CN101503736A - Use of retinoic acid induced gene I, signal pathway mediated by coding protein thereof - Google Patents
Use of retinoic acid induced gene I, signal pathway mediated by coding protein thereof Download PDFInfo
- Publication number
- CN101503736A CN101503736A CNA2009100766556A CN200910076655A CN101503736A CN 101503736 A CN101503736 A CN 101503736A CN A2009100766556 A CNA2009100766556 A CN A2009100766556A CN 200910076655 A CN200910076655 A CN 200910076655A CN 101503736 A CN101503736 A CN 101503736A
- Authority
- CN
- China
- Prior art keywords
- rig
- induced gene
- medicine
- acid induced
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses novel use of a signal passage of a retinoic acid inducible gene I and a protein mediate coded by the retinoic acid inducible gene. The novel use is application of the signal passage of the retinoic acid inducible gene I, or the protein coded by the retinoic acid inducible gene I, or the protein mediate in designing and/or screening medicaments. Tests prove that the signal passage of the RIG-1 gene, or RIG-1 protein or RIG-1 protein mediate is used as a target point to prepare a medicament; and by lowering or inhibiting the RIG-1 and signal passage molecules of the RIG-1, the expression of genes related to inflammation diseases, such as an IL-8 gene, a GRO-alfa gene and the like, is effectively inhibited, and the incidence rate of various inflammation diseases is reduced, and the state of illness of the inflammation diseases is relieved. Therefore, the RIG-1 is used as the target point to prevent and/or treat a series of inflammation diseases so as to provide a novel idea for developing medicaments, and be about to be widely applied in fields of medicament preparation and prevention and treatment of the inflammation diseases.
Description
Technical field
The present invention relates to the new purposes of the signal path of retionic acid induced gene I and mediated by coding protein thereof.
Background technology
Vitamin A acid induced gene I (RIG-I, Retinoic acid-Inducible Gene-I) induces the differentiation acute promyelocytic leukemia as far back as vitamin A acid, and (acute promyelocytic leukemia finds up-regulated in APL), and hence obtains one's name.People source RIG-I encoding gene (Genbank NW_001839149) is positioned at karyomit(e) No. 9, has 18 exons, and encoded protein has 925 amino acid; Mouse source RIG-I encoding gene (Genbank NM_172689) is positioned at karyomit(e) No. 4, has 18 exons equally, and encoded protein then has 926 amino, reaches 81% with people's source protein similarity.People such as Yoneyama found that the RIG-I molecule was being caused to have vital role in the antiviral signal path by dsRNA in 2004, and from then on RIG-I is widely regarded as the dsRNA acceptor that is independent of TLR (Toll-like Receptor) in the innate immune response, is present in cell cytoplasm.RIG-I belongs to the rna helicase enzyme family that contains the DExD/H sequence, cross express the back it by himself C end helicase structural domain identification and in conjunction with the dsRNA of virus, be positioned at C end two placed in-line CARD (caspase recruitmentdomain) structural domain and activate IRF3 and NF-κ B, transmit signal downstream, cause the activation of downstream IFN-β, thereby bring into play its antiviral physiological function.After RIG-I was knocked out, cell can not produce I type Interferon, rabbit and inflammatory factor after being subjected to virus infectiones such as Sendai Virus, NDV and VSV again.
RIG-I can also be induced: IL-1b can induce RIG-I in people's Gingival Fibroblasts by a lot of cytokines except being induced by vitamin A acid and virus; IFN-γ can induce RIG-I in human umbilical vein's epidermic cell (HUVEC), smooth muscle cell (SMC), breast cancer cell (MCF-7) and Urothelial Cell (T24); IFN-α and TNF-α associating can be induced RIG-I in lung epidermic cell (A549).2005, people such as Imaizumi reported that LPS can induce RIG-I at epidermic cell (HUVEC), and crossed expression RIG-I and can raise cyclooxygenase 2 (cuclooxygenase-2, expression COX-2) and activate its promoter region.
Summary of the invention
An object of the present invention is to provide the new purposes of the signal path of retionic acid induced gene I and mediated by coding protein thereof.
The application of the signal path that a kind of new purposes provided by the present invention is retionic acid induced gene I and mediated by coding protein thereof in design and/or screening of medicaments.
The new purposes of another kind provided by the present invention is the application of material in the preparation medicine of target spot for the signal path with retionic acid induced gene I and mediated by coding protein thereof.
Wherein, described medicine can be the medicine that is used to prevent and/or treat inflammation related disease.
Described medicine specifically can be the medicine that is used to prevent and/or treat atheromatosis.
