CN101538581B - Construction method of complete mycobacterium tuberculosis genome ORF clone library and application thereof - Google Patents
Construction method of complete mycobacterium tuberculosis genome ORF clone library and application thereof Download PDFInfo
- Publication number
- CN101538581B CN101538581B CN2009100610660A CN200910061066A CN101538581B CN 101538581 B CN101538581 B CN 101538581B CN 2009100610660 A CN2009100610660 A CN 2009100610660A CN 200910061066 A CN200910061066 A CN 200910061066A CN 101538581 B CN101538581 B CN 101538581B
- Authority
- CN
- China
- Prior art keywords
- ptrg
- mcm
- mycobacterium tuberculosis
- carrier
- xbai
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to the technical field of microbial genetic engineering, specifically relates to a construction method of a complete mycobacterium tuberculosis H37Rv genome ORF bacterial two-hybrid clone library and application thereof. The construction method is characterized by comprising the following steps: preparing a bacterial two-hybrid carrier pTRG-MCM delta suitable for constructing the complete mycobacterium tuberculosis H37Rv genome ORF clone library; obtaining all encoded genes of the mycobacterium tuberculosis H37Rv by a PCR reaction; accurately cloning all encoded genes of the mycobacterium tuberculosis H37Rv into the constructed bacterial two-hybrid carrier pTRG-MCM delta; and transforming Escherichia coli DH10B to obtain the complete mycobacterium tuberculosis H37Rv genome ORF bacterial two-hybrid clone library.
Description
Technical field
The invention belongs to technical field of microbial genetic engineering.Be specifically related to a kind of method and application that makes up complete mycobacterium tuberculosis genome ORF clone library.
Background technology
Tuberculosis is a kind of global transmissible disease that is caused by mycobacterium tuberculosis, also be that single pathogenic infection causes the highest disease of mortality ratio, the annual newly-increased tuberculosis patient 800 in the present whole world～1,000 ten thousand, about 2,000,000 (World Health Organization (2008) the WHO Report 2008 Global Tuberculosis Control.) of annual death toll, it is one of transmissible disease of global emphasis control.
Interact between the protein and be the person that mainly do not finish of cell basic function by the albumen composition that interaction forms.Nearly all important vital movement comprises dna replication dna and transcribes, proteinic synthetic and secretion, signal transduction and metabolism or the like, all be unable to do without the interaction between the protein, and Mycobacterium tuberculosis is no exception.So the interaction of systematically studying between the protein-protein of Mycobacterium tuberculosis not only can provide foundation for the relation of the physiological activity between the overall understanding mycobacterium tuberculosis protein matter; The more important thing is,, seek the research and development of drug targets and antitubercular agent and provide fundamental basis for disclosing pathogenesis lungy.
The method of research protein-protein interaction is existing a lot, as line crystalline diffraction, surface plasma resonance, co-immunoprecipitation, crosslinking technological, protein probe, phage display, double cross technology etc.Bacterium double cross technology (Dove, S.L., and Hochschild, A. (2004) A bacterialtwo-hybrid system based on transcription activation.Methods Mol Biol 261:231-246.) be a kind of interactional molecular biological strong instrument between the protein of studying in the body that is used for.The principle of bacterium double cross is: in intestinal bacteria, if one in interactional albumen combines with DNA in conjunction with the territory by DNA, another one combines with the subunit of bacteria RNA polysaccharase (RNAP), so if its interaction have enough intensity just can activated transcription.Therefore, if " bait (Bait) " and the conjugated protein fusion of sequence-specific DNA, and " target (prey) " and the subunit of bacteria RNA P are merged, " bait " and the interaction of " target " just can be enlisted RNAP at the promotor place and firm its combines so, activate (the Dove that transcribes of reporter gene, S.L., Deng, (1997) Activation of prokaryotic transcriptionthrough arbitrary protein-protein contacts.Nature 386:627-630.).In this system, the conjugated protein lambda particles phage inhibitor (λ cI) that is generally of DNA, and RNAP subunit is generally the α subunit, reporter gene can be the bla and the beta galactosidase enzyme lacZ gene of acyl ammonia enzyme in the coding β, also can be HIS3 gene and the streptomycin resistance gene aadA that participates in the Histidine biosynthetic pathway, but the latter have the ability (～10 in the bigger library of screening
8More than) and lower false positive rate (～3 * 10
-8).In recent years, bacterium double cross technology has been applied to pathogenic micro-organism gene product function and mechanism of causing a disease research (Malek, J.A., et al, (2004) Protein interaction mapping on a functional shotgun sequence ofRickettsia sibirica.Nucleic Acids Res 32:1059-1064.).
At present, existing reported in literature has been found the interaction (Baulard between some protein-proteins in the mycobacterium tuberculosis by bacterium double cross method for screening, A.R. etc., (2003) In vivo interaction between the polyprenol phosphate mannose synthase Ppmland the integral membra
Summary of the invention
The objective of the invention is to make up the bacterium double cross clone library of the full genome ORF of a kind of mycobacterium tuberculosis H37Rv, utilize this library to carry out bacterium double cross screening, be used to study the interaction between the mycobacterium tuberculosis protein matter, for disclosing pathogenesis lungy, the research and development of seeking drug targets and antitubercular agent provide experimental basis and method.
