CN101525366A - 3-(2-carboxylbenzoyl)-oleanolic acid, pharmaceutical composition of same and application of same in treating diabetes and/or obesity - Google Patents

Abstract

The invention discloses 3-(2-carboxylbenzoyl)-oleanolic acid or physiologically acceptable salt of the same, application of the same and a pharmaceutical composition containing the compound. The compound has inhibition effect on protein tyrosine phosphatase 1B (PTP1B) and 11beta-hydroxysteriod dehydrogenase 1 (11beta-HSD1), has antagonism effect on a glucocorticoid receptor (GR), has agonistic effect on nuclear receptor LXRa: RXRa heterodimer, and can also strengthen the expression of glucose transporter 4 (Glut4) at the same time. A whole animal experiment shows that the compound has hypoglycemic activity. Therefore, the 3-(2-carboxylbenzoyl)-oleanolic acid or the physiologically acceptable salt of the same can be used for treating diabetes, obesity and complicating diseases thereof caused by insulin resistance.

Description

3-(2-carboxylbenzoyl)-Oleanolic Acid, its pharmaceutical composition and be used for the treatment of diabetes and/or the purposes of obesity

Technical field

The present invention relates to pharmaceutical chemistry and pharmacotherapeutics field; be specifically related to 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt, its pharmaceutical composition, with and can be used as PTP 1B (PTP1B) inhibitor, 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD1) inhibitor, glucocorticoid receptor (GR) antagonist and nuclear receptor LXR α: RXR α heterodimer agonist and be used for the treatment of the medicinal use of diabetes and/or obesity.

Background technology

Diabetes (diabetes mellitus) are one group of clinical syndromes that is caused by the h and E factor interaction, and absolute or relative deficiency and target tissue cell reduce insulin sensitivity and cause a series of metabolism disorders such as sugar, albumen, fat, power and water Xie Zhi because of insulin secretion.Severe complications such as coronary heart disease, iron deficiency or hemorrhagic cerebrovascular disease, blind, acromelic gangrene take place in the diabetics all apparently higher than non-diabetic people.Estimate that according to the WHO of the World Health Organization because the mode of life of aging population, obesity, unsound diet and shortage motion, by 2025, diabetic subject's number will rise to 300,000,000 by 1.35 hundred million of nineteen ninety-five.Therefore, diabetes and complication thereof have become the worldwide public health problem of serious threat human health.

Generally diabetes are divided into two classes at present, promptly type i diabetes (insulin-dependent diabetes mellitus, IDDM) with type ii diabetes (non insulin dependent diabetes, NIDDM).85～90% belong to type ii diabetes (Australia health and welfare research institute, Australian Institute of Healthand Welfare, 2003) in the diabetes.The type ii diabetes pathogenesis is various and complicated, exists between each patient than big-difference, summarizes relative deficiency and insulin resistant two classes of getting up can be divided into insulin secretion.For type ii diabetes people especially obese diabetic patient, insulin resistant is the key factor in type ii diabetes generation, the evolution.Therefore, on the basis of insulin signaling pathway, designing and developing euglycemic agent in research adipocyte and muscle cell, to improve the insulin resistant state, is the emphasis of present type ii diabetes new drug research, also is one of its main direction.

In insulin signaling pathway, Regular Insulin by with its acceptor (Insulin receptor, IR) the outer alpha subunit of born of the same parents in conjunction with and β subunit intrinsic tyrosine kinase activity in the activated receptor born of the same parents, cause tyrosine residues autophosphorylation crucial in the adjustment structure territory that its tyrosine kinase activity is activated, activatory insulin receptor (IR) passes the signal along on the protein kinase B (AKT) by phosphatidylinositols 3 kinases centre effectors such as (PI3K) again, after protein kinase B (AKT) is activated signal is passed to key factor-glucose transporter 4 (Glut4) of being responsible for glucose transport, impel the last film of the latter and carry out the transhipment of glucose.Glucose transporter 4 (Glut4) mainly is distributed in insulin replies tissue such as muscle and fatty tissue, it body cell carry out glucose absorption keep play a part in the blood glucose balance crucial.Studies show that, the heterozygote Glut4 of glucose transporter 4 (Glut4) gene knockout (+/-) mouse shows the performance of insuline resistance syndrome, and introduce the activity [Nat Med, 3:1096-101,1997.] that glucose transporter 4 (Glut4) can recover whole Regular Insulin again.

Protein-tyrosine-phosphatase (Protein Tyrosine Phosphatase, PTPase) comprise that is striden (non-receptor type) enzyme in film (receptor type) and the born of the same parents, as PTP 1B (PTP1B), CD45 Protein-tyrosine-phosphatase (CD45), T cell protein tyrosine Phospholipid hydrolase (TCPCP), leukocyte common antigen (LCA) associated protein (LAR) and Protein Tyrosine Phosphatases α (PTP α), they participate in a series of important vital processes of regulation and control.Studies show that PTP 1B (PTP1B) can directly act on phosphorylation activatory insulin receptor (IR) and substrate 1 (IRS-1) and with its dephosphorylation, thereby weakens its activity, and the Regular Insulin path is played the negative regulation effect.Reports such as Elchebly, the mouse of PTP 1B (PTP1B) gene knockout that the method for utilization homologous recombination produces grows normal and fecundity is arranged, this mouse significantly strengthens insulin sensitivity what is more important, and the relevant [Science of enhancing of insulin receptor and substrate 1 phosphorylation level in this enhancement and liver and the skeletal muscle, 283:1544-8,1999].Simultaneously, the mouse analytic metabolism level of PTP 1B (PTP1B) gene knockout and overall energy consumption raise, and food-induced obesity and insulin resistant are also had resistant function [Mol Cell Biol, 20:5479-89,2000].

Therefore, present PTP 1B (PTP1B) is considered to treat an important potential drug action target spot of type ii diabetes and obesity.Yet because Protein-tyrosine-phosphatase (PTPases) has participated in the regulation and control of many A signal pathways in cell, therefore, nonspecific Protein-tyrosine-phosphatase (PTPases) inhibitor tends to be accompanied by the generation of multiple side effect.And owing to structurally have high homology between Protein-tyrosine-phosphatase (PTPases) family member, therefore most PTP 1B (PTP1B) of finding at present all are nonspecific inhibitor, therefore seek PTP 1B (PTP1B) inhibitor natural, efficient, highly selective and have great importance.

Glucocorticosteroid (Glucocorticoid, GC) find first in nineteen fifty by Hench, Kendall and these three scientists of Reichstein, it is by adrenal cortex excretory one class steroid hormone, two kinds of existence forms are arranged, the mankind is the 11-dehydrocorticosterone (cortisone of activated hydrocortisone (Cortisol) and non-activity, cortisone), be Kendall compound (Corticosterone) and dehydrocorticosterone (dehydro-corticosterone) rodents.Glucocorticosteroid is widely used in treatment inflammation and immunosuppression reaction.Yet recent research is found, excessive glucocorticosteroid level and hypercortisolism (Cushing ' s syndrome) closely related [Diabetes, 53:1790-7,2004], what the hypercortisolism performance was the most outstanding is progressive obesity and insulin resistant.