Described medicine is specially the medicine that is used to suppress the interleukin 8 factor expression.
The material that described signal path with retionic acid induced gene I and mediated by coding protein thereof is a target spot is a nucleic acid.
The medicine that is used to prevent and/or treat inflammation related disease that it is target spot that another object of the present invention provides a kind of signal path with retionic acid induced gene I and mediated by coding protein thereof.
Any activeconstituents that it is target that the activeconstituents of described medicine can be nucleic acid or other signal path with retionic acid induced gene I and mediated by coding protein thereof.
Above-mentioned arbitrary described nucleic acid can be the siRNA that suppresses described retionic acid induced gene I and express, the described retionic acid of carrier, expression inhibiting of the described siRNA of expression is induced the carrier of the shRNA of I type genetic expression, induced I type gene generation homologous recombination and suppress the carrier that described retionic acid is induced the homologous sequence of I type genetic expression or contained described homologous sequence with described retionic acid.
The loop-stem structure that above-mentioned arbitrary described shRNA can be made of stem I, ring and stem II; The sequence of described stem I is 5 ' AGUGGAAUCACGGAUUAGCTT3 ', and the sequence of described stem II is 5 ' GCUAAUCCGUGAUUCCACU3 '; The coding DNA of described shRNA is 5 '-GATCCCCAGTGGAATCACGGATTAGCTTCAAGAGAGCTAATCCGTGATTCCACTTT TTTA-3 '.
Described medicine can be the medicine that is used to suppress the interleukin 8 factor expression.
Last purpose of the present invention provides a kind of inflammation related disease diagnostic kit.
Inflammation related disease diagnostic kit provided by the present invention comprises the material of the protein expression level that detects retionic acid induced gene I or this genes encoding.
The application of material in preparation inflammation related disease diagnostic kit that detects the protein expression level of retionic acid induced gene I or this genes encoding also belongs to protection scope of the present invention.
Wherein, described material can be and is used to increase the RT-PCR primer of retionic acid induced gene I and/or the antibody of this gene coded protein.
Experimental results show that, the present invention obtains the signal path of retionic acid induced gene I and mediated by coding protein thereof as target spot medicine, by being in harmonious proportion expression or inhibition and the downward modulation RIG-I signal path molecule that suppresses RIG-I down, effectively suppressed the expression of some factors relevant with diseases associated with inflammation, as the IL-8 factor, and then reduced the morbidity risk rate of multiple diseases associated with inflammation and alleviated the state of an illness of diseases associated with inflammation.Therefore, the signal path of RIG-I and mediation thereof is carried out a series of diseases associated with inflammation as target spot, as preventing and/or treating of atherosclerosis etc., for drug development provides new approaches, will be in the middle widespread use of preventing and/or treating of medication preparation and diseases associated with inflammation.
Description of drawings
The result that Fig. 1 induces RIG-I to express for the 25-hydroxycholesterol.
The result that Fig. 2 induces RIG-I to express for high sugar.
Fig. 3 is the protein expression situation of RIG-I in the cell of transfection interfere plasmid, and the situation of transcribing of interfering RIG-I and IL-8 in the cell behind the RI-I.
Fig. 4 is the expression of RIG-I in the scavenger cell in the peripheral blood of scavenger cell and normal people in the Atheromatosis human peripheral.
Fig. 5 is the influence of the molecule in the signal path of RIG-I mediation to IL-8.
Embodiment
Employed experimental technique is ordinary method if no special instructions among the following embodiment.
Used material, reagent etc. if no special instructions, all can be bought from market company among the following embodiment.
HUVEC is a Human umbilical vein endothelial cells, separates obtaining from the neonatal umbilical cord vein that exsomatizes.
THP-1 is people's monocyte type lymphoma cell, and available from U.S. ATCC company, catalog number is TIB-202.
RIG-I is a retionic acid I type gene, and IL-8 is the interleukin 8 factor, and 25-HC is 25 hydroxycholesterols.
Buddhist ripple ester is available from U.S. merck company, and catalog number is 524400; The pSUPER carrier is available from U.S. OligoEngine company, and catalog number is VEC-PRT-0001/0002.
The expression that embodiment 1,25-hydroxycholesterol and high concentration glucose can be induced RIG-I
(1) expression that 25-HC induces RIG-I in HUVEC
From the neonatal umbilical cord vein that exsomatizes, separate endotheliocyte HUVEC, behind the bed board 24 hours, stimulate with 5ug/ml25-HC (every hole adds 5ug25-HC), receive sample behind 4h, 8h, 16h, the 24h, detect at RNA and protein level respectively that RIG-I is proteic to be induced, simultaneously detect inducing of IL-8, with in contrast without any inductive cell at rna level.
