CN101490270A - Transport agents for crossing the blood-brain barrier and into brain cancer cells, and methods of use thereof - Google Patents

Abstract

The present invention discloses methods and materials for delivering a cargo compound into a brain cancer cell and/or across the blood-brain barrier. Delivery of the cargo compound is accomplished by the use of protein transport peptides derived from Neisseria outer membrane proteins, such as Laz. The invention also provides synthetic transit peptides comprised of the pentapeptide AAEAP. The invention further discloses methods for treating cancer, and specifically brain cancer, as well as other brain-related conditions. Further, the invention provides methods of imaging and diagnosing cancer, particular brain cancer.

Description

Be used to pass through the transport agents and the using method thereof of the blood-brain barrier and into brain cancer cells

Relevant application

The application requires the U.S. Provisional Patent Application NO.60/818 of submission on July 6th, 2006 " being used to pass through the transhipment reagent and the using method thereof of the blood-brain barrier and into brain cancer cells " by name according to 35 U.S.C. § § 119 and 120,510, the U.S. Provisional Patent Application No.60/700 that submitted on July 19th, 2005,297, the U.S. Patent application No.11/244 that submitted on October 6th, 2005,105 right of priority.The complete content of these applications is fully consolidated in this by reference.

The statement of governmental interests

The application's theme obtains from the National Institutes of Health (NIH), Bethesda, Maryland, the support of U.S.A. (appropriation numbering ES04050-18).Government can have some power in the present invention.

Background

Be used for brain new drug exploitation than the pharmaceutical progress that is used for other parts of health slowly many.This major part of making progress slowly is to enter brain because most drug can not be passed through the brain capillary wall that forms hemato encephalic barrier (BBB).About 100% macromolecular drug and can not pass through BBB greater than 98% small-molecule drug.Only a group medicine, have height fat solvability and molecular weight and pass through BBB practically less than the daltonian small molecules of 400-500.In passing through the small molecules of BBB, only there is very little per-cent to pass through BBB with significant amount pharmaceutically.(Pardridge，MolecularInnovations?3：90-103(2003))

Only there is the disease of minority brain to respond the small-molecule drug that can pass through BBB, for example dysthymia disorders, affective disorder, chronic pain and epilepsy.More far away encephalopathy does not respond the conventional solvable small molecular weight medicine of fat, for example the HIV of alzheimer's disease, apoplexy/neuroprotective, brain and Spinal injury, the cancer of the brain, brain infection, the ataxic imbalance of various generation, amyotrophic lateral sclerosis (ALS), Huntington Chorea, influence children's congenital heredity mistake, Parkinson's disease and the multiple sclerosis of brain.Even can obtain the minority encephalopathy of effective small-molecule drug also requires further study and exploitation new, improved medicine.The same.

What be difficult to especially treat is the cancer of brain.The common form of cancer is glioblastoma multiforme (GBM) and anaplastic astrocytoma (AA) in the brain.The average survival of suffering from the patient of GBM is about 10 to 12 months, and the average survival of suffering from the patient of AA is 3 to 4 years.For the patient who suffers from GBM, the life that operation will prolong them is the several months only.(Kufe et al., CancerMedicine, § § 23 and 83, (6 ^ThEd.BC Decker, 2003)) most applications by operation and local radiotherapy GBM produce original borderline tumor 2 to 4cm in recurrence.The same.

Using current method that the medicine that can not pass through BBB enters brain comprises by craniotomy, in the method for head boring and the medicament administration that (IC) injects in by (ICV) in the tricorn or brain.Use for IC, medicine remains in the tip of pin and locates on the sedimentary position.Use for ICV, drug distribution can not penetrate into brain essence significantly only as far as the ependyma surface with tricorn.Therefore, IVC and IC application process arrive and are lower than 1% brain volume, only have the encephalopathy of minority to treat by this limited penetrating.The same.

By contrast, the blood vessel approach of wearing that medicine is sent can be treated in fact 100% brain neuroblastoma unit.Because each neurone by its vascular perfusion, wear medicine that blood vessel uses can be after crossing over BBB each neurone of arrival.Yet owing to do not allow that medicine passes through the drug targeting system of BBB, wearing the blood vessel route of administration is disabled for most drug candidates.

Although most drug and other molecules can not pass through BBB, known some bacterium and fungi/viral pathogen pass through BBB and cause infection.(Nassif, et al., Trends Microbiol.10:227-232 (2002)) these bacterial pathogens can be extracellular, for example Neisseria meningitidis (Neisseria meningitidis), streptococcus pneumoniae (Streptococcus pneumoniae) and intestinal bacteria (Escherichia coli) K-1, or intracellular, for example monocytosis Listeria monocytogenes (Listeria monocytogenes) or mycobacterium tuberculosis (Mycobacteriumtuberculosis).Intracellular pathogen is mainly invaded meninges by the white corpuscle that is hidden in infection is inner, thereby the extracellular pathogenic agent enters central nervous system by at first being dispersed in the blood flow then directly with the chamber side of brain endothelium interacts destruction brain capillary endothelium tight the connection.(Nassif et al., the same; Drevets ﹠amp; Leenen, Microbes Infect.2:1609-1618 (2000); Kim, Subcell.Biochem.33:47-59 (2000)) this interaction allows that pathogenic agent invades meninges and cause meningitis.Utilizing the external individual layer that passes through BBB and bilayer model and separate can not be by this model individual layer or double-deck bacteria variants, and various bacteria albumen is generally with the intrusion of BBB with pass through and be associated.(Huang ﹠amp; Jong, Cell.Microbiol.3:277-287 (2001)) for example, E.coli K-1 gene is ibeA, ibeB, aslA, yijP and ompA for example, or the Neisseria meningitidis gene of proteins encoded such as IV type pili, Ope, Opa or the like, and viral protein HIV surface protein gp120 for example, all be considered to allow to effective intrusion of BBB and passed through to cause infection.For extracellular bacterial pathogen, these albumen are considered to allow that the BBB that adheres to subsequently breaks through in order to invade meninges.(Nassif et al., the same; Huang ﹠amp; Jong, the same.) do not have one bacterium surface albumen to be proved to be to promote close-connected destruction to pass through BBB to allow.

Azurin (azurin) sample gene is present in many gonococcuss and the meningococcus, for example gonococcus (Neisseria gonorrhoeae) and Neisseria meningitidis.(Gotschlich ﹠amp; Seiff, FEMS Microbiol.Lett.43:253-255 (1987); Kawula, et al., Mol.Microbiol.1:179-185 (1987)) azurin produces by many pathogenic bacterias, has significant sequence homology between these genes.(Yamada, et al., Cell.Microbiol.7:1418-1431 (2005)) is called the albumen epi-position of " H.8 " and guards among the pathogenicity bo Neisseria gonorrhoeae, detects by the combination that is called monoclonal antibody H.8.Two kinds of different gonococcus genes, laz and lip, the coding and the protein of monoclonal antibody cross reaction H.8.(Hayashi?&?Wu，J.Bioenerg.Biomembr.22：451-471(1990))

Many pathogenic agent have azurin sample albumen, but Neisseria is unique, have the H.8 zone of adhering on it.Laz and Lip are the gonococcus outer surface proteins, and it contains signal peptide lipoprotein consensus sequence, and described consensus sequence is by bacterial enzyme signal peptidase I I identification, and it processes this sequence with the terminal acylation of the N-that produces cysteine residues and lipid acid and glycerine.(Hayashi ﹠amp; Wu, the same; Yamada, etal., Cell.Microbiol.7:1418-1431 (2005)) .Lip lipoprotein, about 6.3kDa, almost completely the pentapeptide by motif Ala-Ala-Glu-Ala-Pro (AAEAP (SEQ ID NO:25)) repeats to constitute, and Laz lipoprotein, about 17kDa, comprise one 39 amino acid whose zones at the N-end, it contains incomplete AAEAP (SEQ ID NO:25) and repeats.(Gotschlich ﹠amp; Seiff, the same; Kawula, et al., the same; Woods et al., Mol.Microbiiol.3:43-48 (1989)). in Laz outside these 39 amino acid N-stub areas be and 127 amino acid whose zones of Pseudomonas aeruginosa (P.aeruginosa) azurin height homologous.(Cannon, Clin.Microbiol.Rev.2:S1-S4 (1989)) Laz participates in oxidation-resistance adverse circumstance and the toxic defence of copper, and improves the survival rate in the human epithelium of cervix uteri analysis of external former generation.(Wu，et?al.，Infect.Immun.73：8444-8448(2005))

The third Diplococcus gonorrhoeae adventitial albumen Pan1 also has AAEAP (SEQ ID NO:25) pentapeptide and repeats motif.The size of (Hoehn and Clark, Infection and Immunity, 60:4704-4708 (1992)) Lip is different in different Neisseria bacterial strains.In bacterial strain FA 1090, Lip length is 71 amino acid, has 13 repetitions of AAEAP (SEQ ID NO:25) and is not six amino acid of a multiple part.In bacterial strain R10, Lip length is 76 amino acid, has 14 AAEAP (SEQ ID NO:25) and repeats.(Cannon, the same) the Lip peptide of purifying is powerful inflammatory conditioning agent, can induce epithelial cell in human uterus's neck of immortality to discharge chemokine interleukin 8 (IL-8) and cytokine IL-6 and with the human embryonic kidney 293 cells generation IL-8 and the transcriptional factors NF-κ B of toll sample acceptor 2 transfections.(Fisette，et?al.，J.Biol.Chem.278：46252-46260(2003))

In view of a large amount of patient who suffers from serious brain and spinal cord illness in the whole world, what need is to carry the movement system that hydrophilic molecule and macromole pass through BBB.Preferably, this delivery system will have specificity does not highly produce general seepage to allow the drug targeting brain BBB.Further, successful delivery system will generally be benign, and allow in the patient this system of repeated use and do not have undesirable side effect.In some cases, successful delivery system will similarly deliver drugs into the All Ranges of brain.In other cases, delivery system will deliver drugs into the brain cancer cells specifically.

Summary of the invention

The invention provides the transit peptides from the Neisseria outer membrane protein, it can promote cargo compound (cargo compound) transhipment of adhering to or link to each other to enter the brain cancer cells and/or pass through hemato encephalic barrier.The present invention also provides the mixture of transit peptides and its cargo compound, and uses described mixture and described transit peptides to diagnose and the method for the treatment of other diseases relevant with brain of brain cancer and diagnosis and treatment.At last, the invention provides the test kit of nucleic acid that comprises described transit peptides and/or mixture and/or encode them.

One aspect of the present invention is isolating transit peptides, and it is Laz, Lip from Neisseria or variant, derivative or the structural equivalents of Pan1, and it promotes the molecule that connects to enter Mammals brain cancer cells or pass through hemato encephalic barrier.The H.8 zone (SEQ ID NO:24) of Laz can have at least 90% amino acid identity with these transit peptides.In some embodiments, described transit peptides is SEQ ID NO:24.In other embodiments, described transit peptides can be modified to prolong or to optimize the transformation period of described peptide in blood flow.

Another aspect of the present invention is a transit peptides, it comprises at least 4 zones of not exclusively or fully repeating to form by Ala-Ala-Glu-Ala-Pro (SEQID NO:25), and AAEAP (the SEQ ID NO:25) pentapeptide that each total length in this zone has at least about 50% repeats.In some embodiments, described incomplete or complete multiple zone is same as Ala-Ala-Glu-Ala-Pro (SEQ ID NO:25) the multiple peptide that comprises equal amts at least about 90% ground.In some embodiments, these transit peptides are synthetic.In other embodiments, these transit peptides can be modified to prolong or to optimize the transformation period of these peptides in blood flow.

Another aspect of the present invention is the mixture that comprises at least one cargo compound that is connected to transit peptides, described transit peptides comprises at least 4 zones of not exclusively or fully repeating to form by Ala-Ala-Glu-Ala-Pro (SEQ ID NO:25), and wherein this zone does not comprise and is lower than about 50% described peptide.Another aspect of the present invention is the mixture that comprises at least a cargo compound that is connected with variant, derivative or structural equivalents from Laz, the Lip of Neisseria or Pan 1, and described variant, derivative or structural equivalents promote the molecule that connects to enter Mammals brain cancer cells or pass through hemato encephalic barrier.In some embodiments, described cargo compound is cupredoxin (cupredoxin), for example azurin, plastocyanin (plastocyanin), iron sulphur bacterium azurin (rusticyanin), false azurin (pseudoazurin), green element (auracyanin) and the azurin sample albumen of subduing of orange are particularly from the azurin of Pseudomonas aeruginosa.In other embodiments, described mixture is modified to prolong or to optimize the transformation period of described peptide in blood flow.This mixture can comprise cupredoxin derived transit peptides in addition.

The cargo compound of this mixture can be protein, lipoprotein, polysaccharide, nucleic acid, dyestuff, particulate, receive grain, toxin and medicine.In some embodiments, described cargo compound is a protein, and described mixture is a fusion rotein.In other embodiments, described cargo compound is a toxin.The therapeutical agent of the treatment of children's congenital heredity mistake, Parkinson's disease and/or multiple sclerosis that described cargo compound can be the HIV infection, the ataxic imbalance of various generation, amyotrophic lateral sclerosis (ALS), the Huntington Chorea that are used for dysthymia disorders, affective disorder, chronic pain, epilepsy, alzheimer's disease, apoplexy/neuroprotective, brain and Spinal injury, brain cancer, brain, influence brain.Described cargo compound can be a detectable substance, for example by fluorometric assay, microscopy, X ray CT, MRI and/or ultrasonic detectable material.

In some embodiments, described mixture is in the carrier that pharmaceutically is fit to.The described carrier that pharmaceutically is fit to can be used for intravenously and use.In other embodiments, described pharmaceutically acceptable carrier is suitable in the tricorn or the injection in the brain.

Another aspect of the present invention is a kind of method, comprise one or more cell is contacted with mixture, described mixture comprises at least a cargo compound that is connected with variant, derivative or structural equivalents from Laz, the Lip of Neisseria or Pan1, and described variant, derivative or structural equivalents promote the molecule that connects to enter Mammals brain cancer cells or pass through hemato encephalic barrier.Described cell can be from the tumour of central nervous system, particularly astrocytoma, glioblastoma, meningioma, oligodendroglioma, prominent astrocytoma, glioma, ependymoma, tumor of spinal cord, ganglioglioma, neurocytoma or medulloblastoma less.