11beta-Hydroxysteroid dehydrogenase (11 β-hydroxysteroid dehydrogenase, 11 β-HSD) are the members of short chain redox enzyme family, the mankind, the ketone group of catalysis glucocorticosteroid C11 position and the redox reaction between the hydroxyl, mutual conversion between the 11-dehydrocorticosterone (cortisone, cortisone) of active hydrocortisone of catalysis biological (Cortisol) and non-activity; Rodents, the mutual conversion between its catalysis Kendall compound (Corticosterone) and the dehydrocorticosterone (dehydro-corticosterone).At present, found that (11 β-HSD) are divided into two kinds of hypotypes, i.e. 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD to 11beta-Hydroxysteroid dehydrogenase ₁) and 11beta-Hydroxysteroid dehydrogenase 2 (11 β-HSD ₂).11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD ₁) be a kind of NADP (H) dependency oxydo-reductase of low-affinity, mainly express at the target organ of glucocorticosteroids such as liver, fatty tissue, sexual gland, brain, placenta and vascular smooth muscle, have oxidation and reductase activity.In the protein of cell-free system or purifying, mainly show as oxidation activity, in intact cell or body, because the existence of glucose-6-phosphate dehydrogenase (G6PD) (G6PDH) can guarantee the supply of endoplasmic reticulum middle and high concentration NADPH and mainly show as reducing activity.11beta-Hydroxysteroid dehydrogenase 2 (11 β-HSD ₂) be a kind of high-affinity NAD dependent dehydrogenase, mainly be distributed in the target organ of mineralocorticoids such as distal convoluted renal tubule, collecting tubule, pancreas, sweat gland, rectum.It is single oxydase; can be converted into cortisone by the catalysis hydrocortisone; when hydrocortisone is too much, make it change into the cortisone of non-activity by oxygenizement; with non-selective mineralcorticoid receptor (Mineralocorticoid receptor in the tissues such as protection kidney and colon; MR), 11beta-Hydroxysteroid dehydrogenase 2 (11 β-HSD ₂) be suppressed and will produce severe side effect, as hypertension.

Kotelevtsev etc. are to 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD ₁) knock out mice studies show that 11 β-HSD ₁(-/-) mouse compares with normal mouse in appearance without any unusually, and have normal Fertility, and what is more important, the researchist is by investigating 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD ₁) in generating, hepatic glucose does the time spent, find the 11 β-HSD of high-fat fed ₁(-/-) glucose level under the mouse fasting state significantly is lower than control group [Proc NatlAcad Sci U S A 94:14924-9,1997].

The molecular mechanisms of action of glucocorticosteroid is illustrated at present, the activatory glucocorticosteroid can pass freely through glucocorticoid receptor (the Glucocorticoid receptor in cytolemma and the cytoplasm, GR) combination, glucocorticoid receptor (GR) is combining the back dimerization with glucocorticosteroid (GC), recruit the co-activation factor, go into nuclear and recruit other transcription factors again, act on glucocorticosteroid response element (GR response elment then, GRE) thus go up the regulation and control target gene, if can raise the key enzyme-PCK (PEPCK) and G-6-Pase (G-6-Pase) expression of gene of glyconeogenesis approach.Studies show that, utilize the special antagonist-RU486 of glucocorticoid receptor (GR) can eliminate the insulin resistant symptom [Diabetes 44:718-720,1995] that mouse causes because of high-fat fed.

Therefore, find and design 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD ₁) the selective depressant and the antagonist of glucocorticoid receptor (GR) will have crucial meaning for metabolic diseases such as treatment diabetes, obesity, hyperlipemia and hypertension.

Liver X receptor α (Liver X receptor α, LXR α) is as a kind of oxidation sterol activated nuclear receptor, participates in the adjusting of the multiple physiological activity of body, comprises the processes such as formation, gluconeogenesis and inflammation of the metabolism of cholesterol and transhipment, fat.In tenuigenin, liver X receptor α (LXR α) combines the back and forms heterodimer and recruit the co-activation factor with retinoic acid receptor X α (RXR α) with its part, go into nuclear then and under the assistance of other associated transcription factors, act on target gene liver X receptor (LXR) cis response element (LXR response element, thus LXRE) the regulation and control target gene transcribes.

Atherosclerosis (Atherosclerosis) is a most common and important type in the arteriosclerosis, the inner membrance that is characterized in artery has the deposition of lipoids, gathering of compound carbohydrate, then proliferation of fibrous tissue and calcium deposit, and medial pathology arranged, this disease relates generally to large-scale and medium-sized flesh elastic-type artery, for seeing, often causes obliteration or the tube wall serious consequence such as hemorrhage of breaking with aorta, coronary artery and cerebral arteries more.Hyperlipemia is an atherosclerotic important risk.A large amount of epidemiological studies and clinical data show, plasma hdl cholesterol (HDL-C) level and the atherosclerotic obvious negative that is.Its topmost mechanism of action of plasma hdl cholesterol (HDL-C) is to participate in the antiport process (RCT) of cholesterol.Brooks etc. by to Tang Jier (Tangier) sick discovering (ATP-binding-cassette transporter 1, ABC1) cholesterol of genes encoding flows out and regulates albumen (cholesterol-efflux regulatory protein) and play an important role in high-density lipoprotein (HDL) (HDL) transport process at the cell inner cholesterol by ATP binding cassette transporter 1.

Studies show that, LXR α: RXR α heterodimer agonist can just be regulated and control ATP binding cassette transporter 1 and aPoA poA1 expression of gene [Biochem Biophys Res Commun274:794-802,2000], can promote the synthetic of bile acide in the outflow of cholesterol in the scavenger cell and the liver, and can suppress the absorption [Nat Genet 22:336-45,1999] of cholesterol in the enteron aisle.In addition, LXR α: RXR α heterodimer agonist can also strengthen expression [the J Biol Chem 278:48283-91 of glucose transporter 4 (Glut4), 2003], suppress glyconeogenesis pathway key enzymatic glucose-6-Phosphoric acid esterase (G6Pase) thereby expression of gene reduction hepatic glucose generation [Biochem Biophys ResCommun 338:981-6,2005].Therefore, find and design LXR α: the agonist of RXR α heterodimer will have a very important role for treatment atherosclerosis and complications, type ii diabetes and complication thereof.

Many in recent years anti-type ii diabetes medicines such as peroxidase hyperplasia factor activated receptor γ (PPAR γ) agonist, PTP 1B (PTP1B) inhibitor constantly goes on the market and be used for clinical treatment.Yet, thereby the medicine of single target spot tends to impel body to produce compensation mechanism makes its attack of escaping medicine produce resistance, it is various and complicated to add the type ii diabetes pathogenesis, and target spot is various, and the medicine of unicity target spot often is difficult to reach good result of treatment.Many target drugs are because thereby it relates to target spot and signal path is many, lowly have low toxicity with the bonding strength of single target spot, hang down advantage [Expert Opinion on Drug Discovery 2:1-10 such as resistance, 2007], therefore, the research of carrying out many target drugs will be to capture one of important means such as difficult diseases such as cancer, diabetes.

