CN101525655A - Method for testing susceptibility of ankylosing spondylitis and kit - Google Patents

Abstract

The invention discloses a method for testing susceptibility of ankylosing spondylitis. The method comprises the following steps that: a TAPI gene or a transcript of an individual is detected and compared with a normal TAPI gene or a normal transcript; and simultaneously, an LMP2 gene or the transcript of the individual is detected and compared with a normal LMP2 gene or the normal transcript, wherein the existence of difference shows that the possibility of the individual with ankylosing spondylitis is higher than that of a normal group. The invention also discloses a corresponding detection kit.

Description

Method for testing susceptibility of ankylosing spondylitis and test kit

Technical field

The present invention relates to molecular biology and medical field.Relate more specifically to transporter of antigenic peptides 1 (Transporter of Antigen Peptides 1, TAP1) and low molecular weight polypeptide 2 (lowmolecular mass polypeptide-2, LMP2) single nucleotide polymorphism (single nucleotidepolymorphism, SNP) and with the dependency of ankylosing spondylitis.The invention still further relates to the method and the test kit that detect these SNP.

Background technology

Ankylosing spondylitis has another name called Bie Hejieliefushi (VonBechterev) disease or Ma-Shi Er Shi (Maritstrumpell) disease, is a kind of chronic, carrying out property, the chronic inflammation disease of axis joint involvement.The main other tissue of articulatio sacroiliaca, joint of vertebral column and vertebra that influences pelvis.Cardinal symptom is a low back pain, vertebra is stiff and range of movement is limited, the X line shows that both sides sacroiliitises (sacroilitis) are its feature.Invade articulatio sacroiliaca earlier because this disease is general, and emphasis involves backbone, finally causes the backbone bony ankylosis, thus domestic and international at present be referred to as more ankylosing spondylitis (Ankglosing Spondytitis, AS).

Ankylosing spondylitis has tangible ethnicity, and sickness rate is widely different in different nationalities.American Indian's sickness rate is the highest, and Flat head's sickness rate is 2.7%～6.3%.Secondly be white people, sickness rate is 0.1%～1.4% among the white people.The yellow is lower than white people, and China is about 0.3%.And Black people's sickness rate is minimum, is about white man's 1/4, only is 0.2% in Africa.

Ankylosing spondylitis is sent out well in 20 to 40 years old grownup, especially 20～30 years old young man.

Ankylosing spondylitis is autosomal dominant inheritance, tangible familial inheritance tendency is arranged, inherited genetic factors＞90%.According to investigations, about ankylosing spondylitis patient relatives sickness rate doubled than common people, risk of recurrence ratio born of the same parents was 82.Patient AS more than 90% has the HLA-B27 positive, and positive rate is 8% in normal population; The children HLA-B27 positive accounts for 50%, and what ankylosing spondylitis took place accounts for 25%.Basically existing at present final conclusion, HLA-B27 conduct independently Disease-causing gene is worked in the morbidity of AS.Because have only 1%～5% to develop into AS in the HLA-B27 positive individuals, prompting also has other genes to participate in the morbidity of AS.

In recent years, the extensive utilization in multigenic disease research of single nucleotide polymorphism (SNP) and haplotype (haplotype) notion is for the generation of research ankylosing spondylitis and the mechanism of development on molecular level have been opened up brand-new thinking.Simultaneously, high-throughput, the continuous appearance of SNP detection means cheaply also provide possibility for the extensive fast typing of SNP.

The existence of SNP whether and gene frequency have the difference of ethnic group and region, this just points out the existence of multigenic disease genetic heterogeneity, promptly same disease or proterties may be that different inherited genetic factorss causes in different crowds.

In addition, this species diversity that the type of SNP and haplotype thereof and frequency exist in the different crowd may with different crowd reactive different closely related to medicine and environmental factors.

Ankylosing spondylitis plays the disease of bigger effect as a kind of inherited genetic factors, and the genetic mechanism of seeking its genes involved and then illustrating the ankylosing spondylitis morbidity has become the focus of present research.

Though have many researchs about range gene polymorphism and ankylosing spondylitis, do not confirm the report of TAP1 gene and ankylosing spondylitis dependency, more do not confirm the report of TAP1 gene SNP of the present invention and ankylosing spondylitis dependency.

