA in the reaction system, an amount of restriction enzyme PstI (identification preface CTGCAG, residual 4 bases are held in cutting back 3 ') and BamH I (recognition sequence is GGATCC, and cutting back 5 ' end participates in 4 free bases), carry out double digestion according to the toolenzyme way of recommendation.

1% agarose gel electrophoresis, gel reclaims test kit and reclaims linear carrier segments

Utilize exonuclease I to scabble single-chain fragment according to the toolenzyme suggested design

Utilize the TdT enzyme to introduce the T base at 3 ' end according to the toolenzyme way of recommendation

Utilizing the CIAP Phosphoric acid esterase to carry out dephosphorylation according to the toolenzyme way of recommendation handles

The clone of 2 directed goal gene

Design of primers upstream ATGCGCAAATTTAATAAA

Downstream GCAGTTATTGAACGCCGG

* add boldface type and partly be the half-selected bit point

Takara Ex Taq archaeal dna polymerase is selected in gene amplification for use, increases according to the test kit way of recommendation

Agarose gel electrophoresis utilizes sepharose nucleic acid to reclaim test kit and reclaims goal gene

3 directed connections

Get 3 microlitre linear carrier fragments, add 3 microlitre PCR products and mix, add the directed ligase enzyme system that forms by T4 dna ligase and PstI, room temperature preservation 20 minutes, 37 degrees centigrade are incubated 30 minutes.Cryopreservation.

Specific embodiments two TA connect directed cloning

The preparation method of 1 directed recombinant vectors is with scheme one

2 directed goal gene clone modes are with scheme one

3 non-directionals connect

Get 3 microlitre linear carrier fragments, add 3 microlitre PCR products and mix, add by the T4DNA ligase enzyme and connect acquisition non-directional recombinant plasmid according to the way of recommendation.

4 transformation and selection cells

Conversion is the PstI expression strain of carrier with pET28a, adds final concentration and be about 0.5% (w/v%) lactose in conventional microbiotic LB screening flat board, induces the restriction enzyme expression of enzymes, directly forward is connected product and carries out the cloning screening.

Specific embodiments three smooth end are directed to be connected

The preparation of 1 directed recombinant vectors

Add 1 microgram pUC18 plasmid DNA in the reaction system, carry out double digestion according to the toolenzyme operation instructions with BamH I and Hind III (recognition sequence is AAGCTT, and enzyme is cut residual 4 bases of back 5 ' end)

1% agarose gel electrophoresis, sepharose nucleic acid reclaims test kit and reclaims linear carrier segments

Utilize the Klenow enzyme to mend flat single-chain fragment according to the toolenzyme operation instructions

Utilizing the CIAP Phosphoric acid esterase according to operation instructions carrier to be carried out dephosphorylation handles

The clone of 2 directed goal gene

Design of primers upstream TATGCGCAAATTTAATA

Downstream CTTTATTGAACGCCGG

* add boldface type and partly be the half-selected bit point

Gene amplification selects for use Takara pyrobest archaeal dna polymerase to increase according to the test kit way of recommendation.

Agarose gel electrophoresis, sepharose nucleic acid reclaims test kit and reclaims goal gene

3 directed connections

Get 3 microlitre linear carrier fragments, add 3 microlitre PCR products and mix, add, the directed ligase enzyme system that BamH I and Hind III form, room temperature preservation 20 minutes, 37 degrees centigrade of insulations 30 minutes by the T4DNA ligase enzyme.Cryopreservation.

Specific embodiments 4 is simplified clone technology

The preparation of 1 directed recombinant vectors

Introduce following gene fragment (the italic thickened portion is respectively the restriction enzyme site of smooth end dna ligase EcoR V and HaeIII) between pUC18 plasmid BamH I and Hind III restriction enzyme site, the amplification back is preserved standby.

Introduce fragment: GATATC-TCTAGAGTCGACCTGCAGGCATGC- GGCC

Introduce back state: GGATCC GATATC-TCTAGAGTCGACCTGCAGGCATGC- GGCCAAGCTT

2 goal gene clone

Design of primers upstream CCATGCGCAAATTTAATA

Downstream ATCTTTATTGAACGCCGG

* add boldface type and partly be the half-selected bit point

3 directed connections

Get 3 microlitre circular vectors, add 3 microlitre PCR products and mix, add by the T4DNA ligase enzyme, EcoR V, the common directed ligase enzyme of forming of three kinds of toolenzymes of HaeIII are that 37 degrees centigrade are incubated 1 hour, room temperature preservation 20 minutes, 37 degree insulations 30 minutes.Cryopreservation.

Claims

1 the present invention relates to a kind of new qualitative gene recombination technology of biological technical field, and by directed recombinant vectors, directed goal gene constitutes with the directed mixture that is connected.

2 directed gene recombination technologies according to claim 1 is characterized in that: two kinds of directed recombinant vectorss all derive from plasmid, clay, phage or virus vector.Wherein a kind of directed recombinant vectors has the sticky end or the smooth end that can be connected with goal gene, and wherein a side or both-side ends contain seminase and cut the site, and can form one or two complete restriction enzyme sites after goal gene oppositely is connected.Another directed recombinant vectors contains one or two restriction enzyme sites, after through the cutting of respective limits restriction endonuclease can with the complete restriction endonuclease restriction enzyme site of reverse purpose of connecting genomic constitution.

3 directed gene recombination technologies according to claim 1 is characterized in that: directed goal gene is the product after PCR product or the restriction endonuclease cutting.Directed goal gene both sides are contained one or two seminases and are cut the site, can carry out forward with directed recombinant vectors or oppositely are connected.Two tie points form one or two complete restriction endonuclease endonuclease digestion sites when oppositely connecting, and two tie points can not form corresponding restriction endonuclease restriction enzyme site when forward connects.

4 directed gene recombination technologies according to claim 1 is characterized in that: the directed mixture that connects is united by dna ligase and restriction endonuclease and is constituted.Wherein the complete restriction enzyme site that forms during reverse connect described in the restriction enzyme endonuclease capable specific recognition claim (2) (3) and carry out cutting damage can not be discerned its tie point and forward is connected product, can not constitute destruction to it.It can be the mixture that two class toolenzymes participate in reacting formation simultaneously that orientation connects mixture, also can be to use ligase enzyme earlier the mixture on the function that back use restriction endonuclease forms; Wherein restriction endonuclease also can this toolenzyme itself, also can be the expression strain of this toolenzyme.