RIG-I rna level detection method is RT-PCR.Extract RNA with trizol, reverse transcription obtains cDNA, detects the expression of RIG-I again with PCR.The primer sequence is: RIG-I: positive-sense strand, 5 '-TCGGCGTTGGAGATGCTA-3 '; Antisense strand, 5 '-TGGAAGAAGGCTTTGAGG-3 '.The result shows that 25-HC can induce transcribing of RIG-I shown in Figure 1A.
RIG-I protein level detection method is the western protein hybridization.Extract total protein of cell, the SDS-PAGE electrophoresis, change film then substep add one anti-two anti-ly, one anti-ly is RIG-I antibody, available from Alexis company, article No. is ALX-804-849.Colour developing at last.The result shows that 25-HC can induce the proteic expression of RIG-I shown in Figure 1B.
The IL-8RNA level detection method is RT-PCR.Extract RNA with trizol, reverse transcription obtains cDNA, detects the expression of RIG-I again with PCR.The primer sequence is IL-8: positive-sense strand, 5 ' TGTGGGTCTGTTGTAGGG3 ', antisense strand, 5 ' GTGAGGTAAGATGGTGGC3 '.The result shows that 25-HC can induce transcribing of IL-8 shown in Figure 1A.
Above result shows that in HUVEC, 25-HC can induce transcribing of RIG-I and IL-8 simultaneously.
(2) induce monocyte THP-1 to be divided into scavenger cell with Buddhist ripple ester
This experiment induction method is according to document (Optimized THP-1 differentiation is requiredfor the detect ion of responses to weak stimuli, Inflammation Research, 1023-3830, E.K.Park) carry out described in: THP-1 cell 1640 culture medium culturing, Buddhist ripple ester class are induced and were made the THP-1 cytodifferentiation become scavenger cell in 72 hours.The THP-1 cell suspension adds Buddhist ripple ester class 6h and just begins adherent growth in substratum, and cell has circle to begin to be transformed into polygon, obtains scavenger cell at last.
RIG-I in the scavenger cell that detection differentiates and IL-8 expression.
The RIG-IRNA level detection method is with consistent in the experiment ().The result shows in scavenger cell that shown in Fig. 1 C 25-HC can induce transcribing of RIG-I.
RIG-I protein level detection method is with consistent in the experiment ().The result shows in scavenger cell that shown in Fig. 1 D 25-HC can induce the proteic expression of RIG-I.
The IL-8RNA level detection method is with consistent in the experiment ().The result shows in scavenger cell that shown in Fig. 1 C 25-HC can induce transcribing of IL-8.
Above result shows that in scavenger cell, 25-HC can induce transcribing of RIG-I and IL-8 simultaneously.
(3) expression that high sugar is induced RIG-I in HUVEC
Separate endotheliocyte HUVEC from the neonatal umbilical cord vein that exsomatizes, bed board stimulated with 30mM glucose after 12 hours, received sample behind 6h, 16h and the 24h, and RIG-I is proteic induces in RNA and protein level detection respectively.
RIG-I rna level detection method is with consistent in the experiment ().The result shows that high sugar can induce transcribing of RIG-I shown in Fig. 2 A.
RIG-I protein level detection method is with consistent in the experiment ().The result shows that high sugar can induce the proteic generation of RIG-I shown in Fig. 2 B.
Above result shows that in HUVEC, high sugar can be induced the expression of RIG-I simultaneously.
The expression of embodiment 2, RIG-I becomes positive correlation with IL-8
One, the expression of the expression of RIG-I and IL-8 is proportionate among the HUVEC
(1) suppresses the expression of RIG-I among the HUVEC by siRNA
1, the structure of interfere plasmid
(1) structure of interfere plasmid
Construction process: in the synthetic sequence of interfering of DNA Synesis Company
5 '-GATCCCCAGTGGAATCACGGATTAGCTTCAAGAGAGCTAATCCGTGATTCCACTTT TTTA-3 is connected on the pSUPER carrier, and the restriction enzyme site of connection is BglII and HindIII, obtains recombinant vectors pSUPER/specific-RNA.
The positive plasmid verification method: by identifying positive colony with EcoRI and two the cutting of HindIII, cut through two, the plasmid of positive colony can obtain the fragment of 281bp, and negative clone then can only obtain the clone of about 227bp.