Technical scheme of the present invention is as follows:
In order to realize the present invention, the applicant has transformed one and has been applicable to the bacterium double cross cloning vector pTRG-MCM Δ that makes up the full genome ORF of mycobacterium tuberculosis H37Rv, utilize the whole encoding genes of PCR method amplification mycobacterium tuberculosis H37Rv, and whole encoding genes are cloned into bacterium double cross cloning vector pTRG-MCM Δ, be transformed in the intestinal bacteria DH10B host cell the final bacterium double cross clone library that obtains complete mycobacterium tuberculosis H37Rv that makes up.Utilize this library to carry out preliminary bacterium double cross screening, The selection result has proved that this library can be used to study the interaction between the mycobacterium tuberculosis H37Rv protein-protein effectively.
Step of the present invention is:
1) amplification of the whole encoding genes of mycobacterium tuberculosis H37Rv
Mycobacterium tuberculosis H37Rv genome sequence (the GenBank accession number: AL123456) that provides according to GenBank, restriction enzyme site to whole encoding genes inside is analyzed, the restriction enzyme site when selecting restriction enzyme site that all encoding gene inside do not have as design of primers.When the design primer, all genes are divided into six classes, the first five genoid is introduced EcoRI and XbaI, NotI and XbaI, EcoRI and XhoI, NotI and XhoI, BamHI and XhoI respectively in upstream primer and downstream primer, the 6th class adopts the method for connecting joint to introduce the EcoRI restriction enzyme site in joint, in downstream primer, introduce the XbaI enzyme cutting site, utilize polymerase chain reaction (PCR) that whole encoding genes are increased.Utilize this method whole encoding genes of mycobacterium tuberculosis H37Rv that just can increase.
2) make up bacterium double cross cloning vector pTRG-MCM Δ
(accession number: eliminate in GI:13958039) last 211 XbaI enzyme cutting site, and keep 1076 XbaI enzyme cutting site, obtains an intermediate carrier pTRG-XbaI Δ with purchasing bacterium double cross carrier pTRG in invitrogen company.Introducing extreme hyperthermophilic archaeon strain S.solfataricus minichromosome in multiple clone site keeps gene M CM gene (accession number: GI:15897676) gene fragment, its length is 2061bp.We are with recombinant plasmid called after pTRG-MCM.Because at two BamHI restriction enzyme enzyme recognition sites of the inner existence of MCM gene, they have influenced the application of carrier, so the pTRG-MCM plasmid is cut with the abundant enzyme of BamHI, form the linear fragment of 844 bases of disappearance, subsequently this fragment is formed the pTRG-MCM Δ from concatemerization after further scabbling processing, its nucleotide sequence is shown in sequence table SEQ ID NO:1.
3) mycobacterium tuberculosis H37Rv bacterium double cross library construction
The whole encoding genes of mycobacterium tuberculosis H37Rv that step 1) obtains accurately are cloned into step 2) in the bacterium double cross carrier pTRG-MCM Δ, transformed into escherichia coli DH10B obtains the bacterium double cross clone library of the full genome ORF of mycobacterium tuberculosis H37Rv.
More detailed technical scheme and application thereof are described referring to " embodiment ".
Description of drawings
Sequence table SEQ ID NO:1 is the nucleotide sequence of the bacterium double cross carrier pTRG-MCM Δ for preparing of the present invention;
Fig. 1 techniqueflow chart of the present invention;
The structure schema of Fig. 2 bacterium double cross carrier pTRG-MCM Δ;
The carrier collection of illustrative plates of Fig. 3 bacterium double cross carrier pTRG-MCM Δ;
Electrophorogram behind Fig. 4 part encoding gene pcr amplification;
Fig. 5 divides into groups to mix the PCR product electrophorogram of purifying;
Fig. 6 divides into groups to mix the recombinant plasmid electrophorogram.
Embodiment
Used in an embodiment of the present invention biomaterial and reagent are from following description:
1, bacterial strain and plasmid: the mycobacterium tuberculosis H37Rv bacterial strain of deactivation is so kind as to give by professor Zhou Jinhai of Wuhan mycobacterium tuberculosis institute (Wuhan City, Hubei Province), and intestinal bacteria DH10B purchases the company in invitrogen, bacterium double cross reporting bacterial strain (
Two-hybridreporter strain) and bacterium double cross carrier pBT, pTRG purchase company in stratagene.
2, main agents:
Restriction enzyme, T4 dna ligase, EX Taq polysaccharase, Klenow fragment, Mung Bean Nuclease purchase in precious biotechnology (Dalian) company limited, and dNTP purchases the company in promega.Primer and order-checking are finished by the handsome company in Shanghai.DNA reclaims test kit and purchases the company in BioFlux.