In sum, for diagnosing ankylosing spondylitis as early as possible, this area presses for seeks the ankylosing spondylitis tumor susceptibility gene, and exploitation detects the method and the test kit of ankylosing spondylitis.

Summary of the invention

Purpose of the present invention just provides the method and the detection kit of a kind of auxiliary diagnosis (especially early diagnosis) ankylosing spondylitis.

Another object of the present invention provides a kind of method of new treatment ankylosing spondylitis.

In a first aspect of the present invention, provide a kind of vitro detection sample whether to have the method for the single nucleotide polymorphism of transporter of antigenic peptides 1 (TAP1), comprise step:

(a) with the TAP1 gene of TAP1 gene-specific primer amplification sample, obtain first amplified production, and, obtain second amplified production with the increase LMP2 gene of sample of LMP2 gene-specific primer; With

(b) detect whether there is following single nucleotide polymorphism in first amplified production:

366 G → disappearances;

Wherein, the nucleotide position numbering is based on SEQ ID NO:1;

With detect whether there is following single nucleotide polymorphism in second amplified production:

185 G → A and 601 G → A;

Wherein, the nucleotide position numbering is based on SEQ ID NO:4.

In another preference, described TAP1 gene-specific primer has the sequence of SEQ ID NO:2 and 3, and described LMP2 gene-specific primer has the sequence of SEQ ID NO:5 and 6.

In another preference, the length of described first amplified production is 100-2000bp and contains among the SEQ IDNO:1 the 621st; And the length of described second amplified production is 100-2000bp and contains among the SEQ IDNO:4 the 185th and 601.

In a second aspect of the present invention, a kind of test kit that detects ankylosing spondylitis is provided, it comprises the primer of specific amplification TAP1 gene or transcript, and described primer amplification goes out length to be 100-2000bp and to contain among the SEQ ID NO:1 the 621st amplified production; And

The primer of specific amplification LMP2 gene or transcript, described primer amplification go out length to be 100-2000bp and to contain among the SEQ ID NO:4 the 185th and 601 amplified production.

In another preference, described test kit also contains the reagent that is selected from down group:

(a) with SEQ ID NO:1 in the 185th and 601 sudden change bonded probe among the 621st, SEQ ID NO:4;

(b) the 185th and 601 sudden change restriction enzyme among the 621st, SEQ ID NO:4 among the identification SEQ ID NO:1.

In another preference, described sudden change is to have following single nucleotide polymorphism simultaneously:

366 G → disappearances;

Wherein, the nucleotide position numbering is based on SEQ ID NO:1; And

185 G → A and 601 G → A;

Wherein, the nucleotide position numbering is based on SEQ ID NO:4.

In another preference, described TAP1 gene-specific primer has the sequence of SEQ ID NO:2 and 3, and described LMP2 gene-specific primer has the sequence of SEQ ID NO:5 and 6.

In a third aspect of the present invention, a kind of method that the susceptibility of ankylosing spondylitis of individuality is diagnosed is provided, it comprises step:

Detect this individual TAP1 gene or transcript, and compare, detect this individual LMP2 gene or transcript simultaneously, and compare with normal LMP2 gene or transcript with normal TAP1 gene or transcript;

Wherein, the possibility that there are differences with regard to showing this individuality trouble ankylosing spondylitis is higher than normal population.

In another preference, detection be gene and the LMP2 gene of TAP1, and with the nucleotide sequence comparing difference of normal TAP1 and LMP2.

In another preference, described difference is to have following single nucleotide polymorphism simultaneously:

366 G → disappearances;

Wherein, the nucleotide position numbering is based on SEQ ID NO:1; And

185 G → A and 601 G → A;

Wherein, the nucleotide position numbering is based on SEQ ID NO:4.

In another preference, described individuality is the people.

Embodiment

The inventor is through deeply and extensive studies, and the SNP of a large amount of candidate genes is measured and analyzes.Find first and proved that the genome sequence of TAP1 and ankylosing spondylitis are closely related, wherein the association study result shows, the SNP rs2071535 of the SNP 1765A/G of the 621st SNP (366 G → disappearances) (being designated as rs3216794) and LMP2 gene intron 1 and intron 2 interconnected lock mutually in the SEQ of TAP1 ID NO:1, the chain variation (i.e. " GGG " → " AA ") that these 3 sites constitute, there is significant difference (P＜0.05) in distribution in control group and case group, therefore can be used as an auxiliary characteristics of complementary detection ankylosing spondylitis (or its susceptibility).Finished the present invention on this basis.