2, plasmid transfection
Method: recombinant vectors pSUPER/specific-RNA is transfected among the HUVEC by calcium phosphate transfection method.
3,25-hydroxycholesterol is induced RIG-I.
Above-mentioned successful cells transfected was cultivated after 48 hours, with 25-hydroxycholesterol it was stimulated, and after 24 hours, detected the proteic expression of RIG-I at RNA and protein level respectively, detected the expression of IL-8 simultaneously at rna level.With without any transfection but through same stimulated cells, change over to no-specific-RNA (the no-specific-RNA sequence: 5 '-TTCTCCGAACGUGUCACGTTT-3 ') also through same stimulated cells, be contrast also without any transfection without any stimulated cells.
The experimental procedure that changes the no-specific-RNA sequence over to is identical with the experimental procedure that changes interfere plasmid over to.
RIG-I RNA is consistent with testing described in (one) among the embodiment 1 with the protein level detection method.
The IL-8RNA level detection method is with consistent described in the experiment () among the embodiment 1.
RIG-I rna level detected result shows that transcribing of RIG-I is subjected to good restraining, almost do not transcribe generation after RNA disturbs shown in Fig. 3 B.
RIG-I protein level detected result shows that the amount when the RIG-I protein content is induced without 25-hydroxycholesterol with normal cell is identical, and is very low after RNA disturbs as shown in Figure 3A.
IL-8RNA level detection result shows that transcribing of IL-8 is subjected to good restraining, almost do not transcribe generation after RNA disturbs shown in Fig. 3 B; The reduction that shows the transcriptional level of RIG-I directly causes the transcriptional level of IL-8 to reduce.
Among Fig. 3, swimming lane 1 is represented without any transfection also without any stimulated cells, swimming lane 2 expressions are without any transfection but through 25-hydroxycholesterol inductive cell, swimming lane 3 expression changes no-specific-RNA over to also through 25-hydroxycholesterol inductive cell, swimming lane 4 successful transfection interfere plasmids of expression and through 25-hydroxycholesterol inductive cell
To sum up the result shows, in HUVEC, after the expression of RIG-I was suppressed, the expression of 25-hydroxycholesterol inductive IL-8 also reduced greatly, and the reduction of the transcriptional level of RIG-I directly causes the transcriptional level of IL-8 to reduce.
Two, the expression amount of RIG-I and IL-8 in the peripheral blood scavenger cell
From stripped Atheromatosis people's peripheral blood, separate scavenger cell, from stripped normal people's peripheral blood, separate scavenger cell, extract cell whole protein and RNA respectively, respectively with the method detection RIG-I expression amount of RIG-I antibody and RT-PCR, detect the IL-8 expression amount then with the RT-PCR method.
The method of RT-PCR detection RIG-I transcriptional level and primer are all with embodiment 1.The result is shown in Fig. 4 A, and the healthy people's of first swimming lane RIG-I expresses very low, and that label be five patients' the RIG-I expression of " 1,2,3,4,5 " is obviously higher.
The method that RT-PCR detects the IL-8 expression amount is with embodiment 1.The result is shown in Fig. 4 A, and the healthy people's of first swimming lane IL-8 expresses very low, and that label be five patients' the IL-8 expression of " 1,2,3,4,5 " is obviously higher.
IL-8 and RIG-I are higher than the expression among the healthy people in all patients, embody consistence.
The method of RIG-I antibody test RIG-I protein content is with embodiment 1, and RIG-I antibody is available from Alexis company, and article No. is ALX-804-849.The result is shown in Fig. 4 B, and the healthy people's of first swimming lane RIG-I expresses very low, and that label be five patients' the swimming lane RIG-I expression of " 1,2,3,4,5 " is obviously higher.
Among Fig. 4, ct represents isolating scavenger cell in normal people's the peripheral blood, No. 1 patient samples of swimming lane 1 expression, No. 2 patient samples of swimming lane 2 expressions, No. 3 patient samples of swimming lane 3 expressions, No. 4 patient samples of swimming lane 4 expressions, No. 5 patient samples of swimming lane 5 expressions.
To sum up the result shows, still is that protein level all has high-caliber RIG-I amount and IL-8 to measure at gene level in patient's scavenger cell, and all very low at its content of peripheral blood scavenger cell of normal people; The interleukin 8 of the content of high-caliber RIG-I and high expression level (IL-8) is directly proportional in patient.
Comprehensive Experiment one and two shows, suppress RIG-I gene transcription and translation, just can stop inducing action to IL-8 by the RIG-I mediation, show in the protein level intervention and can reach same effect, the expression amount of RIG-I directly has influence on the expression amount of IL-8, both become positive correlation, and RIG-I is a reason that produces IL-8.
The signal path of embodiment 3, RIG-I mediation and IL-8 are expressed as positive correlation
PcDNA3.1 (-) carrier is available from U.S. invitrogene company, and catalog number is SKU#V855-20;
One, MAVS in the signal path of RIG-I mediation and IL-8's is expressed as positive correlation
MAVS is the downstream linkers of the signal path of RIG-I mediation.
1, expressing excessively of MAVS gene can be activated IL-8
The source of MAVS gene (Genbank number NM_020746): obtain by pcr amplification, template is the cDNA that the mRNA reverse transcription of mouse source MEF cell obtains, and primer sequence is as follows: sense primer sequence 5 '
CTCGAGATCTGAGCAGCAATGCCGTT3 ', the antisense primer sequence is 5 '
AAGCTTTTCACTAGTGCAGACGCCGC3 '.
Cut above-mentioned amplified production and pcDNA3.1 (-) carrier with restriction enzyme XhoI and HindIII enzyme, connect, the MAVS gene is inserted into the XhoI and the Hind III site of pcDNA3.1 (-) carrier, and screening, checking obtain containing recombinant vectors pcDNA3.1 (-)/MAVS of MAVS gene.
By the PEI-HUVEC infection protocol recombinant vectors pcDNA3.1 (-)/MAVS is changed in the HUVEC cell.Be contrast simultaneously with the HUVEC cell that changes empty carrier pcDNA3.1 (-) over to, the method that changes over to of empty carrier and recombinant vectors pcDNA3.1 (-)/MAVS to change method over to identical.
Detect the expression of IL-8 in changing the HUVEC cell of recombinant vectors pcDNA3.1 (-)/MAVS over to (one) among the embodiment 1 described method.
The result changes in the HUVEC cell of MAVS gene shown in Fig. 5 A, and the expression of IL-8 is increased; Show that expressing excessively of MAVS gene can activate IL-8.
Among Fig. 5 A, swimming lane 1 expression changes the HUVEC cell of empty carrier pcDNA3.1 (-) over to, and swimming lane 4 expressions change the HUVEC cell of recombinant vectors pcDNA3.1 (-)/MAVS over to.
2, can suppress the expression of GRO-α behind the MAVS gene knockout
GRO-α is in the mouse body and people IL-8 homologous gene.
With MAVS gene knockout in the MEF cell of mouse source, knockout technique is according to document " MAVS and MyD88 areessential for innate immunity but not cytotoxic T lymphocyte responseagainst respiratory syncytial virus " (Vijay G.Bhoj etc., PNAS, September9,2008, doi:10.1073/pnas.0804717105PNAS September 16 carries out described in 2008vol.105no.3714046-14051).
Stimulate with 5ug/ml 25-HC (every hole adds 5ug 25-HC), receive sample behind the 16h, detect; Be contrast with the normal mice source MEF cell that does not carry out gene knockout simultaneously.
GRO-α rna level detects: extract RNA with trizol, reverse transcription obtains cDNA, detects the expression of GRO-α again with PCR.The primer sequence is: GRO-α: positive-sense strand is 5 ' ATGGCTGGGATTCACCTC3 ', and antisense strand is 5 ' TCGCACAACACCCTTCTA 3 '.
The result is shown in Fig. 5 B, and the result shows that in the MEF cell of the mouse source of MAVS gene knockout, 25HC is suppressed inducing of GRO-α, and in contrast, 25HC has tangible inducing action to GRO-α.
Among Fig. 5 B, swimming lane 1-3 represents the normal mice source MEF cell without any processing, and wherein, swimming lane 1 is for to induce without any, and swimming lane 2 is for to induce through 25-HC, and swimming lane 3 is that send virus (Sendai virus is abbreviated as SV) induces; Swimming lane 4-6 represents to knock out the mouse source MEF cell of MAVS gene, and wherein, swimming lane 4 is for to induce without any, and swimming lane 5 is for to induce through 25-HC, and swimming lane 6 is induced for SV.
Comprehensive above experimental result shows, MAVS in the signal path that RIG-I mediates and IL-8 are expressed as positive correlation.
Two, the expression of the TAK-1 in the signal path of RIG-I mediation is relevant with IL-8
TAK-1DN is a TAK-1 gene of transforming inactivation through sudden change, its expression can suppress the function of normal TAK-1 gene, the Genbank number of Tu Bian TAK-1 gene is not NM_001078361, and TAK-1DN is that the lysine that it is proteic 66 sports tryptophane.(reference: Pellino3 Is a NovelUpstream Regulator of p38MAPK and act ivates CREB in a p38-dependent Manner*, Marion P.Butler etal, THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol.280, No.30, Issue of July 29, pp.27759-27768,2005.)
The source of TAK-1DN gene: obtain normal TAK-1 gene by pcr amplification.Concrete grammar is the total RNA that extracts mouse source MEF cell, and reverse transcription obtains cDNA, obtains normal TAK-1 gene with cDNA for template PCR clone then.The primer sequence is a positive-sense strand: 5 '
CTCGAGGGCACCGTTCCCGGCCCCAC 3 ', antisense strand: 5 '
GAATTCCGGTCCCAGAGAATCATGAA 3 '.
Cut above-mentioned amplified production and pcDNA3.1 (-) carrier with restriction enzyme Xho I and EcoRI enzyme, connect, the TAK-1 gene is inserted into the XhoI and the EcoRI site of pcDNA3.1 (-) carrier, and screening, checking obtain containing recombinant vectors pcDNA3.1 (-)/TAK-1 of TAK-1 gene.On the basis that obtains normal TAK-1 expression carrier, utilize the product of the Easy Mutagenesis System of Beijing full Shi Jin biotech firm TAK-1 transgenation inactivation to be obtained TAK-1DN expression vector pcDNA3.1 (-)/TAK-1DN expression vector of inactivation type again.
The expression of IL-8 detects in the cell of transfection TAK-1DN: with the liposome transfection method recombinant vectors pcDNA3.1 (-)/TAK-1DN is changed in the HUVEC cell.Be contrast simultaneously with the HUVEC cell that changes empty carrier pcDNA3.1 (-) over to, the method that changes over to of empty carrier and recombinant vectors pcDNA3.1 (-)/TAK-1DN to change method over to identical.Stimulate with 5ug/ml25-HC (every hole adds 5ug25-HC), receive sample behind the 16h, detect; Detect the expression of IL-8 in changing the HUVEC cell of recombinant vectors pcDNA3.1 (-)/TAK-1DN over to (one) among the embodiment 1 described method.
The result is shown in Fig. 5 C, and swimming lane 1 expression changes empty carrier over to not by 25-HC inductive cell, and swimming lane 2 expressions change empty carrier over to and by 25-HC inductive cell, and swimming lane 3 expressions change recombinant vectors pcDNA3.1 (-)/TAK-1DN over to and by 25-HC inductive cell;
The expression of crossing IL-8 in the cell of expressing MAVS and TAK-1DN detects: transfection TAK-1DN changes recombinant vectors pcDNA3.1 (-)/TAK-1DN in the above-mentioned HUVEC cell that contains recombinant vectors pcDNA3.1 (-)/MAVS over to by the PEI-HUVEC infection protocol, and screening verification is contained the HUVEC cell of recombinant vectors pcDNA3.1 (-)/TAK-1DN and recombinant vectors pcDNA3.1 (-)/MAVS simultaneously.Detect the expression of IL-8 in changing the HUVEC cell of recombinant vectors pcDNA3.1 (-)/TAK-1DN over to (one) among the embodiment 1 described method.
The result is shown in Fig. 5 D, and swimming lane 1 expression changes empty carrier over to not by 25-HC inductive cell, and the cell of expressing MAVS is only crossed in swimming lane 2 expressions, and the cell of expressing MAVS and TAK-1DN is crossed in swimming lane 3 expressions simultaneously.
The result shows that after the transfection TAK-1DN, 25HC induces IL-8 to be suppressed; MAVS activates IL8 and also is suppressed.Show that TAK-1 plays an important role in 25HC induces the signal path of IL-8, its mutant can specific inhibition 25HC inducing IL-8.
Comprehensive above proof by intervening RIG-I and signal path molecule thereof, just can play and suppress atherosclerosis factor (as 25 hydroxycholesterols, high sugar etc.) inductive inflammatory reaction, shows that the molecule in the RIG-I signal path can be used as target spot equally.
Claims (17)
1, the application of the signal path of retionic acid induced gene I and mediated by coding protein thereof in design and/or screening of medicaments.
2, the signal path with retionic acid induced gene I and encoded protein mediation thereof is the application of material in the preparation medicine of target spot.
3, application according to claim 1 and 2 is characterized in that: described medicine is the medicine that is used to prevent and/or treat inflammation related disease.
4, application according to claim 3 is characterized in that: described medicine is the medicine that is used to prevent and/or treat atheromatosis.
5, application according to claim 4 is characterized in that: described medicine is the medicine that is used to suppress the interleukin 8 factor expression.
6, according to arbitrary described application among the claim 2-5, it is characterized in that: the material that described signal path with retionic acid induced gene I and mediated by coding protein thereof is a target spot is a nucleic acid.
7, application according to claim 6 is characterized in that: the carrier of the shRNA that described nucleic acid is expressed for the siRNA that suppresses described retionic acid induced gene I and express, the described retionic acid induced gene of carrier, the expression inhibiting I that expresses described siRNA, with described retionic acid induced gene I homologous recombination takes place and suppress homologous sequence that described retionic acid induced gene I expresses or the carrier that contains described homologous sequence.
8, application according to claim 7 is characterized in that: the loop-stem structure that described shRNA is made of stem I, ring and stem II; The sequence of described stem I is 5 ' AGUGGAAUCACGGAUUAGCTT3 ', and the sequence of described stem II is 5 ' GCUAAUCCGUGAUUCCACU3 '.
9, a kind of signal path medicine that is used to prevent and/or treat inflammation related disease that is target spot with retionic acid induced gene I and mediated by coding protein thereof.
10, medicine according to claim 9 is characterized in that: the activeconstituents of described medicine is a nucleic acid.
11, medicine according to claim 10 is characterized in that: the carrier of the shRNA that described nucleic acid is expressed for the siRNA that suppresses described retionic acid induced gene I and express, the described retionic acid induced gene of carrier, the expression inhibiting I that expresses described siRNA, with described retionic acid induced gene I homologous recombination takes place and suppress homologous sequence that described retionic acid induced gene I expresses or the carrier that contains described homologous sequence.
12, medicine according to claim 11 is characterized in that: the loop-stem structure that described shRNA is made of stem I, ring and stem II; The sequence of described stem I is 5 ' AGUGGAAUCACGGAUUAGCTT3 ', and the sequence of described stem II is 5 ' GCUAAUCCGUGAUUCCACU3 '.
13, medicine according to claim 11 is characterized in that: described medicine is the medicine that is used to suppress the interleukin 8 factor expression.
14, a kind of inflammation related disease diagnostic kit comprises the material of the protein expression level that detects retionic acid induced gene I or this genes encoding.
15, diagnostic kit according to claim 14 is characterized in that: described material is to be used to increase the RT-PCR primer of retionic acid induced gene I and/or the antibody of this gene coded protein.
16, detect the application of material in preparation inflammation related disease diagnostic kit of the protein expression level of retionic acid induced gene I or this genes encoding.
17, application according to claim 16 is characterized in that: described material is to be used to increase the RT-PCR primer of retionic acid induced gene I and/or the proteic antibody of this genes encoding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100766556A CN101503736A (en) | 2009-01-12 | 2009-01-12 | Use of retinoic acid induced gene I, signal pathway mediated by coding protein thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100766556A CN101503736A (en) | 2009-01-12 | 2009-01-12 | Use of retinoic acid induced gene I, signal pathway mediated by coding protein thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101503736A true CN101503736A (en) | 2009-08-12 |
Family
ID=40976111
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2009100766556A Pending CN101503736A (en) | 2009-01-12 | 2009-01-12 | Use of retinoic acid induced gene I, signal pathway mediated by coding protein thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101503736A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103491965A (en) * | 2011-02-25 | 2014-01-01 | 奇尼塔公司 | Method and cells for identifying rig-i pathway regulators |
| CN106008696A (en) * | 2016-07-04 | 2016-10-12 | 四川农业大学 | Duck RIG-1 polyclonal antibody and preparation method thereof |
| CN114107496A (en) * | 2021-10-22 | 2022-03-01 | 北京大学 | Application of reagent for detecting expression level of RIG-I-Short in preparation of products for tumor diagnosis and/or prognosis |
| CN115356320A (en) * | 2022-10-20 | 2022-11-18 | 上海诚益生物科技有限公司 | In-vitro RIG-I activation detection method based on homogeneous phase time-resolved fluorescence technology |
| WO2023067362A1 (en) * | 2021-10-23 | 2023-04-27 | The Queen's University Of Belfast | Cardiovascular disease treatment or prevention |
-
2009
- 2009-01-12 CN CNA2009100766556A patent/CN101503736A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103491965A (en) * | 2011-02-25 | 2014-01-01 | 奇尼塔公司 | Method and cells for identifying rig-i pathway regulators |
| US9458492B2 (en) | 2011-02-25 | 2016-10-04 | Kineta, Inc. | Methods and cells for identifying RIG-I pathway regulators |
| CN106008696A (en) * | 2016-07-04 | 2016-10-12 | 四川农业大学 | Duck RIG-1 polyclonal antibody and preparation method thereof |
| CN106008696B (en) * | 2016-07-04 | 2019-08-09 | 四川农业大学 | Duck RIG-1 polyclonal antibody and preparation method thereof |
| CN114107496A (en) * | 2021-10-22 | 2022-03-01 | 北京大学 | Application of reagent for detecting expression level of RIG-I-Short in preparation of products for tumor diagnosis and/or prognosis |
| CN114107496B (en) * | 2021-10-22 | 2023-09-01 | 北京大学 | Application of reagent for detecting RIG-I-Short expression level in preparation of tumor diagnosis and/or prognosis products |
| WO2023067362A1 (en) * | 2021-10-23 | 2023-04-27 | The Queen's University Of Belfast | Cardiovascular disease treatment or prevention |
| CN115356320A (en) * | 2022-10-20 | 2022-11-18 | 上海诚益生物科技有限公司 | In-vitro RIG-I activation detection method based on homogeneous phase time-resolved fluorescence technology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Choi et al. | Interleukin-33 induces angiogenesis and vascular permeability through ST2/TRAF6-mediated endothelial nitric oxide production | |
| Cheng et al. | Chicken STING mediates activation of the IFN gene independently of the RIG-I gene | |
| Heidel et al. | Lack of interferon response in animals to naked siRNAs | |
| Shin et al. | U1-small nuclear ribonucleoprotein activates the NLRP3 inflammasome in human monocytes | |
| Menge et al. | Mesenchymal stem cells regulate blood-brain barrier integrity through TIMP3 release after traumatic brain injury | |
| Deng et al. | Intranasal administration of lentiviral miR-135a regulates mast cell and allergen-induced inflammation by targeting GATA-3 | |
| Zhao et al. | Tripartite motif-containing protein 38 negatively regulates TLR3/4-and RIG-I–mediated IFN-β production and antiviral response by targeting NAP1 | |
| Lee et al. | miR-23a-3p is a key regulator of IL-17C-induced tumor angiogenesis in colorectal cancer | |
| CN103372218B (en) | The microRNA that autoimmune disease is relevant and application thereof | |
| Fekete et al. | Regulatory NLRs control the RLR-mediated type I interferon and inflammatory responses in human dendritic cells | |
| Feketea et al. | A review of macrophage micrornas’ role in human asthma | |
| CN101503736A (en) | Use of retinoic acid induced gene I, signal pathway mediated by coding protein thereof | |
| Zhang et al. | 27‐Hydroxycholesterol enhanced osteoclastogenesis in lung adenocarcinoma microenvironment | |
| Bin et al. | Ankyrin repeat domain 1 regulates innate immune responses against herpes simplex virus 1: A potential role in eczema herpeticum | |
| Wang et al. | Upregulation of KSRP by miR‐27b attenuates schistosomiasis‐induced hepatic fibrosis by targeting TGF‐β1 | |
| Jin et al. | microRNA‐23a contributes to asthma by targeting BCL2 in airway epithelial cells and CXCL12 in fibroblasts | |
| Li et al. | A systematic CRISPR screen reveals an IL-20/IL20RA-mediated immune crosstalk to prevent the ovarian cancer metastasis | |
| Meng et al. | SLAMF6/Ly108 promotes the development of hepatocellular carcinoma via facilitating macrophage M2 polarization | |
| Lai et al. | RNF135 is a positive regulator of IFN expression and involved in RIG-I signaling pathway by targeting RIG-I | |
| Teng et al. | Tfh exosomes derived from allergic rhinitis promote DC maturation through miR-142-5p/CDK5/STAT3 pathway | |
| Zhi et al. | Grouper TRIM23 exerts antiviral activity against iridovirus and nodavirus | |
| CN113073113B (en) | Construction method and application of visualized mouse model for monitoring functions of specific CTLs (cytotoxic T lymphocytes) of new coronavirus spike protein S1 | |
| Guo et al. | Whole transcriptome analysis of chicken bursa reveals candidate gene that enhances the host’s immune response to coccidiosis | |
| Cervantes-Sandoval et al. | Naegleria fowleri induces MUC5AC and pro-inflammatory cytokines in human epithelial cells via ROS production and EGFR activation | |
| Li et al. | Phosphatase and tensin homolog (Pten) of Japanese flounder—its regulation by miRNA and role in autophagy, apoptosis and pathogen infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20090812 |