Embodiment 1: the transformation of bacterium double cross pTRG carrier
(accession number: eliminate in GI:13958039) last 211 XbaI enzyme cutting site, keeps 1076 XbaI enzyme cutting site, obtains an intermediate carrier pTRG-XbaI Δ with purchasing bacterium double cross carrier pTRG in invitrogen company.Introducing extreme hyperthermophilic archaeon strain S.solfataricus minichromosome in multiple clone site keeps gene M CM gene (accession number: GI:15897676) gene fragment, length is 2061bp.With recombinant plasmid called after pTRG-MCM.Because at two BamHI restriction enzyme enzyme recognition sites of the inner existence of MCM, they have influenced the application of this carrier when making up clone library, so the pTRG-MCM plasmid is cut with the abundant enzyme of BamHI, form the linear fragment of 844 bases of disappearance, this fragment forms the pTRG-MCM Δ from concatemerization after further scabbling processing subsequently, and its nucleotide sequence is shown in sequence table SEQ ID NO:1.
Specifically also comprise following concrete steps:
1) the pTRG carrier is partially digested with XbaI;
Reaction system:
Carrier: 30 μ l; XbaI:2 μ 1; 10 times of buffer H:5 μ l; 0.1%BSA:5 μ l; DdH
2O:8 μ l.Hatch 3h for 37 ℃.
2) sepharose reclaims the 4.4kb endonuclease bamhi;
3) hatch 20min for 37 ℃ with the Klenow fragment;
Reaction system:
Carrier: 41 μ l; D (CTP+TTP+ATP): 2 μ l; Klenow fragment:2 μ 1; Buffer:5 μ l.
4) reclaim test kit with above-mentioned DNA and reclaim carrier;
5) hatch 10min for 37 ℃ with Mung Bean Nuclease;
Carrier: 43 μ l; Mung Bean Nuclease:2 μ l; Buffer:5 μ l.
6) reclaim test kit with above-mentioned DNA and reclaim carrier;
7) carrier is from connecting;
Carrier: 6 μ l; T4 DNA ligase:1 μ l; Buffer:1 μ l; DdH
2O:2 μ l.
Reaction conditions: 16 ℃ are spent the night.Obtain intermediate carrier pTRG-XbaI Δ.
8) pTRG-XbaI Δ carrier EcoRI and XhoI double digestion;
Reaction system:
Carrier: 30 μ l; EcoRI:1.5 μ l; XhoI:1.5 μ l; 10 * M Buffer:5 μ l; 0.1%BSA:5 μ l; DdH
2O:7 μ l.Reaction
Condition: 37 ℃ of 3h
9) sepharose reclaims carrier;
10) pcr amplification MCM gene fragment;
Reaction system:
10 * Ex Buffer, 5.0 μ l; 2.5mM dNTP 4.0 μ l; Forward primer 2.0 μ l; Reverse primer 2.0 μ l; The total DNA 1.0 μ l of S.so; Ex Taq polysaccharase 0.3 μ l; Mend ddH
2O to 50.0 μ l.
Response procedures:
94 ℃ of 3min; 94 ℃ of 1min, 52 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 72 ℃ of 8min.
The primer of amplification MCM is:
Forward primer: GAGC
GAATTCGTTGGAAATTCCTAGTAAAC (the line part is the EcoRI restriction enzyme site),
Reverse primer: GGATGG
CTCGAGTCTAGACTAGACTTTTTTGTAACAT (the line part is the XhoI restriction enzyme site)
11) MCM gene fragment EcoRI and XhoI double digestion;
Reaction system:
MCM：30μl；EcoRI：1.5μl；XhoI：1.5μl；10×M?Buffer：5μl；0.1％BSA：5μl；ddH
2O：7μl。
Reaction conditions: 37 ℃ of 3h
12) the intermediate carrier pTRG-XbaI Δ behind the double digestion is connected with MCM;
Reaction system:
pTRG：3μl；MCM：3μl；T4DNA?ligase：1μl；Buffer：1μl；ddH
2O：2μl。
Reaction conditions: 16 ℃ of connections are spent the night.Obtain intermediate carrier pTRG-MCM.
13) intermediate carrier pTRG-MCM cuts with the abundant enzyme of BamHI;
14) the intermediate carrier pTRG-MCM end of cutting with the abundant enzyme of BamHI scabbles and connects certainly, obtains bacterium double cross carrier pTRG-MCM Δ, and its size is 5592bp.
The structure schema of bacterium double cross carrier pTRG-MCM Δ is seen Fig. 2, and the carrier collection of illustrative plates of pTRG-MCM Δ is seen Fig. 3,
PTRG-MCM Δ carrier sequence is seen sequence table SEQ ID NO:1.
Embodiment 2: the amplification of the full genome ORF of mycobacterium tuberculosis H37Rv
Mycobacterium tuberculosis H37Rv genome sequence (the GenBank accession number: AL123456) that provides according to GenBank, restriction enzyme site to whole encoding genes inside is analyzed, the restriction enzyme site when selecting restriction enzyme site that all encoding gene inside do not have as design of primers.When the design primer, all genes are divided into six classes, the first five genoid is introduced EcoRI and XbaI, NotI and XbaI, EcoRI and XhoI, NotI and XhoI, BamHI and XhoI restriction enzyme site respectively in upstream primer and downstream primer, the 6th class adopts the method for connecting joint to introduce the EcoRI restriction enzyme site in joint, introduces the XbaI enzyme cutting site in downstream primer.Utilize this primer design method whole encoding genes of mycobacterium tuberculosis H37Rv that just can increase.