Another aspect of the present invention is the method that treatment suffers from the patient of cancer, and mixture wherein of the present invention is administered to the patient with the treatment significant quantity.In some embodiments, described mixture intravenously ground, body surface ground, use or be administered in cell or the tumour hypodermically, intramuscularly.In other embodiments, described mixture and another kind of cancer therapy are used jointly.

Another aspect of the present invention is the method that makes cancer imaging in the patient, comprises to the patient using mixture with detectable cargo compound, and the position of detecting described cargo compound in described patient.In some cases, described cargo compound is an x-ray contrast agent, and it detects by X ray CT.In other cases, described cargo compound is a magnetic resonance imaging contrast, and it detects by MRI.In other cases, described cargo compound is an acoustic contrast agent, and it detects by ultra sonic imaging.

Another aspect of the present invention is the method for diagnosing cancer, comprises making cell contact and detect described cargo compound with the mixture of the present invention with detectable cargo compound.

Another aspect of the present invention is a kind of test kit, comprise reagent and isolating transit peptides, described transit peptides is Laz, Lip from Neisseria or variant, derivative or the structural equivalents of Pan 1, and it promotes the molecule that connects to enter Mammals brain cancer cells or pass through hemato encephalic barrier.In some embodiments, described test kit further comprises reagent, and described pack contains pharmaceutically acceptable carrier.In other embodiments, described test kit comprises the instrument of using that is used for described reagent.

Another aspect of the present invention is a nucleic acid molecule.In some embodiments, the isolating transit peptides of described nucleic acid encoding, it is Laz, Lip from Neisseria or variant, derivative or the structural equivalents of Pan 1, and it promotes the molecule that connects to enter Mammals brain cancer cells or pass through hemato encephalic barrier.In other embodiments, described nucleic acid encoding transit peptides, described transit peptides comprises at least 4 zones of not exclusively or fully repeating to form by Ala-Ala-Glu-Ala-Pro (SEQ ID NO:25), and wherein this zone does not comprise and is lower than about 50% described peptide.In other embodiments, described nucleic acid encoding comprises the mixture of fusion rotein, and described fusion rotein comprises at least a protein cargo compound that is connected with transit peptides.

Another aspect of the present invention is the method that treatment or diagnosis suffer from the patient of the disease relevant with brain, comprises to described patient and uses transit peptides of the present invention and at least a cargo compound jointly.In other embodiments, cupredoxin derived transit peptides and described transit peptides and/or cargo compound are used jointly.

The brief description of sequence

SEQ ID NO:1 is the genomic dna encoding sequence of gonococcus laz gene, Genbank accession number Y00530.

SEQ ID NO:2 is the genomic dna encoding sequence of Pseudomonas aeruginosa azurin gene.

SEQ ID NO:3 is the H.8 genomic dna encoding sequence in zone of gonococcus laz gene.

SEQ ID NO:4 is the forward primer of the gonococcal Laz encoding gene of pcr amplification (laz).

SEQ ID NO:5 is the reverse primer of the gonococcal Laz encoding gene of pcr amplification (laz).

SEQ ID NO:6 is the segmental forward primer of 3.1kb of pcr amplification pUC18-laz.

SEQ ID NO:7 is the segmental reverse primer of 3.1kb of pcr amplification pUC18-laz.

SEQ ID NO:8 is the segmental forward primer of 0.4kb of pcr amplification pUC19-paz.

SEQ ID NO:9 is the segmental reverse primer of 0.4kb of pcr amplification pUC19-paz.

SEQ ID NO:10 is the segmental forward primer of 3.3kb of pcr amplification pUC19-paz.

SEQ ID NO:11 is the segmental reverse primer of 3.3kb of pcr amplification pUC19-paz.

SEQ ID NO:12 is the segmental forward primer of 0.13kb of pcr amplification pUC18-laz.

SEQ ID NO:13 is the segmental reverse primer of 0.13kb of pcr amplification pUC18-laz.

SEQ ID NO:14 is the forward primer of pcr amplification from the GST encoding gene of pGEX-5X-3.

SEQ ID NO:15 is the reverse primer of pcr amplification from the GST encoding gene of pGEX-5X-3.

SEQ ID NO:16 is a pcr amplification from the signal peptide of pUC18-laz and the forward primer of coding region H.8.

SEQ ID NO:17 is a pcr amplification from the signal peptide of pUC18-laz and the reverse primer of coding region H.8.

SEQ ID NO:18 is the forward primer of pcr amplification from the H.8 coding region of pUC18-laz.

SEQ ID NO:19 is the reverse primer of pcr amplification from the H.8 coding region of pUC18-laz.

SEQ ID NO:20 is the forward primer of pcr amplification from the GST-H.8 integration region of pGEX-5X-3-H.8.

SEQ ID NO:21 is the reverse primer of pcr amplification from the GST-H.8 integration region of pGEX-5X-3-H.8.

SEQ ID NO:22 is the proteic aminoacid sequence of gonococcus bacterial strain F62 Laz, Genbank accession number Y00530.

SEQ ID NO:23 is the aminoacid sequence of the azurin of Pseudomonas aeruginosa.

SEQ ID NO:24 is from the proteic H.8 aminoacid sequence in zone of gonococcus F62 Laz.

SEQ ID NO:25 is the aminoacid sequence of pentapeptide motif.

Brief description of drawings

Fig. 1. Fig. 1 has described from gonococcal laz (A) with from the synoptic diagram of the paz (B) of Pseudomonas aeruginosa.Be used for forming (B) by azurin gene itself (paz) and definite its signal peptide (psp) sequence of pericentral siphon position at the Pseudomonas aeruginosa azurin gene of E.coli clone and overexpression.Be cloned in the H.8 regional frame of laz 5 of the paz gene that comprises Neisseria signal sequence nsp '-terminal (C) (pUC18-H.8-laz) or the paz gene 3 '-terminal (D) (pUC19-paz-H.8).The detailed step of preparation construct provides in embodiment 1.Naz, the gonococcal azurin sample sequence that in the laz gene, exists; Nsp, the Neisseria signal peptide sequence.Signal peptide sequence in two kinds of situations all is cut to produce sophisticated Paz (pericentral siphon) albumen and Laz (surface exposes) albumen.(E), the SDS-PAGE of Laz, Paz and fusion rotein.H.8 fusion rotein for example Laz, H.8-Paz or the irregular migration of Paz-H.8 (all approximately 17kDa) before noticed (Cannon, Clin.Microbiol.Rev.2:S1-S4 (1989) in the albumen in containing H.8 of lipidization (lapidated); Fisette, et al., J.Biol.Chem.278:46252-46260 (2003)).

Fig. 2. Fig. 2 has described to illustrate that H.8-Paz fusion rotein is to the chart of the cytotoxicity degree of various cancer cells.(A) H.8 peptide, Paz, Laz and of synthetic in the aminoterminal H.8 fusions (H.8-Paz) of the H.8 fusions (Paz-H.8) of the C-terminal of Paz and Paz cytotoxicity to glioblastoma LN-229 cell.Described albumen with 3 kinds of different concns (10,20 and 40 μ M) is handled cell 6,12 and 24h.Carry out MTT and analyze the degree of measuring viable cell to calculate cytotoxicity (necrocytosis per-cent).In order to calculate cytotoxicity per-cent, the value that adopts untreated viable cell is measured the quantity of viable cell as 100% in the sample of Paz, Laz and H.8 fusion rotein processing.Determine Cytotoxic degree (%) according to the quantity of dead cell then.(B) H.8 peptide, Paz, Paz-H.8, H.8-Paz with the cytotoxicity of Laz to the human breast cancer MCF-7 cell.All treatment condition and above-mentioned (A) are similar.

Fig. 3. Fig. 3 has described various fluorescently-labeled azurin associated protein entering glioblastoma LN-229 and mammary cancer MCF-7 cell.(A) and Alexa

568 bonded H.8 peptide, Paz, Paz-H.8, H.8-Paz and Laz (each 20 μ M) on cover glass with the LN-229 cell 37 ℃ of incubations 30 minutes, gather image afterwards.(B) manifest by confocal microscopy, as (A) described and Alexa The internalization that the various albumen of 568 bonded enter the MCF-7 cell.(C) manifest the internalization of Laz by confocal microscopy.The fluorescently-labeled Laz of different concns (2,4,8 and 18 μ M) 37 ℃ with LN-229 cell incubation 30 minutes.Nuclear is marked as blueness with DAPI (4,6-diamidino-2-phenylindone).(D) and Alexa

568 bonded Laz (10 μ M) and LN-229 cell are in 37 ℃ of various times of incubation (5,10,20 and 30 minutes).Manifest internalization by confocal microscopy.(E) and Alexa

568 bonded Paz (10 μ M) 37 ℃ and various times of LN-229 cell incubation, gather image afterwards on cover glass.In (E), detect the considerably less fluorescence measured.

Fig. 4. Fig. 4 has described column diagram, its indicated the fluorescence found in the confocal microscope image among Fig. 3 A-D quantitatively.(A) fluorescent quantitation in the image in Fig. 3 A.Use

Carry out in the azurin fluorescence quantitatively.The error post is represented in the single sample standard deviation of fluorescence in three kinds of different cells.(B) fluorescent quantitation in the image among the accompanying drawing 3B.As carrying out among the accompanying drawing 4A quantitatively.(C) amount of fluorescence in the image in Fig. 3 C.As carrying out among Fig. 4 A quantitatively.(D) fluorescent quantitation in the image in accompanying drawing 3D.As carrying out among the accompanying drawing 4A quantitatively.

Fig. 5. using H.8-GST, the combined treatment of fusion rotein promotes Alexa in the glioblastoma LN-229 cell

The picked-up of the Paz of 568 marks.Unlabelled 20 μ M (A) H.8, (B) GST, (C) GST-H.8, (D) H.8-GST, (E) PBS damping fluid and 20 μ M and Alexa

568 bonded Paz 37 ℃ with LN-229 cell incubation 30 minutes.Manifest internalization by confocal microscopy.(F) have or the synthetic that do not have a Paz H.8 peptide, GST and GST-H.8/H.8-GST merge the cytotoxicity of derivative.About 5 * 10 ³Individual LN-229 cell inoculation in 96 hole culture dish, with have 20 μ M Paz (+Paz) or do not have 20 μ M Paz (each 20 μ MH.8 peptide Paz), GST, GST-H.8, H.8-GST or the PBS damping fluid of equal volume handle.Fig. 6. Fig. 6 described to use with

800CW (LI-COR Biotechnology, Lincoln, Nebraska) bonded Paz, H.8-Paz with the brain image of the mouse of Laz injection.(A) from the brain image of the mouse that lives.With 500 μ g with

800CW bonded Paz, H.8-Paz with the Laz peritoneal injection in the nude mice that lives.Behind the 24h, put to death mouse, take out brain, detect fluorescence and use LI-COR Infrared imaging system is measured.(B) as (rostral mesencephalon) area image outside the midbrain of the nude mice brain of processing in (A).Flatly cut mouse brain, gather image.

Fig. 7. Fig. 8 has described among the E.coli the H.8-Gst SDS-PAGE of fusion rotein, Western trace and localized confocal microscope image.Have clone's gst, H.8-gst or the E.coliBL21 of gst-H.8 gene (DE3) cell cultivate with 0.1mM IPTG at 37 ℃.Cell mass PBS washed twice, full cell pyrolysis liquid electrophoresis on SDS-PAGE.The blue dyeing of Coomassie is used to proteinic detection.(B). repeat aforesaid operations, but the content that separates full cell pyrolysis liquid and periplasmic space specifically individually, electrophoresis on SDS-PAGE (20 μ g protein) is measured proteinic total concn and pericentral siphon concentration by the Western trace detection GST or the GST-H.8 fusion rotein that use monoclonal anti-GST antibody.(C). carry clone's gst, H.8-gst or E.coli bacterial strain BL21 (DE) cell of gst-H.8 gene (table 5) cultivate with 0.4mM IPTG at 37 ℃.It is centrifugal that one milliliter every kind these bacterial cultures carry out, and collects the bacterial mass that produces.After with the PBS washed twice, apply 1% FBS-PBS of the 1mL that contains anti-GST antibody (1:2000).Incubation cell suspension 1h uses the PBS washed twice then.Bacterial cell and the anti-rabbit igg of FITC bonded incubation 30 minutes in 1% FBS-PBS.In order to remove unconjugated antibody, washed cell is fixed with ethanol on ice once more.Observe the E.coli sample of handling with DAPI (giving blue-colored) down at confocal microscope (* 100 object lens), individual cells is taken pictures.(D). the E.coli cell that carries pUC19-paz (Pseudomonas aeruginosa azurin), pUC19-laz (Neisseria), pUC18-H.8-paz or pUC18-laz-H.8 is overnight incubation under 37 ℃ of situations that have a 0.1mM IPTG.This culture of centrifugal 0.5ml, the bacterial mass of generation refrigerative PBS washed twice.Apply the anti-azurin antibody (1:500) among 1mL 1% FBS-PBS and hatch 1h on ice.After the PBS washed twice, apply anti-rabbit antibody in conjunction with FITC, hatched 30 minutes on ice, use the PBS washed twice, fix with cold ethanol.Observe bacteria samples by confocal microscope (* 100 object lens).

The detailed description of embodiment

Definition

As used herein, term " cell " comprises the odd number and the plural number of this term, unless be described as " individual cells " especially.

As used herein, term " polypeptide ", " peptide " and " protein " make the polymkeric substance that is used for referring to amino-acid residue interchangeably.This term is applicable to such aminoacid polymers, and one or more therein amino-acid residues are corresponding naturally occurring amino acid whose artificial chemical analogs.This term also is applicable to naturally occurring aminoacid polymers.Term ＂ polypeptide ＂, ＂ peptide ＂ and ＂ protein ＂ also comprise modification, and described modification includes but not limited to that glycosylation, fat connect γ carboxylation, hydroxylation and the ADP ribosylation of (lipid attachment), sulfation, glutaminic acid residue.It being understood that polypeptide always is not straight chain fully.For example, the polypeptide as a result that turns usefulness into as ubiquitin can be a side chain; General result as translation back incident (comprising the incident that natural processing incident and the people's generic operation that is taken place by non-natural cause), they can be cyclic (being with or without branch).Cyclic, side chain with the branch annular polypeptide can be by the natural process of untranslated, also can synthesize by synthetic method completely.Synthetic peptide is the peptide that does not have the help of cellular constituent to make.The synthetic method that produces peptide is well known in the art, and is commercially available.Further, the present invention expects that proteinic aminoterminal of the present invention contains the purposes of methionine(Met) variant and aminoterminal methionine(Met) minimizing variant.