The TAP1 gene

Transporter of antigenic peptides 1 (Transporter of Antigen Peptides 1, sequence TAP1) is known, its detailed sequence and some relevant informations can be referring to network address Http:// www.ncbi.nlm.nih.gov/Genebank/; Http:// www.ncbi.nlm.nih.gov/SNP.For convenience's sake, provide nucleotide sequence relevant among the TAP1 at SEQ ID NO:1 with SNP of the present invention.

The TAP1 gene is positioned at 6P21.3, and size is 8.7k, has 11 exons.Its encoded protein belongs to the MDR/TAP subfamily of ABC (ATP-binding cassette) superfamily.TAP is a class translocator, is divided into two kinds of forms of TAP1 and TAP2, is expressed in the endoplasmic reticulum surface, participates in the processing and the processing of endogenous antigen peptide.The peptide section that the proteasome hydrolysis produces is transported to endoplasmic under the effect of the heterodimer of TAP1 and TAP2 composition, pump into the film marker space via endoplasmic reticulum, combine with HLA I quasi-molecule, form stable HLA-Ag mixture, just can be expressed in cell surface then and offer cell to T.Antigenic peptide may come to this to be and pass the CD8+T lymphocyte receptor and caused arthritic generation.The polymorphism of TAP can make different peptides be transported to endoplasmic reticulum.

Existing research has found that the generation development of various autoimmune disease such as TAP1 gene and diabetes, multiple sclerosis, primary open angle glaucoma, teenager's idiopathic arthritis, struma lymphomatosa, psoriasis, vitiligo and tumour is closely related.The relation of itself and AS (ankylosing spondylitis, ankylosing spondylitis) also is to be worth the research direction inquired into.Abroad have and discover that some site of TAP1 is HLA-B27 positive person with have among the AS patient of disease outside the backbone and increase.China has the scholar to discover that 333 Val/Val phenotypic frequencies of TAP1 may have significant AS resistance in the HLA-B27 positive individuals in the crowd of Anhui.

The inventor checks order to the almost whole zone in the TAP1 gene, many SNP have been found, wherein most of SNP and susceptibility of ankylosing spondylitis are also uncorrelated, yet association study shows that 366 G → disappearances are SNPs very high with the susceptibility of ankylosing spondylitis cognation among the SEQ ID NO:1.

The LMP2 gene

Low molecular weight polypeptide 2 (low molecular mass polypeptide-2, sequence LMP2) is known, its detailed sequence and some relevant informations can be referring to network address Http:// www.ncbi.nlm.nih.gov/Genebank/; Http:// www.ncbi.nlm.nih.gov/SNP.For convenience's sake, provide nucleotide sequence relevant among the TAP1 at SEQ ID NO:4 with SNP of the present invention.

The LMP2 gene is positioned at 6P21.3, and size is 5.7K, and the product of its coding belongs to T1B family (proteasome Type B family), is the core beta subunit of a kind of 20S.This gene receptor/gamma-interferon abduction delivering, its product discharges the catalytic subunit-1 (proteasome beta 6 subunits) in the immunity protease body.Proteasome is a kind of proteolysis enzyme complex that is present in kytoplasm and the karyon, is responsible for most of protein in the degradation of cell, comprises at MHC I quasi-molecule that the expression of HLA-B27 molecule and related antigen are presented in the process and plays a crucial role.The antigen that MHC I quasi-molecule is presented all derives from the degraded product of proteasome.The regulation and control that the function of proteasome is formed by its structure, the Fourth Ring shape cylindrical structural that its core is made up of α and β subunit and becomes the immunity protease body after PA28 combines.LMP2, LMP7 and MECL1 (multicatalytic endopeptidase complex-like1, many catalysis endopeptidase sample mixture-1) is most important subunit in the β ring with proteolytic activity, all can be by IFN-γ abduction delivering, change the speed and the cleavage site of degrade proteins, more help the degraded and antigenic the presenting of endogenous protein.The polymorphism of LMP2 gene affects the functional status of immunity protease body, causes that the quantity and the character of the antigen peptide that the degraded endogenous protein produces changes, and wherein may comprise the specific antigens peptide that can induce AS to take place.Except that relevant with the generation of tumour development, discover all that both at home and abroad the generation of LMP2 gene and B27 positive patient AS and AAU (acute anterior uveitis, acute anterior uveitis) thereof is relevant.