Be exemplified below:
The Rv0001 sequence of announcing according to NCBI (accession number: GI:15607143) design primer:
Rv0001f ATAA
GCGGCCGCA TTGACCGATGACCCCGGTTC (the line part is the NotI restriction enzyme site)
Rv0001r CGACG
TCTAGAGG CTAGCGCTTGGAGCGCTGAC (the line part is the XbaI enzyme cutting site)
The Rv0002 sequence of announcing according to NCBI (accession number: GI:15607144) design primer:
Rv0002f ATAA
GAATTCGG ATGGACGCGGCTACGACAAG (the line part is the EcoRI restriction enzyme site)
Rv0002r ATAA
TCTAGAAT TCAGCCCGGCAACCGAACCG (the line part is the XbaI enzyme cutting site)
The Rv0221 sequence of announcing according to NCBI (accession number: GI:1871594) design primer:
Rv0221f ATAA
GGATCCGA GTGAAACGGCTCAGCGGCTG (the line part is the BamHI restriction enzyme site)
Rv0221r ATAA
CTCGAGAA TCATGCCTGCGCCATCGCGG (the line part is the XhoI restriction enzyme site)
The Rv0104 sequence of announcing according to NCBI (accession number: GI:15607246) design primer:
Rv0104f ATAA
GAATTCAA GTGACGCCCGTCACAACGTT (the line part is the EcoRI restriction enzyme site)
Rv0104r ATAA
CTCGAGGG TTACACCATCAAGGACTCGG (the line part is the XhoI restriction enzyme site)
The Rv0469 sequence of announcing according to NCBI (accession number: GI:57116735) design primer:
Rv0469f ACAA
GCGGCCGCAG ATGACTGAGTTAAGGCTT (the line part is the NotI restriction enzyme site)
Rv0469r ATAA
CTCGAGAA CTACTTGGTCAGTGTGAACT (the line part is the XhoI restriction enzyme site)
With MTB H37Rv genomic dna is template, and the PCR reaction conditions is 96 ℃ of 5min; 96 ℃ of 1min; 60 ℃ of 1min; 72 ℃ of 3min, 30 circulations; 72 ℃ of 7min.
Reaction system is:
2 * GC Buffer I, 25 μ l; 2.5mM dNTP 8 μ l; Upstream primer 1 μ l; Downstream primer 1 μ l; Template 2 μ l;
Ex Taq 0.6 μ l; Add ddH
2O mends to 50 μ l.
Electrophorogram behind the part encoding gene pcr amplification is seen Fig. 4, mixes the gene product electrophorogram of purifying and sees Fig. 5.
Embodiment 3: the structure of the full genome ORF bacterium of mycobacterium tuberculosis H37Rv double cross clone library
The pTRG-MCM Δ carrier that the described gene amplification products that are divided into six classes of embodiment 2 mix respectively with corresponding enzyme is cut combined preparation is connected, and 16 ℃ of connections are spent the night.To connect after the product desalination electricity and be transformed into that (conversion condition: 1800V 4-6mS), obtains greater than 12,000 recombinant clones, and promptly the gene fraction of coverage reaches more than 3 times in the intestinal bacteria DH10B electricity transformed competence colibacillus.To contain bacterial strain (intestinal bacteria DH10B) mixed culture of recombinant clone,, glycerol stock and the plasmid that obtains will be stored in-20 ℃ according to conventional reported method extracting plasmid.Grouping mixes the electrophorogram of recombinant plasmid referring to Fig. 6.
Embodiment 4: the application of the full genome ORF bacterium of mycobacterium tuberculosis H37Rv double cross clone library
With the mixing plasmid transform bacteria double cross reporting bacterial strain of the clone library that obtains in the example 3 (
Two-Hybridreporter strain), prepare electric transformed competence colibacillus.Select interested bait gene, existing with mycobacterium tuberculosis H37Rv gene Rv3874 (accession number: GI:15611010) be the step of example explanation invention.Concrete steps are as follows: Rv3874 is cloned on the double cross pBT carrier recombinant plasmid called after pBT-Rv3874.(conversion condition 1800V 4-6mS) with recombinant plasmid pBT-Rv3874 transformed clone library competence, adds 800 μ l SOB substratum recovery 45 minutes to the method that transforms according to conventional electricity, and being applied to bacterium double cross screening, dull and stereotyped (the screening and culturing based component is formed and seen
Two-hybrid system library construction kit) flat board is inverted in 30 ℃ of incubators and cultivated 3-4 days, can on flat board, see 6 single bacterium colonies.With single colony inoculation (adding final concentration is 30 μ g/ml kantlex, 34 μ g/ml paraxin, 12.5 μ g/ml tsiklomitsins) in the LB liquid nutrient medium, collect the order-checking of bacterium liquid behind 37 ℃ of cultivation 16h.Sequencing result is two genes of Rv3875, Rv3871 through the sequence alignment Analysis and Identification.