As used herein, use " disease " to comprise with respect to normal anatomy and physiological departing from, it constitutes the damage of living animal or one standard state partly, its blocking-up or changed the performance of body function.

As used herein, term " cell growth inhibiting " is meant and slows down or stop cell fission and/or cell proliferation.This term also comprises the raising of cytocerastic inhibition or necrocytosis.

As used herein, term " suffers from " and comprises the current symptom that represents disease, has pathological condition, is in from the recovery of disease and from disease recovery even without visible symptom.

As used herein, term " treatment " comprises and prevents, reduces, stops or the progress or the seriousness of the symptom of the disease-related that reverse and disease maybe will be treated.Thereby term " treatment " comprises according to circumstances medicine, treats and/or prevents and use.

" treatment significant quantity " be effectively prevent, reduce, stop or reversing the specified disease that the experimenter will treat existing symptom development or partly or entirely alleviate the amount of described symptom.The treatment significant quantity determine be in those skilled in the art's the limit of power.

As used herein, term " pure basically " is when being used to modify protein of the present invention or other cellular products, be meant, for example, from growth medium or the isolating protein of entocyte, be in the form that does not have basically or do not mix up other protein and/or active inhibition compound.Term " pure basically " amount of being meant be the separated portions dry weight at least about 75% factor, or " 75% is pure basically " at least.More particularly, term " pure basically " be meant the active compound dry weight at least about 85% compound, or " 85% is pure basically " at least.The most especially, term " pure basically " be meant the active compound dry weight at least about 95% compound, or " 95% is pure basically " at least.Term " pure basically " can also be used to modify synthetically protein of the present invention or the compound that produces, and wherein, for example, synthetic protein separates from the reagent of building-up reactions and byproduct.

As used herein, term " pharmaceutical grade ", when referring to peptide of the present invention or compound, be a kind of peptide or compound, it separates from the composition (comprising synthetic agent and byproduct) of following this material when its native state is found usually basically or in fact, and separates from will damage its composition as the purposes of medicine basically or in fact.For example, " pharmaceutical grade " peptide can separate from any carcinogens.In some cases, " pharmaceutical grade " can (for example modify with the application process of expection, " intravenous drug level "), indicating a kind of peptide or compound, it will be basically or in fact from making said composition be not suitable for any separating substances of using to patient's intravenously.For example, " intravenous drug level " peptide can separate with antiseptic-germicide (for example trinitride) from washing composition (for example SDS).

Term " isolating ", " purifying " or " biology is pure " are meant the composition that material does not have usually basically or in fact and the described material that exists under the native state accompanies.Thereby, preferably do not contain in the in situ environment of described peptide and described peptide relevant material usually according to isolating peptide of the present invention." isolating " zone is meant the zone of the complete sequence that does not comprise polypeptide, and described zone is from described polypeptide." isolating " nucleic acid, albumen or its respective segments shift out from its internal milieu basically, thereby it can be operated by the technician, in expression vector, and obtain described protein or protein fragments such as but not limited to nucleotide sequencing, restrictive diges-tion, site-directed mutagenesis and the subclone of nucleic acid fragment with pure basically amount.

For the term " variant " that peptide uses, be meant the aminoacid sequence variant at this, compare the amino acid that it has replacement, disappearance or inserts with wild type peptide.Variant can be the truncate of wild type peptide." interpolation " is to remove one or more amino acid in wild-type protein, and " brachymemma " is the one or more amino acid of one or more terminal removal from wild-type protein.Thereby variant peptides can produce by the gene of operation coding said polypeptide.By essentially consist or the feature that changes described polypeptide, rather than some its primary activity at least, variant can be produced.For example, " variant " of Neisseria transit peptides can be the Neisseria transit peptides of sudden change that has kept it to pass through BBB and/or entered the ability of brain cancer cells.In some cases, variant peptides is synthetic with alpha-non-natural amino acid (for example ε-(3, the 5-dinitrobenzoyl)-lysine residue).(Ghadiri ﹠amp; Fernholz, J.Am.Chem.Soc, 112:9633-9635 (1990)). in some embodiments, compare with wild type peptide, described variant has the amino acid that is no more than 20,19,18,17 or 16 replacements, disappearance or inserts.In some embodiments, compare with wild type peptide, described variant has the amino acid that is no more than 15,14,13,12 or 11 replacements, disappearance or inserts.In some embodiments, compare with wild type peptide, described variant has the amino acid that is no more than 10,9,8 or 7 replacements, disappearance or inserts.In some embodiments, compare with wild type peptide, described variant has the amino acid that is no more than 6 replacements, disappearance or inserts.In some embodiments, compare with wild type peptide, described variant has the amino acid that is no more than 5 or 4 replacements, disappearance or inserts.In some embodiments, compare with wild type peptide, described variant has the amino acid that is no more than 3,2 or 1 replacements, disappearance or inserts.

Term " amino acid " means and comprises any naturally occurring or non-natural amino acid moiety that exist or the synthetic amino-acid residue as used herein, that is, comprise by one, two, three or more carbon atom, general direct-connected at least one carboxyl of (α) carbon atom and at least one amino any part.

Be meant the peptide that derives from target peptide at this for the term " derivative " that peptide uses.Deriving comprises the chemically modified of peptide, thereby described peptide will still keep some its some primary activity.For example, " derivative " of Neisseria transit peptides can be the Neisseria transit peptides of chemically modifying that has kept it to pass through BBB and/or entered the ability of brain cancer cells.Interested chemically modified includes, but not limited to amidation, acetylize, sulfation, polyoxyethylene glycol (PEG) modification, phosphorylation or the glycosylation of peptide.In addition, the deutero-peptide can be the fusions of polypeptide or its fragment and compound, described compound such as but not limited to, another kind of peptide, drug molecule or other treatment agent or medicament or detectable probe.

Term " amino acid sequence identity per-cent (%) " be defined as when comparison during two sequences in polypeptide the per-cent of the amino-acid residue identical with amino-acid residue in the candidate sequence.In order to determine amino acid identity %, aligned sequences if necessary, is introduced breach and is realized maximum sequence identity %; Conservative property is replaced the part that is not considered to sequence identity.The aminoacid sequence comparison method of determining identity per-cent is well known to a person skilled in the art.Usually, the obtainable computer software of the public, for example BLAST, BLAST2, ALIGN2 or Megalign (DNASTAR) software is used to compare peptide sequence.In specific embodiment, use long complexity filtering device, expection 10, word size 3, existence 11 and extend 1 default parameter and use Blastp (can be from NCBI, Bethesda MD obtains).

When comparison during aminoacid sequence, given aminoacid sequence A with and or the amino acid sequence identity % of relative given aminoacid sequence B (perhaps its can be called given aminoacid sequence A have or comprise and and or certain amino acid sequence identity % of given relatively aminoacid sequence B) may be calculated:

Amino acid sequence identity %=X/Y*100

Wherein

X is by the comparison to A and B of sequence alignment program or algorithm, as the quantity of the amino-acid residue of same coupling scoring,

Y is the sum of amino-acid residue among the B.

If the length of aminoacid sequence A is different from the length of aminoacid sequence B, A can not equal the amino acid sequence identity % of B to A to the amino acid sequence identity % of B.In the time will comparing than long sequence and than short sequence, the sequence of weak point will be " B " sequence.For example, when with the peptide of brachymemma and corresponding wild type polypeptide relatively the time, the peptide of brachymemma will be " B " sequence.

General introduction

The present invention relates to be used for method and the material that the delivering goods compound passes through hemato encephalic barrier (BBB) and/or enters the brain cancer cells, and the material and the method that are used for the treatment of the other diseases of Mammals brain cancer and brain and central nervous system.As disclosed herein, be known that now by the peptide zone of repeating to form of motif AAEAP (SEQ ID NO:25) and allow that peptide and other cargo compound continuous or that merge are passed through hemato encephalic barrier by transhipment and/or enter Mammals brain cancer cells.More specifically, the H.8 zone of gonococcus albumen Laz can be used to transport protein and other cargo compound continuous or that merge and passes through BBB and/or enter the brain cancer cells.In addition, be contemplated that and be similar in AAEAP (SEQ ID NO:25) pentapeptide multiple uses H.8 that the peptide in zone can be used for translocator matter and other cargo compound are passed through BBB and/or entered the brain cancer cells, described peptide for example Lip proteic partly or entirely and Pan 1 proteic partly or entirely, two kinds all from gonococcus.The cargo compound of being sent by the present invention includes but not limited to, protein, lipoprotein, polysaccharide, nucleic acid (comprising antisense nucleic acid), dyestuff, fluorescence labels and radioactive labels, particulate or receive grain, toxin, inorganic and organic molecule, small molecules and medicine.In some embodiments, described medicine and/or toxin kill tumor cell.In other embodiments, the various diseases of described cargo compound treatment brain.

Be known that many cupredoxin albumen, for example the Pseudomonas aeruginosa azurin has the ability of the mammalian cancer cells that enters and kill many types specifically.(Yamada et al., Cell.Biol.7:1418-1431 (2005); Hiraoka et al, PNAS 101:6427-6432 (2004); Hiraoka et al., Biochem.Biophys.Res.Comm.338:1284-1290 (2005)) it is also known that the Pseudomonas aeruginosa azurin for the brain cancer cells for example the spongioblast oncocyte do not have cytotoxicity.Referring to embodiment 2.Startling ground is known that now Laz albumen, the azurin sample albumen from gonococcus and other Neisseria gonorrhoeaes can enter and kill brain cancer cells for example spongioblast oncocyte and other tumours specifically.Referring to embodiment 2 and 7.In addition, be known that now the proteic H.8 structural domain of Laz can give the ability that it entered and killed the spongioblast oncocyte when the N-end that is fused to the Pseudomonas aeruginosa azurin or C-are terminal.Referring to embodiment 2 and 3.

Also startlingly, be known that now the H.8 regional unnecessary protein of using jointly (for example azurin) that physically is attached to gives the ability that this albumen enters the spongioblast oncocyte.Referring to embodiment 5.Compare with independent azurin, H.8 and the physically inadhering azurin that H.8 all improved that is fused to the N-end of GST enter the ability of spongioblast oncocyte, yet be fused to GST the C-end H.8 be invalid.Further, H.8 and be fused to GST the N-end H.8 when using jointly, all strengthened the cytotoxicity of azurin to the spongioblast oncocyte with azurin.Referring to embodiment 5.

The ability that protein that it merges passes through the hemato encephalic barrier of mouse alive and navigates to brain has been given on startling ground, the H.8 structural domain of present known Laz.Referring to embodiment 6.

At last, the surface of fusion rotein presents among the now known responsible E.coli in H.8 zone.Referring to embodiment 7.Though GST and have the GST H.8 that is fused to the C-end and accumulate in the periplasmic space of the E.coli that expresses them has the surface that the GST H.8 that is fused to the N-end is transported to the E.coli cell.Though be not intended to the present invention is limited to any mechanism of action, H.8 the zone cause fusion rotein be transported to the bacterial cell surface ability may to allow that fusion rotein passes through the ability of BBB relevant with zone H.8.Since meningococcus (for example Neisseria meningitidis) pass through BBB invade meninx (Nassif, et al, the same; Huang ﹠amp; Jong, the same .), possible is that the cellular constituent that this bacterium uses the surface to expose is destroyed BBB.The IV type pili of Neisseria meningitidis is relevant with the formation of brain microvillus sample film projection, and central role is played in being retracted in the interaction between Neisseria and the human cell of known this pili.(Pujol et al., PNAS 96:4017-4022 (1999); Merz et al., Nature 407:98-102 (2002)) yet, known IV type pili thinks that bouncing back with the contacting when forming of pili mediation of other cells other unknown surface compositions of Neisseria meningitidis are responsible for passing through BBB.(Nassif et al., the same) thereby the possible H.8 zone that is the surface presents directly relate to allows that Neisseria passes through BBB and interacts with human brain cancer cells.

Laz H.8 zone is 39 amino acid regions of the N-end of Laz, and it contains incomplete AAEAP (SEQ ID NO:25) pentapeptide and repeats.Be contemplated that this AAEAP (SEQ ID NO:25) repeating unit can be used to design the peptide that Transhipment Cargo is passed through BBB and/or enter the brain cancer cells.Further, be contemplated that the aminoacid sequence with AAEAP (SEQ ID NO:25) other outer membrane proteins of multiple from gonococcus and Neisseria meningitidis can be used to design the peptide that Transhipment Cargo is passed through BBB and/or enter the brain cancer cells.Other interested Neisseria outer membrane proteins include but not limited to Lip and Pan 1.(Trees?et?al.，J.Clin.Microbiol.38：2914-2916(2000)；Hoehn?and?Clark，Infection?and?Immunity60：4704-4708(1992))

The present invention relates to be used for the delivering goods compound and pass through method and the material that hemato encephalic barrier enters brain and/or enters the brain cancer cells.Be accompanied by the transit peptides that use is fit to according to sending of cargo compound of the present invention.In an embodiment of the invention, described cargo compound is connected with Neisseria transit peptides of the present invention or AAEAP transit peptides.In another embodiment, described cargo compound and Neisseria transit peptides of the present invention or AAEAP transit peptides are used jointly.In another embodiment, described cargo compound is connected with Neisseria of the present invention or AAEAP transit peptides with cupredoxin derived transit peptides.

In one embodiment, cargo compound is sent with the cell in the anticancer (for example brain cancer cells) and is grown.This cancer cells can from, for example, astrocytoma, glioblastoma, meningioma, oligodendroglioma, prominent astrocytoma, glioma, ependymoma, tumor of spinal cord, ganglioglioma, neurocytoma and medulloblastoma less.For example, described cargo compound can be cyclin, for example p53; Cell cycle protein dependent kinase inhibition, for example p16, p21 or p27; Suicide albumen, for example thymidine kinase or nitroreductase; Cytokine or other immune modulators, for example interleukin-11, interleukin-22 or granulocyte-macrophage colony stimutaing factor (GM-CSF); Or toxin, Pseudomonas aeruginosa exotoxin A for example, or the like.In some embodiments, the biological active fragment of one of above-claimed cpd kind is sent.In another embodiment, described cargo compound is sent to produce the image of destination organization.For example, described destination organization can be a cancer, and described cargo compound can be a kind of compound that is generally used for producing by the image of X ray computer tomography (CT), nuclear magnetic resonance (MRI) and ultrasonic test.In these embodiments, described cargo compound can be gamma-rays or positron radiation radio isotope, magnetic resonance imaging contrast, x-ray contrast agent and/or acoustic contrast agent.In other embodiments, described cargo compound can be sent with the treatment disease relevant with brain.