Particularly, the SNP rs2071535 that the present invention has disclosed the SNP rs3216794 of TAP1 gene 5 ' UTR, the SNP 1765A/G that is positioned at LMP2 gene intron 1 and intron 2 is interconnected lock mutually, has significant statistics effect.The haplotype in above-mentioned three sites (GGG) is to (AA) changing, increased the susceptibility of ankylosing spondylitis.

The proteic polynucleotide of TAP1 and LMP2 can be used for the auxiliary diagnosis of relative disease.Aspect diagnosis, the proteic polynucleotide of TAP1 and LMP2 can be used for detecting TAP1 and the proteic expression of LMP2 TAP1 and LMP2 abnormal exprssion whether or under morbid state.Can be used for hybridization to biopsy specimen to judge TAP1 and the proteic abnormal expression of LMP2 as TAP1 and LMP2 dna sequence dna.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.Carry out RNA-polymerase chain reaction (RT-PCR) amplification in vitro with TAP1 and the special primer of LMP2 albumen and also can detect the proteic transcription product of TAP1 and LMP2.

Detection can be at cDNA, also can be at genomic dna.The form of TAP1 and LMP2 protein mutation comprises that the point mutation compared with the LMP2 dna sequence dna with normal wild type TAP1, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.

The method of the detection SNP of the present invention of most convenient is by TAP1 and LMP2 gene with TAP1 and LMP2 gene-specific primer amplification sample, obtains amplified production; Detect then and whether have following single nucleotide polymorphism in the amplified production: 366 G → disappearances, wherein the nucleotide position numbering is based on SEQ ID NO:1 and 185 G → A and 601 G → A, and wherein the nucleotide position numbering is based on SEQ ID NO:4.

Should understand, after the present invention has disclosed the dependency of the SNP of TAP1 and LMP2 gene and ankylosing spondylitis first, but those skilled in the art can design the amplified production that specific amplification goes out to contain this SNP position easily, determine whether to exist 366 G → disappearances by methods such as order-checkings then.Usually, the length of primer is 15-50bp, preferably is 20-30bp.Though the complete complementation of primer and template sequence is preferred, one skilled in the art will appreciate that at primer and template to have under the situation of certain not complementary (especially 5 of primer ' end) also can increase specifically (promptly only amplifying required fragment).The method that contains the test kit of these primers and use these primers is all within the scope of the invention, as long as the amplified production that this primer amplification goes out contains the correspondence position of SNP of the present invention.A kind of preferred primer is to having SEQ ID NO:2 and 3, and the sequence of SEQ ID NO:5 and 6.

Though the length of amplified production is not particularly limited, the length of amplified production is 100-2000bp usually, preferably is 150-1500bp, more preferably is 200-1000bp.These amplified productions all should contain among the SEQ ID NO:1 185 and 601 among the 621st and the SEQ ID NO:4.

Because SNP of the present invention and ankylosing spondylitis have very high cognation, therefore not only can be used for early stage complementary diagnosing ankylosing spondylitis, and can make some carrier just take reasonable precautions against a rainy day at premorbid not, thereby improve carrier's lifetime and life quality, therefore have earth shaking using value and social benefit.Certainly, finally also should make a definite diagnosis with the conventional sense method.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1

1.1 research object

The case sample is all gathered from the outpatient, and patient's diagnosis is made according to the New York standard that proposed revision in 1984 by the Rheumatology doctor that benevolence Ji hospital is rich in clinical experience, and makes a definite diagnosis by repeatedly following up a case by regular visits to.Check sample is selected from age, gender matched in the southern central sample storehouse, the individuality of no sacroiliitis medical history.

On the basis of informed consent random collecting the peripheral blood sample of 197 patients and 474 normal control individualities.

1.2 experimental technique and result

1.2.1 DNA extraction

Extract DNA with conventional phenol chloroform method from people's peripheral blood sample, concentration correction is used for conventional pcr amplification to 20ng/ul.

1.2.2 the design of PCR and sequencing primer

According to the genome sequence of TAP1 among the GenBank, design and synthetic following primer.Concrete primer is as shown in table 1 below.