Sequence table
＜110〉Hua Zhong Agriculture University
＜120〉a kind of construction process of complete mycobacterium tuberculosis genome ORF clone library and application
<130>
<141>2009-03-11
<160>1
<170>PatentIn?version?3.1
<210>1
<211>5592
<212>DNA
＜213〉intestinal bacteria (Escherichia coli)
<220>
<221>gene
<222>(1)..(5592)
<223>
<400>1
gaattgagcg?aacgtcaaaa?ataagtgcct?tcccatcaaa?aaaatattga?caacataaaa 60
aactttgtgt?tatacttgta?acgctacatg?gagattaact?caatctagct?agagaggctt 120
tacactttat?gcttccggct?cgtataatgt?gtggaattgt?gagcggataa?caatttcaca 180
caggaaacag?ctatgaccat?gattacggat?tcactggaac?tctaaccaaa?gagaggacac 240
aatgcagggt?tctgtgacag?agtttctaaa?accgcgcctg?gttgatatcg?agcaagtgag 300
ttcgacgcac?gccaaggtga?cccttgagcc?tttagagcgt?ggctttggcc?atactctggg 360
taacgcactg?cgccgtattc?tgctctcatc?gatgccgggt?tgcgcggtga?ccgaggttga 420
gattgatggt?gtactacatg?agtacagcac?caaagaaggc?gttcaggaag?atatcctgga 480
aatcctgctc?aacctgaaag?ggctggcggt?gagagttcag?ggcaaagatg?aagttattct 540
taccttgaat?aaatctggca?ttggccctgt?gactgcagcc?gatatcaccc?acgacggtga 600
tgtcgaaatc?gtcaagccgc?agcacgtgat?ctgccacctg?accgatgaga?acgcgtctat 660
tagcatgcgt?atcaaagttc?agcgcggtcg?tggttatgtg?ccggcttcta?cccgagttca 720
ttcggaagaa?gatgagcgcc?caatcggccg?tctgctggtc?gacgcatgct?acagccctgt 780
ggagcgtatt?gcctacaatg?ttgaagcagc?gcgtgtagaa?cagcgtaccg?acctggacaa 840
gctggtcatc?gaaatggaaa?ccaacggcac?aatcgatcct?gaagaggcga?ttcgtcgtgc 900
ggcaaccatt?ctggctgaac?aactggaagc?tttcgttgac?ttacgtgatg?tacgtcagcc 960
tgaagtgaaa?gaagagaaac?cagaggcggc?cggatccgcg?gccgcaagaa?ttcatttgga 1020
aattcctagt?aaacagattg?actatagaga?cgtatttata?gagtttctga?caactttcaa 1080
gggtaacaat?aatcaaaaca?aatatatcga?gaggataaac?gagctagtag?cgtataggaa 1140
aaaaagtctt?ataatagaat?tttctgatgt?actttcgttc?aatgaaaatt?tggcttatga 1200
gataataaat?aataccaaaa?ttattctacc?aattctggaa?ggtgcattgt?atgatcatat 1260
cttgcaattg?cacagctgca?ggtttaacag?ctgctgtagt?aagagaaaag?ggaactggag 1320
agtattactt?agaagctggt?gcgttagtac?ttgctgatgg?tggaatagca?gttattgatg 1380
aaatagacaa?gatgagggat?gaagatagag?tagaccattc?atgaggcaat?ggaacaacag 1440
acagtctcaa?tagcaaaagc?tggaatagta?gctaaattaa?acgctagggc?tgcagttata 1500
gctgcaggga?atccgaaatt?cgggagatac?ataagtgaaa?gaccagtgtc?tgataatatc 1560
aacctacctc?caacaatctt?gtcaagattt?gacctaatat?ttatactaaa?ggatcaacca 1620
ggtgaacaag?atagagaact?tgcgaattac?atattagatg?tacattcagg?aaaatccaca 1680
aaaaatatta?tagatataga?tacattaaga?aaatatatag?catatgcaag?gaaatacgtt 1740
acaccaaaaa?ttactagtga?ggctaagaat?ctgattacag?atttcttcgt?agaaatgagg 1800
aagaaaagct?cagaaacacc?tgatagccca?atattgataa?ctccaagaca?attagaggct 1860
ttaataagaa?tttcagaagc?ctatgccaag?atggctctta?aggctgaagt?cactagagaa 1920
gatgcagaaa?gagcaataaa?tatcatgaga?cttttcctag?agagtgtagg?agttgatatg 1980
gaaagtggaa?aaatagatat?agatacaata?atgactggta?aacctaaaag?cgctagagag 2040
aaaatgatga?aaataataga?aataatagat?agtttagctg?taagttctga?gtgcgcaaaa 2100
gttaaggaca?tactaaaaga?agctcaacaa?gtaggcattg?aaaaaagtaa?tatagaaaaa 2160
ttacttacag?atatgagaaa?gagtggtata?atatatgaag?caaaaccaga?atgttacaaa 2220