Neisseria transit peptides and AAEAP transit peptides

The invention provides transit peptides, it allows that cargo transfer that will connect or associating is in Mammals brain cancer cells rather than in the non-cancer cells and/or transport described goods and pass through BBB.It has been found that, the Neisseria outer membrane protein, for example Laz comprises H.8 structural domain of protein transport structural domain, and it promotes the goods that connects to enter Mammals brain cancer cells and/or pass through entering of BBB.The invention provides Neisseria transit peptides from the Neisseria outer membrane protein.The present invention further provides and comprise the natural or synthetic translocation domain of AAEAP (SEQ ID NO:25) pentapeptide multiple, it can be used for cargo transfer that will connect or associating to Mammals brain cancer cells and/or pass through BBB.

Term " Neisseria transit peptides " is meant the whole or fragment of Neisseria outer membrane protein, and it comprises that goods enters the brain cancer cells and/or passes through the required amino sequence of BBB.The Neisseria outer membrane protein that is fit to includes but not limited to from gonococcal Laz, Lip or Pan 1.Interested especially is from Neisseria meningitidis and gonococcal Laz.Determining to comprise outer membrane protein that goods enters the brain cancer cells and/or pass through the required amino sequence of BBB can be tested and appraised any method that enters the brain cancer cells or pass through those required peptides of BBB and carry out.In a kind of such method, the whole or fragment of Neisseria outer membrane protein is connected to mark substance, tests to determine whether the whole or fragment of Neisseria outer membrane protein enters the brain cancer cells and/or pass through BBB.Can be used for identifying that suitable Neisseria outer membrane protein or its segmental method find at embodiment 4 and 7.

Can be used for the outer membrane protein that suitable Neisseria outer membrane protein of the present invention comprises Neisseria gonorrhoeae, it is by antibody recognition H.8, and/or by the fully several of AAEAP (SEQ ID NO:25) motif or not exclusively repeat to form.In some embodiments, the Neisseria transit peptides is by antibody recognition H.8.Be used for determining protein or peptide whether by the method for antibody recognition H.8 and parameter at Cannon et al., describe among the Infection and Immunity 43:994-999 (1984).

The present invention also provides the AAEAP transit peptides, and it is by the fully a plurality of of AAEAP (SEQ ID NO:25) motif or not exclusively repeat the peptide formed, and it can be transported cargo compound connection or associating and enter Mammals brain cancer cells and/or pass through BBB." not exclusively " as used herein repeats to be defined as the repetition of a kind of AAEAP (SEQ ID NO:25) pentapeptide, and at least one in the wherein said five amino acid is not the part of AAEAP (SEQ ID NO:25) motif.In other embodiments, describedly repeat not exclusively to have that to be no more than 1,2,3 or 4 be not the amino acid of the part of AAEAP (SEQ ID NO:25) pentapeptide.In some embodiments, described Neisseria transit peptides is the proteic 1-39 amino acids of Laz (SEQ ID NO:24).In some embodiments, described Neisseria transit peptides is a length at least about 20 amino acid, length at least about 40 amino acid, length at least about 60 amino acid or length at least about 80 amino acid.In other embodiments, described Neisseria transit peptides length is no more than about 40 amino acid, length and is no more than that about 100 amino acid, length are no more than about 200 amino acid or length is no more than about 400 amino acid.In some embodiments, described Neisseria transit peptides and Neisseria outer membrane protein (for example SEQ ID NO:22) have amino acid sequence identity at least about 90%, the amino acid sequence identity at least about 95% or at least about 99% amino acid sequence identity.

Term " AAEAP (SEQ ID NO:25) transit peptides " is meant the peptide that comprises complete and/or incomplete AAEAP (SEQ ID NO:25) pentapeptide multiple zone.AAEAP (SEQ ID NO:25) transit peptides can be synthetic by standard method, maybe can breed by the expression system based on cell.In some embodiments, described AAEAP (SEQ ID NO:25) transit peptides is repeated to form by the repetition of at least 2 AAEAP (SEQ ID NO:25) pentapeptide, the repetition of at least 4 AAEAP (SEQ ID NO:25) pentapeptide, the repetition of at least 6 AAEAP (SEQ ID NO:25) pentapeptide, the repetition of at least 8 AAEAP (SEQ ID NO:25) pentapeptide, the repetition of at least 10 AAEAP (SEQ ID NO:25) pentapeptide, the repetition of at least 15 AAEAP (SEQ ID NO:25) pentapeptide or at least 20 AAEAP (SEQ ID NO:25) pentapeptide.In some embodiments, described AAEAP (SEQ ID NO:25) transit peptides repeats, is no more than the repetition of 20 AAEAP (SEQ ID NO:25) pentapeptide, is no more than the repetition of 30 AAEAP (SEQ ID NO:25) pentapeptide or is no more than 40 AAEAP (SEQID NO:25) pentapeptide and repeat to form by being no more than 10 AAEAP (SEQ ID NO:25) pentapeptide.In some embodiments, described AAEAP (SEQ ID NO:25) transit peptides is only repeated, is only repeated by incomplete AAEAP (SEQ ID NO:25) pentapeptide or be made up of complete and incomplete AAEAP (SEQID NO:25) pentapeptide multiple mixture by complete AAEAP (SEQ ID NO:25) pentapeptide.

In some embodiments, described AAEAP (SEQ ID NO:25) transit peptides is only repeated to form by AAEAP (SEQ ID NO:25) pentapeptide.In other embodiments, described AAEAP (SEQ ID NO:25) transit peptides by each total length at least about 95% AAEAP (SEQ IDNO:25) pentapeptide repeat, each total length at least about 90% AAEAP (SEQ ID NO:25) pentapeptide repeat, each total length at least about 80% AAEAP (SEQ ID NO:25) pentapeptide repeat, each total length repeats to form at least about 50% AAEAP (SEQ ID NO:25) pentapeptide.In some embodiments, multiple zone and Ala-Ala-Glu-Ala-Pro (SEQ ID NO:25) the multiple peptide that comprises equal amts have at least about 70%, at least about 80%, at least about 90% or at least about 95% identity.

In some embodiments, described Neisseria transit peptides and/or AAEAP (SEQ IDNO:25) transit peptides can be used to promote that the goods of transporting connection optionally enters the brain cancer cells and/or passes through BBB.In other embodiments, described Neisseria transit peptides and/or AAEAP (SEQ ID NO:25) transit peptides can be used to transport the goods of using jointly and enters the brain cancer cells and/or pass through BBB.

The modification of Neisseria translocation domain or AAEAP translocation domain

In other embodiments of the present invention, Neisseria transit peptides or AAEAP (SEQID NO:25) transit peptides is chemically modified or changed hereditarily to produce have been kept the Transhipment Cargo compound to enter the brain cancer cells or has passed through the variant and the derivative of the ability of BBB.

The variant of Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides can be synthetic by standard technique.Derivative is directly or by modification or part to replace the aminoacid sequence that forms from natural amino acid.Variant can be an analogue, and it is to have the structure similar but inequality with natural compounds, some component or the side chain aminoacid sequence different with natural compounds.Analogue can synthesize or originate from different evolution.If derivative or analogue contain the amino acid of modification, variant can be total length or be not total length.

The invention provides the aminoacid sequence variant of Neisseria transit peptides, compare, the amino acid that it has replacement, disappearance or inserts with wild type peptide.Variant of the present invention can be the truncate of Neisseria transit peptides.As used herein, " truncate " of polypeptide is to remove the peptide that at least one amino-acid residue produces from least one end of peptide sequence.In some embodiments, the peptide of brachymemma originates from and removes at least one amino-acid residue, five amino acid residue, at least 10 amino-acid residues, at least 50 amino-acid residues, at least 100 amino-acid residues, at least 120 amino-acid residues or at least 150 amino-acid residues at least from the one or both ends of peptide sequence.In some embodiments, described composition comprises peptide, and described peptide is made up of the zone of Neisseria transit peptides, and described zone is less than total length Neisseria transit peptides.In some embodiments, described composition comprises peptide, and described peptide is made up of surpassing about 10 residues, surpass about 15 residues or surpassing about 20 residues of the Neisseria transit peptides of brachymemma.In some embodiments, described composition comprises peptide, described peptide is no more than about 100 residues, is no more than about 70 residues, is no more than about 50 residues by the Neisseria transit peptides of brachymemma, is no more than about 40 residues or is no more than about 30 residues and form.

The variant of Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides includes but not limited to, the molecule of inclusion region, described zone is on the aminoacid sequence of identical size or when the sequence with comparison compares, with at least about 65%, 70%, 75%, 85%, 90%, 95%, 98% or 99% identity basically with Neisseria transit peptides (SEQ ID NO:24) or AAEAP (SEQ ID NO:25) transit peptides homology, wherein said comparison is undertaken by homology algorithm.When " amino acid sequence identity per-cent (%) " of term between Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides and candidate sequence is defined as when two sequences of comparison in Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides with candidate sequence in the per-cent of the identical amino-acid residue of amino-acid residue.

Described variant also comprises the peptide made from the synthesizing amino acid of non-natural existence.For example, the amino acid of non-natural existence can be incorporated into and prolong in the variant peptides or the transformation period of optimum combination thing in blood flow.This variant includes but not limited to, D, L-peptide (diastereomer) (Futaki et al., J.Biol.Chem.276 (8): 5836-40 (2001); Papo et al., Cancer Res.64 (16): 5779-86 (2004); Miller et al., Biochem.Pharmacol.36 (1): 169-76, (1987)).; The peptide (Lee et al., J.Pept.Res.63 (2): 69-84 (2004)) that contains rare amino acid.; And the alpha-non-natural amino acid that contains alkene (Schafmeister et al., the J.Am.Chem.Soc.122:5891-5892 (2000) that are connected to hydro carbons bail (hydrocarbon stapling); Walenski et al., Science 305:1466-1470 (2004)), and the peptide that comprises ε-(3, the 5-dinitrobenzoyl)-lysine residue.

In other embodiments, peptide of the present invention is the derivative of Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides.The derivative of described transit peptides is the chemically modified body of described peptide, thereby described peptide still keeps some its primary activity.For example, " derivative " of transit peptides can be the transit peptides of chemically modifying that has kept it to pass through BBB and/or entered the ability of brain cancer cells.Active the deriving of mutagenic Neisseria transit peptides or AAEAP transit peptides expected as part of the present invention, as long as such loss of activity is not tangible.As used herein, " significantly forfeiture " is to compare with unaltered peptide to surpass about 50% activity.Interested chemically modified includes, but not limited to amidation, acetylize, sulfation, polyoxyethylene glycol (PEG) modification, phosphorylation and the glycosylation of peptide.In addition, the deutero-peptide can be the fusions of transit peptides or its variant, derivative or structural equivalents and compound, described compound such as but not limited to, another kind of peptide, drug molecule or other treatment agent or medicament or detectable probe.

Interested derivative comprises the chemically modified body, peptide of the present invention thus and the transformation period of composition in blood flow can be for example by well known to a person skilled in the art that several method is extended or optimizes, described chemically modified body includes but not limited to, the peptide of cyclisation (Monk et al., BioDrugs 19 (4): 261-78, (2005); DeFreest et al., J.Pept.Res.63 (5): 409-19 (2004)), N-and the end modified body of C-(Labrie et al., Clin.Invest.Med.13 (5): 275-8, (1990)). and the alpha-non-natural amino acid that contains alkene (Schafmeister et al., the J.Am.Chem.Soc.122:5891-5892 (2000) that are connected to the hydro carbons bail; Walenski et al., Science 305:1466-1470 (2004)) and the peptide that comprises ε-(3, the 5-dinitrobenzoyl)-lysine residue.

Be contemplated that transit peptides of the present invention can be variant, derivative and/or the structural equivalents of Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides.For example, described peptide can be by the truncate of the Neisseria transit peptides of PEGization, thereby makes that it is variant and derivative simultaneously.In one embodiment, use the α that contains the chain (tether) that carries alkene that is connected to by the catalytic alkene metathetical of ruthenium total hydrocarbon class " bail (staple) ", α-dibasic alpha-non-natural amino acid synthesizes peptide of the present invention.(Scharmeister et al., J.Am.Chem.Soc.122:5891-5892 (2000); Walensky et al., Science 305:1466-1470 (2004)). in addition, can merge with other peptides as the peptide of the structural equivalents of Neisseria transit peptides, thereby produce be structural equivalents be again the peptide of derivative.These examples only are illustrative rather than restriction the present invention.

Change can be introduced in Neisseria transit peptides or AAEAP (the SEQ ID NO:25) transit peptides, it causes the change in the aminoacid sequence of Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides, the ability that it does not make Neisseria transit peptides or AAEAP (SEQID NO:25) transit peptides forfeiture Transhipment Cargo compound enter the brain cancer cells and/or pass through BBB." nonessential " amino-acid residue is can change in the sequence of Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides and the ability that do not make its forfeiture Transhipment Cargo compound enter cell and/or pass through BBB, and " essential " amino-acid residue is that this activity is required.

The amino acid that " conservative property " that can carry out replaced is well known in the art.Useful conservative property is replaced at table 1, shown in " the preferred replacement ".Wherein one type amino acid is replaced by the conservative property of another amino acid replacement of same type and is fallen within the scope of the present invention, as long as described replacement does not make the loss of activity of described Neisseria/AAEAP transit peptides.The active this change of mutagenic Neisseria/AAEAP transit peptides is expected as part of the present invention, as long as active forfeiture is not tangible.As used herein, " significantly forfeiture " is to compare with unaltered peptide to surpass about 50% activity.

Table 1 is preferably replaced

The structure of influence (1) polypeptide backbone, for example " non-conservation " of the main body (bulk) of the side chain of β-lamella or alpha-helix conformation, (2) electric charge, (3) hydrophobicity or (4) target site replaced and can be changed Neisseria/AAEAP transit peptides function.As shown in table 2, based on common side chain character residue is divided into groups.Non-conservation is replaced and need is changed to the member of the class in these classifications another kind of.

Wherein one type amino acid is replaced by the non-conservation of another dissimilar amino acid replacements and is fallen within the scope of the present invention, as long as described replacement does not make the loss of activity of described Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides.The active this change of mutagenic Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides is expected as part of the present invention, as long as active forfeiture is not tangible.