Table 1 primer sequence table

The primer title	Sequence (5 '-3 ')	SEQ ID NO：
			Adopted primer is arranged	AGCCATGCGAGAGAAGCTC	2
Antisense primer	CTCAAGCCCAGACCCATTAC	3

According to the genome sequence of LMP2 among the GenBank, design and synthetic following primer.Concrete primer is as shown in table 2 below.

Table 2 primer sequence table

The primer title	Sequence (5 '-3 ')	SEQ ID NO：
			Adopted primer is arranged	GCGGAGCTGCTTCACTTCTA	5
Antisense primer	TTGATCCCTAAGCACAGATGG	6

1.2.3 the pcr amplification of TAP1 and LMP2 gene

DNA with extraction is a template, uses the Taq enzyme, carries out pcr amplification with the Touchdown program on GeneAmp 9700 PCR instrument.Reaction conditions is: 94 ℃ of pre-sex change 2 minutes, and 94 ℃ of sex change 30 seconds, 63 ℃ of annealing 40 seconds, 72 ℃ were extended totally 10 circulations, 0.5 ℃ of each cycle annealing lapse of temperature 40 seconds; Later 94 ℃ of sex change 30 seconds were annealed 40 seconds for 58 ℃, and 72 ℃ were extended totally 30 circulations 40 seconds; Last 72 ℃ were extended 7 minutes.Pcr amplification product is verified through agarose gel electrophoresis.As a result, obtain the amplified production of TAP1 and LMP2 respectively.

1.2.4 the discovery of SNP and detection

The PCR product is behind the Resin resin purification, (appliedbiosystems of u.s.a. applied biosystem company (ABI)) checks order with ABI-3730 dna sequencing instrument, and the interpretation, gene type and the SNP that carry out sequence with Polyphred software (the http://droog.mbt.washington.edu/Polyphred.html of Washington, DC university) confirm.

As a result, find to have several SNP, comprising 185 G → A (SNP 1765A/G) and 601 G → A (rs2071535) among 366 G → disappearances (rs3216794) and the SEQ ID NO:4 among the following SNP:SEQ ID NO:1.

1.2.5 SNP gene type and association analysis

Carry out the SNP gene type with direct unidirectional sequencing.Promptly in ankylosing spondylitis patient and normal control group, carry out somatotype and association analysis.

To the statistical study of being described property of gene type result, contingency table carries out chi square test.Observe genotype and between patient and contrast, whether have difference.

Analytical results is as follows: on the 621st of SEQ ID NO:1 and among the SEQ ID NO:4 on 185 and 601, and in 474 example contrasts, GG/GG/GG 389 examples, G-/AG/AG 85 examples; GG/GG/GG 167 examples in 197 routine cases, G-/AG/AG 28 examples,--/AA/AA 2 examples, both have significant difference, chi square test P=0.055.And, (--/AA/AA) haplotype that isozygotys only occurs in case.

The above results shows: the haplotype of being made up of the SNP rs2071535 of the SNP rs3216794 of TAP1 gene 5 ' UTR, the SNP 1765A/G that is positioned at LMP2 gene intron 1 and intron 2 (GGG) is to (change AA), increased the susceptibility of AS, with the AS significant correlation.

Embodiment 2

The susceptibility of ankylosing spondylitis detection kit

As described in embodiment 1, among the SEQ ID NO:1 among 366 G → disappearances and the SEQ ID NO:4 (GGG) in 185 and 601 three sites to (change AA) and ankylosing spondylitis disease are closely related.Therefore, can be that template increases and detects at DNA based on this sudden change design TAP1 and LMP2 gene-specific primer with patient.

Prepare a test kit (100 person-times), it contains:

Whether the test group that 100 people of random choose constitute is suffered from object, the known trouble ankylosing spondylitis patient of ankylosing spondylitis and is not had the normal people of ankylosing spondylitis after testing comprising the unknown.

Extract the peripheral blood 3ml of object to be detected in the test group, use ordinary method (or using specific test kit) from blood, to extract DNA.PCR primer in the ankylosing spondylitis detection kit is diluted to 1 ì mol/ ì l, is that template is carried out the PCR reaction with the primer that is provided with the DNA that is extracted.Behind the PCR product purification, check order with ABI 3730 dna sequencing instrument, the interpretation and the SNP that carry out sequence with Polyphred software confirm.

Perhaps, amplified production and normal control are carried out stratographic analysis with sex change high performance liquid chromatograph (DHPLC), also can detect 185 G → A and 601 G → A in 366 G → disappearances in the TAP1 gene and the LMP2 gene.

Detected result:

Exist 366 G → disappearances and LMP2 gene to have the object of 185 G → A and 601 G → A for TAP1, further detect to confirm whether to suffer from the ankylosing spondylitis situation by ordinary method.Detected result shows that the susceptibility of ankylosing spondylitis ratio that contains " AA " genotypic detected object is apparently higher than the normal population that contains G.The individuality of "--/AA/AA " of all detections all suffers from AS.

Therefore, this shows by detecting above-mentioned three chain sites whether exist (GGG) to (change AA) can be carried out the complementary detection of ankylosing spondylitis.

Embodiment 3

The complementary detection of susceptibility of ankylosing spondylitis

Repeat the detection of embodiment 2, difference be picked at random 90 people (not knowing before the detection whether the ankylosing spondylitis symptom is arranged) detect.

Prepare a test kit (100 person-times), it contains:

Extract the peripheral blood 3ml of object to be detected, use ordinary method (or using specific test kit) from blood, to extract DNA.PCR primer in the ankylosing spondylitis detection kit is diluted to 1 ì mol/ ì l, is that template is carried out the PCR reaction with the primer that is provided with the DNA that is extracted.Behind the PCR product purification of TAP1 and LMP2, check order with ABI 3730 dna sequencing instrument, the interpretation and the SNP that carry out sequence with Polyphred software confirm.

The result confirmed equally, and the individuality of "--/AA/AA " of all detections all suffers from AS, and has that AS patient's case is higher than GG/GG/GG individuality (exceeding at least 60%) in the individuality of G-/AG/AG.This shows by detecting above-mentioned three chain sites whether exist (GGG) to (change AA) can be carried out the complementary detection of ankylosing spondylitis.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Research Center of Shanghai Human Genome

＜120〉method for testing susceptibility of ankylosing spondylitis and test kit 4

<130>081333

<160>6

<170>PatentIn version 3.4

<210>1

<211>741

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>1

agccatgcga gagaagctcc ggggaggcag cggcacccgc ggggagcggg acacctagag 60

ctagccattg gcactcggac gccgtcccgg tcccggccgg gcctgggact ctccgcgccc 120

cggtggggcc tgaagctccg ggtaccgccg agtcctcccc tactggcggc tgggggaggg 180

aacgagggcg gggctctcgg aaagtcccag gaacaggctg atcctgcgct ggcgagaagc 240

tcagccattt aggggaaagc gaaatcgaaa gcggccgcct gctcactaga taacgcctac 300

ttccaaaagt ggcctgccca gactattttg gtagcaagcg tggaaatcag atctgagaat 360

ctcgggagca gccctggtgc ccaattttct ccatcacgca cacccttctc gcctctccct 420

gcctcctgcc tttccacttg caccagtttt cccaccccag cctcagggcg gggctgcctc 480

gtcacttgtc tcggggcaga tctgccctac acacgttagc gccgcgcgca aagcagcccc 540

gcagcaccca ggcgcctcct ggcggcgccg cgaaggggcg gggctgtcgg ctgcgcgttg 600

tgcgctgtcc caggttggaa accagtgccc caggcggcga ggagagcggt gccttgcagg 660

gatgctgcgg gcgggagcac caaccgggga cttaccccgg gcgggagaag tccacaccgg 720

ggtaatgggt ctgggcttga g 741

<210>2

<211>19

<212>DNA

＜213〉primer

<400>2

agccatgcga gagaagctc 19

<210>3

<211>20

<212>DNA

＜213〉primer

<400>3

ctcaagccca gacccattac 20

<210>4

<211>707

<212>DNA

＜213〉homo sapiens (Homo sapiens)

<400>4

gcggagctgc ttcacttcta cctgtaggag cctcatctcc acctctctac agtggagagg 60

attccactag gcaagttgga acttagggac acagttcttt ctgtgttgta tcacagctgg 120

gctgtggcat tcccctgcag ccggatgaag caatagagaa agtggaaaga tgaagggaaa 180

aaaagcctgt actgacagtc agctctggcc tgttactgtg taatctttga gccagtcact 240

tcgcctctct gggaatgttt cttcttctct aacatgaggg catcaaggct gttcttgccc 300

tgacattcca tattctgtgt ctctgcagac caccatcatg gcagtggagt ttgacggggg 360

cgttgtgatg ggttctgatt cccgagtgtc tgcagggtga gtaaaagtga agatgtatgc 420

atttggaaag aagctaatgg cctcaaatac acactttcct tacccattca tgaaaagact 480

ggcaaactgg agccttggag gaatggagtt gaccttcccc aaaagccact atgataagct 540

atttggtggg tgcttgggtc tctgaatttg tggaggagga tctggggtct gaatgtgtat 600

gtgacctgtc ccagtagtgt acagggatga gtaaaggaat agggtctgag agggggacag 660

gagatagatt tttgagggtc ttctttccat ctgtgcttag ggatcaa 707

<210>5

<211>20

<212>DNA

＜213〉primer

<400>5

gcggagctgc ttcacttcta 20

<210>6

<211>21

<212>DNA

＜213〉primer

<400>6

ttgatcccta agcacagatg g 21

Claims (10)

1. whether a vitro detection sample exists the method for the single nucleotide polymorphism of transporter of antigenic peptides 1 (TAP1), it is characterized in that, comprises step:

(a) with the TAP1 gene of TAP1 gene-specific primer amplification sample, obtain first amplified production, and, obtain second amplified production with the increase LMP2 gene of sample of LMP2 gene-specific primer; With

(b) detect whether there is following single nucleotide polymorphism in first amplified production:

366 G → disappearances;

Wherein, the nucleotide position numbering is based on SEQ ID NO:1;

With detect whether there is following single nucleotide polymorphism in second amplified production:

185 G → A and 601 G → A;

Wherein, the nucleotide position numbering is based on SEQ ID NO:4.

2. the method for claim 1 is characterized in that, described TAP1 gene-specific primer has the sequence of SEQ ID NO:2 and 3, and described LMP2 gene-specific primer has the sequence of SEQ ID NO:5 and 6.

3. the method for claim 1 is characterized in that, the length of described first amplified production is 100-2000bp and contains among the SEQ ID NO:1 the 621st; And the length of described second amplified production is 100-2000bp and contains among the SEQ ID NO:4 the 185th and 601.

4. a test kit that detects ankylosing spondylitis is characterized in that, it comprises the primer of specific amplification TAP1 gene or transcript, and described primer amplification goes out length to be 100-2000bp and to contain among the SEQ ID NO:1 the 621st amplified production; And

The primer of specific amplification LMP2 gene or transcript, described primer amplification go out length to be 100-2000bp and to contain among the SEQ ID NO:4 the 185th and 601 amplified production.

5. test kit as claimed in claim 4 is characterized in that, it also contains the reagent that is selected from down group:

(a) with SEQ ID NO:1 in the 185th and 601 sudden change bonded probe among the 621st, SEQ ID NO:4;

(b) the 185th and 601 sudden change restriction enzyme among the 621st, SEQ ID NO:4 among the identification SEQ ID NO:1.

6. test kit as claimed in claim 5 is characterized in that, described sudden change is to have following single nucleotide polymorphism simultaneously:

366 G → disappearances;

Wherein, the nucleotide position numbering is based on SEQ ID NO:1; And

185 G → A and 601 G → A;

Wherein, the nucleotide position numbering is based on SEQ ID NO:4.

7. test kit as claimed in claim 4 is characterized in that described TAP1 gene-specific primer has the sequence of SEQ ID NO:2 and 3, and described LMP2 gene-specific primer has the sequence of SEQ ID NO:5 and 6.

8. method that the susceptibility of ankylosing spondylitis of individuality is diagnosed is characterized in that it comprises step:

Detect this individual TAP1 gene or transcript, and compare, detect this individual LMP2 gene or transcript simultaneously, and compare with normal LMP2 gene or transcript with normal TAP1 gene or transcript;

Wherein, the possibility that there are differences with regard to showing this individuality trouble ankylosing spondylitis is higher than normal population.

9. method as claimed in claim 8 is characterized in that, detection be gene and the LMP2 gene of TAP1, and with the nucleotide sequence comparing difference of normal TAP1 and LMP2.

10. method as claimed in claim 9 is characterized in that, described difference is to have following single nucleotide polymorphism simultaneously:

366 G → disappearances;

Wherein, the nucleotide position numbering is based on SEQ ID NO:1; And

185 G → A and 601 G → A;

Wherein, the nucleotide position numbering is based on SEQ ID NO:4.