aaagtctagc?tcgagtaatt?aattaattaa?tgaactagtg?agatcctcta?agtcgacctg 2280
caggcatgca?agcttggcag?tttatggcgg?gcgacgaatc?aggtggcact?tttcggggaa 2340
atgtgcgcgg?aacccctatt?tgtttatttt?tctaaataca?ttcaaatatg?tatccgctca 2400
tgaccaaaat?cccttaacgt?gagttttcgt?tccactgagc?gtcagacccc?gtagaaaaga 2460
tcaaaggatc?ttcttgagat?cctttttttc?tgcgcgtaat?ctgctgcttg?caaacaaaaa 2520
aaccaccgct?accagcggtg?gtttgtttgc?cggatcaaga?gctaccaact?ctttttccga 2580
aggtaactgg?cttcagcaga?gcgcagatac?caaatactgt?ccttctagtg?tagccgtagt 2640
taggccacca?cttcaagaac?tctgtagcac?cgcctacata?cctcgctctg?ctaatcctgt 2700
taccagtggc?tgctgccagt?ggcgataagt?cgtgtcttac?cgggttggac?tcaagacgat 2760
agttaccgga?taaggcgcag?cggtcgggct?gaacgggggg?ttcgtgcaca?cagcccagct 2820
tggagcgaac?gacctacacc?gaactgagat?acctacagcg?tgagctatga?gaaagcgcca 2880
cgcttcccga?agggagaaag?gcggacaggt?atccggtaag?cggcagggtc?ggaacaggag 2940
agcgcacgag?ggagcttcca?gggggaaacg?cctggtatct?ttatagtcct?gtcgggtttc 3000
gccacctctg?acttgagcgt?cgatttttgt?gatgctcgtc?aggggggcgg?agcctatgga 3060
aaaacgccag?caacgcggcc?tttttacggt?tcctggcctt?ttgctggcct?tttgctcaca 3120
tgttctttcc?tgcgttatcc?cctgattctg?tggataaccg?tattaccgcc?tttgagtgag 3180
ctgataccgc?tcgccgcagc?cgaacgaccg?agcgcagcga?gtcagtgagc?gaggaagcgg 3240
aagagcgcct?gatgcggtat?tttctcctta?cgcatctgtg?cggtatttca?caccgcatat 3300
ggtgcactct?cagtacaatc?tgctctgatg?ccgcatagtt?aagccagtat?acactccgct 3360
atcgctacgt?gactgggtca?tggctgcgcc?ccgacacccg?ccaacacccg?ctgacgcgcc 3420
ctgacgggct?tgtctgctcc?cggcatccgc?ttacagacaa?gctgtgaccg?tctccgggag 3480
ctgcatgtgt?cagaggtttt?caccgtcatc?accgaaacgc?gcgaggcagc?tgcggtaaag 3540
ctcatcagcg?tggtcgtgaa?gcgattcaca?gatgtctgcc?tgttcatccg?cgtccagctc 3600
gttgagtttc?tccagaagcg?ttaatgtctg?gcttctgata?aagcgggcca?tgttaagggc 3660
ggttttttcc?tgtttggtca?ctgatgcctc?cgtgtaaggg?ggatttctgt?tcatgggggt 3720
aatgataccg?atgaaacgag?agaggatgct?cacgatacgg?gttactgatg?atgaacatgc 3780
ccggttactg?gaacgttgtg?agggtaaaca?actggcggta?tggatgcggc?gggaccagag 3840
aaaaatcact?cagggtcaat?gccagcgctt?cgttaataca?gatgtaggtg?ttccacaggg 3900
tagccagcag?catcctgcga?tgcagatccg?gaacataatg?gtgcagggcg?ctgacttccg 3960
cgtttccaga?ctttacgaaa?cacggaaacc?gaagaccatt?catgttgttg?ctcaggtcgc 4020
agacgttttg?cagcagcagt?cgcttcacgt?tcgctcgcgt?atcggtgatt?cattctgcta 4080
accagtaagg?caaccccgcc?agcctagccg?ggtcctcaac?gacaggagca?cgatcatgcg 4140
cacccgtggc?caggacccaa?cgctgcccga?gatgcgccgc?gtgcggctgc?tggagatggc 4200
ggacgcgatg?gatatgttct?gccaagggtt?ggtttgcgca?ttcacagttc?tccgcaagaa 4260
ttgattggct?ccaattcttg?gagtggtgaa?tccgttagcg?aggtgccgcc?ggcttccatt 4320
caggtcgagg?tggcccggct?ccatgcaccg?cgacgcaacg?cggggaggca?gacaaggtat 4380
agggcggcgc?ctacaatcca?tgccaacccg?ttccatgtgc?tcgccgaggc?ggcataaatc 4440
gccgtgacga?tcagcggtcc?aatgatcgaa?gttaggctgg?taagagccgc?gagcgatcct 4500
tgaagctgtc?cctgatggtc?gtcatctacc?tgcctggaca?gcatggcctg?caacgcgggc 4560
atcccgatgc?cgccggaagc?gagaagaatc?ataatgggga?aggccatcca?gcctcgcgtc 4620
gcgaacgcca?gcaagacgta?gcccagcgcg?tcggccgcca?tgccggcgat?aatggcctgc 4680
ttctcgccga?aacgtttggt?ggcgggacca?gtgacgaagg?cttgagcgag?ggcgtgcaag 4740