Table 2. amino acid classification

In other embodiments, the present invention expects the structural equivalents of Neisseria transit peptides or AAEAP (SEQID NO:25) transit peptides, and it has the remarkable structural similarity with the 1-39 amino acids residue (SEQ ID NO:24) of gonococcus Laz.Especially, remarkable structural homology between the 1-39 amino acids residue of the structural equivalents of Neisseria transit peptides and gonococcus Laz (SEQ ID NO:24) is determined (Gibrat et al., CurrOpin Struct Biol 6:377-385 (1996) by using the VAST algorithm; Madej et al., Proteins 23:356-3690 (1995)).In specific embodiment, be to be lower than about 10 from the texture ratio VAST p value of the 1-39 amino acids residue (SEQ ID NO:24) of the structural equivalents of Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides and gonococcus Laz ^-3, be lower than about 10 ^-5, or be lower than about 10 ^-7In other embodiments, the remarkable structural homology between the 1-39 amino acids residue of the structural equivalents of Neisseria transit peptides and gonococcus Laz (SEQ ID NO:24) can be determined (Holm ﹠amp by using the DALI algorithm; Sander, J.Mol.Biol.233:123-138 (1993)).In specific embodiment, the DALI Z score value of pairing structure comparison is at least about 3.5, at least about 7.0 or at least about 10.0.

Modification to Neisseria transit peptides or AAEAP (SEQ ID NO:25) transit peptides can use methods known in the art to carry out, for example oligonucleotide mediated (fixed point) mutagenesis, L-Ala scanning and PCR mutagenesis.(Carter, Biochem be (1986) J.237:1-7 can to carry out site-directed mutagenesis to clone's DNA; Zoller and Smith, Methods Enzymol.154:329-50 (1987)), cassette mutagenesis, restriction select mutagenesis (Wells et al., Gene 34:315-23 (1985)) or other known technology to produce the nucleic acid of coding Neisseria/AAEAP transit peptides variant.In addition, the Nucleotide of coding Neisseria transit peptides variant or AAEAP (SEQ ID NO:25) transit peptides variant can synthesize by means commonly known in the art.

Neisseria/AAEAP (SEQ ID NO:25) transit peptides-cargo compound mixture

In another aspect of the present invention, provide transit peptides-goods mixture, wherein Neisseria transit peptides or AAEAP transit peptides and at least a cargo compound are compound.The transit peptides of these mixtures can be one of Neisseria transit peptides, AAEAP (SEQ ID NO:25) transit peptides or boths' variant, derivative or a structural equivalents.The cargo compound of being sent by the present invention includes but not limited to, protein, lipoprotein, polysaccharide, nucleic acid (comprising antisense nucleic acid), dyestuff, particulate or receive grain, toxin, inorganic and organic molecule, small molecules and medicine.This transit peptides-goods mixture can be used for entering brain and/or brain cancer cells and general cancer cells for the therapeutic purpose delivering drugs, be used for sending imaging compounds to brain cancer cells and general cancer cells, and be used for to send any other purpose that specific compound enters brain and/or enters the brain cancer cells for diagnostic purpose.Cargo compound can invest the C-end or the N-end of described transit peptides.

In some embodiments, described Neisseria transit peptides or AAEAP transit peptides and cupredoxin derived transit peptides are compound.The U.S. Patent application NO.11/244 that submits on October 6th, 2005 provides cupredoxin derived transit peptides in 105, by reference it is incorporated in this clearly.In some embodiments, described cupredoxin derived transit peptides is its variant, derivative or the structural equivalents that comprises the 50-77 amino acids zone of Pseudomonas aeruginosa azurin.

As used herein, term " compound ", " mixture " or " connection " are meant in the physical union of wanting between the compound composition.In some cases, described physical union can not be directly, but can be by linking group or the another kind of mediation that becomes to assign to.Composition can be protein, other organic molecules or inorganic molecule, or the like.Physical union between composition can or keep described composition to be in any other mode of physical union by covalent linkage, hydrophobicity key and/or Van der Waals force.In various embodiments of the present invention, described cargo compound can comprise: to the cytotoxic cupredoxin of cancer cells, for example from the azurin (SEQ ID NO:24) (" wt-azurin ") of Pseudomonas aeruginosa; Plastocyanin from cyanobacteria blue-green algae (Phormidium laminosum); Iron sulphur bacterium azurin from iron thiobacillus thiooxidant (Thiobacillus ferrooxidans); False azurin from driffractive ring achromobacter (Achromobacter cycloclastes); Azurin from pseudomonas syringae (Pseudomonas syringa), Neisseria meningitidis, Vibrio parahaemolyticus (Vibrio parahaemolyticus), bordetella bronchiseptica (Bordetellabronchiseptica); From orange green bacterium (Chlorqflexus aurantiacus) or green plain A and the B of subduing of gonococcal orange of subduing; With other azurins and azurin sample albumen.In other embodiments, described cargo compound can be a cytochrome c, for example from gonococcal cytochrome C ₅₅₁In other embodiments, described cargo compound can be the variant that has kept its Cytotoxic any above-claimed cpd in cancer cells.

In one embodiment, described cargo compound can be detectable material, and fluorescent substance for example is as green fluorescent protein; Luminophore; Enzyme, for example beta-galactosidase enzymes; Radiolabeled or biotinylated albumen is sent to give cell detectable phenotype.Similarly, can be sent with the particulate of detectable substance (for example fluorescent substance) mark or the grain of receiving.What be fit to receives the United States Patent (USP) NO.6 that an example of grain authorizes on May 7th, 2002, finds in 383,500, by reference it is incorporated in this clearly.Many this detectable substances are known for those skilled in the art.

In some embodiments, described cargo compound can be the detectable substance that is suitable for X ray computer tomography, nuclear magnetic resonance, ultrasonic imaging or radionuclide scitiphotograph.In these embodiments, for diagnostic purpose is administered to the patient with cargo compound.Strengthen image as the cargo compound administration of contrast agents by X ray CT, MRI and ultrasonic acquisition.In various embodiments, described cargo compound is gamma-rays or positron radiation radio isotope, magnetic resonance imaging contrast, x-ray contrast agent and/or acoustic contrast agent.

Via the using of radionuclide cargo compound Neisseria/AAEAP (SEQ ID NO:25) transit peptides target brain tumor tissue, that have or do not have cupredoxin derived transit peptides, can be used for the radionuclide scitiphotograph.In some embodiments, Neisseria/AAEAP (SEQ ID NO:25) transit peptides can contain the radioactive nuleus thuja acid that has or do not have cargo compound.U.S. Patent Publication NO.2006/0039861 provides the contrast medium peptide target, poly, as the radionuclide contrast medium.The commercially available cargo compound that is suitable for x-ray imaging includes but not limited to

(Visipaque 320),

(Schering AG)) and

Can obtain from GE Healthcare (Chalfont St.Giles, United Kingdom).

Via the using of acoustic contrast agent cargo compound Neisseria/AAEAP (SEQ ID NO:25) transit peptides target brain tumor tissue, that have or do not have cupredoxin derived transit peptides, can be used for ultra sonic imaging.The acoustic contrast agent that is suitable as cargo compound includes but not limited to, the microvesicle of biocompatibility gas, liquid vehicle and tensio-active agent microsphere further are included in the optional connection portion Ln between targeting moiety and the microvesicle.Those that interested microvesicle includes but not limited to provide in the table 3.In this article, the term liquid vehicle is meant the aqueous solution, and the nomenclature surface-active agent is meant any amphiphilic species, and it causes solution median surface tension force to reduce.The tabulation that is used to form the tensio-active agent that is fit to of tensio-active agent microsphere discloses in EP0727225A2, is incorporated in this by reference clearly.Nomenclature surface-active agent microsphere comprises receives ball, liposome, vesicle or the like.In some embodiments, acoustic contrast agent is liposome or dextran.Described biocompatibility gas can be air or fluorocarbon (for example C3-C5 perfluor alkane), and it provides echogenic difference and thereby provides the contrast in the ultrasonic imaging.Described gas can be enclosed or is included in the microsphere, and optional ground warp has connected Neisseria/AAEAP (SEQ ID NO:25) transit peptides by linking group on the described microsphere.Described connection can be covalency, ionic or pass through Van der Waals force.

Table 3. is as the microvesicle of acoustic contrast agent and their composition.

Via the using of x-ray contrast agent cargo compound Neisseria/AAEAP (SEQ ID NO:25) transit peptides target brain tumor tissue, that have or do not have cupredoxin derived transit peptides, can be used for other forms of X ray computer tomography and x-ray imaging.The current commercial x-ray contrast agent that is suitable as cargo compound can be divided into two classes: 1) ionic contrast agent has ionic carboxyl and 2) non-ionic contrast medium, it does not contain any ionic group.The example of commercially available ionic contrast agent comprises

(Urogranoic acid) and (P-286 salt), and nonionics comprises

(Schering AG)),

(iopamidol),

(ioversol) and (Visipaque 320).Other x-ray contrast agents that are suitable as cargo compound include but not limited to, one or more X ray absorbefacient or ordination number 20 or bigger " weight " atom further comprise the optional connection portion L between Neisseria/AAEAP (SEQ ID NO:25) transit peptides and the X ray absorption atom _nThe heavy atom that often uses in x-ray contrast agent is an iodine.The x-ray contrast agent (for example, United States Patent (USP) NO.5,679,810) that discloses the x-ray contrast agent of forming by metallo-chelate (for example, United States Patent (USP) NO.5,417,959) and formed by many inner complexs that multiple metal ion is formed.Multinuclear cluster mixture as x-ray contrast agent open (for example, United States Patent (USP) NO.5,804,161, PCTWO91/14460 and PCT WO 92/17215).Other x-ray contrast agents are well known to a person skilled in the art, can use equally well with the cargo compound among the present invention.

Via the using of MRI contrast medium cargo compound Neisseria/AAEAP (SEQ ID NO:25) transit peptides target brain tumor tissue, that have or do not have cupredoxin derived transit peptides, can be used for the MRI imaging.The MRI contrast medium that is suitable as cargo compound includes but not limited to, one or more paramagnetic metal ions further are included in the optional connection portion L between Neisseria/AAEAP (SEQ ID NO:25) transit peptides and the described paramagnetic metal ion _nThe metal ion of metallo-chelate can be a paramagnetic ion.The metal ion that is fit to comprise have 22-29 (comprising), 42,44 and the ordination number of 58-70 (comprising) and having+2 or+those metal ions of 3 oxidation state.The example of this metal ion species is chromium (III), manganese (II), iron (II), iron (III), cobalt (II), nickel (II), copper (II), praseodymium (III), neodymium (III), samarium (III), gadolinium (III), terbium (III), dysprosium (III), holmium (III), erbium (III) and ytterbium (III).The commercially available MRI contrast medium that is suitable as cargo compound includes but not limited to from GE Healthcare's (Chalfont St.Giles, United Kingdom)

(gadodiamide) and

In another embodiment, cargo compound is sent to kill or the growth of anticancer (for example brain cancer cells or other cancer cells).For example, cargo compound can be cyclin, for example p53; Cell cycle protein dependent kinase inhibition, for example p16, p21 or p27; Suicide albumen, for example thymidine kinase or nitroreductase; Cytokine or other immune modulators, for example interleukin-11, interleukin-22 or granulocyte-macrophage colony stimutaing factor (GM-CSF); Or toxin, Pseudomonas aeruginosa exotoxin A for example, or the like.In other embodiments, the biological active fragment of one of above-claimed cpd kind can be sent.

In another embodiment, described cargo compound is the medicine that is used for the treatment of cancer.This medicine comprises, for example, and 5 FU 5 fluorouracil; Interferon alpha; Methotrexate; Tamoxifen and vincristine sulphate (Vincrinstine).Other cargo compound that are suitable for treating cancer include but not limited to: alkylating agent, for example mustargen, alkylsulfonate, nitrosourea, aziridine and triazene; Metabolic antagonist, for example antifol, purine analogue and pyrimidine analogue; Microbiotic, for example anthracene nucleus class, bleomycin, mitomycin, dactinomycin and Plicamycin; Enzyme is the altheine enzyme for example; The farnesyl-protein transferase inhibition; The 5 inhibition; The inhibition of 17 beta-hydroxysteroid dehydrogenases, 3 types; Hormone preparation, for example glucocorticosteroid, oestrogenic hormon/estrogen antagonist, male sex hormone/androgen antagonist, progesterone and luteinizing hormone-releasing hormone (LRH) antagonist, Sostatin LAR; Microtubule disrupting agent, for example ecteinascidin or their analogue and derivative; Microtubule stabilizer, as taxanes, taxol for example , how western taxol

With their analogue, and ebormycine, for example ebomycin A-F and their analogue; Plant derivation product, for example vinca alkaloids, epipodophyllotoxin, taxanes; And topoisomerase (topiosomerase) inhibition; Prenyl protein transferase inhibition; And assorted agent (miscellaneous agent) for example hydroxyurea, Procarbazine, mitotane, hexamethylmelamine, platinum coordination complex (for example cisplatin and carboplatin); With other medicaments as anticancer and cytotoxic agent, biological example reaction modifier, somatomedin; Immunomodifier and monoclonal antibody.

The representational example of these carcinostatic agents and cytotoxic agent kind includes but not limited to the mustargen hydrochloride, endoxan, Chlorambucil, melphalan, ifosfamide, busulfan, carmustine (carmustin), lomustine, Me-CCNU, streptozotocin, thiotepa, dacarbazine, methotrexate, Tioguanine, purinethol, NSC-118218, pentastatin, cladribine (cladribin), cytosine arabinoside, Fluracil, doxorubicin hydrochloride, daunorubicin, idarubicin, bleomycin sulfate, ametycin, dactinomycin, safracin, husky framycin (saframycin), quinocarcin, discodermolide, vincristine(VCR), vinealeucoblastine(VLB), vinorelbine tartrate, etoposide, the phosphoric acid etoposide, Vumon, taxol, tamoxifen, Emcyt, estramustine phosphate sodium, flutamide, buserelin, Leuprolide, pteridine, diynese, L-tetramisole, aflacon, Interferon, rabbit, interleukin-, rIL-2, filgrastim, sargramostim, Rituximab, BCG, vitamin A acid, U 101440E, betamethosone, gemcitabine hydrochloride, altretamine (altretamine) and hydrochloric acid Hycamtin (topoteca) with and any analogue or derivative.