The present invention finds that through random screening oleanolic acid derivate 3-(2-carboxylbenzoyl)-Oleanolic Acid is PTP 1B (PTPB1) inhibitor, 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD ₁) inhibitor, glucocorticoid receptor (GR) antagonist, nuclear receptor LXR α: RXR α heterodimer agonist, can also strengthen simultaneously the expression of glucose transporter 4 (Glut4), the whole animal test shows that it has hypoglycemic activity, is the antidiabetic compound of the many target spots of an effect.And owing to PTP 1B (PTPB1) inhibitor [Mol Cell Biol 20:5479-89,2000], 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD ₁) inhibitor [Proc Natl Acad Sci US A 94:14924-9; 1997], glucocorticoid receptor (GR) antagonist [Diabetes 44:718-720; 1995] aspect the physiological function in the opposing obesity report is arranged all, so 3-(2-carboxylbenzoyl)-Oleanolic Acid also has the effect of potential anti-obesity.

Summary of the invention

An object of the present invention is to provide the following 3-of structural formula (2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt (for example its disodium salt, di-potassium or di-ammonium salts).

3-of the present invention (2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt can be synthetic by following method:

In the presence of pyridine, Oleanolic Acid and phthalic anhydride generate 3-(2-carboxylbenzoyl)-Oleanolic Acid.3-(2-carboxylbenzoyl)-Oleanolic Acid heating for dissolving is slowly separated out 3-(2-carboxylbenzoyl)-Oleanolic Acid disodium salt, di-potassium or di-ammonium salts after the cooling in saturated 80% ethanolic soln of sodium-chlor (or Repone K or ammonium chloride).

Another object of the present invention provides above-mentioned 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt and is used for the treatment of purposes in the medicine of diabetes and/or obesity in preparation.Particularly, described diabetes are the type ii diabetes that caused by insulin resistant.

A further object of the present invention is to disclose above-mentioned 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt as protein-tyrosine phosphatase 1B inhibitor, 11beta-Hydroxysteroid dehydrogenase 1 inhibitor, glucocorticoid receptor antagonists and nuclear receptor LXR α: RXR α heterodimer agonist.

Another purpose of the present invention provides a kind of diabetes that caused by insulin resistant and/or pharmaceutical composition of obesity of being used for the treatment of; it comprises 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt for the treatment of effective dose, and can further comprise pharmaceutically conventional auxiliary material.

Beneficial effect of the present invention: the present invention designs and has synthesized 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt, and it is to PTP 1B and 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD ₁) have restraining effect, to glucocorticoid receptor (GR) antagonistic action is arranged, to nuclear receptor LXR α: RXR α heterodimer has agonism, can also strengthen the expression of glucose transporter 4 (Glut4) simultaneously.The whole animal test shows that it has hypoglycemic activity.3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt can be used for treating diabetes, obesity and the complication thereof that is caused by insulin resistant.3-(2-carboxylbenzoyl)-Oleanolic Acid is synthetic simple, is easy to preparation, and synthesis material is abundant, cheap.

Description of drawings

Figure 1A is that 3-(2-carboxylbenzoyl)-Oleanolic Acid suppresses the enzyme kinetics curve of PTP1B down.■, ●, ▲ the enzyme kinetics curve of PTP1B when representing 3-(2-carboxylbenzoyl)-Oleanolic Acid concentration to be 0,9 μ M, 12 μ M respectively.

Figure 1B is the Ki pH-value determination pH of 3-(2-carboxylbenzoyl)-Oleanolic Acid.X-coordinate is represented the concentration of 3-(2-carboxylbenzoyl)-Oleanolic Acid, and ordinate zou is represented the Km value, and the numerical value of curve and X-coordinate joining is the Ki value.

Fig. 2 A is the influence of 3-(2-carboxylbenzoyl)-Oleanolic Acid to insulin receptor (IR) phosphorylation, and wherein glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is confidential reference items.

Fig. 2 B is the influence of 3-(2-carboxylbenzoyl)-Oleanolic Acid to protein kinase B (AKT) phosphorylation, and wherein GAPDH is confidential reference items.

Fig. 3 is 11beta-Hydroxysteroid dehydrogenase 1 (11 β-HSD ₁) proteic purifying.11 β-HSD that swimming lane 1～5 expression elutes from the nickel post with the 500mM imidazoles ₁(24-292 amino acids), the about 29kDa of size.

Fig. 4 A is that glycyrrhetinic acid (GA) is to 11 β-HSD ₁The concentration dependent curve that enzymic activity suppresses.X-coordinate is compound concentrations (M)-Log value, and ordinate zou is that compound is to 11 β-HSD ₁Inhibiting rate (%).

Fig. 4 B is that 3-(2-carboxylbenzoyl)-Oleanolic Acid is to 11 β-HSD ₁The concentration dependent curve that enzymic activity suppresses.X-coordinate is compound concentrations (M)-Log value, and ordinate zou is that compound is to 11 β-HSD ₁Inhibiting rate (%).

Fig. 4 C is 3-(2-carboxylbenzoyl)-Sodium oleanolate salt pair 11 β-HSD ₁Enzymic activity suppresses figure.

Fig. 5 is the antagonistic activity of 3-(2-carboxylbenzoyl)-Oleanolic Acid to GR.Compare for 2 groups with contrast, ^*P＜0.05, ^*P＜0.01.

Fig. 6 is 3-(2-carboxylbenzoyl)-Oleanolic Acid to LXR α: the agonist activity of RXR α heterodimer.Compare with control group, ^*P＜0.05, ^*P＜0.01.

Fig. 7 A is that 3-(2-carboxylbenzoyl)-Oleanolic Acid is to the active influence of Glut4 promoter transcription.

Fig. 7 B is the influence of 3-(2-carboxylbenzoyl)-Oleanolic Acid to Glut4mRNA transcriptional level in the 3T3-L1 adipocyte, compares with control group, ^*P＜0.05, ^*P＜0.01.

Fig. 8 is the influence of 3-(2-carboxylbenzoyl)-Oleanolic Acid to Glut4 protein expression level in the 3T3-L1 adipocyte.

Fig. 9 is the influence of 3-(2-carboxylbenzoyl)-Oleanolic Acid to diabetes model mouse glucose level.

Embodiment

The present invention is further elaborated below in conjunction with specific embodiment, but do not limit the present invention.

In the following preparation example, ¹H-NMR Varian Mercury AMX300 type Instrument measuring.All through distillation again, employed anhydrous solvent all is to obtain by the standard method drying treatment to all solvents before use.Unless otherwise indicated, it all is to carry out under argon shield and follow the tracks of with TLC that institute responds, during aftertreatment all through saturated common salt washing and anhydrous magnesium sulfate drying process.The purifying of product unless otherwise indicated all uses silica gel column chromatography, and employed silica gel is the 200-300 order, GF ₂₅₄Be Haiyang Chemical Plant, Qingdao or the production of the rich silica gel company of Yantai edge.