attccgaata?ccgcaagcga?caggccgatc?atcgtcgcgc?tccagcgaaa?gcggtcctcg 4800
ccgaaaatga?cccagagcgc?tgccggcacc?tgtcctacga?gttgcatgat?aaagaagaca 4860
gtcataagtg?cggcgacgat?agtcatgccc?cgcgcccacc?ggaaggagct?gactgggttg 4920
aaggctctca?agggcatggg?tcggcgctct?cccttatgcg?actcctgcat?taggaagcag 4980
cccagtagta?ggttgaggcc?gttgagcacc?gccgccgcaa?ggaatggtgc?atgtaaggag 5040
atggcgccca?acagtccccc?ggccacgggg?cctgccacca?tacccacgcc?gaaacaagcg 5100
ctcatgagcc?cgaagtggcg?agcccgatct?tccccatcgg?tgatgtcggc?gatataggcg 5160
ccagcaaccg?cacctgtggc?gccggtgatg?ccggccacga?tgcgtccggc?gtagagaatc 5220
cacaggacgg?gtgtggtcgc?catgatcgcg?tagtcgatag?tggctccaag?tagcgaagcg 5280
agcaggactg?ggcggcggcc?aaagcggtcg?gacagtgctc?cgagaacggg?tgcgcataga 5340
aattgcatca?acgcatatag?cgctagcagc?acgccatagt?gactggcgat?gctgtcggaa 5400
tggacgatat?cccgcaagag?gcccggcagt?accggcataa?ccaagcctat?gcctacagca 5460
tccagggtga?cggtgccgag?gatgacgatg?agcgcattgt?tagatttcat?acacggtgcc 5520
tgactgcgtt?agcaatttaa?ctgtgataaa?ctaccgcatt?aaagctaatc?gatgataagc 5580
tgtcaaacat?ga 5592
Claims (2)
1. bacterium double cross carrier pTRG-MCM Δ that is used to make up the full genome ORF clone library of mycobacterium tuberculosis H37Rv is characterized in that it obtains by following steps:
1) will purchase in the XbaI enzyme cutting site elimination in last 211 sites of bacterium double cross carrier pTRG of invitrogen company: with XbaI the pTRG carrier is carried out enzyme earlier and cut, 5 ' the end of enzyme being cut the back linear carrier with the Klenow fragment is mended flat again, and with linear carrier from concatemerization, thereby eliminate in the XbaI enzyme cutting site that 211 sites are complete, obtains an intermediate carrier pTRG-XbaI Δ;
2) the intermediate carrier pTRG-XbaI Δ that step 1) is obtained digests with restriction enzyme EcoRI and XhoI;
3) utilize the minichromosome of extreme hyperthermophilic archaeon strain S.solfataricus to keep gene M CM as a media gene, the method by PCR obtains the MCM media gene that two ends contain EcoRI and XhoI restriction enzyme site respectively;
4) the MCM media gene that step 3) is obtained digests with restriction enzyme EcoRI and XhoI;
5) with step 2) the MCM media gene that obtains of the intermediate carrier pTRG-XbaI Δ that obtains and step 4) is connected under 16 ℃ condition and spends the night, and obtains intermediate carrier pTRG-MCM;
6) the intermediate carrier pTRG-MCM that step 5) is obtained cuts with the abundant enzyme of restriction enzyme BamHI;
7) the intermediate carrier pTRG-MCM end after the step 6) enzyme is cut scabbles and connects certainly, obtains the bacterium double cross carrier pTRG-MCM Δ transformed, and its size is 5592bp, and its nucleotide sequence is shown in sequence table SEQ ID NO:1.
Wherein, it is as follows that step 3) is utilized the right sequence of the primer of MCM gene of pcr amplification:
Forward primer: GAGCGAATTCGTTGGAAATTCCTAGTAAAC;
Reverse primer: GGATGGCTCGAGTCTAGACTAGACTTTTTTGTAACAT.
