CN101495621A - Novel hepatocyte-like cells and hepatoblast-like cells derived from HBS cells - Google Patents

Abstract

The present invention relates to a novel hepatocyte-like cell population derived from hBS cells and to the potential use of such heopatocyte-like cells in e.g. medical treatment, drug screening and toxicity testing. Furthermore, the invention relates to hepatoblast-like cells that may have suitable characteristics so that they can be used for the same applications as the hepatocyte-like cells and that furthermore may be used in in vitro studies of hepatogenesis such as early hepatogenesis or hepato-regenerative disorders. Both the hepatocyte-like and the hepatoblast-like cells according to the invention express drug transporter and/or drug metabolising characteristics either at the gene or protein expression level.

Description

Derived from the novel liver cell like cell of HBS cell with become the liver cell like cell

Background of invention

The present invention relates to novel liver cell like cell colony and this potential use of quasi-liver cell like cell in for example pharmacological agent, drug screening and toxotest of derived from hBS cell.In addition, the present invention relates to have the one-tenth liver cell like cell of suitable feature, thereby make them can be used to increase and further be divided into function liver cell like cell when needed, and further can be used for the interior research of external and body that liver is taken place, for example early stage liver is taken place or the liver regeneration illness.Liver cell like cell according to the present invention is expressed drug transporter and/or drug metabolism feature on gene or protein expression level.

Background of invention

Expectation versatility human stem cell is thoroughly changed the accessibility for various people's cell types.The breeding versatility is human blastocyst-derived to be done (hBS) cell and makes its possibility that further is divided into required target cell type subsequently, will be for providing stable and unlimited basically cell supply with external a series of application in vivo.

Liver failure and late period hepatopathy cause global mass mortality, and be the main load of healthcare system.Liver transplantation is still the most successful treatment.Yet the effect of this operation is limited and interrelates with many complication examples (as infecting or repelling).Short and the patient that treated that liver transplantation also faces the available donor organ very often will be referred to lifelong immunosuppression.By reducing needs, will have great importance for the society of suffering from these serious diseases and individuality based on the treatment of cell about organ.

In addition, liver is metabolism and the detoxifcation center in the human body, and has therefore paid a large amount of effort so that the functional cell types of evaluation reliable sources is used for vitro test.Unfortunately, the complicacy of liver and function can not be by any cell type reflections of present available.In former generation,, the operability of human liver cell was limited, and when being used for external application, also known described cell is lost its normal phenotype and functional property (promptly in 24 hours) fast.Otherwise the alternatives a kind of commonly used about primary cell is to comprise extremely low-level metabolic enzyme, and has the hepatic cell line that is different from natural hepatocellular other key proteins distributions in the body basically.Therefore, many tests still use animal material to carry out, although known hepatic metabolism is a species specificity, and are created in the hepatotoxic difficulty of predicting in another species different with the species of test thus.

In drug development, harmful liver response is still the most significant toxicity tendency.Therefore, when selecting compound when entering clinical trial, the early prediction of people's hepatotoxicity tendency has primary importance.Improve the exploitation that the effort of the performance in this field must solve availability problem and model, this provides the higher coverage to the bioprocess of complexity, described bioprocess with in the people, induce disadvantageous liver injury consistent.In 2 fields, the use of the noble cells of derived from hBS cell provides chance likely.

Therefore, press for anthropomorphic dummy liver cell and can predict the model system of the candidate molecules effect in the exploitation of novel drugs or chemical preparations.With regard to operability and physiology dependency, human pluripotent stem cells can serve as functional human liver cell's the renewable source of ideal.When the hBS cell was placed suitable environment, 2-4 observed some liver feature after week in differentiation.

By people such as Rambhatla 2003, the cell with some liver cell sample feature has been identified in the previous research of WO 01/81549 and WO 2005/097980, i.e. CYP and GST activity in Fen Hua the hBS cell cultures, but with regard to drug transporter expression and specific C YP and GST expression pattern, the cell that is produced does not demonstrate and may substitute the required metabolisming property of traditional liver system up to now.Presented the cell-derived liver cell like cell of the hBS that is used for drug development and regenerative medicine colony in the present invention, it has important metabolic enzyme and at least 72 hours stably express of drug transporter.

Cellartis patent application WO2006034873 uses the method for the different factors with the approach of tracking developmental biology based on allowing with limiting mode.In the present invention, this mainly is the secretor type internal factor of the cell of influence differentiation.In addition, the replacement frequency difference of substratum.Present method allows more not frequent replacement substratum and is more effortless method therefore.In addition, cell of the present invention is more sophisticated and can cultivates the longer time section in the mensuration system that is used for drug development and toxotest.

WO2005097980 and US20030003573 do not have the existence of instruction about drug transporter or function translocator.WO2005097980 only sets forth CYP3A4, CYP2C9 and CYP1A2 is the required enzyme (referring to table 3) that is used for drug screening.Yet, this application do not instruct about these most important CYPs active anything.Especially, CYP3A4 is used for the single most important enzyme that uses at drug development and toxotest.Great majority in all medicines carry out metabolism via CYP3A4.Therefore, wish that the liver cell of derived from hBS cell demonstrates functional CYP3A4, CYP2C9 and CYP1A2 enzyme in the composition between the adult hepatocellular Different Individual of reflection people, this wishes so.

Wish that also the liver cell of derived from hBS has (i) functional CYP3A4, CYP2C9 and CYP1A2 enzyme, (ii) functional GST enzyme and the (ii) combination of functional drug transporter for drug development and toxotest.With regard to most important CYPs and drug transporter, do not describe described cell among the WO200509780 in detail, and in addition, it shows limited GSTs characterization data.On the contrary, the present invention has the abundant description of II phase enzyme.

The invention summary

The present invention relates to the liver cell like cell and become the liver cell like cell, and be used for the method that it divides other preparation.Liver cell like cell of the present invention is suitable for using in drug development and toxotest especially well, because they express drug transporter and/or metabolic enzyme.

Human blastocyst-derived stem cells (hBS cell) is polyenergic and can produces the cell of all 3 embryo's germinal layers: entoderm, ectoderm and mesoderm, and further produce all somatocyte and sexual cell.Therefore, in future, noble cells with derived from hBS cell of hepatocellular functional character not only has and is used for transplanting or is used for the potential held at the extra body rami hepatici of the patient with liver failure at bio-reactor, also is used to study the hepatic metabolism and the liver toxicity of medicine target, xenobiontics as test macro.When needing, hBS deutero-liver cell can potentially provide the unlimited source from the functional human liver cell of same genetic donor, and therefore improves the predictability of vitro test (for example toxotest) and reduce zooperal needs.Yet the toxicity of xenobiontics relies on its bio-transformation usually and becomes toxicity and reactive metabolite, and therefore needs the existence and the distribution of bioconversion systems.At present, human liver cell is configured for the model of external drug metabolism and toxotest former generation.Yet when cultivating primary hepatocyte, the activity of drug metabolism enzyme and many translocator functions be forfeiture and/or change fast.In addition, the many hepatoma cell lines (for example HepG2) that are used in vitro study lack the expression of many important drug metabolism enzymes.

Cytochrome P450 s (CYP) is the main enzyme in the I phase metabolism of blended function monooxygenase and xenobiontics.The character that depends on xenobiontics, this oxidative metabolism cause deactivation and promoted elimination, activation or the metabolic activation of prodrug.The main site that CYP expresses is a liver, and CYP3A4 is a abundantest CYP isozyme in the adult liver of people.Belong to the 1-3 of family for the most important enzyme of drug metabolism, be responsible for the metabolic 70-80% of all I stage dependents of clinical use medicine.Because polymorphism, CYP expresses and activity presents big interindividual variation.In addition, CYP can induce several times or suppress by specific drugs, cause other, although be temporary transient, the mutability of metabolic activity.It should be noted that the basic active composition of CYP of 3 main CYP-families (1-3) in the liver cell has great importance for drug metabolism.In the embodiment of this paper, described the cell-derived liver cell like cell of hBS, wherein detected from most of CYP enzymes mRNA of (comprising CYP1A2 and CYP3A4/7).Detect main CYP family, the basic CYP activity of CYP1A2, CYP2C9 and CYP3A4 more accurately, and form between the active individuality of other 3 kinds of CYP that mention and be similar to the sort of of human primary hepatocyte.Therefore, the invention provides the method for the liver cell like cell that is used to prepare the expressive function drug metabolism enzyme.

When the drug metabolism of analyzing liver and toxicity, the function medicament translocator in the liver cell is BSEP for example, and MRP2 and OATP:s are essential.Therefore, the invention provides the method for the liver cell like cell that is used to prepare the expressive function translocator.

Therefore, the present invention relates to the cell colony of derived from hBS cell, at least 20% cell demonstrates at least one following characteristics in the wherein said cell colony: α-1-antitrypsin, cytokeratin 18, HNF-3 β, albumin or liver-fatty acid binding protein, and described cell colony has at least 3 in following 6 features

A. drug transporter

I) at least 1% cell demonstrates protein and/or the genetic expression of BSEP,

Ii) at least 1% cell demonstrates protein and/or the genetic expression of MRP2,

Iii) at least 1% cell demonstrates protein and/or the genetic expression of OATP-2 and/or OATP-8,

B. drug metabolism enzyme

Iv) at least 20% cell demonstrates protein and/or the genetic expression of GST A1-1,

V) at least 20% cell demonstrate CYP450s-1A2 ,-2A6 ,-2B6 ,-2C8 ,-2C9 ,-2C19-2D6 ,-2E1 ,-3A4 and-3A7 at least 2 kinds protein and/or genetic expression,

Vi) at least 20% cell does not demonstrate protein and/or the genetic expression of GST P1-1.

In addition, the present invention relates to the cell colony of derived from hBS cell, at least a at least about among 10% cell expressing HNF3 β and the AFP in the wherein said cell colony, and have multiplication capacity, and described cell colony has at least 2 in following 4 features:

A. acceptor

I) at least 1% cell demonstrates the protein and/or the genetic expression of α-6-integrin,

Ii) at least 1% cell demonstrates protein and/or the genetic expression of c-Met,

B. intercellular adhesion molecule

Iii) at least 1% cell demonstrates protein and/or the expression of ICAM-1,

C: transcription factor

Iv) at least 10% cell demonstrates protein and/or the expression of HNF-4 α.

D. cytokeratin

V) at least 1% cell demonstrates protein and/or the expression of CK19,

Vi) at least 1% cell demonstrates protein and/or the expression of CK7,

E. epithelial cell adhesion molecule

Vii) at least 1% cell demonstrates protein and/or the expression of EpCAM.

Urea is the eventual degradation product of protein and amino acid metabolism.

Liver cell in the liver is the unique cell type that ammonia is changed into the body of urea.Therefore, the invention provides the method for the liver cell like cell that is used to prepare urea synthesis.

In one embodiment of the invention, hBSC deutero-liver cell like cell is produced urea with the level that is similar to primary hepatocyte, and with urea secretion in substratum.Compare with primary hepatocyte, the liver cell like cell has the ability of synthetic at least 10%, 20%, 50%, 70%, 80%, 90% or at least 100% urea.The liver cell like cell can be analyzed and it still has high-caliber urea synthesis afterwards with regard to urea from the 10th day to the 20th day.About more details, referring to the embodiment 10 of this paper.

The separation of liver cell like cell and plantation to different no raisers surface again make the liver cell like cell colony with multi-form purifying become possibility, and this is required by the handiness that requires in drug toxicity test and metabolism and based on the different application in hepatocellular other measurements determination methods.Therefore, the invention provides in any form (for example 96 hole flat boards) and be used to prepare liver cell like cell purifying and enrichment and do not have raiser's culture, preferably the collagen I cultured method.

In one embodiment of the invention, the liver cell like cell is successfully planted on the different hole surfaces again, for example 96 hole flat boards.Different surfaces can be collagen I, Matrigel or mEF cellular layer.It is very difficult planting primary hepatocyte again.Therefore compare with primary hepatocyte, real advantage is that the liver cell like cell has the ability of being planted again.About more details, referring to the embodiment 15 of this paper.

Make into and maintain ancestors' state when liver cell is cultivated and to be divided into functional hepatocellular ability be valuable for keeping functional hepatocellular unlimited source when maintaining different appropriate condition following time under the propagation permissive condition with amplification ability.Therefore, the invention provides by making into the liver cell like cell and plant again and be used to make into the method that the liver cell like cell maintains ancestors' state on the mEF cellular layer.In addition, when on the surface of planting matrigel or glue primordial covering again, become the liver cell like cell to be divided into the liver cell like cell.

The present invention's definition

Definition and abbreviation

As used herein, feeder cell mean the sustenticular cell type that is used alone or in combination.Cell type can further have the mankind or other origin of species.The tissue of feeder cell of deriving comprises embryo, fetus, newborn infant, teenager or adult's tissue, and it further comprises the tissue derived from skin, comprises foreskin, umbilical cord, muscle, lung, epithelium, placenta, uterine tube, gland, a matter or mammary gland.Feeder cell can be derived from belonging to following cell type: human fibroblasts, fibrocyte, myocyte, keratinocyte, endotheliocyte and epithelial cell.The example of concrete cell type of feeder cell of can being used to derive comprises embryo fibroblast, the extraembryonic endoderm cell, the extraembryonic mesoderm cell, fetal fibroblast and/or fibrocyte, the fetus myocyte, fetal skin cell, the fetus pneumonocyte, the fetus endotheliocyte, the human fetal epithelium cell, the umbilical cord mesenchyma cell, placenta inoblast and/or fibrocyte, the placenta endotheliocyte, birth back foreskin inoblast and/or fibrocyte, birth back myocyte, birth back skin cells, birth back endotheliocyte, adult skin inoblast and/or fibrocyte, become human muscle cell, adult's uterine tube endotheliocyte, adult's gland endometrial cell, proton theca cell in utero between the adult, become the human breast carcinoma parenchyma, become human endothelial cell, become human epithelial cell or adult's keratinocyte.When feeder cell derived from hBS cell, this cell can be an inoblast.

As used herein, term " 3D " means three-dimensional.

As used herein, term " blastocyst-derived stem cells " refers to BS cell and people's form called after " hBS cell ".

As used herein, term " AAT " means liver marker alpha antitrypsin.

As used herein, term " AFP " means liver marker alpha-fetoprotein.

As used herein, term " BSEP " means the biliary salts Send out pump.

As used herein, term " CK " means liver marker cytokeratin (being used interchangeably), and it has different subtype, for example cytokeratin 18, cytokeratin 19 and cytokeratin 7.

As used herein, term " c-Met " means pHGF and/or dispersion factor acceptor (scatter factor receptor).

As used herein, term " ICAM-1 " means intracellular adhesion molecule 1.

As used herein, term " LFABP " means liver-fatty acid binding protein (being used interchangeably).

As used herein, term " EpCAM " means epithelial cell adhesion molecule (being used interchangeably).

As used herein, term " FGF " means fibroblast growth factor, preferably has people and/or recombinant sources, and the hypotype that belongs to it is for example bFGF (also being called FGF2 sometimes) and FGF4.

As used herein, term " DMSO " means dimethyl sulfoxide (DMSO).

As used herein, " CYP " means cytochrome P, and more specifically is cytochrome P 450, the main 1 phase metabolic enzyme of the liver of forming by many different subunits, and subunit is 1A1,1A2,3A4 etc. for example.

As used herein, term " GST " means Thiadiazolidine isomerase, and the example of its hypotype is GST A1-1, GST M1-1 and GST P1-1.

As used herein, " HNF3 β " and/or " HNF3b " be interchangeable to be used to mean hepatocyte neclear factor 3, is to regulate entoderm derived tissues, for example transcription factor of the genetic expression in liver, pancreas islet and the adipocyte.HNF3 β can also be called Foxa2 sometimes, and this is the name that comes from jaw frame transcription factor family member's transcription factor.

As used herein; term " OATP " means organic anion transhipment polypeptide; the sodium (Na+) of organic anion-dependency transhipment, for example sulfobromophthalein (BSP) and (the cholyltaurine salt) puted together and unconjugated (cholate) cholic acid (similarly) in its mediation liver.

As used herein, term " UGT " means the UDP glucuronic acid based transferase, and this is the active class liver enzyme of catalysis glucuronic acidization.

As used herein, term " no foreign matter " means the avoidance fully that directly or indirectly is exposed to non-human animal's component.

As indicated above, the invention provides the derived from hBS cell improvement the liver cell like cell with become the liver cell like cell.The liver cell like cell of described improvement is expressed drug transporter and/or metabolic enzyme, guarantees and ingestion of medicines, secretion and metabolism like liver cell is used identical drug transporter and metabolic enzymes in vivo.Therefore, the expression of all these features is the required features about the cell for the treatment of to use in drug development and toxotest, because expect that they are similar to intravital liver cell at the response class of medicine and chemical preparations.

Therefore, disclosed one-tenth liver cell like cell or liver cell like cell are advantageously used in many research purposes among the present invention, for example in drug discovery process, in external model, be used to study drug transporter, be used to study drug metabolism enzyme in external model, be used to study liver and take place in external model, for example early stage liver is taken place, in external model, be used to study human liver regenerated venereal disease disease, be used for external liver toxicity test.

In addition, can be advantageously used in according to one-tenth liver cell like cell of the present invention and liver cell like cell and treat and/or prevent several hepatopathys and illness.Therefore, can in medicine, use according to one-tenth liver cell like cell of the present invention and liver cell like cell.

Becoming the liver cell like cell is the progenitor cell of liver cell like cell, and therefore they are fit to for example be used to obtain the liver cell like cell of metabolic activity, or is used to study the maturation towards the liver cell like cell.

The liver cell like cell

In this article, term " liver cell like cell " means the cell that demonstrates at least one following characteristics: α-1-antitrypsin, cytokeratin 18, HNF-3 β, albumin or liver-fatty acid binding protein.Liver cell like cell according to the present invention further has the important and stable characteristics that relates to drug transport and drug metabolism.

Therefore, in one embodiment, the present invention relates to the cell colony of derived from hBS cell, at least 20% cell demonstrates at least one following characteristics in the wherein said cell colony: α-1-antitrypsin (AAT), cytokeratin 18 (CK18), HNF-3 β, albumin or liver-fatty acid binding protein (LFABP), and described cell colony has at least 3 in following 6 features

A. drug transporter

I) at least 1% cell demonstrates protein and/or the genetic expression of BSEP,

Ii) at least 1% cell demonstrates protein and/or the genetic expression of MRP2,

Iii) at least 1% cell demonstrates protein and/or the genetic expression of OATP-2 and/or OATP-8,

B. drug metabolism enzyme

Iv) at least 20% cell demonstrates protein and/or the genetic expression of GST A1-1,

V) at least 20% cell demonstrate following at least 2 kinds of protein and/or genetic expression: CYP450s-1A2 ,-2A6 ,-2B6 ,-2C8 ,-2C9 ,-2C19-2D6 ,-2E1 ,-3A4 and-3A7,

Vi) at least 20% cell does not demonstrate protein and/or the genetic expression of GST P1-1.

In addition or as requiring vi) replacement, at least 5% cell demonstrates protein and/or the genetic expression of GST M1-1.

In one embodiment of the invention, the liver cell like cell can be via I phase cytopigment p450 enzymes metabolism medicine.Especially, can be under the situation that does not have inductor metabolism cyp1A2, cyp2C9 and cyp3A4.In one embodiment, be Phenacetin, diclofenac and midazolam by the metabolic material of liver cell like cell, and meta-bolites is analyzed by LC-MS.Must be pointed out that the liver cell like cell can metabolic drug and do not influence inductor (as for example describing) in WO2005097980.

In another embodiment, the liver cell like cell has active composition of the active cyp-that forms of the cyp that is similar in the human primary hepatocyte culture.Especially, the composition during the composition of Cyp1A2, Cyp3A4 in the liver cell like cell and Cyp2C9 and human primary hepatocyte are cultivated is suitable.With ratio of components in the human primary hepatocyte culture, the Cyp-between Cyp1A2, Cyp3A4 and the Cyp2C9 has 30%, 50%, 75% and 100% difference active the composition.

In one embodiment of the invention, liver cell like cell expressive function drug transporter.Especially, the OATP-2 that the picked-up by the ICG dyestuff is measured is active, the existing of the functional drug transporter in the described ICG dyestuff indicator cells (Figure 48).

In another embodiment of the invention, cell colony derived from hBS cell, at least 20% cell demonstrates at least one following characteristics in the wherein said cell colony: α-1-antitrypsin, cytokeratin 18, HNF-3 β, albumin or liver-fatty acid binding protein, and described cell colony has 2 following characteristics

A. drug transporter

Iii) at least 1% cell demonstrates the OATP-2 and/or the OATP-8 of functionally active,

B. drug metabolism enzyme

Iv) at least 20% cell demonstrates the functionally active of GSTA1-1,

V) at least 20% cell demonstrates Cyp1A2, Cyp3A4 and/or the Cyp2C9 by the functionally active of analyzing the drug metabolite measurement.

In another embodiment of the invention, cell colony derived from hBS cell, at least 75% cell demonstrates following characteristics in the wherein said cell colony: α-1-antitrypsin, cytokeratin 18, HNF-3 β, albumin or liver-fatty acid binding protein, and described cell colony has at least 2 following characteristics

A. drug transporter

Iii) at least 10% cell demonstrates the OATP-2 and/or the OATP-8 of functionally active,

B. drug metabolism enzyme

Iv) at least 30% cell demonstrates the functionally active of GST A1-1,

V) at least 50% cell demonstrates Cyp1A2, Cyp3A4 and/or the Cyp2C9 by the functionally active of analyzing described drug metabolite measurement.

Glycogen storage is another notable feature of liver cell like cell.

In addition, the liver cell like cell is male with the per-cent that becomes the liver cell like cell for Notch-2.The Notch signal transduction pathway is widely used in keeping of fetal development among the adult and stable state.It also is one of crucial path that constitutes the stem cell signal network.In Mammals, identified Notch part similar on 4 kinds of Notch acceptors (Notch1-Notch4) and the 5 kinds of structures (Delta-sample 1[is also referred to as Deltal], Delta-sample 3, Delta-sample 4, Jagged1 and Jagged2) up to now.The Notch part is the single transmembrane protein.By combining with the part of expressing on the adjacency cell, activate the Notch acceptor, this causes proteolysis to discharge and the nuclear translocation of the cell intracellular domain of Notch, and this regulates differentiation conversely.Notch-2 has keying action in wide expression during the fetal development and in many organs.In liver, Notch-2 relates to the formation and the differentiation (people such as Ader, 2005, people such as Kodama, 2006) of liver inner catheter.Because the liver like cell is produced by stem cell, be important so understand the effect of notch signal conduction in these cell types.

The liver cell like cell demonstrates the general form of liver cell, promptly they have polygon cell shape, maxicell diameter (about 25-50 μ M), normally double-core and demonstrate the trend of gathering lipid granule.

AAT, CK18, HNF-3 β, albumin and LFABP are the liver specificity markers, and their expression is a liver cell like cell sign like this.Yet, be not that all these liver specificity markers all must be expressed in all cells according to cell colony of the present invention.Rely on the purposes of their supposition, even only express in these markers a kind, for example only 2 kinds, only 3 kinds or only 4 kinds cell play a role with also can being similar to liver cell, and so be used for above-mentioned purpose.In order for example to study metabolism, need CYP and GST at least by lysis.In order to study picked-up, OATP is important, and in addition for draining research, needs for example BSEP or MRP-2.Research may be carried out more in vivo, needs these many more features.Be more preferably and may have the liver cell like cell together with other liver cell types, for example scavenger cell and Kupffer Cell (Kuppffer cell) provide liver environment and cell-cell interaction.Such culture systems can be one or more cell type embeddings sandwich shape within it, and analog case can further make the liver cell like cell demonstrate polarity potentially in this 3D structure and the more body, promptly shows towards water-wet side of blood with towards hydrophobic side of bile.For toxicity research, because their interaction, I and II phase metabolic enzyme all need.In addition, wish the reaction of described cell colony and known drug inductor, for example I phase and/or II phase metabolic enzyme are derivable thus.

In one embodiment of the invention, have above-mentioned feature i)-at least 3 cell colony in vi) at least about 30%, for example at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90 or at least about 95% cell, demonstrate at least 2, for example at least 3, at least 4, at least 5 or all following characteristics α-1-antitrypsins, CK18, HNF-3 β, albumin or LFABP.In a specific embodiments, at least one feature belongs to drug transporter class (being feature i)-iii)) and at least one feature belong to drug-metabolization enzymes (be feature iv)-vi)).Therefore, except one or more liver specificity markers, described cell colony can further have at least one described drug transporter feature and at least one described drug metabolism feature.More specifically, cell colony according to the present invention has feature i)-in vi) at least 4, for example at least about 5 or all 6.

Feature i) relate to cell per-cent in the cell colony that comprises the liver cell like cell, described cell demonstrates protein and/or the genetic expression of drug transporter BSEP in cell colony according to the present invention.BSEP represents the biliary salts Send out pump and is that ATP is in conjunction with box (ABC) translocator, it uses the transhipment of the energy catalytic molecular of ATP hydrolysis by extracellular and cell inner membrance, and therefore for example medicine is outputed in the bile and (be usually located at and be called in the body on the hepatocellular top side).In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 15%, at least 20%, at least 30%, at least 40% or at least 50% cell demonstrates protein and/or the genetic expression of BSEP.

Feature ii) relates to the cell per-cent in the cell colony that comprises the liver cell like cell, and described cell demonstrates protein and/or the genetic expression of drug transporter MRP2 in cell colony according to the present invention.MRP2 represents multi-drug resistance protein 2, and also is the member of abc transport protein family and drug metabolite outputed in the bile.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% cell demonstrates protein and/or the genetic expression of MRP2.

Feature iii) relates to the cell per-cent in the cell colony that comprises the liver cell like cell, and described cell demonstrates protein and/or the genetic expression of drug transporter OATP2 and/or OATP8 in cell colony according to the present invention.OATP-2 and OATP-8 represent organic anion transport protein 2 and 8, and all are the members that known for example picked-up comes the OATP family of the poisonous endogenous metabolism product of autoblood and xenobiontics.OATP is positioned at liver cell in vivo on the outside, the end of blood.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% cell demonstrates protein and/or the genetic expression of OATP2 and/or OATP-8.

Feature iv) relates to the cell per-cent in the cell colony that comprises the liver cell like cell, and described cell demonstrates protein and/or the genetic expression of drug metabolism enzyme GST A1-1 in cell colony according to the present invention.The integral part of puting together and be II phase detoxification system of Thiadiazolidine isomerase (GST) catalysis xenobiontics and gsh.Be divided into 7 classifications in these external 17 kinds of different people's cytosol GST subunits, called after is A, M, P and S for example.GST A1-1 is the abundantest subunit in the body in grownup's liver.GST M1-1 also expresses in grownup's liver, and GST P1-1 expresses to higher degree in fetus liver.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 30%, for example at least 40%, at least 50%, at least 60%, at least 70% or at least 80% cell demonstrates protein and/or the genetic expression of GST A1-1.

Feature v) relates to the cell per-cent in the cell colony that comprises the liver cell like cell, described cell in cell colony according to the present invention, demonstrate protein and/or the genetic expression that is selected from least 2 kinds of following drug metabolism enzymes: CYP450s-1A2 ,-2A6 ,-2B6 ,-2C8 ,-2C9 ,-2C19-2D6 ,-2E1 ,-3A4 and-3A7.CYP represents Cytochrome P450 and is the class of enzymes that is arranged in the endoplasmic reticulum of liver.Their effect is the metabolism and the detoxifcation of endogenous compound and xenobiontics.These enzymes of high density appear in liver and the small intestine, but many CYP also appear in its hetero-organization.CYP can comprise by many mechanism and suppress and induce change and can be interpersonal different.The CYP system is important for understanding drug metabolism, drug interaction and drug-induced liver toxicity.

In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 30%, for example at least 40%, at least 50%, at least 60%, at least 70% or at least 80% cell demonstrate protein and/or the genetic expression that is selected from least 2 kinds of following drug metabolism enzymes: CYP450s-1A2 ,-2A6 ,-2B6 ,-2C8 ,-2C9 ,-2C19-2D6 ,-2E1 ,-3A4 and-3A7.In addition, general CYP450 enzymic activity can show in this type of cell colony, and described cell colony can further demonstrate at least a kind in these CYP450 protein, for example at least 2 kinds, at least 3 kinds, at least 4 kinds, at least 5 kinds, at least 6 kinds, at least 7 kinds, at least 8 kinds, at least 9 kinds or whole 10 kinds enzymatic activities.

Feature vi) relates to the cell per-cent in the cell colony that comprises the liver cell like cell, and described cell does not demonstrate protein and/or the genetic expression of II phase enzyme GST P1-1 in cell colony according to the present invention.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% cell does not demonstrate protein and/or the genetic expression of GST P1-1.

In addition, show that described cell colony can demonstrate the GST enzymatic activity, it can be at least 0.01 μ mol/ minute/mg in the lysate of described cell colony, for example at least 0.03 μ mol/ minute/mg, at least 0.05 μ mol/ minute/mg, l/ minute/mg of at least 1.0 μ mo, at least 0.07 μ mol/ minute/mg, at least 0.09 μ mol/ minute/mg, at least 0.11 μ mol/ minute/mg, at least 0.13 μ mol/ minute/mg or at least 0.15 μ mol/ minute/mg protein.

In a specific embodiments of the present invention, described cell colony comprises the cell of coexpression CK 18 and one or more CYP drug metabolism enzymes, described CYP drug metabolism enzyme for example, CYP1A2, CYP2A6, CYP2B6, CYP2D6, CYP2E1, the combination of CYP2C8, CYP2C9 and CYP2C19, or the combination of CYP3A4 and CYP3A7.

Except above-mentioned feature, has at least one following supplementary features according to the cell at least about 5% in the cell colony of the present invention

A. acceptor

Vii) at least 5% cell demonstrates protein and/or the genetic expression of c-Met,

B. intercellular adhesion molecule

Viii) at least 5% cell demonstrates protein and/or the genetic expression of ICAM-1,

C. drug metabolism enzyme

Ix) at least 1% cell demonstrates protein and/or the genetic expression of UGT,

D: transcription factor

X) at least 90% cell does not demonstrate protein and/or the genetic expression of Oct-4.

Preferably, described cell colony have feature vii), viii), ix) or x) at least 2, for example at least 3 or whole 4.

Feature vii) relates to according to the protein of the acceptor c-Met in the cell colony of the present invention and/or the level of genetic expression.C-Met is pHGF and/or dispersion factor acceptor, expects thus to regulate in the liver cell like cell response cell and mechanism (methylating) and having is regulated in the cell identical with human liver cell in the body and machine-processed (methylating).In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates protein and/or the genetic expression of c-Met.

Feature viii) relates to according to the protein of the intercellular adhesion molecule ICAM-1 in the cell colony of the present invention and/or the level of genetic expression.ICAM-1 is for the important intracellular adhesion molecule of the cell-cell interaction in the liver.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates protein and/or the genetic expression of ICAM-1.

Feature ix) relates to according to the protein of cell colony Chinese traditional medicine metabolic enzyme UGT of the present invention and/or the level of genetic expression.The UDP glucuronic acid based transferase is to add the GSTII phase metabolic enzyme of sugar be responsible for for fat-soluble chemical preparations, 2 kinds of endogenous substrates and medicine and other xenobiontics enzymatics equally.In Mammals, glucuronic acid is to be used to stop metabolic waste and to gather in vivo to main sugar that may deleterious level from the fat-soluble chemical preparations of environment or medicine.UGT2B7 is an II phase enzyme important in grownup's liver especially, and for example it and Cyp2C9 cooperate with Cyp3A4 with the metabolic drug diclofenac.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates protein and/or the genetic expression of UGT.In addition, show that described cell colony can demonstrate the UGT enzymatic activity.

Feature x) relate to the cell per-cent that comprises according in the cell colony of liver cell like cell of the present invention, described cell does not demonstrate protein and/or the genetic expression of transcription factor Oct-4.Oct-4 is that its expression is the transcription factor of the feature of undifferentiated hBS cell, and its existence in the cell colony that comprises the liver cell like cell is undesirable.Therefore, nothing or low Oct-4 show that they no longer are undifferentiated hBS cells, and this for example is favourable in regenerative medicine, because undifferentiated cell colony can produce teratoma sample tissue subsequently potentially.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates protein and/or the genetic expression of Oct-4.

Above-mentioned feature i)-x) some in can be induced after adding inductor, and described inductor can be selected from dexamethasone, omeprazole alone or in combination.Inductor can also comprise Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine.At least a like this CYP450 protein expression can be induced after adding inductor.In addition, GST A1-1 and/or GST M1-1 protein expression can be induced after adding inductor.The UGT protein expression also can be induced after adding inductor.

Liver cell like cell according to the present invention can be kept those features i that they demonstrate in the training period)-x).In this article, term " feature of keeping " means through limit cultivating and stable protein expression of analysis phase, and this can be for example further shown with immunohistochemistry and measurement and comparison expression intensity.Therefore, comprise according to the cell colony of liver cell like cell of the present invention and can for example at least 1 week or at least 72 hours, still keep feature vitro culture at least 1 month.

In one embodiment of the invention, described cell colony or its subgroup that comprises the liver cell like cell further expressed AFP.

Use for some other organ mimic, may also need other liver cell types, for example Kupffer Cell and/or scavenger cell.

According to liver cell sample of the present invention or become the liver cell like cell to obtain higher yield using before some in the feature selected separately with regard to described herein its.Can be by using with regard to the Detection of antigen of the liver marker of expressing on the cell surface and the follow-up described cell of FAC sorting purifying.About other alternative approach based on antigenic sorting is by culture dish with the specific antibody bag, and will add in the ware and make from the cell of substratum and have correct antigenic cell combination, and discard all the other cells, and results bonded cell is used for further use.This method is sometimes referred to as immune elutriation and can also selects to carry out as feminine gender, is about to the unwanted cells type and combines with envelope antigen, and be kept at the substratum that has the liver cell like cell in the suspension.This method also can be carried out on magnetic bead well, and so-called MAC sorting or use column chromatography are well carried out.The method of other of purifying cells, the liver cell like cell that for example has specific characteristics comprises and uses the density gradient substratum to be used for centrifugal down based on buoyant density or big or small cellular segregation.

Another alternative approach that is used to obtain the liver cell sample or become the purifying colony of liver cell like cell is the population mixture of the cell-derived cell of hBS to be carried out positive or negative select.2 kinds of systems of selection can be undertaken by following craft: with cell dicing or interpolation and be exposed to enzyme (for example collagenase IV or trypsinase) or sequestrant (for example EDTA), or even the suitable enzyme and the mixture of sequestrant.In a specific embodiments of the present invention, culture dish is washed 2 times with no calcium/magnesium PBS, and incubation among the 0.5mM EDTA that in no calcium/magnesium PBS, dilutes subsequently, this causes removing non-liver cell sample or non-one-tenth liver cell like cell, and stays the feminine gender selection of the liver cell like cell type of complete growth on the mice embryonic raiser.After being exposed to described sequestrant and/or enzyme in addition, liver cell like cell and feeder cell are separated further to concentrate and to use in experiment with ware.

Become the liver cell like cell

In this article, term " liver cell like cell " means expresses at least a among HNF3 β and the AFP, and has the cell of multiplication capacity.Therefore, one embodiment of the invention relate to the cell colony of derived from hBS cell, at least a at least about among 10% cell expressing HNF3 β and the AFP in the wherein said cell colony, and have multiplication capacity, and described cell colony has at least 2 in following 4 features:

A. acceptor

I) at least 1% cell demonstrates the protein and/or the genetic expression of α-6-integrin,

Ii) at least 1% cell demonstrates protein and/or the genetic expression of c-Met,

B. intercellular adhesion molecule

Iii) at least 1% cell demonstrates protein and/or the expression of ICAM-1,

C: transcription factor

Iv) at least 10% cell demonstrates protein and/or the expression of HNF-4 α.

D. cytokeratin

V) at least 1% cell demonstrates protein and/or the expression of CK19,

Vi) at least 1% cell demonstrates protein and/or the expression of CK7,

E. epithelial cell adhesion molecule

Vii) at least 1% cell demonstrates protein and/or the expression of EpCAM.

They have high nuclear-cytoplasmic ratio and are being the notable feature that cube also is into the liver cell like cell in shape.In addition, they can have the small nut Renhe particle in tenuigenin.Preferably described cell can be diameter 10-30 μ m.

Becoming the liver cell like cell is the cell with entoderm origin, and it has the ability that further is divided into the liver cell like cell.HNF3 β is the entoderm marker, and entoderm is along growing the path towards liver cell.Also known HNF3 β expresses in pancreas.In this article, the cell that means in the cell colony of term " multiplication capacity " is in the division.

Can be by being Gata4, Cdx2 (the relevant homeobox transcription factor of tail), Sox 17 (gene product that contains the gene 17 of Sry box), Pdx1 (the pancreas duodenum homeobox factor-1) and AFP with the example of other entoderm marker except that HNF3 β of the hBS cell expressing of liver cell like cell differentiation towards becoming the liver cell sample, wherein the latter is considered as the fetus liver marker usually.

In addition, become the liver cell like cell to breed, this is a sign of its ancestors' state, and promptly they are liver cell like cells immature and that break up fully.The vegetative state of cell can show that for example BrdU mixes and follow-up dyeing by several different methods, or uses for the special for example another kind dyeing of KI67 of protein label of proliferative cell, the described KI67 proliferative cell in the colony that dyes fixedly the time.

About becoming the feature i of liver cell like cell)-vii) be for connective marker thing in the important body of liver development.

Feature i) relate to the per-cent of the cell in the cell colony that comprises into the liver cell like cell, described cell demonstrates the protein and/or the genetic expression of α-6-integrin receptor.α-6-integrin is a laminin receptor.Laminin receptor is the part of the extracellular matrix in for example developmental liver, and for example becomes on liver cell and the liver cell to express at many cell types in vivo.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates the protein and/or the genetic expression of α-6-integrin receptor.

Feature ii) relates to the per-cent of the cell in the cell colony that comprises into the liver cell like cell, and described cell demonstrates the protein and/or the genetic expression of c-Met acceptor.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates the protein and/or the genetic expression of c-Met acceptor.

Feature iii) relates to the per-cent of the cell in the cell colony that comprises into the liver cell like cell, and described cell demonstrates protein and/or the genetic expression of intercellular adhesion molecule ICAM-1.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates protein and/or the genetic expression of intercellular adhesion molecule ICAM-1.

Feature iv) relates to the per-cent of the cell in the cell colony that comprises into the liver cell like cell, and described cell demonstrates protein and/or the genetic expression of transcription factor HNF-4 α.This transcription factor is specifically expressing in endoderm cell's type, and therefore is into the sign of liver cell like cell.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates protein and/or the genetic expression of HNF-4 α.

Feature v) relates to the per-cent of the cell in the cell colony that comprises into the liver cell like cell, and described cell demonstrates the protein and/or the genetic expression of cytokeratin 19.This cytokeratin liver stem cells with become liver cell but specifically expressing in liver cell not, and therefore be into the sign of liver cell like cell.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates the protein and/or the genetic expression of cytokeratin 19.

Feature vi) relates to the per-cent of the cell in the cell colony that comprises into the liver cell like cell, and described cell demonstrates the protein and/or the genetic expression of cytokeratin 7.This cytokeratin liver stem cells with become liver cell but specifically expressing in liver cell not, and therefore be into the sign of liver cell like cell.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates the protein and/or the genetic expression of cytokeratin 7.

Feature vii) relates to the per-cent of the cell in the cell colony that comprises into the liver cell like cell, and described cell demonstrates the protein and/or the genetic expression of epithelial cell adhesion molecule.This epithelial cell adhesion molecule is specifically expressing in liver cell the liver ancestors but not, and therefore is into the sign of liver cell like cell.In one embodiment of the invention, comprise in the cell colony of liver cell like cell at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% cell demonstrates the protein and/or the genetic expression of epithelial cell adhesion molecule.

In one embodiment of the invention, have above-mentioned feature i)-at least 2 cell colony in vii) at least 15%, at least a among at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% cell expressing HNF3 β and the AFP for example, and have multiplication capacity.In addition, the cell colony that comprises into the liver cell like cell can have feature i)-in vii) at least 3 or whole 4.

In another embodiment of the invention, the cell colony that comprises into the liver cell like cell further has at least one following characteristics

F. drug transporter:

Viii) at least 1% cell demonstrates protein and/or the genetic expression of BSEP,

Ix) at least 1% cell demonstrates protein and/or the genetic expression of MRP2,

BSEP and MRP2 are for being important carry out the drug transport process towards between the growth period of liver cell like cell, because metabolism, detoxifcation and drainage also may be that this etap is required.

Other purposes aspect

Because the expression of drug transport and drug metabolism enzyme, liver cell like cell of the present invention with become the liver cell like cell all to be well suited in middle use.Therefore, the cell colony of describing among the present invention can be used to prepare the medicament production that is used to prevent and/or treat by following pathological state that causes and/or disease: tissue degeneratiaon is the sex change of liver organization for example, the liver illness, for example be selected from following liver illness: autoimmune disorder comprises primary biliary cirrhosis; Metabolic disorder comprises hyperlipemia; The liver illness that causes by for example alcohol abuse; The disease that causes by virus, for example hepatitis B, hepatitis C and hepatitis A; By the hepatic necrosis that causes for for example acute toxic reaction of pharmacy medicine; With the ablation of tumors in suffering from the patient of hepatocellular carcinoma for example, and metabolism pathological state and/or disease.

In addition, liver cell like cell according to the present invention with become the liver cell like cell to be suitable for screening purpose.For example described cell can use in the method that is used for regard to the hepatotoxicity SCREENED COMPOUND, described method comprise make from according to the cellular exposure of cell colony of the present invention in compound, and measure whether compound is toxic for cell.Described cell can also use in the method that is used for regulating with regard to it ability SCREENED COMPOUND of hepatocyte function, described method comprise make from according to the cellular exposure of cell colony of the present invention in compound, measure and to result from any phenotype or the metabotic change that contact with compound in the cell, and the ability that changes with the adjusting hepatocyte function is associated.

For the purposes in regenerative medicine, the hBS cell must be derived from no foreign matter hBS cell (referring to embodiment 1), and in addition in differentiation, separation be commissioned to train for possible time and never be exposed to non-human animal's deutero-component directly or indirectly during supporting.This can realize by for example recombinate substratum and additive of end user's deutero-component exclusively.

The method that is used to prepare

Cell colony according to the present invention need not to use differentiation agents to obtain, and described differentiation agents is used by other people usually.Differentiation agents has the deleterious shortcoming of pair cell, the quality that this causes the low yield of the noble cells that obtains by this class methods and can influence the cell of these acquisitions in addition.The inventor has identified and need not to use differentiation agents and allow the hBS cytodifferentiation to become the liver cell like cell and/or become the culture condition of liver cell like cell.Be used to prepare liver cell like cell according to the present invention and the method that becomes the liver cell like cell quality of improvement of cell and the yield of improvement are provided thus.In addition, the cell of acquisition has feature described herein, and described feature makes these cells be particularly suitable for the application that this paper elsewhere is mentioned.

In one embodiment of the invention, successfully carry out the hBS cell and in 96 hole flat boards, be divided into the liver cell like cell.It is successful that at least 50%, 60%, 70%, 80%, 90% or 100% of 96 holes become in the liver cell like cell in the hBS cytodifferentiation.The hBS cell will for example be divided into the liver cell like cell according to the solution of the present invention in the time of the 20th, 25,30 or 35 day.

In addition, the method according to this invention is more effortless than currently known methods.Do not need the additive of the expensive factor as substratum, except that bFGF, it is with than the lower amount of previous report and more add continually, and these make that together this method is more cheap than currently known methods.

This method relies on the internal factor from emiocytosis, rather than has the more or less any potential additive of toxic characteristic, that is, and and gentle, the relevant environment of physiology more.Therefore, this method relies on infrequent substratum replacement and the replacement of part substratum.Toxicant only is used to confirm the inducibility of some inducible enzyme.

In addition, this method relies on for the mEF cell towards the differentiation key of liver cell like cell.MEF cell concn about the hBS cytodifferentiation can be 20.000 cells/cm ²-200.000 cells/cm ², for example about 30.000-100.000 cell/cm ², 40.000-70.000 cell/cm for example ², 52.000 cells/cm for example ²

For the existence that is bFGF towards important a kind of other factors of the differential method of liver cell like cell, it adds in the substratum before differentiation.

Being used for starting material of the present invention suitably is the undifferentiated hBS cell of multipotency, for example undifferentiated hBS clone.This type of material can derive from Cellartis AB and also can obtain by NIH stem cell register office http://stemcells.nih.gov/research/registry/.Cellartis AB has 2 kinds of hBS clones (SA001 and SA002) and a kind of subclone (SA002.5) of the SA002 that can obtain by NIH.These hBS clones are frequently used in the present invention.

Recommendation is following as the feature of raw-material hBS cell: for alkaline phosphatase, SSEA-3-SSEA-4, TRA 1-60, TRA 1-81, Oct-4 is positive, for SSEA-1, telomerase activation and versatility in vitro and in vivo be negative (latter forms by the telomere in the immunodeficient mouse and shows) (Fig. 1).

Before use, can be as raw-material hBS clone derived from the LOT preparation of implementing characterization program.(patent in the trial surpasses 100 suction pipes to the LOT preparation formation of hBS clone during the expansion of hBS cell WO2004098285) and a freezing subsequently single go down to posterity according to standard method.Before freezing and back and the form of monitoring hBS clone the continuous passage of the follow-up cultivation of cell after LOT thaws.LOT refrigerated quality verifies by the inspection rate of recovery of thawing, and this should show the rate of thawing for each suction pipe 100% that thaws for 10 times.Cell in subsequently refrigerated being gone down to posterity and substratum are carried out the security test for microbiological safety, do not contain pollutent to guarantee cell.The characterization program of carrying out comprises the differentiation state of the method for broad range with checking hBS clone.At first carry out the marker representation analysis of marker (SSEA-1, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, Oct-4 and ALP) for the common acceptance of undifferentiated cell.Check that by karyotyping and FISH cell is through going down to posterity and freeze-thaw round-robin genetic stability.Use Telo TAGGG Telomerase PCRELISA ^PLUSTest kit is measured telomerase activation.By vitro differentiation via the embryoid step and by differentiation in the body via the versatility of the hBS Transplanted cells being checked the hBS cell under the scrotum of immune deficiency SCID mouse.

Starting material used herein can be not have the foreign matter deutero-fully in addition, and the liver cell like cell that can obtain not have fully foreign matter thus is used for the possible purposes at regenerative medicine.No foreign matter for the hBS cell is derived, and all substratum of use can or not contact with any non-human animal's material not derived from any non-human animal's material with matrix components, feeder cell and other materials.Derive and the suitable ingredients of not having a foreign matter liver cell like cell in addition is no foreign matter deutero-human fibroblasts for the no foreign matter of hBS cell, human foreskin fibroblast for example, have the serum-free of recombinant growth factors, differentiation factor and/or other additives of potential or based on the substratum of human serum, and the people's recombinase or the aseptic machine tool that are used for the separation and the breeding of cell.

Alternative starting material are endoderm cells, i.e. the cell-derived cell of hBS of having finalized the design towards entoderm pedigree (for example entoderm progenitor cell).This type of cell can be expressed one or more following entoderm markers: HNF3 β (hepatocyte neclear factor 3), Gata4, Cdx2 (tail be correlated with homeobox transcription factor), Sox17 (gene product that contains the gene 17 of Sry box) and Pdx1 (the pancreas duodenum homeobox factor-1).

One embodiment of the invention relate to and are used to prepare the method that comprises according to the colony of one-tenth liver cell like cell of the present invention and/or liver cell like cell, and it comprises the steps

I) on the supported matrix in serum free medium, the ancestors that make hBS cell or derived from hBS cell are vitro differentiation at least 5 days,

Replaced substratum in ii) per approximately 5 days-Yue per 25 days,

Iii) come isolated cell by mechanical separation,

Iv) by handling the cell that separating step randomly obtains in iii) with enzyme,

V) express randomly sorting cells based on surface antigen.

The ancestors of derived from hBS cell can express HNF3 β and AFP and have multiplication capacity

Step I) vitro differentiation in was carried out 10 days at least, for example at least 20 days, at least 30 days or at least 40 days.The feature that determines the cell that obtains to have the liver cell like cell preset time of the differentiation in the step still becomes the feature of liver cell like cell hereto.Therefore, in order to obtain the liver cell like cell, the hBS cell on the supported matrix in serum free medium or the ancestors' of derived from hBS cell vitro differentiation was carried out about 18 days-Yue 30 days, preferred 20-27 days, more preferably from about 25 days, and only needed about 5-about 10 days for obtaining into the liver cell like cell, preferred 15 days.

Serum free medium can be selected from VitroHES ^TM, be supplemented with the VitroHES of bFGF ^TMWith VitroHES from body homology pre-adaptation ^TM(adapting to for the liver cell like cell).Serum free medium can further comprise bFGF, preferably with the about 200ng/ml of about 4ng/ml-, and the concentration of the about 150ng/ml of for example about 4ng/ml-, the about 100ng/ml of about 4ng/ml-, the about 50ng/ml of about 4ng/ml-or the about 10ng/ml of about 4ng/ml-.

In one embodiment of the invention, serum free medium is the VitroHES that comprises bFGF ^TMThe concentration of bFGF can be the about 200ng/ml of about 4ng/ml-, the about 150ng/ml of for example about 4ng/ml-, the about 100ng/ml of about 4ng/ml-, the about 50ng/ml of about 4ng/ml-or the about 10ng/ml of about 4ng/ml-.The concentration of bFGF can be 4ng/ml.

At step I i) in, can be from per approximately 10 days to per 20 days, for example every about 12-18 days, for example every 14-15 days replacement serum free mediums.

Supported matrix can comprise feeder cell, for example people or mouse feeder cell, or it can comprise to have and limits or limit the extracellular matrix of forming.Alternatively, supported matrix can be included in bag quilt on the inside of the plastics Tissue Culture Flask that is used for cell cultures, the proteinic bag quilt of alone or in combination one or more, or it can comprise the 3D environment, for example porous filter.Using under the situation of porous filter as supported matrix, this porous filter has the aperture of the about 4 μ m of diameter, and it can wrap quilt with one or more protein alone or in combination.

One or more protein that are used to as mentioned above wrap by bottle or filter can be selected from collagen, ln and combination thereof.

The step I ii) mechanical separation of the middle cell of carrying out can be undertaken by one-tenth liver cell like cell and/or the liver cell like cell that cutting is judged by the range estimation of cellular form.The liver cell like cell shows the general form of liver cell, promptly they have polygon cell shape, maxicell diameter (about 25-50 μ M), normally double-core and be tending towards gathering lipid granule.By experience and experiment fully, for example the expression of α-1-antitrypsin, CK18, HNF-3 β, albumin or LFABP is relevant to have made form and liver marker.The selection of carrying out can further be verified as into liver cell like cell or liver cell like cell by identifying via immunohistochemistry.The alternative approach of mechanical separation be by for example enzyme or sequestrant or its combination make cell and its on the surface of growth and separated from one another, and come sorting cells by for example FAC sorting, magnetic bead or immune elutriation after this.Cell can be planted in suitable culturing bottle with the number that more or less limits subsequently and/or analyze bottle for example in the porous flat plate, to be further used for analyzed in vitro.

According to method described herein, can in the presence of feeder cell (for example people or mouse feeder cell), obtain according to cell colony of the present invention, perhaps they can obtain under the situation that does not have feeder cell.Under the situation that does not have feeder cell, can use the extracellular matrix that has qualification or limit composition to obtain according to cell colony of the present invention, or the plastics Tissue Culture Flask that uses in inside one or more protein of having used alone or in combination to wrap quilt obtain.The suitable protein that is used for this purpose can be selected from collagen, ln and combination thereof.Alternatively, can use 3D environment (for example porous filter) to obtain according to cell colony of the present invention.

The other method that obtains the liver cell like cell is to carry out the hBS cell directional via final similarly entoderm in the 3D cultivation of forming stimulation by for example different substratum to be divided into the liver cell like cell.Can add subsequently and aspect type and concentration, change the different factors or component, for example the serum in the substratum, somatomedin and other stimulating factors.In brief, can cut (out-lined) that delineates, undifferentiated hBS cell sheet and be transferred to for example filter insert of 24 hole flat boards.All cultures subsequently can growth in different substratum are formed, and implements to analyze on different time points, and immunohistochemical analysis for example is to find the maximized Best Times window of yield that is used to make the liver cell like cell or becomes the liver cell like cell.

Obtaining the liver cell like cell or become another method of liver cell like cell can be to make the entoderm progenitor cell of hBS cell or derived from hBS cell and for example liver sheet, for example with as grow up liver or cultivate altogether of the people of explanation among the embodiment 2 hereinafter with the organ sheet or the cell type of another species, for example stimulate towards the taxi mice embryonic liver of liver cell like cell differentiation and cultivate altogether.Common cultivation in this type systematic is for the 3D structure, for example liver cell and conduit bunch formation be favourable.

In addition, in inducing of liver cell sample and the vegetative state that becomes the liver cell like cell can be by the substratum of adjusting at liver cell that comprises somatomedin for example, cultivate and induced.

In a specific embodiments of the present invention, the cell colony of acquisition can be no foreign matter.

One embodiment of the invention relate to and are used to prepare the modification method that comprises according to the colony of liver cell like cell of the present invention, and it comprises the steps

I) at the substratum that is suitable for cultivating hBS cell VitroHES for example ^TMMake hBS cells in vitro differentiation as many as 10-30 days, time period of preferred 13-27 days in the substratum, for example until the 15th day or 23 days.For example, 100% substratum can be replaced with new hepatocyte culture medium, and replaces 50% subsequently,

Ii) in the time of 10-40 days, during preferably at 13-35 days, for example replace at cultivating the new substratum that liver cell is optimized, for example HCM substratum in the time of the 15th day or the 23rd day the time.Described substratum can comprise one or more following components: bovine serum albumin, xitix, Urogastron, Transferrins,iron complexes, Regular Insulin, hydrocortisone and microbiotic.

The cultivation base unit weight that is used to replace can be 30% until 100%.Described substratum can be replaced weekly 3 times or 1 time weekly, preferably weekly 1 time.

In addition, this method can comprise the steps

Iii) randomly add the dexamethasone as many as 10 days, preferred 8 days of high density

Iv) randomly added Sodium propanecarboxylate (NaB) and HGF as many as 10 days, preferred 5 days

V) isolated cell

Vi) by handling the cell that separating step randomly obtains in ii) with enzyme,

Vii) express randomly sorting cells based on surface antigen.

The situation that all the elements mentioned under general method and details are just actual is applied to specific embodiments mentioned above.

Test kit

Another aspect of the present invention relates to test kit, and it comprises i) comprise the liver cell like cell and/or become the cell colony of liver cell like cell, ii) one or more maturation factors and/or maturation medium and iii) randomly, working instructions.Described maturation medium can be selected from VitroHES ^TM, be supplemented with the VitroHES of bFGF ^TMWith VitroHES from body homology pre-adaptation ^TM(adapting to for the liver cell like cell).

One or more maturation factors are selected from bFGF, Urogastron, pHGF and oncostatin M.

In addition, described test kit can comprise and be used to monitor sophisticated instrument.

In one embodiment, be used for monitoring sophisticated instrument and comprise i) be selected from least 3 kinds of gene of following presentation markup thing at coding, the PCR primer of at least 4 kinds or at least 5 kinds for example: HNF3 β, AFP, albumin, BSEP, MRP2, OATP-2, OATP-8, GSTA1-1, CYP450-1A2, CYP450-2A6, CYP450-2B6, CYP450-2C8, CYP450-2C9, CYP450-2C19CYP450-2D6, CYP450-2E1, CYP450-3A4, CYP450-3A7, GST M1-1 and UGT and ii) user manual.

In another embodiment, be used for monitoring sophisticated instrument and comprise i) at being selected from least 3 kinds of following presentation markup thing antigen, the antibody of at least 4 kinds or at least 5 kinds for example: HNF3 β, AFP, albumin, BSEP, MRP2, OATP-2, OATP-8, GST A1-1, CYP450-1A2, CYP450-2A6, CYP450-2B6, CYP450-2C8, CYP450-2C9, CYP450-2C19CYP450-2D6, CYP450-2E1, CYP450-3A4, CYP450-3A7, GST M1-1 and UGT and ii) user manual.

Other instrument that is used for monitoring cell is the component that PROD assay method component and the urea that is used for substratum and/or albumin detect.

Reference

Schwarz, Robert.E, Deng the people, Defined conditions for developmentof functional Hepatic Cells from human embryonic stem cells, STEM CELLS AND DEVELOPMENT 14:643-655 (2005).

Rambha tla, Generation of hepatocyte-like cells from humanembryonic stem cells, Cell Transplant.2003; 12 (1): people such as 1-11Heins, Derivation, characterization, anddifferentiation of human embryonic stemcells; StemCells; 2004; 22 (3): 367-76.

WO 03055992, is used to set up the method for multipotency blastocyst-derived stem cells system

WO 2005/097980

WO 01/81549

Legend

Fig. 1

The feature of starting material hBS cell, i.e. (A) form, (B) SSEA-1 (feminine gender), (C) SSEA-3, (D) SSEA-4, (E) TRA-1-60, (F) TRA-1-81, (G) Oct-4, (H) ALP (all from hBS clone SA002, LOT AL002) and (I) by versatility in the illustrational body of cutting into slices from the painted teratoma of phenodin such as Yihong of immunodeficient mouse, its mesectoderm tissue mark until upper right side, entoderm tissue to lower right side and mesoderm tissue to the left side (from hBS clone SA121).

Fig. 2

Shown for liver marker (A) albumin and (B) CK-18 together with (C) DAPI (nuclear) and (D) stage contrast the liver cell like cell of stained positive, all at SA002, in the 56th generation, is after breaking up 23 days on the mEF.

Fig. 3

Shown that HNF3 β is together with the liver cell like cell of (C) DAPI stained positive for liver marker (A) AAT with (B), all at SA034, in the 137th generation, is after breaking up 32 days on the mEF.

Fig. 4

Shown at SA034, the 135th generation, on the mEF differentiation 25 days after for the liver cell like cell of liver marker (A) LFABP stained positive with at SA002, the 56th generation, on the mEF differentiation 23 days after for the p+ liver cell like cell of early stage liver mark (B) AFP.

Fig. 5

Shown at SA002, the 63rd generation, differentiation on the mEF after 23 days with (B) (A) CK18 of Cyp1A2 coexpression.Reactivity can manifest so that microscope and color are clear.

Fig. 6

Shown at SA002, the 63rd generation, differentiation on the mEF after 23 days with (B) (A) CK18 of Cyp2A6 coexpression.The Cyp protein expression can also use the CYP inductor mixture of Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine further to be induced (data not shown).Reactivity can manifest so that microscope and color are clear.

Fig. 7

Shown at SA002, the 63rd generation, differentiation on the mEF after 23 days with (B) (A) CK18 of Cyp2B6 coexpression.Reactivity can manifest so that microscope and color are clear.

Fig. 8

Shown at SA002, the 63rd generation, differentiation on the mEF after 23 days with (B) (A) CK18 of Cyp2C8/9/19 coexpression.The Cyp protein expression can also use the CYP inductor mixture of Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine further to be induced (data not shown).Reactivity can manifest so that microscope and color are clear.

Fig. 9

Shown at SA002, the 63rd generation, differentiation on the mEF after 23 days with (B) (A) CK18 of Cyp2D6 coexpression.The Cyp protein expression can also use the CYP inductor mixture of Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine further to be induced (data not shown).Reactivity can manifest so that microscope and color are clear.

Figure 10

Shown at SA002, the 63rd generation, differentiation on the mEF after 23 days with (B) (A) CK18 of Cyp2E1 coexpression.The Cyp protein expression can also use the CYP inductor mixture of Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine further to be induced (data not shown).Reactivity can manifest so that microscope and color are clear.

Figure 11

Shown at SA002, the 63rd generation, differentiation on the mEF after 23 days with (B) (A) CK18 of Cyp3A4/7 coexpression.The Cyp protein expression can also use the CYP inductor mixture of Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine further to be induced (data not shown).Reactivity can manifest so that microscope and color are clear.

Figure 12

Cyp 3A4/7 in the liver cell like cell that manifests by western blotting and the inducibility of Cyp 1A2 have been shown with after inducing mixture process.

Inductive hBS cell (the Cyp inductor mixture of Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine 96 hours): at the 51st, 53,54 and 55 generations of SA002 (LOT AL002), after breaking up 23-25 days on the mEF, and SA002.5 (LOTBE002.5) the 51st, 52,54 and 55 generations, after breaking up 23-24 days on the mEF.

Untreated hBS cell: at the 47th, 52 and 56 generations of SA002 (LOT AL002), in differentiation on the mEF after 19-23 days, and the 48th, 53 and 55 generations of SA002.5 (LOT BE002.5), in differentiation on the mEF after 19-26 days.

(catalog number (Cat.No.) HB-8065, ATCC): in the 23rd generation, is as negative control for HepG2.

Former generation keratinocyte (catalog number (Cat.No.) C-12003, Promocell) with the 2nd generation as negative control.

Thaw and the human primary hepatocyte (masculinity and femininity) of prepared fresh as positive control.Beta-actin contrasts as inner the loading.

Figure 13

Shown the general Cyp activity of using the PROD assay method.This paper manifests by lightness, and this activity obtains increasing after handling with Cyp inductor (as above).Untreated cell in stage contrast (A) and the PROD fluorescence (B), the inducing cell in stage contrast (C) and the PROD fluorescence (D).Technology contrast (not adding PROD) in stage contrast (E) and the PROD fluorescence (F) to cell.All photos are at the 56th generation of SA002, in differentiation on the mEF after 26 days.It is yellow to manifest brightness with grey scale better that photo uses Adobe Photoshop to be transformed into from redness.

Figure 14

Shown (A) and back (B) before inducing by the mixture that adds Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine GST A1-1, induce before (C) and back (D) GST M1-1 and induce before (E) and after the GST P1-1 expression of (F).For GST M1-1 and GST P1-1, can't observe clear and definite inducing, induce and observe slightly for GST A1-1.It is yellow to manifest brightness with grey scale better that photo uses Adobe Photoshop to be transformed into from redness.

Figure 15

Shown and induced by the GST A1-1 of western blotting in the liver cell like cell with after inducing mixture process.

The 35th, 36,43 and 46 generations of SA002.5 (LOT BE002.5), and SA167 (LOTCE167) the 17th, 18,25 and 28 generations, in differentiation on the mEF after 20-26 days, both are untreated or with the CYP inductor mixture process of Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine 96 hours.(thawing) primary hepatocyte of GST protein formulation and people's masculinity and femininity prepared fresh is with comparing.

Figure 16

At derived from the liver cell like cell of 3 kinds of different hESC systems and the GST enzymatic activity of the CDNB in human liver cell and the HepG2 cell, be expressed as the substrate that mol puts together/minute/the mg total protein (mean value ± SD, n=3).

Figure 17

Shown immunoreactivity for the liver cell like cell of II phase metabolic enzyme UGT1A1 and UGT1A6.

UGT1A1 (A) and CK18 (B) coexpression, and UGT1A6 (C) and CK18 (D) double staining are all at the 59th generation of SA002, in differentiation on the mEF after 24 days.Reactivity can manifest so that microscope and color are clear.

Figure 18

Shown immunoreactivity to the liver cell like cell of drug transporter OATP-2/8.At the 56th generation of SA002, in (A) DAPI, (B) OATP-2/8, (C) the stage contrast of differentiation on the mEF after 23 days.It is yellow to manifest brightness with grey scale better that photo uses Adobe Photoshop to be transformed into from redness.Reactivity can manifest so that microscope and color are clear.

Figure 19

Shown immunoreactivity to the liver cell like cell of drug transporter BSEP.At the 32nd generation of SA002, in (A) DAPI, (B) BSEP, (C) the stage contrast of differentiation on the mEF after 23 days.It is yellow to manifest brightness with grey scale better that photo uses Adobe Photoshop to be transformed into from redness.Reactivity can manifest so that microscope and color are clear.

Figure 20

Shown immunoreactivity to the liver cell like cell of drug transporter MRP-2.About the 33rd generation of SA002, in (A) DAPI, (B) MRP-2, (C) the stage contrast of differentiation on the mEF after 22 days.It is yellow to manifest brightness with grey scale better that photo uses Adobe Photoshop to be transformed into from redness.Reactivity can manifest so that microscope and color are clear.

Figure 21

Shown from clone SA002, LOT AL002, in the 15th generation, is the glycogen storage in the liver cell like cell when breaking up the 21st day.Glycogen detects by the PAS coloring system and is incarnadine dyeing.Culture personnel selection saliva before glycogen detects is handled (B and D) or be untreated (A and C).

Figure 22

CYP and GST immunostaining have been shown to the liver cell like cell that on Matrigel, breaks up.

(A) Cyp1A2 and (B) Cyp 2B6 coexpression and (C) CK18 and (D) GSTA1-1 coexpression, all at SA002, in the 57th generation, is after breaking up 24 days on the Matrigel.It is yellow to manifest brightness with grey scale better that photo uses Adobe Photoshop to be transformed into from redness.

Figure 23

Shown and control sample (BE002.5 from the undifferentiated hBS cell of same amount cDNA, the 24th generation, the 5th day (control sample 1) and BE002, the 62nd generation, the 4th day (control sample 2)) relevant, use QPCR from clone SA002.5, LOTBE002.5, the high MRP-2 that the 2nd generation broke up the 21st day expresses.Expression level is calculated by the CT value (threshold cycle) that obtains at 3 kinds of cell samples and further compares with the expression of control sample 2.MRP2 in the liver cell like cell is expressed in the undifferentiated cell high 11-32 doubly.

Figure 24

Shown inducing that Cyp 1A2 in the liver cell like cell expresses.Untreated liver cell like cell (A) and corresponding stage contrast (B) and inductive (C) and corresponding stage contrast (D).It is yellow to manifest brightness with grey scale better that photo uses Adobe Photoshop to be transformed into from redness.

Figure 25

Shown inducing that Cyp 2B6 in the liver cell like cell expresses.Untreated liver cell like cell (A) and respective stage contrast (B) and inductive (C) and respective stage contrast (D).It is yellow to manifest brightness with grey scale better that photo uses Adobe Photoshop to be transformed into from redness.

Figure 26

Shown by the plastidogenetic AFP of the hBS that cultivates altogether with the fetal mice liver is positive and become the liver cell like cell.Red human specific nuclear antigen (differential dyeing nuclear) shows that the hBS cell produces positive big bunch (referring to the embodiment 2) of green entoderm deutero-AFP.

Figure 27

Shown derived from Cyp1A2,3A4/7 in the untreated and inductive liver cell like cell of clone SA167 (A and B), SA002 (Cand D) and SA002.5 (E and F) and the western blot analysis of 1A1 protein expression.A, C, E: untreated cell, B, D, F: with the cell of inductor mixture process.G: human liver cell Lot GIU22 (for CYP1A1Lot MYO), H: untreated hESC is SA002.5, I:MEF, J:HepG2 cell and K: recombinant C YP1A1.

Figure 28

(A) shown reaction at liver/entoderm marker HNF4 α, (B) shown reaction at the marker Ki67 of the proliferative cell ratio that is used for Display Group, (C) show in many one-tenth liver cell like cells localized HNF4 α and Ki67 altogether, (D) shown DAPI (dyeing nuclear) and (E) demonstration form.

Figure 29

Shown and related to the multiplication capacity and the inductive result thereof of substratum in response.(referring to embodiment 4).(A)-(C) be presented at VitroHES ^TMThe liver cell like cell of the middle SA002 cell of cultivating, wherein (A) shows form, (B) shows for KI67 marker reactionless (promptly not having propagation) with (C) to show for the antitryptic reaction of liver marker α-1-.(D)-(F) be presented at the liver cell sample SA002 cell of cultivating in the WillimasE substratum, wherein (D) shows form, (E) shows for the reaction (propagation) of KI67 marker with (F) to show for the antitryptic reaction of liver marker α-1-.

Figure 30

Shown the EROD reaction in liver cell like cell and the primary hepatocyte.Left column is presented at that (from the top) is untreated, the EROD activity omeprazole+Rifampin inductive and the 6 component mixture inductive liver cell like cells, and right row show the accordingly result in the primary hepatocyte.Therefore the liver cell like cell has specific C yp 1A2 reactivity, and this also detects before handling with the Cyp inductor, although very faint at that time.(referring to embodiment 13).

Figure 31

Shown with HepG2 and compared the Cyp activity in the cell-derived liver cell like cell of hBS.(A) and (D) show untreated liver cell like cell, (B) and (E) shown inductive liver cell like cell, and (C) and (F) shown HepG2.

Figure 32

Shown the PROD reaction in liver cell like cell and the primary hepatocyte.Left column is presented at that (from the top) is untreated, the PROD activity primidone inductive and the 6 component mixture inductive liver cell like cells, and right row show the accordingly result in the primary hepatocyte.Therefore the liver cell like cell also has general Cyp activity before handling with the Cyp inductor.(referring to embodiment 4).

Figure 33

Rat hepatocytes (photo is from Professor Ian Cotgreave) (left side) with liver cell tubule that mark comes out and liver cell like cell (right side) have been shown with tubule similar structures.

Figure 34

Shown the schema that is used for via becoming the liver cell like cell from the cell-derived liver cell like cell of hBS.

Figure 35

The Notch2 (green is in the film) of film expression and the expression of nuclear staining (blueness) among the clone SA461 (the 26th generation) have been shown after cultivating 17 days.The liver cell like cell of arrow indication double-core.Magnification 250x.

Figure 36

Shown liver cell like cell, HepG2 and people's liver extract induce with non-inducing culture thing in measure and the relative gene expression dose of Cyp3A4,3A7,1A1,1A2 and Cyp2A6 relatively by real time pcr.The measurement of people's liver extract is made as 1, and every other sample is compared with the reference of people's liver with regard to every kind of cytopigment p450.Carry out stdn about all expression of gene at GAPDH (CYP1A1/1A2, CYP2A6) or TBP (CYP3A4/3A7).

Figure 37

The research and design that has shown the improvement of the substratum that is used to cultivate the liver cell like cell.Research and design A; After 15 days with 100% substratum from VitroHES ^TMReplace to HCM and in the time of 23 days, 50% HCM is replaced with new HCM substratum.Carry out this experiment with clone SA002.Research and design B; After 23 days with 100% substratum from VitroHES ^TMReplace to HCM.Carry out this experiment with clone SA348.

Figure 38

Shown according to experimental design A and B, Figure 37 and embodiment 1,2, table 5 is respectively at VitroHES ^TM(A) and the form of the liver cell like cell of cultivating among the HCM (B).

Figure 39

Shown according to experimental design A and B, Figure 37 and embodiment 1,2, table 5 compares with HCM, and HNF4-α, albumin, CYP3A4 and UGT2B7 are at VitroHES ^TMIn relative mRNA expression level.From reference scheme (VitroHES ^TM) data be made as 1, and presented in the drawings via the multiple in the heterogeneic expression level of HCM substratum and increased.

Figure 40

Shown replenishing and the research and design of inducible factor about the substratum that is used for cultivating the liver cell like cell.Research and design C; After 22-24 days, add 50 μ m dexamethasone.Experiment is carried out with clone SA002, SA167 and SA348.Research and design D; VitroHES ^TMSubstratum replaced to other 5 days of the HCM substratum that is supplemented with HGF and Sodium propanecarboxylate (NaB) after 21 days.

Figure 41

Shown according to experimental design C, Figure 40 and embodiment 1,2,3, table 6 is at VitroHES ^TM(A) and be supplemented with the VitroHES of 50 μ m dexamethasone ^TMThe form of the liver cell like cell of cultivating (B).And, according to experimental design D, Figure 40 and embodiment 1,2, table 7 is at C) VitroHES ^TMD) be supplemented with the liver cell like cell of cultivating among the HCM of HGF and Sodium propanecarboxylate.

Figure 42

A) shown according to experimental design C, Figure 40 and embodiment 1,2,3, table 6 is at the relative mRNA expression level of handling HNF4-α, albumin, CYP3A4 and UGT2B7 in the liver cell like cell of back with 50 μ m dexamethasone.B) according to experimental design D, Figure 40 and embodiment 1,2, table 7, the relative mRNA expression level after using Sodium propanecarboxylate and HGF handles.From reference scheme (VitroHES ^TM) data be made as 1, and presented in the drawings via the multiple in the heterogeneic expression level of different treatment and increased.

Figure 43

Shown about substratum and replaced frequency, seldom the research and design of replacing with frequent substratum.Use HCM and VitroHES ^TM

Figure 44

Figure 43 and embodiment 1, the form of table 8 liver cell like cell after seldom (A) replaces the substratum of frequent (B) have been shown according to experimental design E.

Figure 45

Shown according to experimental design E, Figure 43 and embodiment 1, table 8 is replaced relatively with frequent substratum, and substratum is seldom replaced the relative mRNA gene expression dose of back HNF4-α, albumin, CYP3A4 and UGT2B7.The data of replacing from frequent substratum are made as 1, and the multiple that has presented in the drawings in the heterogeneic expression level in substratum replacement back seldom increases.

Figure 46

Sky, 3 (A)-6 (B-C) after planting 38 the biggest liver cell like cells on 96 holes of collagen I bag quilt again.Using no Ca and Mg PBS (A) or collagenase (B-D) to handle the explant of liver cell like cell before the plantation again.Culture carries out double staining at liver cell marker CK18 (B, D) and HNF3 β (C).Scale: 100 μ m (A) and 50 μ m (B-C).About experimental detail referring to embodiment 15.

Figure 47

The immunohistochemistry of liver cell like cell and form have been shown in (A-C and the G-I) that plant collagen I bag quilt again and mEF cellular layer (D-F and J-L) 96 holes after last 5 day.Culture is at becoming liver cell marker HNF4 α (A, B, D, E) and CK19 (G, H, J, K) to dye.Shown among B, E, H and the K about the marker of nuclear staining and the coverage diagram of Dapi.Difference is as seen about each painted corresponding aspect graph in C, F, I and L.Arrow indication dikaryocyte among the figure C.Scale: 25 μ m; Use the 40x object lens.About experimental detail referring to embodiment 18.

Figure 48

Be presented at the ICG picked-up of liver cell like cell in 30 the biggest cultures.

Figure 49

Be presented at the one-tenth liver cell of 15 the biggest cultures.This cell is a male for CK19 (A), CK7 (B) and EpCam (C).

Embodiment

Embodiment 1

Starting material

Be used for starting material of the present invention and be the suitably undifferentiated hBS cell of multipotency, for example undifferentiated hBS clone.This type of material can derive from Cellartis AB and also can obtain by NIH stem cell register office http://stemcells.nih.gov/research/registry/.Cellartis AB has 2 kinds of hBS clones (SA001 and SA002) and a kind of subclone (SA002.5) of the SA002 that can obtain by NIH.In addition, 20 kinds of Cellartis clones in the UK stem cell bank, have been listed.These hBS clones and frequently use in the present invention from the other SA167 of CellartisAB and SA348.Recommendation is following as the feature of raw-material hBS cell: for alkaline phosphatase, SSEA-3, SSEA-4, TRA 1-60, TRA 1-81, Oct-4 is positive, for SSEA-1, telomerase activation and versatility in vitro and in vivo is that negative (latter forms by the telomere in the immunodeficient mouse and shows) (referring to Fig. 1) (method and scheme are as indicated previously, people such as Heins, WO03055992).

LOT preparation and characterization program

(patent in the trial surpasses 100 suction pipes to the LOT preparation formation of hBS clone during the expansion of hBS cell WO2004098285) and a freezing subsequently single go down to posterity according to standard method.Before freezing and back and the form of monitoring hBS clone during continuous generation of the follow-up cultivation of cell after LOT thaws.LOT refrigerated quality verifies by the inspection rate of recovery of thawing, and this should show the rate of thawing for each suction pipe 100% that thaws for 10 times, promptly can carry out time being commissioned to train foster from the suction pipe of each single checking at the back cell material that thaws.Cell in subsequently refrigerated being gone down to posterity and substratum are carried out the security test about microbiological safety, do not contain pollutent to guarantee cell.The characterization program of carrying out comprises the method for broad range, with the differentiation state of checking hBS clone.At first carry out the marker representation analysis of marker (SSEA-1, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, Oct-4 and ALP) for the common acceptance of undifferentiated cell.Check that by karyotyping and FISH cell is through going down to posterity and freeze-thaw round-robin genetic stability.Use Telo TAGGG Telomerase PCR ELISAPLUS test kit to measure telomerase activation.By vitro differentiation via the embryoid step and by differentiation in the body via the versatility of the hBS Transplanted cells being checked the hBS cell under the scrotum of immune deficiency SCID mouse.

Starting material used herein can be not have the foreign matter deutero-fully in addition, the liver cell like cell that can obtain not have fully foreign matter thus is used for the possible purposes at regenerative medicine, and therefore significantly reduces the risk of transplant rejection and may shifting of non-human pathogen.No foreign matter for the hBS cell is derived, and all substratum of use can or not contact with any non-human animal's material not derived from any non-human animal's material with matrix components, feeder cell and other materials.Derive and the suitable ingredients of not having a foreign matter liver cell like cell in addition is no foreign matter deutero-human fibroblasts for the no foreign matter of hBS cell, human foreskin fibroblast for example, have the serum-free of recombinant growth factors, differentiation factor and/or other additives of potential or based on the substratum of human serum, and the people's recombinase or the aseptic machine tool that are used for the separation and the breeding of cell.

Embodiment 2

Obtain the scheme of liver cell like cell

Internal factor scheme (inducing) differentiation by being exposed to the internal factor of secreting to substratum

A) the hBS cell to the growth of the mEF cellular layer in the IVF culture dish (Falcon) is implemented in 37 ℃, 5%CO ₂With 40 days differentiation of as many as under 95% humidity, to obtain the liver cell like cell.Substratum (the VitroHES that uses with 4ng/ml people's recombinant bfgf [Invitrogen] of interpolation ^TM[Vitrolife AB]) by discarding old substratum of about 1-2ml and interpolation 1-2ml fresh culture every 7-21 days, replaced in per 14 days usually.After 18-30 days, use sharp microscopic capillary or Stem Cell Tool ^TM(Vitrolife AB) is as cutting and means of transferring isolating hepatocytes like cell from culture, and merge cell subsequently and be used for Long-term Storage (freezing) or use immediately, or alternatively directly fixing and dyeing or be used for for example Cyp activation measurement in culture dish as viable cell.MEF has seemed to provide the signal of interest of supporting that the liver cell like cell is grown, because the differentiation of hBS cell is significantly changing (for example in the hBS cell cultures on Matrigel) and obtaining the liver cell like cell (data not shown) of much less from this type of cultivation under the situation that does not have mEF.This can be used for this type of part that obtains of cultivating the substratum that mEF adapts to by use saves, and illustrates that the factor is secreted in the substratum via mEFs.As one man, we have observed in the training period to surpass and have replaced substratum 2 times and seem that for acquisition liver cell like cell be disadvantageous.Another important factor that is used to obtain the liver cell like cell is to use the bFGF supplemental medium.

B) in being supplemented with the mEF acclimatizing culture medium of 4ng/ml bFGF at Matrigel ^TM(Becton-Dickinson) go up the hBS cell of growing and be implemented in 37 ℃, 5%CO ₂With 40 days differentiation of as many as under 95% humidity, to obtain the liver cell like cell.Replaced the substratum that uses in every 7-21 days.After 18-30 days, use sharp microscopic capillary or Stem Cell Tool ^TMAs cutting and means of transferring isolating hepatocytes like cell from culture, and merge cell subsequently and be used for Long-term Storage (freezing) or use immediately, or fix and be used to characterize for example immunohistochemistry.

Manually and mainly rely on form and carry out liver cell like cell with noble cells colony and the selection that becomes the liver cell like cell in the culture dish.By previous experience and experiment fully, the expression of those that use mainly that immunohistochemistry makes that form and liver marker for example list among the embodiment 3-7 is relevant.Use those experiences, the technician can initiatively select the liver cell like cell by form.

In order to obtain into the liver cell like cell, use same approach but incubation period is foreshortened to 10-20, preferred 15 days.

Filter and cultivate

The undifferentiated hBS cell (the 42nd generation of BE 002.5) that to cultivate 5-10 days on mEF in the IVF ware cuts into small pieces, and by using glass capillary to be transferred to the filter insert (aperture: 4 μ m φ of the 24 hole flat boards that comprise 400 μ l substratum, cultivate for explant special-purpose, Millipore).Filter contacts with media surface, allows the nutrition intake of cell and produce wet environment to prevent that simultaneously the cell in the substratum from flooding, thus situation in the analogue body.Described substratum is by 50%VitroHES ^TMWith constitute from 50% conditioned medium that does not break up the hBS cell on the mEF that is supplemented with 4ng/ml bFGF.Every the sky or replaced half substratum in per the 3rd day.Cell broke up respectively before analysis 7,14,21 and 31 days.By immunohistochemical analysis 3D-hBS cell culture.Fixed culture in 4%PFA, cryopreservation in 30% sucrose subsequently, and be embedded among the Sakura O.C.T.tissue-tek.On form with the freezing microtome section of analyzing 10 μ m with regard to the immunoreactivity of different entoderms and liver cell sample marker.

Be total to culture scheme

The organ of mice embryonic liver takes place to stimulate the hBS cell to be divided into the liver cell like cell in 3 dimension filter systems.Separate the liver explant of EGFP (enhanced green fluorescent protein) Transgenic Mice Embryo be in different developmental phases, and be transplanted to the hBS cell of cultivating in the adjacent filter system.Cultivate independent hBS cell or the adjacent hBS Transplanted cells of the mice embryonic explant except that liver (heart and yolk sac) and on filter, cultivate in contrast.Coculture is at the VitroHES that is supplemented with 4ng/ml bFGF ^TMIn grow, and replaced 50% substratum in per the 2nd or 3 day.The the 7th and 14 day, preparation was cultivated altogether and is used for immunohistochemical analysis.Analyze entoderm and liver marker for example HNF3 β, AFP, HNF4 α, CK18, CYP3A4/7 and CYP1A2/1.

The amount or the number of entoderm derived structure are divided into 4 classifications--tuftlet, big bunch, conduit and lining, epithelium (referring to this paper definition hereinafter).Removing extra-epithelial structure is male for entoderm with early stage liver marker AFP, HNF3 β and α-1-antitrypsin.Number with regard to every kind of section and culture counting different structure.With the overall number of each structure divided by slice numbers for every kind of coculture counting.This obtains measuring this structure in every section how long once value takes place, and this will be given in the indication of the amount of 3 dimension hBS co-culture of cells thing mesendoderm structures.Calculate the mean value of each group (n=3) and the standard error (SEM) of mean value.This research repeats 2 times.

Tuftlet is defined as to be less than or equal to 5 be the cell aggregation of positive cells for AFP.Being defined as more than or equal to 6 with big bunch is the cell aggregation of positive cells for AFP.The conduit and the lining that form common category are defined as list or multilayer hollow structure.Epithelium is defined as with the group structure structure that prolongs nuclear that has in closely going with positive lining of AFP or cell cluster bonded.Epithelium never is a male for AFP.In the time of the 14th day, the tuftlet of similar quantity has taken place in all groups, and conduit and lining exist only in the group that comprises mice embryonic explant graft, and therefore the hBS cell of spontaneous differentiation is not easy to form conduit and lining.Yet, with the hBS cell comparison of yolk sac and heart coculture and spontaneous differentiation, big bunch of more normal being present in the liver coculture.For example HNF3 β, AFP, α-1-antitrypsin, HNF-4 α, CYP3A4/7 and CYP1A2/1 are male for entoderm and liver marker such as the structure of big bunch and conduit.Yet, bunch be negative for CK18, may indicate immature liver cell like cell.

In a word, data point out the hBS cell can with from the intimate contact of the liver of E10.5 mice embryonic during than more effectively being divided into into liver cell like cell or liver cell like cell individually.

Table 1 has been listed the liver marker that passes through immunohistochemical analysis after cultivating 14 days altogether with hBS cell and E10.5 fetal mice liver.

The IHC mark	Bunch/conduit
		HNF3β	+
HNF4α	+
		AFP	+
AAT	+
		CK18	-
CYP3A4/7	+
		CYP1A2/1	+

Embodiment 3

Sign (referring to Fig. 2,3 and 4) with the liver marker

The liver cell like cell demonstrates hepatocellular gross morphology, promptly they have polygon cell shape, maxicell diameter (about 25-50 μ M), normally double-core and be tending towards gathering lipid granule.In addition, they express several markers for the liver cell type specification, for example albumin, alpha1-antitrypsin, LFABP, CK18 and HNF3 β.They no longer express the stem cell labeling thing that is used for undifferentiated cell, Oct-4.Some is speculated as more jejune liver cell like cell and still expresses fetus liver marker AFP.These cells are preferentially found in the colony of the hBS cell that breaks up.DAPI (4 ', 6 '-diamidino-2-benzene indole hydrochloride, Sigma Aldrich) in contrast to manifest nucleus.(about at Matrigel ^TMCK18 in the liver cell like cell of last differentiation expresses, referring to Figure 22.)

For the evaluation that is proliferated into liver cell sample progenitor cell, use AFP, HNF4, CK19, CK7 and EpCam.(Figure 49)

One of use resists:

Albumin (rabbit) 1: 500, DAKOCytomation, A0001

AAT (rabbit) 1: 200, DAKOCytomation, A0012

CK18 (mouse) 1: 200, DAKOCytomation, M7010

LFABP (goat) 1: 500, Santa Cruz, sc-16064

HNF3b (goat) 1: 250, Santa Cruz, sc-6554

Oct-4 (mouse) 1: 500, Santa Cruz, sc-5279

C-Met (HGF acceptor, mouse) 1: 100, upstate, 05-237

α 6-integrin (CD49f, rat) 1: 250, BD Biosciences, 555736

ICAM-1 (CD54, mouse) 1: 500, BD Pharmingen, 559047

AFP (mouse) 1: 200, SIGMA, A8452

HNF4alpha (rabbit) 1: 400, Santa Cruz, sc-8987

CK19 (mouse) 1: 200, Novocastra, NCL-CK19

CK7 (mouse) 1: 200, Novocastra, NCL-L-CK7-560

EpCAM-FITC，1∶200，GeneTex，Inc.GTX28666

Two of use resists:

Anti-goat-the Alexa 488,1: 500 of-donkey, Molecular Probes, #A-11055

Anti-mouse-the Cy3 of-donkey, 1: 1000, Jackson Immuno Research, #715-165-151

-donkey resists-mouse-Cy2, and 1: 100, Jackson Immuno Research, #715-225-151

-donkey resists-rabbit-Alexa 488,1: 1000, Molecular Probes, #A-21206

-donkey resists-rabbit-Alexa 594,1: 1000, Molecular Probes, #A-21207

-donkey resists-rat-Cy3, and 1: 500, Jackson Immuno Research, #712-165-153

-donkey resists-rat-Cy2, and 1: 100, Jackson Immuno Research, #712-225-153

The immunostaining scheme:

Albumin, AAT, CK18, HNF3b, Oct-4, CK19, CK7, AFP:

In 4%PFA, fix 15 minutes, 2x PBS washing, in being dissolved in the 5%FBS of 0.1%PBT 30 minutes, one resists in being dissolved in the 1%FBS of 0.1%PBT and is incubated overnight in 4 ℃, two resisted in being dissolved in the 1%FBS of 0.1%PBT under RT incubation 3 hours, all in 0.1%PBT, wash, under the room temperature in the DAPI of 0.05mg/ml 5 minutes, in the DAKOCytomation mounting medium, fix.

LFABP, c-Met, α 6-integrin, ICAM-1, CXCR4:

In 4%PFA, fix 15 minutes, 2xPBS washing, in being dissolved in the 5%FBS of PBS 30 minutes, one resists in being dissolved in the 1%FBS of PBS and is incubated overnight in 4 ℃, two resisted in being dissolved in the 1%FBS of PBS under RT incubation 3 hours, all in PBS, wash, under the room temperature in the DAPI of 0.05mg/ml 5 minutes, in the DAKOCytomation mounting medium, fix.

EpCam：

In 4%PFA, fix 15 minutes, 2xPBS washing, in being dissolved in the 5%FBS of 0.1%PBT 30 minutes, what FITC directly puted together one resists in being dissolved in the 1%FBS of 0.1%PBT and is incubated overnight in 4 ℃, in PBS, wash, under the room temperature in the DAPI of 0.05mg/ml 5 minutes, in the DAKOCytomation mounting medium, fix.

Embodiment 4

Characterize

I phase metabolic enzyme:

The liver cell like cell is showed the immunoreactivity at following Cyp: 1A2,2A6,2B6,2C8/9/19 (potential antibody cross reaction between 3 hypotypes), 2D6,2E1,3A4/7 (potential antibody cross reaction between 2 hypotypes).(about the liver cell like cell that on mEF, breaks up, referring to Fig. 5-11 with about at Matrigel ^TMThe expression of Cyp1A2 and Cyp2B6 in the liver cell like cell of last differentiation is referring to Figure 22).Be exposed to the induction type that Cyp induces mixture visible Cyp expression after 96 hours, described Cyp induces mixture to comprise 25 μ M Rifampins, 20 μ M desoxyphenobarbitals (primidone), 100 μ M dexamethasone, 88mM alcohol, 25 μ M omeprazoles and 100 μ M vazadrine.(about inducing of Cyp 1A2 in the liver cell like cell on mEF and 2B6, referring to Figure 24 and 25).Cyp also carries out immunohistochemical analysis in HepG2, this does not produce any reaction (referring to Figure 31).

One of use resists:

Cyp1A2 (rabbit) 1: 100, biomol, CR3130

Cyp2A6 (rabbit) 1: 100, biomol, CR3260

Cyp2B6 (sheep) 1: 100, biomol, CR3295

Cyp2C8/9/19 (rabbit) 1: 100, biomol, CR3280

Cyp2D6 (sheep) 1: 100, biomol, CR3245

Cyp2E1 (rabbit) 1: 100, Chemicon, AB1252

Cyp3A4/7 (sheep) 1: 100, biomol, CR3345

Cyp2E1 (rabbit) 1: 1000, Oxford Biomedical Research, PA26

Cyp3A4/7 (rabbit) 1: 1000, Oxford Biomedical Research, PA32

Two of use resists:

-donkey resists-goat-Alexa 488,1: 500, Molecular Probes, #A-11055

Anti-mouse-the Cy3 of-donkey, 1: 1000, Jackson Immuno Research, #715-165-151

-donkey resists-mouse-Cy2, and 1: 100, Jackson Immuno Research, #715-225-151

-donkey resists-rabbit-Alexa488, and 1: 1000, Molecular Probes, #A-21206

-donkey resists-rabbit-Alexa 594,1: 1000, Molecular Probes, #A-21207

-donkey resists-rat-Cy3, and 1: 500, Jackson Immuno Research, #712-165-153

-donkey resists-rat-Cy2, and 1: 100, Jacks on Immuno Research, #712-225-153

-donkey resists-sheep-Alexa488, and 1: 1000, #A-11015

-donkey resists-sheep-Alexa594, and 1: 1000, #A-11016

The immunostaining scheme:

In 4%PFA, fix 15 minutes, 2xPBS washing, in being dissolved in the 5%FBS of 0.1%PBT 30 minutes, one resists in being dissolved in the 1%FBS of 0.1%PBT and is incubated overnight in 4 ℃, two resisted in being dissolved in the 1%FBS of 0.1%PBT under RT incubation 3 hours, all in 0.1%PBT, wash, under the room temperature in the DAPI of 0.05mg/ml 5 minutes, in the DAKOCytomation mounting medium, fix.

Western blotting:

In western blotting, confirm the expression (referring to Figure 12) of Cyp1A2 and 3A4/7.After handling with the Cyp induced drug, with from be untreated and the protein band of inductive cell relatively, 1A2 and 3A4 and or the protein mass of 3A7 (potential cross reaction) obviously increase, manifest the inducibility of liver cell like cell.

Use be supplemented with 1: 100 protease inhibitor cocktail (Sigma-Aldrich) M-PER proteins extraction reagent (Pierce) from cell, extract protein.By electrophoresis isolated protein on the 12%SDS polyacrylamide gel, then it is transferred to nitrocellulose filter (Biorad, Hercules, CA).For immunoblotting, one resisting in 1%BSA sealing damping fluid and dilute at (Cyp1A2 (rabbit) and Cyp3A4/7 (rabbit), the both is from Biomol).Two anti-be that corresponding HRP-puts together antibody and (was respectively the anti-goat of goat antirabbit, goat anti-mouse and rabbit (1: 2000; DAKO, Glostrup, Denmark)).Specification sheets (Amersham, Piscataway, NJ) use enhanced chemiluminescence (ECL) according to manufacturers.The HepG2 cell is as negative control.Former generation human liver cell (In Vitro Technologies, Leipzig is Germany) as positive control.

In other operation, use from Biomo (rabbit pAb, Cyp1A2 specific antibody CR130).From respectively at inductive and untreated SA002, LOT AL002 and SA167, the result of this operation of LOT AL002 points out the specific C yp1A2 reaction (although very weak) in the 2 kinds of cell-derived liver cell like cell of hBS colonies.(referring to Figure 27).

Cyp activation measurement (referring to Figure 13,30 and 32):

It is active and induce the mixture process cell PROD is active after 96 hours with Cyp and induce by force that the PROD assay method demonstrates composition PROD in the untreated liver cell like cell.Carry out the EROD assay method in addition, show that specificity group becomes second nature with derivable Cyp 1A2 activity (referring to Figure 30).2 kinds of assay methods all demonstrate with primary hepatocyte in the same derivable activity, and in addition, before any the inducing in the cell-derived liver cell like cell of hBS, in fact have basal expression, although very weak.

Mixture comprises 25 μ M Rifampins, 20 μ M desoxyphenobarbitals (primidone), 100 μ M dexamethasone, 88mM ethanol, 25 μ M omeprazoles and 100 μ M vazadrine.PROD (Pentoxyresorufin) is that general Cyp activation measurement and EROD (oxyethyl group resorufin) is special for Cyp1A2.PROD or EROD mother liquor 2 kinds of products of Sigma Aldrich catalog number (Cat.No.) 77105 and 46121 (respectively from) concentration with 2mM in DMSO is prepared.Pair cell was induced 96 hours with various inductors or is not handled in contrast.Before carrying out this assay method, with cell with the careful washing of PBS 2 times, and in fresh PBS incubation 15-30 minute to wash the inductor of residual quantity off.With 25 μ M PROD among cell and the PBS or with PBS in 50 μ M EROD in the dark in 37 ℃ of incubations 60 minutes.And then analyze with cell washing 2 times and at microscopically with PBS.

At the inductive of liver cell like cell, HepG2 and people's liver extract with not in the inductive culture, measure and the relative gene expression dose of Cyp3A4,3A7,1A1,1A2 and Cyp2A6 relatively by real time pcr.The measurement of people's liver extract is made as 1, and every other sample is relevant with the reference of people liver with regard to every kind of cytopigment p450.Carry out stdn about all expression of gene at GAPDH (CYP1A1/1A2, CYP2A6) or TBP (CYP3A4/3A7), referring to Figure 36.

Embodiment 5

Characterize:

II phase metabolic enzyme:

The liver cell like cell is showed at the strong immunoreactivity of GST A1-1 with at the more weak immunoreactivity of GST M1-1.Do not show or demonstrate low immunoreactivity (about the liver cell like cell that on mEF, breaks up, referring to Figure 14) at fetus GST P1-1.In addition, the liver cell like cell demonstrates the immunoreactivity (referring to Figure 17) at UGT 1A1 and UGT 1A6.After handling with induced drug, observe at slightly the inducing of GST A1-1, but do not observe clearly inducing at GST M1-1 or GST P1-1.(about at Matrigel ^TMGSTA1-1 in the liver cell like cell of last growth expresses, referring to Figure 22).

One of use resists:

GSTA1-1 (rabbit) 1: 500, Oxford Biomedical Research, GS62

GSTM1-1 (rabbit) 1: 500, Oxford Biomedical Research, GS67

GSTP1-1 (rabbit) 1: 500, Oxford Biomedical Research, GS72

UGT1A1 (rabbit) 1: 500, BD Biosciences, 458411

UGT1A6 (rabbit) 1: 500, BD Biosciences, 458416

Two of use resists:

-donkey resists-rabbit-Alexa488, and 1: 1000, Molecular Probes, #A-21206

-donkey resists-rabbit-Alexa594, and 1: 1000, Molecular Probes, #A-21207

The immunostaining scheme:

In 4%PFA, fix 15 minutes, 2xPBS washing, in being dissolved in the 5%FBS of 0.1%PBT 30 minutes, one resists in being dissolved in the 1%FBS of 0.1%PBT and is incubated overnight in 4 ℃, two resisted in being dissolved in the 1%FBS of 0.1%PBT under RT incubation 3 hours, all in 0.1%PBT, wash, under the room temperature in the DAPI of 0.05mg/ml 5 minutes, in the DAKOCytomation mounting medium, fix.

Western blotting:

Western blotting confirms expressing from the GST A1-1 (25kDa) in the liver cell like cell of hBS clone SA002.5 (LOT BE002.5), SA167 (LOT CE167) (referring to Figure 15) and SA002 (LOT AL002) (data not shown).About the GST hypotype GST P1-1 (25kDa) of fetus more, do not detect expression by western blotting.Cell lysate from the V79 cell of crossing expressing human GST is used as positive control.B-Actin muscle (42kDa) contrasts as the inner sample of going up.In undifferentiated hBS cell, can't detect the expression of GST A1-1 or GST P1-1 from strain SA002 or SA002.5.

Use be supplemented with 1: 100 protease inhibitor cocktail (Sigma-Aldrich) M-PER proteins extraction reagent (Pierce) from cell, extract protein.By electrophoresis isolated protein on the 12%SDS polyacrylamide gel, then it is transferred to nitrocellulose filter (Biorad, Hercules, CA).For immunoblotting, resist in 1%BSA blocking-up damping fluid at one of GST A1-1 and GST P1-1 (1: 1000) and to dilute.Two anti-be that corresponding HRP-puts together antibody and (was respectively the anti-goat of goat antirabbit, goat anti-mouse and rabbit (1: 2000; DAKO, Glostrup, Denmark)).Specification sheets (Amersham, Piscataway, NJ) use enhanced chemiluminescence (ECL) according to manufacturers.Former generation human liver cell (In VitroTechnologies, Leipzig, Germany) and the GST protein formulation as positive control.

GST activation measurement (referring to Figure 16):

Use people's 1974 such as Habig spectrophotometer measurement assay method to measure at 1-fluoro-2 the GST catalytic activity of 4-dinitrobenzene (CDNB).CDNB (1-chloro-2,4-dinitrobenzene) is that general GST is with reference to substrate (Mannervik 1988).Reaction mixture is made up of 20mM CDNB and the 10 μ l protein cleavage things of 0.2MGSH, the 2.5l of the 0.1M potassiumphosphate (pH 6.5) of 85 μ l in the M-PER lysis buffer, 2.5 μ l.The nonprotein complete assay method mixture of M-PER lysis buffer that contains 10 μ l is with comparing.Use Philips PU8720 UV/VIS scanning spectrophotometer to monitor absorbancy 1 minute in 340nm place and 30 ℃.Measure in the liver cell like cell of derived from hBS clone SA002 (LOT AL002), SA002.5 (LOT BE002.5) and SA167 (LOT CE167) and human primary hepatocyte sample culture and HepG2 culture at the GST catalytic activity of CDNB.The liver cell like cell of derived from hBS demonstrates with the similar GST activity of human primary hepatocyte with than the obvious higher GST activity of HepG2 culture.Referring to Figure 16.

Embodiment 6

Characterize:

Drug transporter

Immunohistochemistry:

The liver cell like cell demonstrates the immunoreactivity (referring to Figure 18,19,20) at translocator MRP2, BSEP and OATP-2 and/or OATP-8 (potential antibody cross reaction).OATP-2/8 and MRP2 seem to express in most of liver cell like cells, and BSEP only expresses in the microcommunity that becomes liver cell and liver cell like cell.

One of use resists:

MRP2 (rabbit) 1: 50, Santa Cruz, sc-20766

BSEP (goat) 1: 50, Santa Cruz, sc-17292

OATP-2 (mouse) is prediluted, Progen Biotechnik GmbH, clone mMDQ

Two of use resists:

-donkey resists-goat-Alexa 488,1: 500, Molecular Probes, #A-11055

Anti-mouse-the Cy3 of-donkey, 1: 1000, Jackson Immuno Research, #715-165-151

-donkey resists-mouse-Cy2, and 1: 100, Jackson Immuno Research, #715-225-151

-donkey resists-rabbit-Alexa488, and 1: 1000, Molecular Probes, #A-21206

-donkey resists-rabbit-Alexa594, and 1: 1000, Molecular Probes, #A-21207

-donkey resists-rat-Cy3, and 1: 500, Jacks on Immuno Research, #712-165-153

-donkey resists-rat-Cy2, and 1: 100, Jackson Immuno Research, #712-225-153

-donkey resists-sheep-Alexa488, and 1: 1000, #A-11015

-donkey resists-sheep-Alexa594, and 1: 1000, #A-11016

The immunostaining scheme:

MRP2、OATP-2：

In 4%PFA, fix 15 minutes, 2xPBS washing, in being dissolved in the 5%FBS of 0.1%PBT 30 minutes, one resists in being dissolved in the 1%FBS of 0.1%PBT and is incubated overnight in 4 ℃, two resisted in being dissolved in the 1%FBS of 0.1%PBT under RT incubation 3 hours, all in 0.1%PBT, wash, under the room temperature in the DAPI of 0.05mg/ml 5 minutes, in the DAKOCytomation mounting medium, fix.

BSEP：

In 4%PFA, fix 15 minutes, 2xPBS washing, in being dissolved in the 5%FBS of PBS 30 minutes, one resists in being dissolved in the 1%FBS of PBS and is incubated overnight in 4 ℃, two resisted in being dissolved in the 1%FBS of PBS under RT incubation 3 hours, all in PBS, wash, under the room temperature in the DAPI of 0.05mg/ml 5 minutes, in the DAKOCytomation mounting medium, fix.

The analysis of MRP2 genetic expression (referring to Figure 23)

Compare with undifferentiated cell, the MRP2 in the liver cell like cell expresses high 11-32 times respectively.

Use from the Trizol Reagent of Gibco from liver cell like cell (SA002.5, the 2nd generation of LOT BE002.5, after breaking up 21 days on the mEF) and undifferentiated hBS cell (SA002.5, the 24th generation of LOT BE002.5, the 5th day (control sample 1) and SA002, LOT BE002, the 62nd generation, the 4th day (control sample 2)) the total RNA of middle extraction.(Invitrogen Ltd, Paisley UK) become complementary DNA (cDNA) with the total RNA reverse transcription of 5 μ g after the processing using deoxyribonuclease I to use Supercriptll test kit (Invitrogen Ltd).Use Primer3 software program and Netprimer to be designed for the gene-specific primer and the probe of translocator.Use is used for the primer and SensiMix Sybr Green Mix (the final MgCl of 1.5mM of genes involved ₂); (Celtic Diagnostics), the 0.7 AmpliTaq Gold of unit archaeal dna polymerase), 300nM gene specific forward and reverse primer are by polymerase chain reaction (PCR) amplification 200ng cDNA.The primer sequence that uses is a forward: tgcagcctccataaccatga and reverse: ggacttcagatgcctcca.At the enterprising performing PCR of Corbett Rotorgene, wherein initial step in 50 ℃ 2 minutes, in 95 ℃ 10 minutes and subsequently in 95 ℃ 15 seconds and in 62 ℃ of 40 circulations of 260 seconds.The pcr amplification of every kind of sample carries out in duplicate so that pipetting error drops to minimum.Comprise that for each run no template contrast is as negative control.Use the Ct value of standard A BI scheme record, and use 2 about every kind of sample ^{Δ (40-Ct)}Calculating is about the relative genetic expression of every kind of sample.By minimum sample being made as zero relative expression who estimates under the hypothesis of 90% efficient.

Embodiment 7

Detect (Periodic Acid-Schiff coloring system, SIGMA-ALDRICH, catalog number (Cat.No.) 395-B) by the glycogen storage of PAS dyeing in cell

Detect the liver cell like cell by the PAS staining and store up glycogen (referring to Figure 21).As the technology negative control, the culture that saliva is handled confirms the minimizing that glycogen detects in the 95-99% culture.When no matter when having the glucose residue, the common function that glycogen synthesizes and stores up the many cell types that are human body.Yet liver cell and skeletal muscle are being stored up special specialization aspect the glycogen.In the hBS cell cultures of differentiation, before selecting or cutting the liver cell like cell, observe other cell colonys that to store up glycogen and observe the several colonies that to store up glycogen.Importantly, in the culture of not storing up glycogen, there is non-liver cell like cell.Fix 15 minutes in 4% paraformaldehyde that cell at room temperature dilutes in methyl alcohol, in PBS, wash 3 times then.As the technology negative control, the culture saliva of at room temperature choosing was handled 20 minutes, washed in PBS then.People's saliva comprises the α-Dian Fenmei that digests glycogen.To make at room temperature that oxidation of glycol becomes that the Periodic acid of aldehyde add to handle with untreated culture in 5 minutes, repetitive scrubbing in PBS subsequently.Then, culture incubation 15 minutes at room temperature in Schiffs reagent makes and reacts between triaminotriphenyl-carbinol and the sodium metabisulfite that this generation makes the cellular compartment that contains ethylene glycol dye the triaminotriphenyl-carbinol product of bright pink colour.In PBS, after the washing, cell was at room temperature redyed in phenodin 90 seconds, and fixing preceding in mounting medium at H ₂Carry out rinsing among the O.The nuclear of brazilwood extract dyeing cell (light blue).

Embodiment 8

Genetic analysis

The analysis purposes specific gene, for example hereinafter the another kind of method of those disclosed is by using quantitative PCR (QPCR).A kind of this generic operation of doing like this is as follows: at first select suitable gene, the coupling primer of design and those gene complementations, undertaken quantitatively by pcr analysis, and the expression level of goal gene and house-keeping gene (if known to stably express between the differentiation phase) or the gene of reducing between the differentiation phase are compared.The example of the suitable gene of reducing between the differentiation phase in several hBS clones is Cripto, Nanog and Oct-4.

The cell-derived liver cell like cell of hBS can further characterize on hereditary level (mRNA expression level), by routine techniques, microarray, microfluidic card or the gene chip of those (tables 1) that the gene that for example has a suitable selection is for example listed in the following table.Derived from the cDNA of total RNA of sample can with for example microfluidic card hybridization, and experiment is provided with middle operation at PCR, and uses suitable software further to analyze.

Table 2

According to Guide Book (Applied Biosystems 7900HT Micro Fluidic CardGetting Started Guide) and following shortening scheme, clone SA167, LOT CA167 and SA002, the undifferentiated hBS cell of LOT AL002 and on the LDA chip, run parallel in repeated experiments with inductor mixture process and untreated liver cell like cell derived from 2 kinds of clones:

By total RNA prepare cDNA and in no RNA enzyme/DNA enzyme water with it the dilution, to accept suitable concentration (vide infra).Following component is mixed:

cDNA(1-100ng)，5μl

No RNA enzyme/DNA enzyme water

TaqMan Universal PCR，45μl

Master mixture (2X), 50 μ l

Amount to: 100 μ l

After this sample is loaded on the LDA card (every kind of sample mixture is 100ul and 170ngcDNA/ sample) and carries out centrifugally, seal the LDA card then.At last, make to be stuck on the ABI 7900HT real-time PCR system according to the specification sheets in the handbook and move, and by using SDS 2.2.1 software and relative quantification methods analyst result.

The summary of (analyzing or QPCR by the LDA) liver protein that detects up to now in the cell-derived liver cell like cell of hBS is presented in following table 3 and 4.

Table 3

CYPs	UGT	Translocator
				1 a1	1A1，3，4，5，6，7，8，9，10	OATP-A
1 a2	1A3	OATP-C
			1B1	1A6	NTCP
2 a6	1A8	OCT1
			2B6	2B7	MDR3
2C8		MDR1
			2C9		BSEP
2C19		MRP2
			2D6
2E1
			3A4
3A5
			3A7

Table 4

Transcription factor	Other
		PXR	Albumin
CAR	G-6-Pase
		FXR
RXRα	Apo E
		RXRβ	Alcoholdehydrogenase 1A
RXRγ
		HNF-1α
HNF-3α
		HNF-3β
HNF-4α
		HNF6
DBP
		C/EBP A
C/EBP B

Embodiment 9

The bioreactor culture of liver cell like cell

HBS cell and deutero-cell type thereof for example become liver cell like cell or liver cell like cell to cultivate in the 3-D space, and described 3-D space can be divided by for example artificial hollow fiber capillary membranes.This system will make cell can grow into bigger cell mass between kapillary, and by perfusion culture base and gas (as oxygen) provide optimization, natural surroundings.Can develop closed bioreactor system producing more substantial cell (as many as 10^11 cell), and the keeping of the functional property of sustenticular cell.To allow subsequently in closed GMP system, to increase in proportion via the dabbling cellular segregation of enzyme.Can use FAC sorting or the use density gradient medium and the centrifugal cell purification that carries out of for example expressing subsequently based on for example membrane antigen.

Embodiment 10

Urea synthesis

Therefore urea synthesis is the liver specificity feature, measures on the different time points of urea level after inducing 24 hours from the substratum of the different clones that are divided into the liver cell like cell.Collect media samples and send and be used for analyzing.At Klinisk Kemi, C-lab, Sahlgrenska University Hospital, Gothenburg are used for the test kit (Roche/Hitachi) of the dynamic UV assay method of urea/blood urea nitrogen and analyze urea secretion.

Desired value in blood serum is 10-50mg/dL (1.7-8.3mmol/L).

Is 0.8mmol/L according to this method about the more low-level of urea detection.

HBSC deutero-liver cell like cell is produced urea with the level that is similar to primary hepatocyte and it is secreted in the substratum.What is interesting is, only when the liver cell like cell appears in the culture, promptly about 20 days and thereafter, can detect enough, significant urea level.

Further function test also can be carried out described in 2002 and 2005 as people such as Schwarz about for example albumin secretion.The liver cell like cell with become the liver cell like cell more further function characterize and can carry out the LDL picked-up and gluconeogenetic ability is analyzed with regard to it.

Embodiment 11

Cell polarity and functional

Sandwich culture systems can further be improved cell polarity and functional in the past along with the time of liver cell like cell.In this type of culture systems, the embedding of liver cell like cell provides the 3D environment of the interior liver of analogue body except that lower level oxidative stress, the liver cell like cell can show polarity thus, promptly form and have top side (hydrophobicity, bile side in body) and the epithelium spline structure of the end outside (wetting ability is towards body inner blood side).Another potential improvement for the liver cell like cell in sandwich cultivation is even stronger Cyp expression inducibility.

Embodiment 12

Characterize with immunohistochemical Notch:

The hBS cell of the cultivation that will grow in the IVF ware is at room temperature fixed 15 minutes with 4% paraformaldehyde.Cell subsequently with one anti-(Notch2,1: 200, Santacruz, sc5545 USA) is incubated overnight in 4 ℃.Second day with cell with 1XPBS washing 2 times 10 minutes, then with two anti-(anti-rabbit-FITC, 1: 500) incubation 1 hour at room temperature in 1XPBS together, wash 2 times respectively 5 minutes and be exposed to 1 μ g/ml DAPI solution 5 minutes.Cell wash with water 2 times each after 5 minutes, they are fixed among the Aquamount and by fluorescent microscope analyze.Recently shown undifferentiated hBS cell expressing Notch2 (people such as Noggle, 2006).In Cellartis hBS clone SA002, extremely a large amount of cells is weak Notch2 male in first day of differentiation.After 2 weeks, Notch2 only finds the dikaryocyte of promptly similar liver form (referring to Figure 35) in the minority subclass of liver cell sample and/or one-tenth liver cell like cell.

Embodiment 13

According to the internal factor scheme among the embodiment 2 by make the hBS cell cultivate respectively 14 with the vegetative state of testing into liver cell like cell and liver cell like cell over 21 days.Analyze when angel's culture in 4%PFA at room temperature fixedly 15-20 minute, washing several times and infiltration processing among the 0.1-0.5%TritonX100 that dilutes in PBS in PBS.For becoming the liver cell like cell, use entoderm/early stage liver marker HNF4 α (rabbit pAb, SantaCruz, SC-8987, dilution in 1: 400) and for the liver cell like cell, use entoderm/liver marker HNF3 β (Foxa-2) (IgG, Santa Cruz, SC-6554,1.200 dilutions).In order to study the propagation of 2 kinds of liver cell like cell colonies, add antibody Ki67 (BDPharmingen, #556003, dilution in 1: 500) at the refrigerator overnight incubation.Several times after the washing, apply two anti-and incubations 2 hours at room temperature.The washing culture also comprises DAPI so that detect nuclear in the washing the last time.By with Ki67 locating and displaying altogether, to become the liver cell like cell for HNF4 α male be propagation (referring to Figure 28).The liver cell like cell is not a male for Ki67, and demonstration is non-proliferative cell.

In addition, the proliferation-inducing of test hBS cell-derived liver cell like cell is to watch by the somatomedin that changes culture medium condition and add the propagation in the known stimulation primary hepatocyte whether inducing multiplication capacity in the liver cell like cell.Break up under the condition that allows hBS cell (clone SA002) formerly to describe and became into liver cell and liver cell like cell in 17 days.Substratum is replaced to the Williams substratum E (Sigma, W-4128) that is supplemented with 10%FBS (or serum substitute), 1%PEST, 1%Glutamax, 1xITS, 0.25ng/ml dexamethasone, 2%DMSO, 20ng/ml HGF, 10ng/ml EGF, 10ng/ml oncostatin M, 10mM niacinamide and 4ng/ml bFGF.The hBS cell was cultivated 5-15 days in addition, wherein per approximately 5 days replacement substratum.Thereafter as mentioned above at the multiplication capacity of other 11 days post analysis cells.When in the Williams E substratum that replenishes as mentioned above, cultivating, the liver cell like cell propagation of derived from hBS cell, and at the VitroHES that is supplemented with 4ng/ml bFGF ^TMDo not detect propagation (referring to Figure 29) in the liver cell like cell of middle growth.Therefore, if when in therefore suitable medium, cultivating, can the multiplication capacity of cell cultured supernatant like cell for increasing.

Embodiment 14

The hBS cell is to the differentiation of liver cell like cell in 96 hole flat boards

With manual 96 holes of cutting and be transferred to the mEF bag quilt of ametycin processing into pieces of the biggest hBS cell of 4-5.Add 2-3 sheet hBS cell in each hole.Culture is at the VitroHES that is supplemented with 4ng/ml bFGF ^TMIn at 37 ℃, 5%CO ₂With incubation 20-30 under 95% humidity days.In the time of the 10th day, use the fresh VitroHES that is supplemented with 4ng/ml bFGF ^TMReplace 50% substratum and in the time of the 20th day, replace 100%.The hBS cell colony is to break up with the similar mode of hBS cell colony of cultivating in the IVF ware of MEF bag quilt, therefore about the 14th day occur around the colony with HNF4 alpha immunization reacting positive, become the liver cell like cell and occur the liver cell like cell during at the 20th day.By using this scheme, it is successful that 80% 96 holes became aspect the liver cell like cell in the hBS cytodifferentiation in the time of the 20th day.

Embodiment 15

The liver cell like cell is planted on the different surfaces again

Before the liver cell like cell is planted again, wrapped by the hole of 96 hole flat boards by pre-with the difference bag: from collagen I (the BD Biosciences of rat tails, #354236), the Matrigel of 10%-100% different concns (basement membrane matrix, BD Biosciences, #356237) or the mEF cellular layer handled of ametycin.The following quilt that wraps: add collagen I in 96 holes and at 37 ℃, 5%CO ₂With incubation under 95% humidity 30 minutes-1 hour.From each hole, discard unnecessary collagen I, and subsequently the hole is washed 2 times to remove any trace acidic acid with PBS.The HCM substratum that makes the hole be full of 50-100 μ l to be supplemented with the preheating of 20%FCS (is supplemented with the HCM of cc-4316BB, cc-4362BB from Cambrex, cc-4335BB, cc-4313BB, cc-4321BB, cc-4317BB, cc-4381BB ^TMThe HBM of SingleQouts ^TM, cc-3199).For matrigel bag quilt, the freezing aliquots containig of matrigel is thawed in refrigerator overnight.Matrigel is diluted to reach the matrigel of 10%-100% in the HCM substratum.The matrigel of different concns added 96 holes and in 37 ℃ of incubations 30 minutes.Before being supplemented with the HCM substratum of 20%FCS, adding discards unnecessary matrigel.By using liver cell like cell zone, and with the stem cell cutter it is transferred to and comprises VitroHES from the biggest culture of miniature scalper micro-dissections 25-38 of BD ^TMThe collection ware of substratum.The zone that comprises the liver cell like cell of micro-dissections forms tuftlet and it is concentrated from several flat boards.Before planting on the dull and stereotyped different bag quilts in 96 holes that comprise the HCM substratum that is supplemented with 20%FCS again, bunch with no calcium and magnesium PBS in 37 ℃ handle 10 minutes, on heated plate TrypLeSelect (Gibco, #12563) handled 3-5 minute for 42 ℃, or handled 5-15 minute in 37 ℃ with collagenase IV.After one day, have the liver cell like cell bunch with surface attachment and begin from bunch migrating to the surface.Separating treatment for all different types of bag quilts and liver cell like cell all is like this.The HCM substratum that is supplemented with 20%FCS is replaced to serum-free HCM substratum.Every other day provide fresh HCM substratum to culture.After several days, the liver cell like cell is implantation hole more.The liver cell like cell is kept in cultivation still had the liver gross morphology in 45 days: big polygon and syncyte (referring to Figure 46), and be male (Figure 46) for liver cell marker HNF3 β and CK18.

Embodiment 16

Metabolism liver cell like cell

Under the situation that does not have inductor with regard to it respectively via I phase cytopigment p450 enzyme--the cell-derived liver cell like cell of hBS that the aptitude tests of cyp1A2, cyp2C9 and cyp3A4 metabolism Phenacetin, diclofenac and midazolam obtain by different differentiation schemes.Measure to divide other material to be discharged into meta-bolites in the substratum by LC-MS.Comprising mixed culture from the liver cell like cell of clone SA002, SA002.5 and SA348 tested when big at 26-35 days.Material as mixture at no phenol red medium; In 26 μ M Phenacetins, 9 μ M diclofenacs and the 3 μ M midazolams at 37 ℃ and 5%CO ₂Following incubation 6 hours, 12 hours and 24 hours.Collect from the sample of every kind of culture and time point, and with high speed centrifugation 20 minutes to remove any cell debris.The clarifying media samples of 100 μ l is transferred to 96 hole flat boards, and in each hole, adds 15 μ l acetonitriles.Make sample freezing until being undertaken by LC-MS and analyzing meta-bolites and measure.

The liquid chromatography (LC) system is by (Switzerland) (AgilentTechnologies Deutschland, Waldbronn Germany) form for Zu He HP 1100 serial LC pumps and column oven for CTC Analytics, Zwingen with HTS PAL syringe.For 4-hydroxyl diclofenac and 1-hydroxyl midazolam, anti-phase HyPurity C18 (2.1x50mm, 5 μ m, ThermoQuest, Runcorn UK) goes up and to carry out LC in 40 ℃ with HyPurity C18 pre-column and separate.Mobile phase is made up of (A) 0.1% (v/v) formic acid and 0.1% (v/v) formic acid that (B) is dissolved in acetonitrile.Organically-modified agent content was increased to 80%B through 3 minutes from the 5%B linearity, got back to 5%B then 0.2 minute.

For Paracetamol, upward carry out chromatography at Zorbax Eclipse XDB-C8 (4.6x150mm, 5 μ m) with HyPurity C18 pre-column, use identical system and moving phase.Organically-modified agent content was increased to 30%B through 5 minutes from the 2%B linearity, was increased to 80%B through 2 minutes from the 30%B linearity then, then through getting back to 2%B in 0.1 minute.Retention time about 4-hydroxyl diclofenac, 1-hydroxyl midazolam and Paracetamol was respectively 2.9,2.4 and 6.4 minutes.(ternary quadruple mass-spectrometer API4000 Canada) detects for Applied Biosystems/MDS Sciex, Concord with being equipped with electrospray interface.MS is to operate under 450 ℃ for 4-hydroxyl diclofenac in the turbo heater temperature, and operates in 550 ℃ for 1-hydroxyl midazolam and Paracetamol, and atomizer gas is respectively (GS1) 50,30,70 and 50.Turbine gas (curtain gas) is respectively (GS2) 50,60,70 and 70,, and curtain gas is respectively 20,20,10 and 20.Electrospray voltage for 4-hydroxyl diclofenac is in the negative mode-3kV, and is respectively 5 in holotype and 3.5kV for 1-hydroxyl midazolam and Paracetamol.Collision energy is made as-15,39 and 21V respectively, and collisional activated decomposition gas is respectively 5,7 and 5.Selected MRM transition is 309.9＞265.9 for 4-hydroxyl diclofenac, is 342.0＞202.7 and is 152.3＞110.0 for Paracetamol for 1-hydroxyl midazolam.Use the sampling time of 200ms.Use Applied Biosystems/MDS Sciex Analyst 1.4 softwares to carry out instrument control, data gathering and data evaluation.

From the Cyp activity of different ages with the cell-derived liver cell like cell of hBS different under the situation that does not have inductor.

Clone	Age	Cyp1A2	Cyp 3A4	Cyp2C9	Explain
						SA002	26-37 days	*	*	*
SA348	30-37 days	*	*	*
						SA002.5	34-39 days	*	*	*	HCLC plants to collagen I or matrigel again and demonstrates Cyp 1A2,3A4 and 2C9 activity.

Embodiment 17

The active composition of cyp

When analyzing drug metabolism so that predicting intravital drug metabolism, the active composition of cyp in the liver cell is basic.The Cyp that how to reflect human liver cell well is active to be formed for the cyp activity of analyzing hBSC deutero-liver cell like cell is formed, in mixture (respectively by cyp1A2, cyp2C9 and cyp3A4 metabolism) the liver cell like cell and human primary hepatocyte of adding derived from clone SA348 with medicine Phenacetin (26 μ M), diclofenac (9 μ M) and midazolam (3 μ M).Behind 12 hours incubations of medicinal mixture, collect the LC-MS that sample is used for meta-bolites and detect.As before analyzing at preparation sample as shown in the embodiment 16 and by LC-MS.Cyp between 3 kinds of enzyme systems of analytical test is active to be formed.

Cyp between Cyp1A2, Cyp3A4 and the Cyp2C9 is active to be formed

	Cyp1A2	Cyp3A4	Cyp2C9
				Human primary hepatocyte	67％	21％	12％
Liver cell like cell SA348	70％	21％	8％

The active active composition of the cyp that is similar in the human primary hepatocyte cultivation of forming of the cyp of liver cell like cell.

Embodiment 18

The improvement of liver cell like cell

In order to improve hBSC deutero-liver cell like cell, use screening method based on real time pcr.The improvement of relative expression's level indication liver cell like cell of 4 kinds of gene HNF4 α, Cyp3a4, albumin and UGT2B7.Cyp3a4 is a cytopigment p450 enzyme important in the adult human liver.60% I phase enzymic activity in its formation adult human liver.Albumin is expressed at sophisticated and adult hepatocyte's camber.UTG2B7 is the important II phase enzyme (glucuronyl transferase) of adult human liver.That the Cyp3a4 of elevated levels, albumin and UTG2B7 indication improve, sophisticated and the liver cell like cell of function more arranged potentially.HNF4 α is into the early stage marker of liver cell like cell.The level indication that raises in the HNF4 α genetic expression increases the one-tenth liver cell like cell of number.The HNF4 α of high-caliber albumin, Cyp3A4 and UTG2B7 and minimizing level will point out sophisticated and the HCLC colony of function will more be arranged.

Use the total RNA (about detailed description vide infra) of Invitrogens Trizol method extraction from the cell sample of different schemes.Use oligo dT from total RNA specimen preparation cDNA then.Use instant Taqman primer thereafter, from the standard program of Applied Biosystems and the instrument cDNA that in real-time PCR reactions, increases.

For the required number of cycles of analyzing and testing (CT value), the PCR product is carried out stdn for the CT value of the house-keeping gene GAPDH in the same sample.Thereafter the comparison C that is used for relative quantification by use _tMethod (Δ Δ C _tMethod) the stdn CT value of control sample in standardized CT value and the each experiment is compared.The result is expressed as subsequently that the multiple between the sample and control sample changes in the identical experiment.

Well-designed different parameter and culture scheme are so that improve the liver cell like cell.Test different substratum, make the liver cell like cell in cultivation, keep the longer time, analyze the frequency in the substratum replacement, test different maturations and inducible factor etc.

The reference scheme that is used for making the hBS cytodifferentiation become the liver cell like cell (being similar to the sort of that embodiment 2 describes):

The 1st day in blocks with hBS cell manual cut, and be transferred to comprise and be supplemented with 4ng/ml

The VitroHES of bFGF ^TMThe IVF ware of the mEF bag quilt of substratum

Substratum with 50% replaced with the VitroHES that is supplemented with 4ng/ml bFGF in the 10th day ^TM

Substratum.

The 14-15 days one-tenth liver cell like cells by HNF4 α dyeing indication are presented on the week of colony

Enclose.

100% substratum replaced with in the 20th day and be supplemented with 4ng/ml bFGF's

VitroHES ^TMSubstratum.The liver cell like cell appear at colony around.

One of key element of this scheme is that few substratum that takes place is replaced.Internal factor is crucial for various process.

The improvement scheme

The different substratum of I

From the experiment 1,2 in the HCM cultivation base table 5 of Cambrex; Figure 37-39

II is supplemented with maturation and inducible factor

A. the experiment in the dexamethasone table 61,2,3; Figure 40-42

The b.HCM substratum, HGF, the experiment 1,2 in the Sodium propanecarboxylate table 7; Figure 40-42

The III substratum is replaced frequency

HCM substratum and VitroHES ^TMExperiment 1 in the table 8; Figure 43-45

I. the HCM substratum from Cambrex is the bovine serum albumin (BSA-FAF that is supplemented with single aliquots containig; 10ml/500ml HBM, cc-4362BB, Cambrex), xitix (0.5ml/500ml HBM, cc-4316BB, Cambrex), Urogastron (rh-EGF; 0,5ml/500ml HBM, cc-4317BB, Cambrex), Transferrins,iron complexes (0.5ml/500mlHBM; Cc-4313BB, Cambrex), Regular Insulin (0.5ml/500ml HBM; Cc-4321BB, Cambrex), hydrocortisone (0.5ml/500ml HBM; Cc-4335BB, Cambrex) and microbiotic (GA-1000; 0.5ml/500ml HBM; Cc-4381BB, serum-free basic medium Cambrex).Substratum is optimized at the primary hepatocyte culture.

VitroHES wherein ^TMThe scheme of replacing with the HCM substratum after the 15th or 23 day produces the liver cell like cell that improves.The gene expression dose that demonstrates albumin, CYP3A4 and UGT2B7 derived from the liver cell like cell of the improvement of clone SA002 and SA348 raise (Figure 39).Judge that by form the periphery with hepatocellular colony is wideer in the culture that improves, and cell more non-sclerous (steatotic) (Figure 38).About research and design, referring to Figure 37, about the scheme details, referring to table 5 experiment 1 and 2.

IIa. the HCLC derived from clone SA167, SA348, SA002 breaks up according to reference scheme, yet, when finishing, scheme replenishes 8 days outward appearances (Figure 41 A+B) to improve HCLC with the high density dexamethasone.In addition, demonstrate wherein the gene expression dose of HNF4 α, albumin, cyp3A4 and the UGT2B7 tangible trend (Figure 42 A) that raises.About research and design, referring to Figure 40, research and design C and about the scheme details, referring to table 6, experiment 1,2,3.

IIb. the liver cell like cell derived from clone SA167 and SA002 breaks up until the 21st day according to reference scheme.On that time point, substratum replaced to the HCM substratum that is supplemented with HGF and Sodium propanecarboxylate (NaB)

III. test the importance that the seldom substratum of the differentiation of liver cell like cell of derived from hBS cell and ripening process is replaced, and analyze, VitroHES is wherein arranged with regard to several different substratum ^TMAnd HCM ^TMSubstratum.Follow reference scheme until the 15th day.After the 15th day, one week of substratum replaces 3 times or 1 time.About research and design, referring to Figure 43 with about the scheme details, referring to the experiment in the table 81.All substratum for test are observed visible trend.The seldom replacement of substratum has improved liver cell like cell (Figure 44 A+B) and for Cyp3A4, albumin, UTG2B7 and the HNF4 α gene expression dose (Figure 45) that raise in the form direction.Data point out that internal factor is crucial for the atomization of hBSC deutero-liver cell like cell.

Embodiment 19

The cell-derived one-tenth of hBS liver cell progenitor cell

In order to be created as liver cell ancester cell system, to separate the cell-derived one-tenth of 15 the biggest hBS liver cell like cell, and plant the difference bag again by last.Before the plantation again of one-tenth liver cell like cell, wrapped by the hole of 96 hole flat boards by pre-with different bags: have 17-20x10 ³Cell/cm ²The mEF cell handled of the ametycin of density, the collagen I from rat tails of dilution in 1: 3 in the HCM substratum (BD Biosciences, #354236) or Matrigel (basement membrane matrix, BD Biosciences, #356237).Bag be operated as before in embodiment 15 about as described in collagen I and the matrigel.The HCM substratum that makes the hole be full of 50-100 μ l to be supplemented with the preheating of 20%FCS (is supplemented with the HCM of cc-4316BB, cc-4362BB from Cambrex, cc-4335BB, cc-4313BB, cc-4321BB, cc-4317BB, cc-4381BB ^TMThe HBM of SingleQouts ^TM, cc-3199).By using, and move to the stem cell swivel and to comprise VitroHES from the miniature scalper micro-dissections of BD one-tenth liver cell like cell zone from 15 the biggest cultures ^TMThe collection ware of substratum.The zone that comprises the one-tenth liver cell like cell of micro-dissections forms tuftlet and collects from several flat boards.With described bunch

The liver cell general feature, and have growth (Figure 47 D-F and K, the L bunch on the mEF cellular layer of the one-tenth liver cell like cell of small nut.In addition, the great majority of on mEF, growing become liver cell like cell bunch for become liver cell marker CK19 be strong positive (Figure 47 J, K), and only have part on collagen I and matrigel become the liver cell like cell for CK19 be male (Figure 47 G, H).Show HNF4 α positive nucleus at one-tenth liver cell like cell on the mEF cellular layer and the liver cell like cell on collagen I and matrigel bag quilt, yet, compare with the liver cell like cell that becomes of on mEF, growing, the latter has bigger nuclear and more weak painted nuclear (Figure 47 A, B, D, E).Data point out that the mEF cellular layer has the ability that the liver cell like cell maintains ancestors' state that makes into, and collagen I and matrigel bag by on allow into the liver cell like cell and be divided into the liver cell like cell.

Embodiment 20

The function medicament translocator

By culture being used the function test of indocyanine green (ICG) analysis about the translocator in the hBSC deutero-liver cell like cell.ICG is dissolved to the concentration of 5mg/ml in the distillatory sterilized water, be diluted to the final concentration of 1mg/ml then in substratum.ICG solution added in the Tissue Culture Dish and in about 60 minutes of 37 ℃ of incubations.Behind the incubation, cell carries out rinsing with phosphate buffered saline (PBS) (PBS), and with the cellular uptake of stereomicroscopy ICG.The liver cell like cell can absorb the ICG dyestuff, and this hints exist (Figure 48) of intracellular function medicament translocator.

Claims (93)

1. the cell colony of derived from hBS cell, at least 20% described cell demonstrates at least one following characteristics in the wherein said cell colony: α-1-antitrypsin, cytokeratin 18, HNF-3 β, albumin or liver-fatty acid binding protein, and described cell colony has at least 3 in following 6 features

A. drug transporter

I) at least 1% described cell demonstrates protein and/or the genetic expression of BSEP,

Ii) at least 1% described cell demonstrates protein and/or the genetic expression of MRP2,

Iii) at least 1% described cell demonstrates protein and/or the genetic expression of OATP-2 and/or OATP-8,

B. drug metabolism enzyme

Iv) at least 20% described cell demonstrates protein and/or the genetic expression of GST A1-1,

V) at least 20% described cell demonstrate CYP450s-1A2 ,-2A6 ,-2B6 ,-2C8 ,-2C9 ,-2C19-2D6 ,-2E1 ,-3A4 and-3A7 at least 2 kinds protein and/or genetic expression,

Vi) at least 20% described cell does not demonstrate protein and/or the genetic expression of GST P1-1.

2. according to the cell colony of claim 1, wherein said cell colony has at least one described drug transporter feature and at least one described drug metabolism feature.

3. according to each cell colony in claim 1 or 2, wherein said cell colony has at least 4, for example at least 5 described features.

4. according to each cell colony in the aforementioned claim, wherein said cell colony has whole 6 described features.

5. according to the cell colony of claim 1 or 2, at least 20% described cell demonstrates at least one following characteristics in the wherein said cell colony: α-1-antitrypsin, cytokeratin 18, HNF-3 β, albumin or liver-fatty acid binding protein, and described cell colony has following characteristics

A. drug transporter

Iii) at least 1% described cell demonstrates the OATP-2 and/or the OATP-8 of functionally active,

B. drug metabolism enzyme

Iv) at least 20% described cell demonstrates the functionally active of GSTA1-1,

V) at least 20% described cell demonstrates Cyp1A2, Cyp3A4 and/or the Cyp2C9 by the functionally active of analyzing described drug metabolite measurement.

6. according to the cell colony of claim 1 or 2, the described cell of at least 75% in the wherein said cell colony demonstrates following characteristics: α-1-antitrypsin, cytokeratin 18, HNF-3 β, albumin or liver-fatty acid binding protein, and described cell colony has following characteristics

A. drug transporter

Iii) at least 10% described cell demonstrates the OATP-2 and/or the OATP-8 of functionally active,

B. drug metabolism enzyme

Iv) at least 30% described cell demonstrates the functionally active of GSTA1-1,

V) at least 50% described cell demonstrates Cyp1A2, Cyp3A4 and/or the Cyp2C9 by the functionally active of analyzing described drug metabolite measurement.

7. according to each cell colony in the aforementioned claim, wherein feature i) at least 5%, for example at least 10%, at least 15%, at least 20%, at least 30%, at least 40% or at least 50% described cell is effective.

8. according to each cell colony in the aforementioned claim, wherein feature is ii) at least 5%, and for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% described cell is effective.

9. according to each cell colony in the aforementioned claim, wherein feature is iii) at least 5%, and for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% described cell is effective.

10. according to each cell colony in the aforementioned claim, wherein feature is iv) at least 30%, and for example at least 40%, at least 50%, at least 60%, at least 70% or at least 80% described cell is effective.

11. according to each cell colony in the aforementioned claim, wherein feature is v) at least 30%, for example at least 40%, at least 50%, at least 60%, at least 70% or at least 80% described cell is effective.

12. according to each cell colony in the aforementioned claim, wherein feature is vi) at least 10%, and for example at least 20%, at least 30%, for example at least 40%, at least 50%, at least 60%, at least 70% or at least 80% described cell is effective.

13. according to each cell colony in the aforementioned claim, in the wherein said cell colony at least about 30%, for example at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about at least one following characteristics of described cell expressing of 95%: α-1-antitrypsin, cytokeratin 18, HNF-3 β, albumin or liver-fatty acid binding protein.

14. according to each cell colony in the aforementioned claim, wherein at least about 5% described cell coexpression cytokeratin 18 and CYP1A2.

15. according to each cell colony in the aforementioned claim, wherein at least about 5% described cell coexpression cytokeratin 18 and CYP2A6.

16. according to each cell colony in the aforementioned claim, wherein at least about 5% described cell coexpression cytokeratin 18 and CYP2B6.

17. according to each cell colony in the aforementioned claim, wherein at least about 5% described cell coexpression cytokeratin 18 and CYP2C8, CYP2C9 and/or CYP2C19.

18. according to each cell colony in the aforementioned claim, wherein at least about 5% described cell coexpression cytokeratin 18 and CYP2D6.

19. according to each cell colony in the aforementioned claim, wherein at least about 5% described cell coexpression cytokeratin 18 and CYP2E1.

20. according to each cell colony in the aforementioned claim, wherein at least about 5% described cell coexpression cytokeratin 18 and CYP3A4 and/or CYP3A7.

21., wherein have at least one following supplementary features at least about 5% described cell according to each cell colony in the aforementioned claim

A. acceptor

Vii) at least 5% described cell demonstrates protein and/or the genetic expression of c-Met,

B. intercellular adhesion molecule

Viii) at least 5% described cell demonstrates protein and/or the genetic expression of ICAM-1,

C. drug metabolism enzyme

Ix) at least 1% described cell demonstrates protein and/or the genetic expression of UGT,

D: transcription factor

X) at least 90% described cell does not demonstrate protein and/or the genetic expression of Oct-4.

22. according to the cell colony of claim 21, wherein said cell colony have feature vii), viii), ix) or x) at least 2, for example at least 3.

23. according to the cell colony of claim 21 or 22, wherein said cell colony have feature vii), viii), ix) or x) in whole 4.

24. according to each cell colony among the claim 21-23, wherein feature is vii) at least 10%, and for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% described cell is effective.

25. according to each cell colony among the claim 21-24, wherein feature is viii) at least 10%, and for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% described cell is effective.

26. according to each cell colony among the claim 21-25, feature i x wherein) at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% described cell is effective.

27. according to each cell colony among the claim 21-26, feature x wherein) at least 10%, for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 95% described cell is effective.

28. according to each cell colony in the aforementioned claim, wherein at least a described CYP450 protein expression is derivable after adding inductor.

29. according to each cell colony in the aforementioned claim, wherein said GST A1-1 and/or GST M1-1 protein expression are derivable after adding inductor.

30. according to each cell colony among the claim 21-29, wherein said UGT protein expression is derivable after adding inductor.

31. according to each cell colony among the claim 28-30, wherein said inductor is selected from dexamethasone, omeprazole alone or in combination.

32. according to each cell colony among the claim 28-31, wherein said inductor comprises Rifampin, dexamethasone, desoxyphenobarbital, ethanol, omeprazole and vazadrine.

33. according to each cell colony in the aforementioned claim, wherein said cell colony demonstrates the feature proteinic enzymatic activity of at least a described CYP450 v).

34. according to each cell colony in the aforementioned claim, wherein said cell colony demonstrates the GST enzymatic activity.

35. cell colony according to claim 33, at least 0.4 μ mol/ in the lysate that wherein said GST enzymatic activity is described cell colony minute/mg, for example at least 0.03 μ mol/ minute/mg, at least 0.05 μ mol/ minute/mg, at least 1.0 μ mol/ minute/mg, at least 0.07 μ mol/ minute/mg, at least 0.09 μ mol/ minute/mg, at least 0.11 μ mol/ minute/mg, at least 0.13 μ mol/ minute/mg or at least 0.15 μ mol/ minute/mg protein.

36. according to each cell colony among the claim 21-35, wherein said cell colony demonstrates the UGT enzymatic activity.

37. according to each cell colony in the aforementioned claim, wherein said cell colony still keeps feature vitro culture at least 1 month.

38. according to each cell colony in the aforementioned claim, wherein said cell colony still keeps feature at least 1 week of vitro culture.

39. according to each cell colony in the aforementioned claim, wherein said cell colony still keeps feature vitro culture at least 72 hours.

40. according to each cell colony in the aforementioned claim, wherein said cell colony is further expressed alpha-fetoprotein.

41. according to each cell colony in the aforementioned claim, wherein said cell colony feeder cell for example people or mouse feeder cell in the presence of obtain.

42. according to each cell colony in the aforementioned claim, wherein said cell colony obtains under the situation that does not have feeder cell.

43. according to the cell colony of claim 42, wherein said cell colony uses extracellular matrix to obtain, wherein said matrix has to limit or do not limit to be formed.

44. according to each cell colony in claim 42 or 43, wherein said cell colony uses the plastics Tissue Culture Flask to obtain, described plastics Tissue Culture Flask wraps quilt with alone or in combination one or more protein on inside.

45. according to the cell colony of claim 44, wherein said one or more protein are selected from collagen, ln and combination thereof.

46. according to each cell colony in claim 44 or 45, wherein said cell colony use the 3D environment for example the porous filter obtain.

47. according to each cell colony among the claim 41-46, wherein said cell colony does not contain foreign matter.

48. the cell colony of derived from hBS cell, at least a at least about among 10% described cell expressing HNF3 β and the AFP in the wherein said cell colony, and have multiplication capacity, and described cell colony has at least 2 in following 5 features:

A. acceptor

I) at least 1% described cell demonstrates the protein and/or the genetic expression of α-6-integrin,

Ii) at least 1% described cell demonstrates protein and/or the genetic expression of c-Met,

B. intercellular adhesion molecule

Iii) at least 1% described cell demonstrates protein and/or the expression of ICAM-1,

C. transcription factor

Iv) at least 10% described cell demonstrates protein and/or the expression of HNF-4 α.

49. according to the cell colony of claim 48, wherein said cell colony has at least 2 following characteristics:

A. acceptor

I) at least 1% described cell demonstrates the protein and/or the genetic expression of α-6-integrin,

Ii) at least 1% described cell demonstrates protein and/or the genetic expression of c-Met,

B. intercellular adhesion molecule

Iii) at least 1% described cell demonstrates protein and/or the expression of ICAM-1,

C. transcription factor

Iv) at least 10% described cell demonstrates protein and/or the expression of HNF-4 α.

D. cytokeratin

V) at least 1% described cell demonstrates protein and/or the expression of CK19,

Vi) at least 1% described cell demonstrates protein and/or the expression of CK7,

E. epithelial cell adhesion molecule

Vii) at least 1% described cell demonstrates protein and/or the expression of EpCAM.

50. according to the cell colony of claim 48 or 49, wherein said cell colony has at least 3 described features.

51. according to each cell colony among the claim 48-50, wherein said cell colony has at least 4, for example at least 5, at least 6 or whole 7 described features.

52. according to each cell colony among the claim 48-51, wherein said feature i) at least 5%, for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% described cell is effective.

53. according to each cell colony among the claim 48-52, wherein said feature is ii) at least 5%, and for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% described cell is effective.

54. according to each cell colony among the claim 48-53, wherein said feature is iii) at least 5%, and for example at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% described cell is effective.

55. according to each cell colony among the claim 48-54, wherein said feature is iv) at least 15%, and for example at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% described cell is effective.

56. according to each cell colony among the claim 48-55, in the wherein said colony at least about 15%, for example at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or express at least a among HNF3 β and the AFP at least about 95% described cell expressing, and have multiplication capacity.

57. according to each cell colony among the claim 48-56, wherein said colony has at least one following characteristics

F. drug transporter:

Viii) at least 1% described cell demonstrates protein and/or the genetic expression of BSEP,

Ix) at least 1% described cell demonstrates protein and/or the genetic expression of MRP2,

58. be used for the purposes used at drug discovery process as the cell colony that limits in each among the claim 1-57.

59. in external model, be used to study the purposes of drug transporter as the cell colony that limits in each among the claim 1-57.

60. in external model, be used to study the purposes of drug metabolism enzyme as the cell colony that limits in each among the claim 1-57.

The purposes that for example early stage liver is taken place takes place 61. be used to study liver as the cell colony that limits in each among the claim 1-57 in external model.

62. in external model, be used to study the purposes of human liver regenerated venereal disease disease as the cell colony that limits in each among the claim 1-57.

63. be used for the purposes of external liver toxicity test as the cell colony that limits in each among the claim 1-57.

64. as the purposes of cell colony in medicine that limits in each among the claim 1-57.

65. be used for preventing and/or treating the purposes of the medicament production of the pathological state that caused by tissue degeneratiaon and/or disease as the cell colony that limits in each among the claim 1-57 in preparation, described tissue degeneratiaon is the sex change of liver organization for example.

66. be used for the treatment of purposes in the medicament production of liver illness in preparation as the cell colony that limits in each among the claim 1-57.

67. be used for preventing and/or treating the purposes of the medicament production that is selected from following liver illness in preparation as the cell colony that limits in each among the claim 1-57: autoimmune disorder comprises primary biliary cirrhosis; Metabolic disease comprises hyperlipemia; Diabetes B; Fat; The liver illness that causes by for example alcohol abuse; The disease that causes by virus, for example hepatitis B, hepatitis C and hepatitis A; By the hepatic necrosis that causes for for example acute toxic reaction of pharmacy medicine; With the ablation of tumors in suffering from the patient of hepatocellular carcinoma for example.

68. be used for preventing and/or treating the purposes of the medicament production of metabolism pathological state and/or disease in preparation as the cell colony that limits in each among the claim 1-57.

69. come among the claim 48-57 freely one or more cells of the cell colony that limits in each to be used to obtain the purposes of the liver cell like cell of metabolism improving.

70. come among the claim 48-57 freely one or more cells of the cell colony that limits in each to be used to study sophisticated purposes towards the liver cell like cell.

71. be used for the method with regard to the hepatotoxicity SCREENED COMPOUND, it comprises the cellular exposure that makes among the claim 1-57 freely the cell colony that limits in each in described compound, and whether measure described compound be toxic for described cell.

72. be used for regulating the method for the ability SCREENED COMPOUND of hepatocyte function with regard to it, it comprises that the cellular exposure that makes among the claim 1-57 freely the cell colony that limits in each is in described compound, measure and result from any phenotype or the metabotic change that contacts with described compound in the described cell, and described variation is associated with the ability of regulating hepatocyte function.

73. method, it comprises the steps

I) on the supported matrix in serum free medium, the ancestors that make hBS cell or derived from hBS cell are vitro differentiation at least 5 days,

Replaced described substratum in ii) per approximately 5 days-Yue per 25 days,

Iii) come isolated cell by mechanical separation,

Iv) by handling the described cell that separating step randomly obtains in iii) with enzyme,

V) express the described cell of randomly sorting based on surface antigen,

So that obtain the cell colony that limits in each as among the claim 1-57.

74. according to the method for claim 73, the ancestors of wherein said derived from hBS cell express at least a among HNF3 β and the AFP, and have multiplication capacity.

75. according to each method in claim 73 or 74, wherein said serum free medium is the VitroHES that comprises bFGF ^TM

76. according to each method among the claim 73-75, the concentration of wherein said bFGF is the about 200ng/ml of about 4ng/ml-, the about 150ng/ml of for example about 4ng/ml-, the about 100ng/ml of about 4ng/ml-, the about 50ng/ml of about 4ng/ml-or the about 10ng/ml of about 4ng/ml-.

77. according to the method for claim 75, the concentration of wherein said bFGF is 4ng/ml at least.

78. according to each method among the claim 73-77, wherein step I) in described vitro differentiation carried out for example at least 20 days, at least 30 days or at least 40 days at least 10 days.

79. according to each method among the claim 73-78, wherein said supported matrix comprises feeder cell, for example people or mouse feeder cell.

80. according to each method among the claim 73-78, wherein said supported matrix comprises to have and limits or limit the extracellular matrix of forming.

81. each method in 0 according to Claim 8, wherein said supported matrix comprises the bag quilt on the inside that is coated on the plastics Tissue Culture Flask that is used for cell cultures, involved one or more protein alone or in combination of described bag.

82. according to each method among the claim 73-81, wherein said supported matrix comprises for example porous filter of 3D environment.

83. 2 method according to Claim 8, wherein said porous filter has the aperture of the about 4 μ m of diameter.

84. each method among the 2-83 according to Claim 8, wherein said porous filter are wrapped quilt with alone or in combination one or more protein.

85. each method among the 1-84 according to Claim 8, wherein said one or more protein are selected from collagen, ln and combination thereof.

86. according to each method among the claim 73-85, wherein per approximately 10 days-Yue 20 days performing step ii).

87. according to each method among the claim 73-86, wherein per approximately 14 days-15 days performing step ii).

88. test kit, it comprises i) cell colony as limiting in each among the claim 1-57, ii) one or more maturation factors and/or maturation medium and iii) randomly, working instructions.

89. 8 test kit according to Claim 8, wherein said maturation medium is selected from VitroHES ^TM, be supplemented with the VitroHES of bFGF ^TM, from the VitroHES of body homology pre-adaptation ^TMWith liver cell specificity substratum.

90. each test kit in 8 or 89 according to Claim 8, wherein said one or more maturation factors are selected from bFGF, Urogastron, pHGF and oncostatin M.

91. 9 test kit according to Claim 8, it further comprises and is used to monitor sophisticated instrument.

92., wherein be used to monitor sophisticated described instrument and comprise according to the test kit of claim 91

I) be selected from the gene of following presentation markup thing at least 3 kinds at coding, the PCR primer of at least 4 kinds or at least 5 kinds for example: HNF3 β, AFP, albumin, BSEP, MRP2, OATP-2, OATP-8, GST A1-1, CYP450-1A2, CYP450-2A6, CYP450-2B6, CYP450-2C8, CYP450-2C9, CYP450-2C19 CYP450-2D6, CYP450-2E1, CYP450-3A4, CYP450-3A7, GST M1-1 and UGT and

Ii) user manual.

93., wherein be used to monitor sophisticated described instrument and comprise according to each test kit in claim 90 or 91

I) at least 3 kinds that are selected from the following presentation markup thing antigen, the antibody of at least 4 kinds or at least 5 kinds for example: HNF3 β, AFP, albumin, BSEP, MRP2, OATP-2, OATP-8, GST A1-1, CYP450-1A2, CYP450-2A6, CYP450-2B6, CYP450-2C8, CYP450-2C9, CYP450-2C19 CYP450-2D6, CYP450-2E1, CYP450-3A4, CYP450-3A7, GST M1-1 and UGT and

Ii) user manual.

Images