The preparation of preparation embodiment: 3-(2-carboxylbenzoyl)-Oleanolic Acid

With (438mg, 1mmol) Oleanolic Acid is dissolved in (10mL) pyridine, add (177mg, 1.2mmol) Tetra hydro Phthalic anhydride, reaction is spent the night, and adds (2mol/L) hydrochloric acid and regulates pH to 3, with (30mL) ethyl acetate extraction, with (10mL, 2mol/L) salt acid elution organic phase twice, with (10mL) distilled water wash once.With the organic phase anhydrous sodium sulfate drying, underpressure distillation, with silica gel column chromatography separate (sherwood oil: ethyl acetate=10: 1 V/V), obtain the white powder compound (527mg, 0.87mmol), productive rate 87%.

¹H NMR (CDCl ₃, 300MHz) (δ): 7.86 (d, 1H, J=7.5, phenyl hydrogen), 7.68 (d, 1H, J=7.2, phenyl hydrogen) 7.56 (m, 2H, phenyl hydrogen) 5.27 (t, 1H, J=3.3,12-CH), 4.72 (m, 1H, 3-CH), 2.80 (m, 1H, 18-CH).

¹³C NMR (CDCl ₃, 75.0MHz) (δ): 38.10 (C-1), 27.90 (C-2), 83.26 (C-3), 39.49 (C-4), 55.59 (C-5), 18.36 (C-6), 32.70 (C-7), 41.67 (C-8), 47.72 (C-9), 37.89 (C-10), 23.64 (C-11), 122.78 (C-12), 143.80 (C-13), 45.99 (C-14), 27.86 (C-15), 22.97 (C-16), 37.97 (C-17), 41.74 (C-18), 46.64 (C-19), 30.89 (C-20), 33.99 (C-21), 32.71 (C-22), 28.36 (C-23), 17.02 (C-24), 15.65 (C-25), 17.41 (C-26), 26.17 (C-27), 173.05 (C-28), 33.29 (C-29), 23.82 (C-30), 134.04,132.20,130.85,130.18,129.95, (129.06 phenyl hydrogen), 168.12 (benzene methyl-CO-), 185.23 (benzoic-CO-).

Experimental example

Experimental example 1:3-(2-carboxylbenzoyl)-Oleanolic Acid suppresses the determination of activity experiment to PTP1B

The present invention expresses in e. coli bl21 (DE3) and separation and purification obtains people's source PTP1B albumen and other PTPases such as CD45, TCPCP, LAR and PTP α, has tested the inhibition activity of compound 3-(2-carboxylbenzoyl)-Oleanolic Acid to these PTPases.Experiment shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid can significantly suppress the PTP1B enzymic activity, and other PTPases are had certain selectivity.

1, experimental principle

P-nitrophenyl phosphoric acid (p-Nitrophenyl phosphate, pNPP) be the soluble substrate of alkaline phosphatase, under the catalysis of PTPases such as PTP1B, it sloughs a phosphate radical, generate yellow solvable product-p-nitrophenol (p-Nitrophenol), this product has photoabsorption at the 410nM place, and the variation (read plate once in per 40 seconds, and read 40 times) that detects 410nM place's photoabsorption on the BioRAD microplate reader just can record the initial velocity (V of PTP1B enzyme reaction ₀).

2, experiment material

1) 10 * pNPP (50mM): accurately claim the pNPP powder dissolution of 18.5mg in the 1mL distilled water, to be mixed with the stock solution of 50mM.

2) the proteic preparation of people source PTP1B: people source PTP1B (1～321 amino acids) gene order is cloned on the pGEX4T-1 prokaryotic expression carrier, be converted in the e. coli bl21 (DE3) and express, with the PTP1B albumen that the GST column purification obtains, dialyse, be concentrated to about 0.5mg/mL.

3) PTP1B enzyme reaction damping fluid: 140mM NaCl, 2.7mM KCl, 10mMNa ₂HPO ₄, 1.8mM KH ₂PO ₄, transfer pH to 7.4.

3, compound suppresses the determination of activity experiment

Compound and PTP1B are hatched 10min in advance.Reaction system: reaction buffer (50mMHEPES, pH 7.4,100mM NaCl, 2mM EDTA) 88 μ L, compound or DMSO (being dimethyl sulfoxide (DMSO)) 1 μ L and PTP1B (0.5mg/mL) 1 μ L as the solvent of compound.Add 10 * pNPP (50mM), 10 μ L then in reaction system, measure the OD value at the 410nm place by the BioRAD microplate reader, every 20s reads plate once, reads 40 times, tries to achieve initial velocity of reaction.Three repetitions are all set in all experiments.

Inhibiting rate calculation formula: inhibiting rate (%)=(V ₁-V ₀)/V ₀* 100

(V ₁The initial velocity of enzyme reaction when adding compound, V ₀Initial velocity when adding DMSO)

Can obtain the IC of this compound by measuring the inhibiting rate of compound under different concns to the PTP1B enzymic activity ₅₀Value.3-(2-carboxylbenzoyl)-Oleanolic Acid is to the same PTP1B of inhibition activity determination method of other PTPases.Annotate: DMSO in the experimental design involved in the present invention (dimethyl sulfoxide (DMSO) is as the compound solvent) organizes all as negative control.

4,3-(2-carboxylbenzoyl)-Oleanolic Acid suppresses the mensuration of type to PTP1B

I.e. 0,9,12 μ M and 5 the different concentration of substrate promptly 1,5,10,30 of 3 different 3-(2-carboxylbenzoyl)-Oleanolic Acid concentration have been chosen in this experiment, and 50mM has measured the initial velocity of different concentration of substrate under 3 different inhibitor concentration respectively.Carry out the inhibition type that mapping analysis is judged 3-(2-carboxylbenzoyl)-Oleanolic Acid by Origin7.0 software then.

5, experimental result:

1) compound suppresses determination of activity:

The inhibition activity of 3-(2-carboxylbenzoyl)-Oleanolic Acid to PTP1B, its IC have been measured in this experiment respectively ₅₀=11.8 μ M; also measured it then respectively and several enzymes in the PTPases family have been comprised the inhibition activity of CD45, TCPCP, LAR and PTP α; the result is as shown in table 1; 3-(2-carboxylbenzoyl)-Oleanolic Acid does not suppress active to LAR and PTP α, and CD45 and TCPCP are had the selectivity more than 3 times to PTP1B.

Table 1 3-(2-carboxylbenzoyl)-Oleanolic Acid to the inhibition specific activity of different PTPases

Annotate: "-" expression compound concentration does not suppress active to this enzyme when 100 μ M.

Above result shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid can suppress the activity of PTP1B on molecular level, and other PTPases are had certain selectivity.

2) 3-(2-carboxylbenzoyl)-Oleanolic Acid suppresses the mensuration of type to PTP1B:

I.e. 0,9,12 μ M and 5 the different concentration of substrate promptly 1,5,10,30 of 3 different inhibitor concentration have been chosen in this experiment, and 50mM has measured the initial velocity of different concentration of substrate under 3 different inhibitor concentration respectively.Analyze mapping by Origin7.0 software then.On behalf of the straight line of different inhibitor concentration, the result intersect at the coordinate axis Y-axis for three as shown in Figure 1, and according to the enzyme kinetics theory, 3-(2-carboxylbenzoyl)-Oleanolic Acid is the competitive inhibitor of PTP1B, and it suppresses constant K i value is 16.89 μ M.