2. method that makes up the full genome ORF clone library of mycobacterium tuberculosis H37Rv is characterized in that step is as follows:
1) utilize PCR method to obtain whole encoding genes of mycobacterium tuberculosis H37Rv: the restriction enzyme site to the whole encoding genes of mycobacterium tuberculosis H37Rv inside is analyzed, restriction enzyme site when selecting restriction enzyme site that all encoding gene inside do not have as design of primers, when the design primer, all genes are divided into six classes, the first five genoid is introduced EcoRI and XbaI respectively in upstream primer and downstream primer, NotI and XbaI, EcoRI and XhoI, NotI and XhoI, BamHI and XhoI, the 6th class adopts the method for connecting joint to introduce the EcoRI restriction enzyme site in joint, in downstream primer, introduce the XbaI enzyme cutting site, utilize PCR that whole encoding genes are increased, utilize the whole encoding genes of PCR method amplification mycobacterium tuberculosis H37Rv of this design of primers;
2) gene amplification product that will be divided into six classes mixes, be connected with the pTRG-MCM Δ carrier that corresponding enzyme is cut combined preparation respectively, will connect the product desalination after electricity be transformed into intestinal bacteria DH10B, obtain recombinant clone, to contain the intestinal bacteria mixed culture of recombinant clone, obtain recombinant plasmid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100610660A CN101538581B (en) | 2009-03-11 | 2009-03-11 | Construction method of complete mycobacterium tuberculosis genome ORF clone library and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100610660A CN101538581B (en) | 2009-03-11 | 2009-03-11 | Construction method of complete mycobacterium tuberculosis genome ORF clone library and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101538581A CN101538581A (en) | 2009-09-23 |
| CN101538581B true CN101538581B (en) | 2011-10-12 |
Family
ID=41121968
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100610660A Expired - Fee Related CN101538581B (en) | 2009-03-11 | 2009-03-11 | Construction method of complete mycobacterium tuberculosis genome ORF clone library and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101538581B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504677B (en) * | 2018-03-06 | 2020-05-12 | 上海晶诺生物科技有限公司 | Recombinant TM4 phage library for constructing glutamic acid gene family deletion mycobacterium tuberculosis and application thereof |
| CN111549152A (en) * | 2020-05-08 | 2020-08-18 | 南京实践医学检验有限公司 | Kit and detection method for rapidly enriching mycobacterium tuberculosis in cerebrospinal fluid |
| CN114842911B (en) * | 2022-06-21 | 2022-09-20 | 深圳市睿法生物科技有限公司 | Gene detection process optimization method and device based on precise medical treatment |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997024451A2 (en) * | 1995-12-29 | 1997-07-10 | Estonian Biocentre | Episomal vector and uses thereof |
-
2009
- 2009-03-11 CN CN2009100610660A patent/CN101538581B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997024451A2 (en) * | 1995-12-29 | 1997-07-10 | Estonian Biocentre | Episomal vector and uses thereof |
Non-Patent Citations (4)
| Title |
|---|
| Roland Brosch et al.Use of Myobacterium tuberculosis H37Rv bacterial artificial chromosome library for genome mapping，sequencing，and comparative genomics.《Infect Immun》.1998,第66卷(第5期),全文. * |
| Ruth A.McAdam et al.Characterization of a mycobacterium tuberculosis H37Rv transposon library reveals insertions in 351 ORFs and mutants with altered virulence.《Molecular Genetics and Immunobiology of Myobacteria》.2002,第148卷全文. * |
| 张宗德等.结核分枝杆菌毒力标准株H37Rv基因组文库的构建.《中国防痨协会全国学术会议大会学术报告》.2001,全文. * |
| 蔡宏等.牛结核分枝杆菌基因文库的构建.《中国预防兽医学报》.1999,第21卷(第2期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101538581A (en) | 2009-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106834341A (en) | A kind of site-directed point mutation carrier and its construction method and application | |
| CN109971778B (en) | Vector combination for rapid gene editing in halomonas and application thereof | |
| KR20140101890A (en) | Biotechnological production of 3-hydroxyisobutyric acid | |
| CN110004182B (en) | Preparation method and application of large-particle inclusion in microbial cell | |
| CN101538581B (en) | Construction method of complete mycobacterium tuberculosis genome ORF clone library and application thereof | |
| KR101735632B1 (en) | Expression vector for cyanobacteria | |
| CN115044598B (en) | Efficient preparation method of bacterial ghost of enterobacteriaceae | |
| CN101781657A (en) | Recombined bacillus subtilis secretion type expression vector | |
| KR102242467B1 (en) | Modified cyanobacterial gene expression system | |
| CN114181921B (en) | Rhodopseudomonas palustris 5-aminoacetylpropionate synthetase mutant and application thereof | |
| CN114656546B (en) | Parthenogenesis haploid induction gene and application thereof | |
| CN111321162B (en) | Plasmid system and method for comprehensively representing strength of escherichia coli terminator | |
| KR101750293B1 (en) | Transformed synechococcus elongatus having capability of producing acetone from carbon dioxide | |
| CN113999317B (en) | Fusion gene for stimulating body to resist African swine fever infection and encoding protein and application thereof | |
| CN107365779A (en) | Utilize the method for corynebacterium glutamicum production violacein | |
| CN114686411B (en) | Mixture of engineering bacteria, kit for sensing and adsorbing heavy metal pollutants and treatment method | |
| KR101743018B1 (en) | Transformed synechococcus elongates having capability of producing biodiesel from carbon dioxide and method for producing biodiesel using the same | |
| CN101148662B (en) | Heterogenous expression and purifying method for human AIDS virus auxiliary receptor CCR5 | |
| CN112575020B (en) | Salt-tolerant synechococcus gene engineering bacterium capable of biologically synthesizing glycerol glucoside and construction method | |
| KR101789522B1 (en) | Transformed synechococcus elongates having capability of squalene from carbon dioxide and method for producing squalene using the same | |
| CN114085861B (en) | Arginine decarboxylase producing strain and construction method thereof | |
| CN113527455B (en) | Seed development related protein TaGSR1 and application thereof in wheat strain type breeding | |
| CN101962688B (en) | Specific primer used for identifying nanobacteria and application thereof | |
| CN114015711B (en) | Recombinant protein for inhibiting aeromonas veronii infection, and preparation method and application thereof | |
| KR102286791B1 (en) | Recombinant strains expressing fusion protein which fragment of SrbA protein and golgi resident protein fused and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111012 Termination date: 20200311 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |