CN101503445A - Nucleic acid molecule SI-CYPJ-32 and use thereof in anti-cancer medicine preparation - Google Patents

Abstract

The invention belongs to the biological medicine field, relating to nucleotide molecules and the application thereof in the preparation of antitumor medicines. The invention provides the nucleotide molecules for preparing the antitumor medicines. The nucleotide molecules have the activity for inhibiting the tumor growth and the sequence thereof comprises 5'-CCUUUCCAAAUACGGUGUA-3' or 5'-CCTTTCCAAATACGGTGTA-3' which is known as SI-CYPJ-32 in the invention. The nucleotide molecules SI-CYPJ-32 can obviously inhibit the tumor cell proliferation; when the nucleotide molecules are applied to a naked mouse, the tumor body growth of the naked mouse is obviously inhibited compared with the control naked mouse in the same condition of culture, and the phenomenon becomes obvious day by day as time goes on. The invention provides a new approach and means for the tumor treatment and mitigation.

Description

Nucleic acid molecule SI-CYPJ-32 and the application in the preparation cancer therapy drug thereof

Technical field

The invention belongs to biomedicine field, relate to a kind of nucleic acid molecule and the application in the preparation antitumor drug thereof.

Background technology

Tumor disease has now risen to No. the 2nd, the world " killer ", and its death toll is only second to cardiovascular diseases.In the past few years, the foreign medical science bound pair has had new understanding again in the pathogeny of tumor disease on cell base.Based on the further understanding to tumor invasion mechanism, people utilize various approach to develop and develop can be special, effectively killing tumor cell and to the avirulent medicine of normal cell.At present, for treatment for cancer is first-selection with chemotherapy and radiotherapy still, though both have obtained suitable curative effect to tumor treatment, but since lack to the specificity of tumour cell thus have bigger toxic side effect and some tumour cell to chemotherapy and radiation handle insensitive, therefore limited their application in clinical to a great extent.In recent years, can to kill and wound cancer cells specifically and normal cell is not had the medicine of toxic side effect in order to develop, from cell, paid much attention to and huge investment by the research on the molecular level to the pathogenesis of cancer for people.

Summary of the invention

The purpose of this invention is to provide a kind of nucleic acid molecule that is used to prepare antitumor drug.

Another object of the present invention provides the application of above-mentioned nucleic acid molecule.

The invention provides a kind of nucleic acid molecule that is used to prepare antitumor drug, it has active and its sequence that suppresses tumor growth and comprises 5 '-CCUUUCCAAAUACGGUGUA-3 ' or 5 '-CCTTTCCAAATACGGTGTA-3 '.Be called as SI-CYPJ-32 in the present invention.

Wherein, A, T, U, G and C are respectively adenine nucleotide, thymidylic acid, uridylate, guanylic acid and cytidylic acid(CMP).

In the present invention, this term of term " nucleic acid molecule SI-CYPJ-32 " also comprises the nucleotide sequence variation form of 5 '-CCUUUCCAAAUACGGUGUA-3 ' or 5 '-CCTTTCCAAATACGGTGTA-3 '.These variant forms comprise: several (are generally 1-15, preferably 1-10,1-5 more preferably) disappearance, insertion and/or the replacement of Nucleotide, and add several (being generally in 10, preferably is in 5) Nucleotide at 5 ' and/or 3 ' end.For example, (3 ' end) add the sequence that some dT (deoxythymidine) back forms in 5 '-CCUUUCCAAAUACGGUGUA-3 ' back.

Among the present invention, SI-CYPJ-32 has the sequence that suppresses the active of tumor growth and comprise 5 '-CCUUUCCAAAUACGGUGUA-3 ' dTdT.

Among the present invention, SI-CYPJ-32 can be to have the activity that suppresses tumor growth and be the sequence of 5 '-CCUUUCCAAAUACGGUGUA-3 ' dTdT.

Among the present invention, SI-CYPJ-32 can be to have the activity that suppresses tumor growth and be the sequence of 5 '-CCTTTCCAAATACGGTGTA-3 '.

In the present invention, can select various carrier known in the art for use,, be connected to become recombinant vectors with SI-CYPJ-32 as commercially available carrier.For example, can adopt slow virus, adenovirus or fores encephalitis virus expression system (SemlikiForest Virus).Slow virus (Lentivirus) belongs to the retrovirus subgenus, with human immunodeficiency virus (human immunod efficiency virus, HIV) being representative. slow virus not only has the division of infection target cell and integrates in its genome, especially has the multiple Unseparated Cell ability that comprises neuronal cell, scavenger cell, liver cell, myocardial cell and stem cell etc. that infects, thereby, lentiviral vectors is widely used in the especially research of gene therapy of gene function as the effective tool of transgenosis.

In addition-and the aspect, the present invention also provides the preparation method of above-mentioned nucleic acid molecule SI-CYPJ-32, and the sequence of promptly pressing SI-CYPJ-32 is with each ribonucleic acid molecule dehydrating condensation successively.

Nucleic acid molecule SI-CYPJ-32 of the present invention can adopt preparation method's preparation of various routines.Nucleic acid molecule SI-CYPJ-32 sequence of the present invention can obtain with the method for enzymolysis process or synthetic usually.

The present invention also provides the above-mentioned application of nucleic acid molecule SI-CYPJ-32 in the preparation antitumor drug.

Experiment shows that SI-CYPJ-32 of the present invention can obviously suppress tumor cell proliferation.SI-CYPJ-32 or the cell that contains SI-CYPJ-32 are applied to nude mice, compare with the nude mice of not using SI-CYPJ-32 under the same culture conditions (used RNA interfering forward sequence is GCCTTTCCAAATACGGTGTA), the former obviously is suppressed in the growth of knurl body, and this phenomenon is As time goes on obvious day by day.

Nucleic acid molecule SI-CYPJ-32 of the present invention and analogue thereof when using (administration) in treatment, can provide different effects.Usually, can these materials are formulated in nontoxic, inert and the pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although the pH value can be with being changed to some extent by preparation Substance Properties and illness to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intramuscular, intraperitoneal, subcutaneous, intracutaneous or topical.

With nucleic acid molecule SI-CYPJ-32 of the present invention is example, can be with itself and suitable pharmaceutically acceptable carrier coupling.This class pharmaceutical composition contains compound and the pharmaceutically acceptable carrier or the vehicle for the treatment of significant quantity.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Nucleic acid molecule SI-CYPJ-32 of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 1 microgram/kg body weight-Yue 10 mg/kg body weight.In addition, SI-CYPJ-32 of the present invention also can use with the other treatment agent.

When nucleic acid molecule SI-CYPJ-32 of the present invention is used as medicine, this polypeptide of treatment effective dose can be applied to Mammals, wherein should treat effective dose usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.

Among the present invention, the pharmaceutical composition that described antitumor drug is made up of the nucleic acid molecule SI-CYPJ-32 that contains effective therapeutic dose and carrier pharmaceutically or vehicle.Described pharmaceutical composition can be injection or tablet.Its effective therapeutic dose can for every day 1 microgram/kilogram to 10 mg/kg body weight.

Among the present invention, described medicine can be injection, pulvis or tablet.

Nucleic acid molecule SI-CYPJ-32 of the present invention can obviously suppress tumor cell proliferation; When being applied to nude mice, compare with the contrast nude mice under the same culture conditions, the growth of knurl body obviously is suppressed, and this phenomenon is As time goes on obvious day by day.The present invention is for tumor treatment and a kind of new approach and the means of providing are provided.

Embodiment

Embodiment one SI-CYPJ-32 suppresses tumor cell proliferation

LV-CYPJ-RNAi is the virus vector that carries target CYPJ bobby pin shape RNA (sh-RNA), and LV-non-silencing carries the segmental virus vector of contrast.Slow virus is buied from the Shanghai triumphant gene engineering of Ji company limited.

Virus infection hepatoma cell strain SK-Hep1:(A) the day before yesterday is inoculated 3～5 * 10 respectively in experiment ³Individual purpose cell is in 96 well culture plates, and it is 100 μ l that institute adds culture volume.The virus of getting-70 ℃ of preservations when (B) testing is being melted on ice, as required virus dilution.(C) from incubator, take out cell and discard original fluid, clean cell with 50 μ l serum free mediums, add 50 μ l serum free mediums then after, add viral dilution liquid 50 μ l.The nutrient solution cumulative volume is 100 μ l, is put in 37 ℃ of cultivations behind the mixing.Be changed to the normal substratum that contains serum behind the 48h.(D) behind virus infection 72h, observe GFP green fluorescence (perhaps RFP red fluorescence), detect the infection conditions of virus the purpose cell with inverted fluorescence microscope.The result shows that infection rate reaches more than 70%, and the cell growth obviously slows down.

Embodiment two suppresses the nude mice tumor growth

2.1 nude mice (Shanghai Slac Experimental Animal Co., Ltd.) becomes knurl: a large amount of cultivation detected the SK-Hep1 cell, trysinization, centrifugal results institute cultured cells with PBS washing back counting, is resuspended in PBS, and cell carried out subcutaneous injection with disposable syringe to nude mice, inject 〉=5, (female, 30-40 days) for every group, the injection cell amount of every nude mice is 200 μ l, and cell count is about 2 * 10 ⁶, tumour grows after the week.

2.2 virus injection: when gross tumor volume grows to 10-30mm ³During volume, 20 μ l are contained 3 * 10 ⁷The PBS of TU titre virus enters in the tumour with the syringe direct injection.Experimental group injection LV-CYPJ-RNAi virus, control group injection LV-non-silencing virus.Two days later, use the same method again and dosage injection virus once.

2.3 tumor monitoring and knurl piece cut: detect the state of mouse every day, tumor size of measurement in per three days.Each five of experimental group and control group mice are measured, and from infecting the 29th day, significant difference (P＜0.01) appears in experimental group tumour and control group gross tumor volume.After 32 days, put to death mouse, and carry out weighing from subcutaneous taking-up knurl piece.The average-volume of experimental group tumour is 0.43 ± 0.12cm3, and the average-volume of control group tumour is 0.70 ± 0.08cm3, significant difference (P＜0.01).The weight in average of experimental group tumour is 0.21 ± 0.07cm3, and the weight in average of control group tumour is 0.5 ± 0.15cm3, significant difference (P＜0.01).Section, dyeing and fluoroscopic examination to the knurl body show that LV-CYPJ-RNAi and LV-non-silencing virus have all successfully infected the knurl body.

The result shows that compare with control group, the nude mice knurl bulk-growth of injecting virus (containing SI-CYPJ-32) obviously slows down.This explanation, SI-CYPJ-32 of the present invention can obviously suppress tumor growth.

Claims (6)

1. a nucleic acid molecule is characterized in that, it has active and its sequence that suppresses tumor growth and comprises 5 '-CCUUUCCAAAUACGGUGUA-3 ' or 5 '-CCTTTCCAAATACGGTGTA-3 '.

2. a kind of nucleic acid molecule as claimed in claim 1 is characterized in that, it has active and its sequence that suppresses tumor growth and comprises 5 '-CCUUUCCAAAUACGGUGUA-3 ' dTdT.

3. a kind of nucleic acid molecule as claimed in claim 1 is characterized in that, it has active and its sequence that suppresses tumor growth is 5 '-CCUUUCCAAAUACGGUGUA-3 ' dTdT.

4. a kind of nucleic acid molecule as claimed in claim 1 is characterized in that, it has active and its sequence that suppresses tumor growth is 5 '-CCTTTCCAAATACGGTGTA-3 '.

5. the preparation method as any nucleic acid molecule among the claim 1-4 is characterized in that, by the sequence of any nucleic acid molecule among the claim 1-4, with each Yeast Nucleic Acid group or thymus nucleic acid group dehydrating condensation successively.

6. as the application of any nucleic acid molecule among the claim 1-4 in the preparation antitumor drug.