Experimental example 2: cell levels test compounds 3-(2-carboxylbenzoyl)-Oleanolic Acid is to the effect of enhanced sensitivity of insulin signaling pathway

The present invention has tested 3-(2-carboxylbenzoyl)-Oleanolic Acid to two the signaling molecule-insulin receptors (IR) of Regular Insulin path and the influence of AKT phosphorylation level, the phosphorylation level direct reaction of these two signaling molecules the susceptibility of insulin signaling pathway.

1, experimental principle

After the insulin receptor combination on Regular Insulin and the cytolemma, insulin receptor generation autophosphorylation also activates the conduction of downstream signal, AKT is also activated by phosphorylation subsequently, finally activates glucose transporter 4 (Glut4), makes it insert to the transportation of carrying out glucose on the cytolemma.PTP1B can be with the IR dephosphorylation as the negative regulatory factor of Regular Insulin path, thereby suppresses the transmission of insulin signaling.Therefore, the activity that has suppressed PTP1B will increase the phosphorylation level of IR and AKT.

2, experiment material

1) cell cultures: the HepG2 cell, cultivate in 12 orifice plates with α-MEM substratum (adding 10%FBS) that (culture condition is 37 ℃, 5%CO ₂).

2) employed antibody of experiment and use Dilution ratio:

A. one is anti-: phosphorylation insulin receptor (IR) antibody: phospho-IGF-I Receptor beta (Tyr1135/1136)/Insulin Receptor beta (Tyr1150/1151) is (1: 1000, Cell Signaling technology company) (19H7); Total insulin receptor antibody: anti-Insulin Receptorbeta (1: 1000, Cell Signaling technology company); Phosphorylation AKT antibody: anti-phospho-AKT (Ser473) (1: 1000, Cell Signaling technology company); Total AKT antibody: anti-AKT (1: 1000, Cell Signaling technology company); GAPDH (1: 10,000, the Kang Cheng biology).

B. two is anti-: anti-Rabbit (1: 5000, Jackson), anti-mouse (1: 10,000, AbCam company limited).

3, IR under the insulin stimulating and AKT phosphorylation level test experiments

The HepG2 cell is cultivated in 12 orifice plates with α-MEM substratum (adding 10%FBS); α-the MEM that substratum is changed into serum-free when cell grows to 90～100% density carries out serum starvation; hatch 3-(2-the carboxylbenzoyl)-Oleanolic Acid or the DMSO of 10～20 μ M positive compound Compound-2 (the positive inhibitor of PTP1B, structural formula is as follows) or different concns simultaneously.After chemical combination is hatched 4h, change substratum into the serum-free α-MEM substratum that contains 16.7nM Regular Insulin, insulin stimulating 3min.Ice-cold then PBS washes and stops for 3 times stimulating, and adds SDS sample buffer (60 μ g/ hole) lysing cell, with the cracked cell harvesting, carries out the phosphorylation level that Western blot experiment detects IR and AKT.

The Compound-2 structural formula

The main experiment parameter of Westem blot: test employed antibody ratio described in the experiment material.Get each 8 μ L of above-mentioned sample and carry out SDS-PAGE, after electrophoresis was intact, the semidrying electricity changeed 2h.The pvdf membrane that electricity takes a turn for the better is room temperature sealing 30min in confining liquid, resists 4 ℃ of overnight incubation with corresponding one again.Then, wash film, 5min time, wash 3 times with the TBST damping fluid.TBST is removed in suction, pvdf membrane and two is resisted at incubated at room 1.5h again.Then wash pvdf membrane, 5min/ time, wash 3 times with the TBST damping fluid.(Pierce) toning system develops for Horseradish Peroxidase, HRP to use horseradish peroxidase at last.

4, experimental result

The present invention has investigated the influence to two the crucial effector-IR and the AKT phosphorylation level of Regular Insulin path of 3-(2-carboxylbenzoyl)-Oleanolic Acid; as previously mentioned PTP1B can negative regulation insulin signaling pathway; can weaken the phosphorylation level of IR and AKT, the inhibitor of PTP1B then can reverse this effect.The result almost detects the phosphorylation less than IR or AKT as shown in Figure 2 when not having insulin stimulating, the phosphorylation level of IR or AKT obviously strengthens behind the insulin stimulating 3min.The positive inhibitor Compound-2 of PTP1B can strengthen the phosphorylation level of IR and AKT under the insulin stimulating significantly; 3-(2-carboxylbenzoyl)-Oleanolic Acid can strengthen the phosphorylation level of IR and AKT equally significantly as the inhibitor of PTP1B, and has concentration dependent.

Above-mentioned result of study shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid can strengthen the susceptibility of Regular Insulin path significantly on cell levels.

Experimental example 3:3-(2-carboxylbenzoyl)-Oleanolic Acid is to 11 β-HSD ₁Inhibition determination of activity experiment

The present invention is by obtaining people source 11 β-HSD at escherichia coli expression and purifying ₁, measured 3-(2-carboxylbenzoyl)-Oleanolic Acid and its sodium salt to 11 β-HSD ₁Suppress active, result of study shows that this compound and sodium salt thereof can both suppress 11 β-HSD ₁Activity.

1, experimental principle:

11 β-HSD ₁Be a kind of dependent oxydo-reductase of NADP (H) of low-affinity, 11 β-HSD that the vivoexpression purifying obtains ₁Mainly show as oxidation activity.At NADP ⁺Exist the time, Cortisol is at 11 β-HSD ₁Catalysis under its C11 position hydroxyl be oxidized to ketone group, and NADP ⁺Then therefore be reduced and generate NADPH, the latter has photoabsorption at the 340nm place, and the variation (per minute is read once, reads 40 times) that detects 340nm place's photoabsorption on the TECAN microplate reader just can calculate 11 β-HSD ₁Initial velocity of reaction (V ₀).

2,3-(2-carboxylbenzoyl)-Oleanolic Acid and sodium salt thereof are to 11 β-HSD ₁Inhibition determination of activity experiment

1) 11 β-HSD ₁Expression and purifying

With people source 11 β-HSD ₁(aa24～292) dna sequence dna is cloned in the pET28a prokaryotic expression carrier, with recombinant plasmid pET28a_11 β-HSD ₁Be transformed in the e. coli bl21 (DE3), at 20 ℃, 0.1mM isopropyl-(IPTG), abduction delivering 3h under the condition of 0.25mM Kendall compound collects thalline and places-80 ℃ more than the frozen 1h.Get a pipe bacterial sediment (0.5L) add 10～15mL lysis buffer (30mM CHAPS, 50mM Tris-HCl, 150mM NaCl, the 3mg/mL N,O-Diacetylmuramidase, pH8.6), after fully suspending, stirring at room 0.5～1h.Ultrasonic 30s, 13,000rpm, 30min, get supernatant liquor in the Ni post in conjunction with 4 hours.Wash-out: after allowing solution in the pillar pass freely through, with the elution buffer (+4mMCHAPS that contains the 40mM imidazoles, pH8.0) 10 column volumes of wash-out, the elution buffer (+4mMCHAPS that contains the 60mM imidazoles, pH8.0), (+4mMCHAPS, pH8.0) wash-out obtains target protein to contain the elution buffer of 500mM imidazoles with 20mL at last.This albumen is carried out dialysis in the 500mL dialysis buffer liquid (20mM Tris, 500mM NaCl, 4mM CHAPS), changed liquid once in 3 hours, totally three times.Protein concentration is concentrated to more than the 0.5mg/mL the every pipe packing of 100 μ L ,-80 ℃ of preservations.

2) compound suppresses the determination of activity experiment

With 3-(2-carboxylbenzoyl)-Oleanolic Acid, 3-(2-carboxylbenzoyl)-Oleanolic Acid disodium salt or DMSO and 11 β-HSD ₁At reaction buffer (50mM Tris, 150mM NaCl, 0.5mM EDTA, 0.01%Brij35, NADP ⁺) in hatch 10min in advance, the Cortisol that adds final concentration then and be 180 μ M starts reaction.Measure the acquisition initial velocity of reaction by the TECAN microplate reader.

Inhibiting rate calculation formula: inhibiting rate (%)=(V ₁-V ₀)/V ₀* 100.

(V ₁The initial velocity of enzyme reaction when adding compound, V ₀Initial velocity when adding DMSO)

Can obtain this compound to 11 β-HSD by measuring the inhibiting rate of compound under different concns ₁IC ₅₀Value.This experiment is with 11 β-HSD ₁Inhibitor glycyrrhetinic acid (Glycyrrhetinicacid, GA) positive compound.

3, experimental result

1) 11 β-HSD ₁Expression and purifying

11 β-HSD ₁Be a transmembrane protein that is combined on the endoplasmic reticulum, its total length is difficult to obtain by the prokaryotic expression purifying, and the present invention is at expression in escherichia coli and obtained the 11 β-HSD of truncation type by the method purifying of nickel post affinity chromatography ₁Albumen (24～292 amino acids promptly do not comprise and stride the film district), by SDS-PAGE electrophoresis detection result as shown in Figure 3,11 β that obtained-HSD ₁About 29kDa, purity is higher relatively.

2) 3-(2-carboxylbenzoyl)-Oleanolic Acid and sodium salt thereof suppress the determination of activity experiment

The exactness of the enzyme activity determination platform of setting up in order to verify, the present invention has at first measured positive compound GA to 11 β-HSD ₁The inhibition activity, record IC ₅₀=12.1nM, close with 30～40nM of bibliographical information, show that the enzyme live system of being set up is correctly credible.Based on this platform, the present invention has measured 3-(2-carboxylbenzoyl)-Oleanolic Acid to 11 β-HSD ₁The inhibition activity, record IC ₅₀=9.78 μ M.Simultaneously, further detection 3-(2-carboxylbenzoyl)-Oleanolic Acid disodium salt is to 11 β-HSD ₁The inhibition activity, the result shows that its sodium salt also has and suppresses active (accompanying drawing 4).

The above results shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid and sodium salt thereof can suppress 11 β-HSD on enzyme running water is flat ₁Activity.

Experimental example 4:3-(2-carboxylbenzoyl)-Oleanolic Acid is to the antagonistic activity determination experiment of glucocorticoid receptor (GR)

The method that the present invention adopts luciferase (luciferase) reporter gene of glucocorticoid receptor response element (GRE) regulation and control to detect has been measured the antagonistic activity of 3-(2-carboxylbenzoyl)-Oleanolic Acid to GR.The result shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid can concentration dependent ground antagonism GR activity.

1, experimental principle:

In tenuigenin, GR with can recruit the co-activation factor after glucocorticosteroid combines, and dimerization forms homodimer, the latter go into the nuclear back under the assistance of other associated transcription factors, act on the glucocorticoid receptor response element (GRE) of target gene thus go up transcribing of regulation and control target gene.To contain two GRE consensus motifs dna sequence dna (5 '- TGTACAGGATGTTCTCTCTGCCTCTGC TGTACAGGATGTTCT-3 ') be cloned in the pGL3-promoter vector and obtain recombinant vectors pGL3-GRE-Luc, in this recombinant vectors, firefly luciferase gene (luciferase reporter gene) transcribe the control that only is subjected to response element GRE.Therefore, the activity of Photinus pyralis LUC just is equivalent to the transactivation activity of GR.In this system, corotation pRL-SV40 plasmid, luciferase is expressed under the control of SV40 strong promoter, and the activity of measuring this luciferase is then eliminated owing to the different errors of bringing of transfection efficiency with this as confidential reference items.

2, experiment material and method:

1) cell cultures: (culture condition is 37 ℃ to the HEK-293 cell, 5%CO in the cultivation of DMEM substratum (10%FBS) lining ₂).

2) mensuration of the luciferase reporter gene of transient transfection and GRE regulation and control: the liposome transfection method is carried out with reference to the Lipo2000 of Invitrogen company reagent specification sheets.HEK-293 cell kind is on 24 orifice plates, when cell grows to 50～70% density, transient cotransfection pGL3-GRE-Luc and GR eukaryon expression plasmid pEGFP-GR and confidential reference items plasmid pRL-SV40, transfection after 12 hours changes substratum into DMEM (10%FBS), adding compound simultaneously hatches, inhale after 18 hours and remove substratum, PBS washes once, with Luciferase test kit (Promega) lysing cell and measure Photinus pyralis LUC and the activity of confidential reference items luciferase (the Luciferase measuring method carries out with reference to the Luciferase of Promega company test kit specification sheets).

3, experimental result:

Dexamethasone (Dex) is the GR part of synthetic, and can cause latter's conformational change after GR combines, and recruits the co-activation factor and incorporates nuclear promotes to have the GRE sequence in promotor expression of gene into.Ru486 is the antagonist of GR, can stop the part of GR such as Dex to combine with GR.The present invention utilizes the luciferase reporter gene method for measuring of GRE regulation and control, has measured the antagonistic activity of 3-(2-carboxylbenzoyl)-Oleanolic Acid to GR in the HEK-293 cell.The result as shown in Figure 5, the transactivation activity that Dex (0.1 μ M) can exciting GR, about 4 times of agonist activity.And the effect of Ru486 (1 μ M) energy strongly inhibited Dex.3-(2-carboxylbenzoyl)-Oleanolic Acid also can concentration relies on the exciting effect of ground antagonism Dex, and antagonistic activity is more remarkable when concentration is 10 μ M.

The above results shows, the transactivation activity that 3-(2-carboxylbenzoyl)-Oleanolic Acid can antagonism GR shows as the antagonist of GR.

Dexamethasone formula R u486 structural formula

Experimental example 5:3-(2-carboxylbenzoyl)-Oleanolic Acid is to nuclear receptor LXR α: the agonist activity determination experiment of RXR α heterodimer

The present invention has tested 3-(2-carboxylbenzoyl)-Oleanolic Acid to LXR α by the luciferase reporter gene method for measuring of LXR cis response element (LXRE) regulation and control on cell levels: the transactivation activity of RXR α heterodimer.Result of study shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid has the exciting LXR α in concentration dependent ground: the transactivation activity of RXR α heterodimer.

1, experimental principle:

In tenuigenin, LXR α and RXR α form heterodimer and recruit the co-activation factor, start this gene transcription thereby go into nuclear then on the LXRE that acts on target gene under the assistance of other associated transcription factors.LXRE is cloned in the pGL3-promoter vector makes up recombinant vectors pGL3-LXRE-Luc, in this recombinant vectors, firefly luciferase gene transcribe the control that only is subjected to response element LXRE.Therefore, the activity of Photinus pyralis LUC just is equivalent to LXR α: the transactivation activity of RXR α.With pCDNA3.1-LXR α, pCDNA3.1-RXR α, pGL3-LXRE-Luc and confidential reference items plasmid pRL-SV40 cotransfection are in cell, and by measuring Photinus pyralis LUC and confidential reference items uciferase activity respectively, the ratio of the two promptly characterizes LXR α: the transactivation activity of RXR α.

2, experiment material and method

1) cell cultures: the culture condition of HEK-293 cell is with experimental example 4.

2) luciferase reporter gene of transient transfection and LXR cis response element regulation and control is measured: the liposome transfection method is carried out with reference to the Lipo2000 of Invitrogen company reagent specification sheets.HEK-293 cell kind is on 24 orifice plates, when cell grows to 50～70% density, utilize liposome transient cotransfection pGL3-LXRE-Luc, pCDNA3.1-LXR α, pCDNA3.1-RXR α and confidential reference items plasmid pRL-SV40, transfection is changed liquid with substratum after 12 hours and is become DMEM (10%FBS), adding compound simultaneously hatched 18 hours, substratum is removed in suction, PBS washes once, with Luciferase test kit (Promega) lysing cell and measure Photinus pyralis LUC and the activity of confidential reference items luciferase (the Luciferase measuring method carries out with reference to the Luciferase of Promega company test kit specification sheets).This experiment is with the positive compound of TO901317 (LXR part).

The TO901317 structural formula

3, experimental result

TO901317 is the part of liver X receptor (LXR α), when its with can impel after LXR α combines the latter to recruit the co-activation factor and form heterodimer with RXR α, this heterodimer acts on the LXRE after going into nuclear, thereby promotes to have in promotor the expression of gene of LXRE sequence.The present invention utilizes the luciferase reporter gene method for measuring of LXR cis response element regulation and control to measure 3-(2-carboxylbenzoyl)-Oleanolic Acid to LXR α: the agonist activity of RXR α heterodimer.The result as shown in Figure 6; TO901317 (1 μ M) is to LXR α: RXR α has nearly 2.5 times agonist activity; 3-(2-carboxylbenzoyl)-Oleanolic Acid energy concentration dependent exciting LXR α in ground: RXR α transactivation activity shows as LXR α: the agonist of RXR α heterodimer.

Experimental example 6:3-(2-carboxylbenzoyl)-Oleanolic Acid is to the experiment of glucose transporter 4 (Glut4) expression level regulation and control

The present invention has tested the influence of 3-(2-carboxylbenzoyl)-Oleanolic Acid to the Glut4 expression level by the experimental techniques such as luciferase (luciferase) reporter-gene assays, real-time fluorescence quantitative PCR method and Western blot of Glut4 promoter regulation, and the result shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid can increase mRNA and the protein expression level of Glut4.

1, experimental principle

Glucose transporter 4 (Glut4) mainly is distributed in insulin replies tissue such as muscle and fatty tissue, it body cell carry out glucose absorption keep play a part in the blood glucose balance crucial.Studies show that the heterozygote Glut4 of Glut4 gene knockout (+/-) mouse shows the performance of insuline resistance syndrome, and introduces the activity that Glut4 can recover whole Regular Insulin again.

1) mensuration of the luciferase reporter gene of Glut4 promoter regulation

Promotor is an integral part of gene, and it is controlling the time of origin of genetic expression (transcribing) and the degree of expression.The promoter region of Glut4 gene is cloned in the pGL3-basic carrier, make up pGL3-Glut4 promotor-luc recombinant vectors, in this recombinant vectors, firefly luciferase gene transcribe the control that only is subjected to the Glut4 promotor, so the activity of Photinus pyralis LUC just directly reflects Glut4 expression of gene level.

2) real-time fluorescence quantitative PCR method experiment

The mRNA level is the direct reflection of a gene transcription level.With the total mRNA of cell extract and reverse transcription become the first chain cDNA, as template, can carry out quantitative analysis to the template level by real-time fluorescence quantitative PCR.In the real-time fluorescence quantitative PCR reaction, introduced a kind of fluorescence chemical material, carrying out along with the PCR reaction, the PCR reaction product constantly adds up, fluorescence signal intensity also equal proportion increases, in the fluorescent signal index amplification stage, there is linear relationship between the logarithmic value of PCR product amount and the starting template amount.Set a threshold value on fluorescent signal index amplification stage optional position, the cycle number CT value that is experienced when arriving this preset threshold according to the fluorescent signal in each reaction tubes then (threshold value, threshold value) characterizes the template level.

3) Western blot experiment: in adipocyte, have the proteic expression of Glut4.Differentiation 3T3-L1 cell is using compound treatment after 24 hours, ice-cold PBS washes 3 times, add SDS sample buffer (60 μ g/ hole) lysing cell, with the cracked cell harvesting, with the proteic expression level of Glut4 antibody test Glut4, glyceraldehyde 3-phosphate dehydro-genase (GAPDH) is not subjected to the influence of compound as its expression level of house-keeping gene, can eliminate systematic error as confidential reference items.

2, experiment material and method

1) cell cultures: the culture condition of HEK-293 cell is with experimental example 4.

2) mensuration of the luciferase reporter gene of transient transfection and Glut4 promoter regulation: the HEK-293 cell cultivates in 24 orifice plates with DMEM substratum (10%FBS) that (culture condition is 37 ℃, 5%CO ₂), when cell grows to 50～70% density, change serum-free DMEM substratum into, utilize liposome method cotransfection pGL3-Glut4 promotor-luc (0.2 μ g/ hole) and confidential reference items pRL-SV40 (0.05 μ g/ hole) plasmid, transfection is changed liquid with substratum after 12 hours and is become DMEM (10%FBS), adding compound simultaneously hatched 18 hours, substratum is removed in suction, PBS washes once, with Luciferase test kit (Promega) lysing cell and measure Photinus pyralis LUC and the activity of confidential reference items luciferase (the Luciferase measuring method carries out with reference to the Luciferase of Promega company test kit specification sheets).This experiment is with the positive compound of TO901317 (LXR part).

3) adipocyte is cultivated in 6 orifice plates with DMEM (10%FBS) before the cultivation of 3T3-L1 cell and induce differentiation: the 3T3-L1, continue to cultivate 2 days after growing to 100% density, nutrient solution changes the DMEM that contains 10%FBS into and adds 1 μ g/mL Regular Insulin (insulin), 0.5mM isobutyl methyl xanthine (isobutylmethylxanthine, MIX) and 1 μ M dexamethasone (dexamethasone, Dex) (Sigma), induced 3 days, to remove MIX and Dex at the 4th day, with containing 10%FBS, the DMEM of 1 μ g/mL insulin continued to induce 3 days, changed DMEM (10%FBS) at the 7th day into and cultivated, and changed liquid once in after this per 2 days.Hatched compound on the 8th day in differentiation, hatch the extracting or the Western blot that carry out total RNA after 24 hours and detect Glut4mRNA or protein expression level.

4) total mRNA extracting and real-time fluorescence quantitative PCR method: with the 3T3-L1 cell total rna (with reference to Promega test kit specification sheets) of TRIZOL method extracting differentiation, the first chain cDNA is synthetic to carry out according to Shanghai JaRa company reverse transcription test kit specification sheets.With this cDNA is template, by real-time fluorescence quantitative PCR, is that confidential reference items can carry out quantitative analysis to the template level with GAPDH.Used primer sequence among the RT-PCR:

5) Western blot experiment significant parameter: one is anti-: Glut4 antibody (1: 1,000, Santa Cruz company), GAPDH (1: 10,000, the Kang Cheng biology); Two is anti-: anti-Rabbit (1: 5,000, Jackson company), anti-mouse (1: 10,000, AbCam company limited).

3, experimental result:

Studies show that the Glut4 expression of gene is subjected to the regulation and control of LXR in adipocyte, people find to have the existence of LXR cis-acting elements (LXRE) in the promotor of Glut4.TO901317 can promote the proteic expression of Glut4 (1) in the adipocyte as the part of LXR.The present invention has at first analyzed the agonist activity of 3-(2-carboxylbenzoyl)-Oleanolic Acid to the Glut4 promotor by the luciferase reporter gene method for measuring of Glut4 promoter regulation; the result is shown in Fig. 7 A; compare with contrast DMSO treatment group; TO901317 (5 μ M) has about 3 times agonist activity to the Glut4 promotor; and the agonist activity of 3-(2-carboxylbenzoyl)-Oleanolic Acid is more remarkable than TO901317, and has concentration dependent.Then; the present invention has also measured the transcriptional level of Glut4 mRNA by the method for real-time fluorescence quantitative PCR; the result is shown in Fig. 7 B; the transcriptional level of Glut4 mRNA in 1.5 times of exciting 3T3-L1 adipocytes in ground of TO901317 (5 μ M) energy; and Comparatively speaking; the exciting effect of 3-(2-carboxylbenzoyl)-Oleanolic Acid is obviously stronger, and has concentration dependent.In order to further specify 3-(2-carboxylbenzoyl)-Oleanolic Acid to the agonist activity on the Glut4 protein expression level, last the present invention also investigates by the method for Western blot.Result's consistent (as shown in Figure 8) of result and above-mentioned two kinds of measuring methods, promptly 3-(2-carboxylbenzoyl)-Oleanolic Acid can the proteic expression level of the exciting Glut4 in concentration dependent ground.

Above-mentioned result of study shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid has tangible reinforced effects to the expression level of being responsible for the crucial effector-Glut4 of glucose transport in the adipocyte.

Experimental example 7:3-(2-carboxylbenzoyl)-Oleanolic Acid anti-diabetic animal model experiment method and result

The fasting blood glucose level of the present invention by measuring type ii diabetes model mouse behind abdominal injection 3-(2-carboxylbenzoyl)-Oleanolic Acid, tested of the influence of 3-(2-carboxylbenzoyl)-Oleanolic Acid to type ii diabetes model mouse blood sugar; the result shows that 3-(2-carboxylbenzoyl)-Oleanolic Acid has good hypoglycemic activity, and has concentration dependent.

1, experimental principle:

Streptozotocin (STZ) is a kind of antibiotic and antitumor drug, can be to animal (dog, rabbit, monkey, rat, mouse etc.) the beta Cell of islet selective destruction of some kind, and produce diabetes.STZ, can be acted on beta Cell of islet specifically and cause its structure deteriorate and the insulin secretion function obstacle by the glucose transporter of low-affinity on the beta Cell of islet (GLU T2) transhipment owing to the glucose moiety structure that itself contains.Exogenous insulin suppresses the expression of Regular Insulin in GLUT2 and the β cell, can stop that STZ's cause the diabetes effect.Its internal dysentery is less relatively, and surviving rate is higher, is the more a kind of method for preparing diabetes animal model of using both at home and abroad at present.It is generally acknowledged, it is heavy dose of that (40～90mg/kg) STZ abdominal cavity or vein can directly destroy beta Cell of islet, multiple low dose (15mg/kg) injection STZ constantly destroys the β cell by immunologic mechanism to cause diabetes, constantly destroys relevant with the β cell of T cell mediated.

2, materials and methods

1) laboratory animal:

3 age in week 40 of male SPF level C57BL6 mouse, available from Chinese Academy of Sciences's Shanghai Experimental Animal Center, body weight 10 ± 2g.Animal is divided into normal group, model group, group of solvents, 2.5,5mg/kg group, 8 every group at random.

2) foundation of type ii diabetes model:

After high lipid food raised for 4 weeks, (STZ, 100mg/kg) abdominal injection was 1 time for streptozotocin.Continue high lipid food and fed for 3 weeks, during monitoring blood glucose value several times, totally 7 weeks.Not modeling of normal group, only the feeding normal diet is freely drunk water.

3) research of 3-(2-carboxylbenzoyl)-anti-type ii diabetes of Oleanolic Acid:

Not administration of normal group; Group of solvents abdominal injection 2.5%Tween80; Other is organized equal abdominal injection and is dissolved in relative medicine in the 2.5%Tween80 solvent.After 4 weeks of administration, adopt blood glucose meter (Luo Shi, Accu-CHEK Active) the monitoring blood glucose value after 12 hours on an empty stomach.

3, experimental result:

It is one of biochemical indicator of treatment type ii diabetes that glucose level reduces; by detecting activity, result that 3-(2-carboxylbenzoyl)-Oleanolic Acid influences the anti-type ii diabetes of estimating this compound to the glucose level of type ii diabetes model mouse as shown in Figure 9; 3-(2-carboxylbenzoyl)-Oleanolic Acid has good hypoglycemic activity, and has concentration dependent.Illustrate that this compound has certain therapeutic action to type ii diabetes, have potential treatment of obesity effect simultaneously.

Claims (6)

1, following 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt of structural formula:

2,3-according to claim 1 (2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt is characterized in that, described salt is 3-(2-carboxylbenzoyl)-Oleanolic Acid disodium salt, di-potassium or di-ammonium salts.

3, claim 1 or 2 described 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt are used for the treatment of purposes in the medicine of diabetes and/or obesity in preparation.

4, purposes as claimed in claim 3 is characterized in that, described diabetes are the type ii diabetes that caused by insulin resistant.

5, purposes as claimed in claim 3; it is characterized in that described 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt are as protein-tyrosine phosphatase 1B inhibitor, 11beta-Hydroxysteroid dehydrogenase 1 inhibitor, glucocorticoid receptor antagonists and nuclear receptor LXR α: RXR α heterodimer agonist.

6, a kind of diabetes that cause by insulin resistant and/or pharmaceutical composition of obesity of being used for the treatment of; it is characterized in that; comprise claim 1 or 2 described 3-(2-carboxylbenzoyl)-Oleanolic Acid or its physiologically acceptable salt for the treatment of effective dose, and can further comprise pharmaceutically conventional auxiliary material.

Images