Can be used as the carcinostatic agent of cargo compound and the example of other cytotoxic agents comprises following: German Patent No.4138042.8, WO 97/19086, WO 98/22461, WO 98/25929, WO98/38192, WO 99/01124, WO 99/02224, WO 99/02514, WO 99/03848, WO 99/07692, WO 99/27890, WO 99/28324, WO 99/43653, WO 99/54330, WO 99/54318, WO 99/54319, WO 99/65913, WO 99/67252, the ebormycine derivative that finds among WO 99/67253 and the WO 00/00485; The cell cycle protein dependent kinase inhibition that finds among the WO 99/24416 (also referring to United States Patent (USP) NO.6,040,321); With the prenyl protein transferase inhibition of finding among WO97/30992 and the WO 98/54966; And for example at United States Patent (USP) NO.6,011, those medicaments of describing taxonomically and particularly in 029, its compound can adopt, adopt with the LHRH instrumentality, particularly in treatment for cancer with any NHR instrumentality (for example AR instrumentality, ER instrumentality).

Other examples of cargo compound comprise those compounds that can be delivered to brain valuably.These cargo compound comprise medicine and the other treatment agent that is used for the treatment of the disease relevant with brain.These diseases relevant with brain include but not limited to, the HIV infection of melancholia, affective disorder, chronic pain, epilepsy, alzheimer's disease, apoplexy/neuroprotective, brain and Spinal injury, brain cancer, brain, the ataxic imbalance of various generation, amyotrophic lateral sclerosis (ALS), Huntington Chorea, influence children's congenital heredity mistake, Parkinson's disease and the multiple sclerosis of brain.

Can include but not limited to tricyclic anti-depressants as the antidepressant drug that cargo compound is treated melancholia and affective disorder, for example nortriptyline, Venlafaxine

And Nefazadone (nefazadone)

Selectivity serotonin reuptake inhibitor (SSRI), for example Fei Luoketing

, Sertraline

, fluvoxamine

Paroxetine

And citalopram

, calm mirtazapine

And more activated Bupropion (bupropion)

Also interested is headache and migraine remedy, includes but not limited to Ergotamine, dihydroergotamine, Ketoprofen, Proprasylyte (propranolol), timolol, atenolol USP 23, metoprolol and nadolol.

Can include but not limited to common anodyne, for example acetaminophen as the medicine that cargo compound is treated chronic pain

Anti-inflammatory drug is Asprin for example; On-steroidal anti-inflammatory medicine (NSAID) is Ibuprofen BP/EP for example

And Naproxen Base

Opium kind analgesics is morphine sample opioid for example; Thymoleptic and anti-outbreak medicine.

Can include but not limited to phenylethyl barbituric acid, dilantin, Trimethadione as the medicine that goods is treated epilepsy

, diazepam

, carbamazepine

Valproic acid

(ethosuximide),

(ethosuximide), Trileptal (trileptal), carbamazepine,

(Levetiracetam), lamotrigine, acetazolamide, triagabine, Sodium Valproate, lyrica, clonazepam, carbamazepine, topiramate, valproic acid, lamotrigine, ethosuximide, clobazam, vigabatrin, Levetiracetam, gabapentin, zonisamide, Primidone, Phenytoin Sodium Salt and oxcarbazepine.

Can include but not limited to anticholinesterase as the medicine that cargo compound is treated alzheimer's disease, for example

(be called as in the past

) (lycoremine),

(sharp this bright),

(E2020),

(tacrine) and N-methyl D-aspartic acid (NMDA) antagonist,

(Memantine hydrochloride).

Can include but not limited to as the medicine that cargo compound is treated apoplexy or is used for neuroprotective , erythropoietin (EPO), thrombopoietin, TNF-α, oestrogenic hormon, melatonin and cannaboid.

Can treat the medicine that brain HIV infects as cargo compound and include but not limited to non-nucleoside reverse transcriptase inhibitor (NNRTI) for example delavardine, Stocrin (efavirenz) and nevirapine; Efabirenz (NRTI) for example Abacavir, Abacavir, lamivudine, Abacavir, lamivudine, zidovudine, didanosine, emtricitabine, emtricitabine, tenofovir DF, lamivudine, lamivudine, zidovudine, stavudine, tenofovir DF, bundle former times his guest and zidovudine; Protease inhibitor (PI) is ammonia Pune Wei, Reyataz R, that Wei of furan mountain, Indinavir, rltonavir, ritonavir, Nai Fennawei, ritonavir, Saquinavir and tipranavir for example; And fusion inhibitor En Fuwei peptide for example.

Can include but not limited to as the medicine that cargo compound is treated amyotrophic lateral sclerosis (ALS) creatine,

NAALAD enzyme, neurodex,

Anavar, Coenzyme Q10 99.0, topiramate

, xaliproden, Indinavir, Minocycline HCl and buspirone.

Can include but not limited to antipsychotic drug, for example haloperidol, or other drug, for example clonazepam, thymoleptic, for example Fei Xiting, Sertraline and nortriptyline as the medicine that cargo compound is treated Huntington Chorea; Tranquilizer and lithium; Minocycline HCl, citalopram and Ethyl-EPA

Can treat parkinsonian medicine as cargo compound and include but not limited to anticholinergic or amantadine, levodopa (L-dopa), bromocriptine, pergolide, pramipexole, Ropinirole, selegiline and amantadine.

Can include but not limited to as the medicine that cargo compound is treated multiple sclerosis thyroliberin (more understand be ACTH), prednisone, Prednisolone Acetate, methyl meticortelone, Betamethasone Valerate, dexamethasone, interferon-(

With ), interferon-alpha,

(mitoxantrone), ring spore (Sandimmune), endoxan

, methotrexate, imuran

And CldAdo

In another embodiment, described cargo compound is the nucleic acid of one of coding above-claimed cpd kind.

Provide above-mentioned example only to be used for explanation, many other such compounds are well known by persons skilled in the art.

The nucleic acid of above-mentioned arbitrary structural domain of encoding Neisseria translocation domain or AAEAP translocation domain or being connected with cargo compound

In yet another aspect, the invention provides the nucleic acid molecule of coding Neisseria/AAEAP (SEQ IDNO:25) transit peptides and its variant or fusion rotein, described fusion rotein comprises Neisseria/AAEAP (the SEQ ID NO:25) transit peptides that is connected with cargo compound, and wherein said cargo compound is a protein.Can prepare by the combination of technology known in the art according to nucleic acid molecule of the present invention.The encoding sequence that uses in these nucleic acid can be those that exist in the natural gene group DNA of coding particular peptide, maybe can be from known codon design.These encoding sequences can consider that also organic optional codon utilization and the preferred codon that will express described peptide are used to design.The nucleotide sequence of Neisseria/AAEAV (SEQ ID NO:25) transit peptides and transit peptides-goods mixture can be by chemosynthesis or clone's preparation respectively.Can use ligase enzyme that nucleotide sequence is linked together to obtain target nucleic acid molecules then.Use the method for Neisseria translocation domain or AAEAP translocation domain delivering goods compound

Composition of the present invention can be used for, and for example, the detection of cell type or imaging are used for treatment for cancer, particularly central nervous system or brain treatment for cancer, or are used for the treatment of diseases relevant with brain.Described composition can be used with the treatment significant quantity.Usually, host organisms is a Mammals, for example the mankind or animal.In some embodiments, described cargo compound and Neisseria/AAEAP (SEQ ID NO:25) transit peptides is sent compoundly, and in other embodiments, described cargo compound and Neisseria/AAEAP (SEQ ID NO:25) transit peptides is used jointly but is not compound with it.Surpassing a kind of cargo compound can use jointly with Neisseria/AAEAP transit peptides.Using jointly of cargo compound can take place with using simultaneously of described transit peptides, in same pharmaceutical preparation, or in using another pharmaceutical preparation that described transit peptides uses within about a hour.In addition, using jointly of Neisseria/AAEAP (SEQ ID NO:25) transit peptides and cargo compound can comprise using of Neisseria/AAEAP (SEQ ID NO:25) transit peptides, and it begins to surpass about one hour from using of described cargo compound but is less than about two hours, four hours, six hours, 12 hours or the twenty four hours generation.In some embodiments, Neisseria/AAEAP transit peptides, cargo compound and cupredoxin derived transit peptides can be used jointly.In other embodiments, Neisseria/AAEAP transit peptides can with use jointly with the cupredoxin derived transit peptides of cargo compound compound..

In other various embodiments of the present invention, Neisseria/AAEAP (SEQ IDNO:25) transit peptides is external, elder generation's external back body is interior or the interior delivering goods compound of body enters cell.For example, by adding the mixture of Neisseria/AAEAP (SEQID NO:25) transit peptides and cargo compound, can realize external sending to cell culture (for example biopsy thing).Perhaps, by adding described mixture, and the sample of described processing is turned back among the patient, can realize sending in the body of earlier external back to the sample that shifts out from the patient (for example blood, tissue or marrow).By directly using described mixture, also can realize sending to the patient.That method of the present invention can be used for the treatment of, prevention, diagnosis or study purpose.

The composition that contains Neisseria/AAEAP (SEQ ID NO:25) transit peptides, comprise that the mixture that comprises Neisseria/AAEAP (SEQ ID NO:25) transit peptides can use by any suitable approach, for example, by oral, the oral cavity, suction, hypogloeeis, rectum, vagina, transurethral, nose, body surface, endermic (promptly through skin) or parenteral (comprise intravenous, intramuscular, subcutaneous and coronary artery in use), or by in the tricorn or brain in injection.Composition of the present invention and its pharmaceutical preparation can be used with any significant quantity and realize its its intended purposes.When in order to treat cancer or any disease that other need be treated when using, described composition is used with the treatment significant quantity.The dosage of various cargo compound can be gathered from many reference with the guidance of using arrangement, it describes the use of these compounds in treatment or diagnosis, Physicians ' Desk Reference (PDR) for example, or determine in addition by those of ordinary skills.

Composition of the present invention can be sterilized by the known sterilising technology of routine, or can sterile filtration.The aqueous solution that produces can packedly use same as before, or by freeze-drying, freeze dried goods made up with sterile solution before using.When using according to Neisseria/AAEAP of the present invention (SEQ ID NO:25) transit peptides, cargo compound and/or transit peptides-cargo compound mixture in intravenous mode, using can be by intravenous drip or intermittent infusion.

The supplier or the clinicist that participate in nursing determine definite formulation, route of administration and dosage according to patient's situation.Dosage and can adjusting so that the blood plasma level of the composition of the present invention that is enough to keep result of treatment to be provided at interval according to individual.Usually, compositions desired with the mixture of putting into practice selected pharmaceutical carrier according to predetermined route of administration and standard drug in use.

The character of the compound that contains Neisseria/AAEAP (SEQID NO:25) transit peptides, cargo compound, host, mode of administration that the dosage that is fit to for example can depend on to be adopted and the disease that will treat or diagnose and seriousness and change.Yet, in an embodiment of method of the present invention, obtaining satisfied treatment result in the mankind needs about 0.001 the compound or the Neisseria/AAEAP transit peptides mixture that contain Neisseria/AAEAP (SEQ ID NO:25) transit peptides to about 20mg/kg body weight.In one embodiment, be used for the mankind treatment indicate every day dosage about 0.7mg contains the scope of the compound of Neisseria/AAEAP (SEQ IDNO:25) transit peptides or Neisseria/AAEAP transit peptides mixture to about 1400mg in, for example with every day dosage, use to dosage, every month dosage and/or successive doses convenient drug administration weekly.Every day, dosage can be every day 1 to 12 time or more discontinuous dosage.Perhaps, dosage can be every other day, per three days, per four days, per five days, per six days, weekly and similarly fate increases up to 31 days or more of a specified duration using.Dosed administration can be that continue, intermittent or single dose, uses any applicable form of medication, comprises that tablet, paster, intravenously use, or the like.More specifically, described composition is used with the treatment significant quantity.In specific embodiment, described treatment significant quantity is about 0.01-20mg/kg body weight.In specific embodiment, described dosage level is about 10mg/kg/ days, about 15mg/kg/ days, about 20mg/kg/ days, about 25mg/kg/ days, about 30mg/kg/ days, about 35mg/kg/ days, about 40mg/kg/ days, about 45mg/kg/ days or about 50mg/kg/ days.

In some embodiments, import to the patient and to contain the composition of Neisseria/AAEAP (SEQ IDNO:25) transit peptides or the method for Neisseria/AAEAP transit peptides mixture is, use jointly with other medicines that become known for treating cancer.This method is well known in the art.In specific embodiment, the composition or the Neisseria/AAEAP transit peptides mixture that contain Neisseria/AAEAP (SEQ ID NO:25) transit peptides are the parts of mixture (cocktail), perhaps contain or with the part of the co-administered of the medicine of other treatment cancer.This medicine is included in this any cargo compound of listing that is used for cancer therapy.

The pharmaceutical composition that comprises composition of the present invention can be used according to the invention, can use one or more physiology acceptable carriers to be mixed with the preparation that can use remedially in a conventional manner, described physiology acceptable carrier comprise the processing of being convenient to described composition vehicle and auxiliary agent, be used to suppress or stimulate excretory promoting agent or its mixture of described composition.

Coding Neisseria/AAEAP transit peptides or made up one of transit peptides and cargo compound and/or the nucleic acid molecule of the fusion rotein of cupredoxin derived transit peptides can insert in the carrier and as gene therapy vector.Gene therapy vector can pass through for example intravenous injection, topical application (U.S. Patent No. 5,328,470) or be delivered to the experimenter by stereotactic injection.The pharmaceutical preparation of (Chenet al., Proc Natl Acad Sci USA, 91:3054-57 (1994)) gene therapy vector can comprise acceptable diluent, maybe can comprise sustained-release matrix, wherein embedding the gene delivery instrument.Perhaps, in the time can intactly producing complete genome delivery vector (for example, retroviral vector) from reconstitution cell, pharmaceutical preparation can comprise one or more cells that produce this genes delivery system.

In one aspect, described composition is sent as DNA, thereby produces described mixture in position.In one embodiment, described DNA is " exposing ", and as for example Ulmer et al., Science 259:1745-49 (1993) describes and Cohen, and Science 259:1691-92 (1993) is summarized.By naked DNA being coated on the picked-up that can increase naked DNA on the carrier (the degradable pearl of biological example), described carrier is then by in the transporte to cells effectively.In this method, DNA may reside in the known any various delivery systems of those of ordinary skills, comprises expression of nucleic acid system, bacterial expression system and virus expression systems.The technology that DNA is incorporated in these expression systems is known to a person of ordinary skill in the art.Referring to, for example, WO90/11092, WO93/24640, WO 93/17706 and U.S. Patent No. 5,736,524.

Be used for coming and going carrier of germ plasm and can be divided into two kinds of general types between organism: cloning vector is rf plasmid or phage, has the nonessential zone of propagation in the host cell that is fit to, and wherein can insert foreign DNA; Described foreign DNA is replicated and breeds, and is the composition of carrier as it.Expression vector (for example, plasmid, yeast or animal virus genome) is used for exogenous genetic material being introduced host cell or organizing to transcribe and to translate foreign DNA, as described the DNA of composition.In expression vector, the DNA of importing is operably connected to element (for example promotor), and it gives the host cell signal to transcribe the DNA of insertion.Some promotor is useful especially, inducible promoter for example, and it comes regulatory gene to transcribe in response to specific factor.The composition polynucleotide are operably connected to inducible promoter can regulate and control Neisseria/AAEAP transit peptides composition polypeptide or segmental expression.The example of typical inducible promoter comprises alpha-interferon, heat shock, heavy metal ion and steroid those promotors of reacting of glucocorticosteroid (Kaufman, Methods Enzymol.185:487-511 (1990)) and tsiklomitsin for example.Other ideal inducible promoters comprise that for the cell that has imported construct be not endogenous those promotors, yet, when outer seedbed provides inductor, in those cells, be responsiveness.Usually, useful expression vector plasmid normally.Yet, other forms of expression vector, for example virus vector (for example, replication defect type retrovirus, adenovirus and adeno-associated virus (AAV)) is expected.

Carrier is selected by the carrier final result of the organism of using or cell and expectation indicated.Usually, carrier comprises signal sequence, replication orgin, marker gene, enhancer element, promotor and transcription termination sequence.

The pharmaceutical composition that contains the Neisseria translocation domain

The mixture that contains Neisseria/AAEAP (SEQ ID NO:25) pharmaceutical composition of the present invention of transit peptides or the Neisseria/AAEAP that is connected with cargo compound (SEQ ID NO:25) transit peptides can be made in the mode of any routine; for example, mixing, dissolving, the granulation by routine, roll sugar-coat, emulsification, inclosure, embedding or step of freeze drying.Neisseria/AAEAP transit peptides mixture can be easily and pharmaceutically acceptable carrier combinations well known in the art.This carrier allows preparation to be configured to tablet, pill, lozenge, capsule, liquid, gel, syrup, slurry, suspension, or the like.The vehicle that is fit to can also comprise, for example, and weighting material and cellulose preparation.Other vehicle can comprise, for example, and seasonings, tinting material, release agent, thickening material and other acceptable additive, adjuvant or tackiness agent.

In various embodiments, described pharmaceutical composition comprises carrier and vehicle (includes but not limited to damping fluid, carbohydrate, N.F,USP MANNITOL, protein, polypeptide or amino acid, for example glycine, antioxidant, fungistat, sequestrant, suspension agent, thickening material and/or sanitas), water, oil, salt brine solution, dextrose hydrate and glycerine solution, reach approximate other required pharmaceutically acceptable auxiliary substances of physiological condition, for example buffer reagent, tonicity contributor, wetting agent or the like.Though it should be understood that and can adopt the known any suitable carrier of those of ordinary skills to use composition of the present invention, the type of carrier will depend on the pattern of using and change.Compound also can use technique known to enclose in the liposome.Also can adopt the carrier of biodegradable microsphere as composition of the present invention.For example, in U.S. Patent No. 4,897, shown the biodegradable microsphere that is fit in 268,5,075,109,5,928,647,5,811,128,5,820,883,5,853,763,5,814,344 and 5,942,252.As used herein " compound " comprises peptide of the present invention, aminoacid sequence, cargo compound and mixture and nucleic acid.

Being used for pharmaceutical compositions can be made up of crystalloid or colloid with the intravenous fluid of using described Neisseria/AAEAP (SEQ IDNO:25) transit peptides, goods and transit peptides-goods mixture and nucleic acid.Crystalloid as used herein is the aqueous solution of inorganic salt or other water soluble molecules.Colloid as used herein contains bigger insoluble molecule, for example gelatin.Intravenous fluid can be aseptic.

Can be used for the brilliant sample liquid that intravenously uses and include but not limited to that physiological saline (sodium chloride solution of 0.9% concentration), ringer lactate or Ringer's solution, and 5% D/W (being sometimes referred to as D5W) are described in table 4.

Table 4: the composition of common crystalloid solution

* ringer lactate also contains 28mmol/L lactic acid salt, 4mmol/L K ⁺And 3mmol/LCa ²⁺

The transformation period of composition of the present invention in blood flow can be extended or optimize, for example,, include but not limited to by well known to a person skilled in the art several method, the peptide of cyclisation (Monk et al., BioDrugs 19 (4): 261-78, (2005); DeFreest et al., J.Pept.Res.63 (5): 409-19 (2004)), D, L-peptide (diastereomer) (Futaki et al., J.Biol.Chem.Feb 23; 276 (8): 5836-40 (2001); Papo et al., Cancer Res.64 (16): 5779-86 (2004); Miller et al., Biochem.Pharmacol.36 (1): 169-76, (1987)) peptide (the Lee et al. that, contains alpha-non-natural amino acid, J.Pept.Res.63 (2): 69-84 (2004)) and N-is end modified and end modified (the Labrie et al. of C-, Clin.Invest.Med.13 (5): 275-8, (1990)).Interested especially is the modification of d-isomerization (replacement) and stabilized peptide, replaces or the replacement of L-amino acid via D-.

When using by injection, composition can be formulated in the aqueous solution, preferably in physiology ground compatible buffers (for example Hanks solution, Ringer's solution or normal saline buffer solution).This solution can comprise preparaton (formulatory agent) for example suspension agent, stablizer and/or dispersion agent.Perhaps, described composition can be that powder type is used for before use and the carrier (vehicle) that is fit to (for example, aseptic apirogen water) body plan.

When using by suction, described composition can be with the form of aerosol injection from compression wrap or atomizer, send by the propelling agent that is fit to (for example Refrigerant 12, trichlorofluoromethane, carbonic acid gas or other gas that is fit to).For the aerosol of pressurization, dose unit can be determined by the amount that provides valve to send metering.For example, the anther sac of the gelatin that uses in sucker or insufflator and cartridge case can be formulated as the powdered mixture that contains albumen and suitable powder matrix (base) (for example lactose or starch).

When using by body surface, described composition can be configured to solution, gelifying agent, ointment, ointment, suspension or the like, as known in the art.In some embodiments, using is mode by transdermal patch.When using by suppository (for example, rectum or vagina), composition also can be formulated in the composition that contains conventional suppository bases.

When oral using, described composition can easily be prepared with pharmaceutically acceptable carrier combinations well known in the art.Can adopt solid carrier, for example N.F,USP MANNITOL, lactose, Magnesium Stearate or the like; This carrier allows chemokine to be configured to tablet, pill, lozenge, capsule, liquid, gelifying agent, syrup, slurry, suspension or the like, is used for the oral absorption by the experimenter that will treat.For oral chamber solid dosage, for example powder, capsule and tablet, suitable vehicle comprises weighting material (for example carbohydrate), cellulose preparation, granulating agent and tackiness agent.

Well known in the art other easily carrier also comprise the multivalence carrier, for example bacterial capsule polysaccharide, dextran or genetically engineered carrier.In addition, the sustained release preparation that comprises described composition allows to discharge the time that described composition continues prolongation, thereby when not having described sustained release preparation, composition will cause or strengthen result of treatment before from experimenter's System Cleaning, and/or by for example proteolytic enzyme and simple hydrolytic action degraded.

The test kit that comprises Neisseria/AAEAP (SEQ ID NO:25) translocation domain

In yet another aspect, the invention provides contain the test kit of one or more following materials in packing or container: (1) comprises the reagent of the mixture of the Neisseria that is connected with cargo compound or AAEAP (SEQ ID NO:25) transit peptides; (2) contain the reagent of pharmaceutically acceptable adjuvant or vehicle; (3) be used to the instrument used, for example syringe; The explanation of (4) using.Wherein in identical container, exist two or more embodiment of part (1)-(4) also to expect.In other embodiments, described test kit part can comprise the reagent that comprises Neisseria or AAEAP (SEQ ID NO:25) transit peptides, and the independently reagent that comprises described cargo compound.In other embodiments, described test kit comprises the reagent that comprises Neisseria or AAEAP (SEQ ID NO:25) transit peptides, and does not comprise the reagent that comprises described cargo compound.In other embodiments, described reagent is used for intravenously by preparation to be used, and/or the instrument of using is suitable for intravenously and uses.In some embodiments, described test kit can comprise cupredoxin derived transit peptides, particularly the Pseudomonas aeruginosa azurin.In other embodiments, described test kit can comprise the reagent that is used for cargo compound is connected to Neisseria/AAEAP transit peptides or cupredoxin derived transit peptides.

When test kit was provided, the heterogeneity of composition can be packaged in the container separately, mixes immediately before use.The separately packing of this composition can allow prolonged preservation and the function of non-loss of activity composition.

The reagent that comprises in the test kit can provide in the container of any kind, thus the life-span that has kept heterogeneity, and described reagent is not by absorption of the material of container or change.For example, the sealed glass ampoule can contain freeze dried polypeptide or polynucleotide or damping fluid, and it is packed in neutral, non-reactive gas (for example nitrogen).Ampoule can be made of any suitable material, for example glass, organic polymer (for example polycarbonate, polystyrene or the like), pottery, metal or general any other material that adopts of maintenance similar reagents.Other examples of the container that is fit to comprise simple bottle, and it can be by making with the ampoule materials similar, and coating, and it can comprise the inside that paper tinsel is arranged, for example aluminium or alloy.Other containers comprise test tube, bottle, flask, bottle, syringe, or the like.Container also can have aseptic enter hole, for example has the bottle of stopper, and described stopper can be by the subcutaneous injection needle-penetration.Other containers can have two compartments being separated by the film that moves easily, and two of permissions are partially mixed when removing film.Removable film can be glass, plastics, rubber, or the like.

The test kit material that can also furnish an explanation.Specification sheets can be printed on paper or other matrix, and/or for example diskette, CD-ROM, DVD-ROM, Zip dish, record-reproduce head, mrt, flash memory device or the like provide to can be used as the electronically readable medium.Detailed specification sheets can not be physically related with test kit; But, can guide the user to arrive the specified internet website of producer or retail trader of test kit, or provide as e-mail.

More complete understanding of the present invention can be by obtaining with reference to following specific embodiment.Only for illustrative purpose rather than limit the scope of the invention, embodiment has been described.When condition can show suitable or become suitable, the replacement of pro forma change and equivalent was expected.Though adopted specific term at this, this term is intended that descriptive meaning, rather than the purpose in order to limit.Can produce the modification of the present invention and the variation of above elaboration, and not deviate from its spirit and scope, thereby, as specified by subsidiary embodiment, only in addition such restriction.

Embodiment

Embodiment 1.Laz and the H.8-clone and the expression of azurin fusion gene

Gonococcal laz gene is cloned (Figure 1A) according to its known array (SEQ ID NO:1).The Pseudomonas aeruginosa azurin gene (SEQ ID NO:2) that is called paz (Figure 1B) and from the sequence (SEQ ID NO:3) of the H.8 epi-position of gonococcal laz be used in the terminal frame of 5 of paz ' clone with produce H.8-paz (Fig. 1 C) or in the terminal frame of 3 of paz ' clone to produce paz-H.8 (Fig. 1 D), as described below.

Clone and reagent.Human cancer cell, bacterial isolates and plasmid are listed in table 5.Human breast cancer MCF-7 cell and cerebral tumor LN-229 cell are from the stock culture center of the surgical oncology system of Chicago illinois university (UIC).Cell cultures has Eagle ' s salt, is containing 2mM L-glutamine, 0.1mM MEM indispensable amino acid and be added with among the MEM of 10% heat-inactivated fetal bovine serum, 100 units/ml penicillin and 100 μ g/ml Streptomycin sulphates.All cells at 37 ℃ at 5% CO ₂In cultivate.(Yamada，et?al.，Proc.Natl.Acad.Sci.USA?99：14098-14103(2002)；Punj，et?al.，Oncogene?23：2367-2378(2004)).

Table 5. cancer cells, bacterial isolates and genetic constructs

^*Ap, penbritin; Km, kantlex; GST, glutathione-S-transferase.

The clone and the overexpression of azurin gene described in the clone of paz and laz gene and expression.(Yamada, et al., Proc.Natl.Acad.Sci.USA 99:14098-14103 (2002); Punj, et al., Oncogene 23:2367-2378 (2004)) use gonococcus bacterial strain F62 by PCR genomic dna as the template DNA gonococcal Laz encoding gene (laz) that increases.Forward that uses and reverse primer be 5 '-CCG GAATTCCGGCAGGGATGTTGTAAATATCCG-3 ' (SEQ ID NO:4) and 5 '-GG GGTACCGCCGTGGCAGGCATACAGCATTTCAATCGG-3 ' (SEQ ID NO:5), wherein EcoRI that introduces in addition and KpnI restriction site line out below respectively.1.0kb the dna fragmentation of amplification with EcoRI and KpnI digestion, is inserted into pUC18 carrier (Yanisch-Perron, et al., Gene 33:103-119 (1985)) in the corresponding site, make the laz gene be positioned at the downstream of lac promotor, produce expression plasmid pUC18-laz (table 5, Fig. 1).

With pUC19-paz and pUC18-laz as template by PCR construction expression gonococcus Laz H.8 with the plasmid of azurin (Paz) fusions of Pseudomonas aeruginosa.For fusions H.8-Paz, use pUC18-paz as template and following primer amplification 3.1kb fragment,

5 '-(phosphorylation) GGCAGCAGGGGCTTCGGCAGCATCTGC-3* (SEQID NO:6) and 5 '-CTGCA GGTCGACTCTAGAGGATCCCG-3 ' (SEQ ID NO:7) wherein lines out below the SalI site.The 0.4kb fragment of pcr amplification obtains from pUC19-paz and the following primer as template,

5 '-(phosphorylation) GCCGAGTGCTCGGTGGACATCCAGG-3 ' (SEQ IDNO:8) and 5 '-TA CTCGAGTCACTTCAGGGTCAGGGTG-3 ' (SEQ ID NO:9) wherein lines out below the XhoI site.Will from the PCR fragment of the SaiI of pUC18-laz digestion and from the PCR fragment cloning of the XhoI digestion of pUC19-paz with produce expression plasmid pUC18-H.8-paz (table 5, Fig. 1).

For the Paz-H.8 fusions, use pUC19-paz as template and following primer amplification 3.3kb fragment, 5 '-CTTCAGGGTCAGGGTGCCCTTCATC-3 ' (SEQ ID NO:10) and 5 '-CTGCAGGTCGACTCTAGA GGATCCCG-3 ' (SEQ ID NO:11) wherein lines out below the BamHI site.Use pUC18-laz as template and following primer amplification 0.13kb fragment, 5 '-(phosphorylation) TGCTCTCAAGAACCTGCCGCGCCTGC-3 ' (SEQID NO:12) and 5 '-TA GGATCCTTAGGCAGCAGGGGCTTCGGCAGCATCTGC-3 ' (SEQ ID NO:13) wherein lines out below the BamHI site, in addition the TTA of Yin Ruing, be italic corresponding to the bacterial gene terminator codon.With the PCR fragment cloning of two BamHI digestion to produce expression plasmid pUC19-paz-H.8 (table 5).

E.coliJM109 is used as host strain, is used for azurin and its derivative expression of gene.Reorganization E.coli strain culturing is containing 100 μ g/ml penbritins, 0.1mM IPTG and 0.5mMCUSO ₄2 * YT substratum in, cultivate 16h at 37 ℃ and produce azurin.

Merge the proteic plasmid construction of GST.Glutathione S-transferase (GST) encoding gene uses pGEX-5X-3, and (GE Healthcare Bio-Sciences Corp., Piscataway NJ) passes through pcr amplification as template DNA.Forward that uses and reverse primer be 5 '-CG AGCTCATGTCCCCTATACTAGGTTATTGG-3 ' (SEQ ID NO:14) and 5 '-CCC AAGCTTTCAGGGGATCCCACGACCTTCGATCAGATCC-3 ' (SEQ ID NO:15), wherein respectively, the restriction site SacI of Yin Ruing and lining out below the HindIII in addition, the TCA of Yin Ruing in addition, corresponding bacteria gene terminator codon is an italic.The corresponding site that is inserted into the pET29a carrier with the amplification of DNA fragments of the 1.0kb of SacI and HindIII digestion produces expression plasmid pET29a-gst (table 5).

For H.8-GST merging, the signal peptide of laz and H.8 coding region use pUC18-laz pass through pcr amplification as template DNA.Forward that uses and reverse primer be 5 '-GGAATT CATATGAAAGCTTATCTGGC-3 ' (SEQ ID NO:16) and 5 '-CC GGAATTCGGCAGCAGGGGCTTCGGC-3 ' (SEQ ID NO:17), wherein the restriction site in NdeI that introduces in addition and EcoRI site lines out below respectively.The corresponding site that is inserted into the pET29a-gst carrier with the amplification of DNA fragments of the 0.14kb of NdeI and EcoRI digestion produces expression plasmid pET29a-H.8-gst (table 5).

Merge for GST-H.8, H.8 the coding region uses pUC18-laz to pass through pcr amplification as template DNA.Forward that uses and reverse primer be 5 '-CG GGATCCCCTGCTCTCAAGAACCTGCCGCGCC-3 ' (SEQ ID NO:18) and 5 '-CG GAATTCTTAGGCAGCAGGGGCTTCGGCAGCATCTGC AGG-3 ' (SEQ ID NO:19), the restriction site BamHI that introduces in addition and lining out below the EcoRI wherein, the bacterial gene terminator codon TTA of introducing is an italic.The corresponding site that is inserted into the pGEX-5X-3 carrier with the amplification of DNA fragments of the 0.14kb of BamHI and EcoRI digestion produces pGEX-5X-3-H.8.The GST-H.8 integration region passes through pcr amplification with pGEX-5X-3-H.8 as template DNA then.Forward that uses and reverse primer be 5 '-CG AGCTCATGTCCCCTATACTAGGTTATTGG-3 ' (SEQ ID NO:20) and 5 '-CCG CTCGAGTCAGGCAGCAGGGGCTTCGGCAG-3 ' (SEQ ID NO:21), the restriction site SacI that introduces in addition and lining out below the XhoI site wherein, the bacterial gene terminator codon TCA of introducing is an italic.The corresponding site that is inserted into the pET29a carrier with the amplification of DNA fragments of the 1.1kb of SacI and XhoI digestion produces expression plasmid pET29a-gst-H.8 (table 5).

E.coli BL21 (DE3) is used as host strain, is used for the expression of gst and its fusion derivative.

When under there is the situation of IPTG in the E.coli bacterial strain that carries these plasmids, cultivating, as to the described lysing cell of azurin and purifying protein (Yamada, et al., Proc.Natl.Acad.Sci.USA 99:14098-14103 (2002); Punj, et al., Oncogene 23:2367-2378 (2004); Yamada, et al., Cell.Microbiol.7:1418-1431 (2005)), various azurin derivatives move (Fig. 1 E) at SDS-PAGE as single composition, and the protein (about 17kDa) that contains has H.8 shown irregular migration, as previously noted (Cannon et al., the same; Fisette et al., the same).

Embodiment 2.H.8 strengthens the cytotoxicity of Pseudomonas aeruginosa azurin to spongioblast oncocyte rather than breast cancer cell

Reported that Paz preferentially enters (Yamada to cancer cells, et al., Cell.Microbiol.7:1418-1431 (2005)) and it is in vitro and in vivo to human melanoma (Yamada, et al., Proc.Natl.Acad.Sci.USA 99:14098-14103 (2002)) and mammary cancer (Punj, et al., Oncogene 23:2367-2378 (2004)) cytotoxicity.Yet known Paz or Laz are to cerebral tumor such as not influence of glioblastoma.This studied Paz, Laz, H.8-Paz (H.8 epi-position is at the N-of Paz end) and Paz-H.8 (H.8 epi-position is at the C-of Paz end) be to the influence of glioblastoma (LN-229 clone) and mammary cancer (MCF-7 clone) cell.

Proteinic preparation.The azurin of Pseudomonas aeruginosa (Paz), gonococcal Laz, Paz-H.8 and H.8-Paz carry out purifying as previously described.(Yamada, et al., Proc.Natl.Acad.Sci.USA 99:14098-14103 (2002); Punj, et al., Oncogene23:2367-2378 (2004); Yamada, et al., Cell.Microbiol.7:1418-1431 (2005)) all reorganization GST fusions derivative such as former description carry out purifying.(Yamada, et al., Cell.Microbiol.7:1418-1431 (2005)) buys 39 amino acid whose H.8 peptides of chemosynthesis.

Cytotoxicity analysis.Carry out the analysis of 3-(4,5-dimethylthiazole-2-base-2,5-phenylbenzene) tetrazolium bromide (MTT) and come definite cytotoxicity cancer cells.At 37 ℃, 5% CO ₂With cell (every hole 5 * 10 ³Individual) be inoculated in the 96 hole culture dish of 100:1 substratum.Spend the night after the incubation, remove supernatant liquor, the proteinic fresh culture that contains specified various concentration is added in the cell that adheres to.These cells are by the specified various times of incubation, add 10 μ l 5mg/mlMTT (Sigma-Aldrich, St.Louis MO) solution and analyze the quantity of measuring viable cell by MTT 37 ℃ of incubations 2 hours to culture afterwards.Stop the MTT reaction by the 40mM HCl that adds in the 100 μ l Virahols.Measure the MTT first moon of formation for (J.Immunol.Methods 65:55-63 (1983)) according to the method spectrophotometric ground that Mosmann describes.

Synthetic H.8 peptide has considerably less cytotoxicity to glioblastoma LN-229 (Fig. 2 A) or mammary cancer MCF-7 (Fig. 2 B) cell.In glioblastoma (Fig. 2 A) rather than in mammary cancer (Fig. 2 B) cell, the influence of azurin (Paz) is a dose-dependently, though very low, along with azurin concentration is brought up to the raising of 40 μ M cytotoxicities from 10 μ M.The cytotoxicity that improves only surpasses the 6h incubation period more or less.The most significant be Paz, Paz-H.8, H.8-Paz with Laz difference aspect the cytotoxicity in glioblastoma and breast cancer cell.Though in the MCF-7 cell for different incubation time Paz, Paz-H.8, H.8-Paz have substantially the same cytotoxicity (Fig. 2 B) at all dosage with Laz, H.8-Paz or the much lower cytotoxicity of Laz have than Paz-H.8, for spongioblast oncocyte Paz, particularly in short incubation period (6h).Though thereby H.8 part itself lacks cytotoxicity, has seemed to strengthen the cytotoxicity of Paz, only at glioblastoma and not at breast cancer cell.

The H.8 epi-position that exists among embodiment 3.Paz or the Laz promotes the picked-up of azurin in the spongioblast oncocyte

Compare Paz-H.8 with Paz, H.8-Paz with Laz the enhanced cell toxicity of spongioblast oncocyte proposed problem, H.8 whether part promotes the picked-up of azurin in the spongioblast oncocyte in some way.Alexa

The red fluorescent protein of 568 marks (Invitrogen-MolecularProbes Corp., Carlsbad CA) is used to measure glioblastoma and inner these the proteic internalizations of breast cancer cell.This technology before had been used to represent internalization (Punj, et al., the Oncogene 23:2367-2378 (2004) of azurin in the MCF-7 cell; Yamada, et al., Cell.Microbiol.7:1418-1431 (2005)).

Confocal microscopy.In order to prepare microscopic sample, at 37 ℃ at 5% CO ₂Down with cell overnight incubation on cover glass.The 37 ℃ of fresh cultures of pre-temperature and the (Alexa of red fluorescence mark 568) azurin or GST merge the derivative mixing, with the specified time of cell incubation.Use the PBS washed cell, fix 5 minutes with methyl alcohol at-20 ℃.With PBS washing three times and add and contain 1.5mg/ml and be used for 4 of nuclear staining, 6-diamidino-2-phenylindone (DAPI) Vector Laboratories, Burlingame CA) afterwards, gather image by using Carl Zeiss LSM510 laser scanning confocal microscope.(Yamada，et?al.，Cell.Microbiol.7：1418-1431(2005))

With Paz-H.8, H.8-Paz compare with Laz, azurin (Paz) by internalization, has shown that Paz enters the barrier of glioblastoma LN-229 cell (Fig. 3 A and 4A) with the effectiveness that reduces.By contrast, as the Paz in mammary cancer MCF-7 cell of previous report by internalization effectively, with Paz-H.8, H.8-Paz or Laz compare and have equal or slightly high effectiveness (Fig. 3 B and 4B).(Punj, etal., Oncogene 23:2367-2378 (2004); Yamada, et al., Cell.Microbiol.7:1418-1431 (2005)) dose-dependently that Laz enters in the LN-229 cell has represented the optimum concn (Fig. 3 C and 4C) at 37 ℃ of about 16 μ M during 30 minutes incubation period, is higher than this concentration and will further strengthen (data not shown).Under 10 μ M concentration, though in about 10 to 20 minutes most of Laz in the LN-229 cell by internalization (Fig. 3 D and 4D), the internalization of Paz is minimum (accompanying drawing 3E) under this condition, shows that the Paz internalization is born poor efficiency in the LN-229 cell.Similar but form correlated Paz-H.8 and remarkable internalization H.8-Paz (Fig. 3 A and 4A) with Paz and shown the H.8 relative position of part with Laz in the LN-229 cell, at the terminal still C-end of the N-of Paz, do not influence the ability that it promotes Paz part internalization in the spongioblast oncocyte.

Embodiment 4.H.8 partly promotes to enter in glioblastoma rather than the Paz in breast cancer cell

In order to determine that whether epi-position H.8 becomes the part of Paz as the needs among the Laz, or can it work separately and promote Paz to enter the spongioblast oncocyte, used various H.8 fusion roteins except independent H.8.Because little peptide (as 39 amino acid whose synthetic H.8 parts) has low stability in solution, we made up with H.8 the part glutathione S-transferase (GST) fusions, be similar to Paz-H.8 or H.8-Paz, make H.8 to be integrated into the N-end (H.8-GST) of GST or the C-end (GST-H.8) of GST.The structure of GST fusogenic peptide has been described in embodiment 1.Rubescent look fluorescence in conjunction with Alexa

568 Paz and unlabelled synthetic H.8 peptide, GST, GST-H.8 and H.8-GST fusion rotein carry out incubation individually, and with phosphate buffered saline (PBS) (PBS) incubation in contrast, in the LN-229 cell, measure the internalization of 20 μ M Paz mixtures after 30 minutes at 37 ℃ of incubations.Compare with PBS (Fig. 5 E), GST (Fig. 5 B) or GST-H.8 (Fig. 5 C), when importing with Paz individually, synthetic H.8 peptide has strengthened Paz internalization (Fig. 5 A) really.The quantitative demonstration of fluorescence H.8 peptide promotes Paz to enter to reach 2.1 times.Yet existence H.8-GST strengthens the internalization (Fig. 5 D) of (above 3 times) Paz significantly.On the other hand, GST-H.8 has only shown slight promotion (Fig. 5 C).Paz itself (Fig. 5 E) only lentamente enters the spongioblast oncocyte, shows entering by H.8 mediation in brain tumor cell.The independent spongioblast oncocyte (Fig. 3 A) that H.8 do not enter, but it promotes the ability (Fig. 5 A) of the internalization of Paz to reflect that its promotes the ability that protein enters brain tumor cell.

Embodiment 5. Paz enhanced internalization in the spongioblast oncocyte under situation about existing has H.8-GST caused cytotoxicity higher in this cell.

We under the situation that has or do not exist 20 μ M Paz with LN-229 cell incubation synthetic H.8 peptide, GST, GST-H.8 and albumen (each 20 μ M) 24h H.8-GST, the spongioblast oncocyte of living by the MTT analysis to measure behind 24h is measured Cytotoxic degree then.Lacking under the situation of Paz, H.8 peptide, GST or gst fusion protein all do not represent any significant cytotoxicity (Fig. 5 F ,-Paz).Under the situation that has 20 μ M Paz, itself has represented low cytotoxicity (Fig. 5 F under the situation that has peptide H.8 or PBS, + Paz), only under situation about existing H.8-GST, observe sizable cytotoxicity and strengthen (Fig. 5 F, + Paz), and GST itself or GST-H.8 shown really certain cytotoxicity strengthen (Fig. 5 F ,+Paz).Combine, these data show to be used as for proteinic part or when having protein (as Paz), and H.8 part promotes the transhipment of Paz in these cells, produces enhanced cell toxicity.

Passing through to allow of BBB of embodiment 6.H.8 mediation enters brain

H.8 epi-position allows that the ability (Fig. 3 A, 4A and 5D) of fusion rotein in the glioblastoma LN-229 cell or independent proteinic enhanced internalization has proposed problem: H.8 whether promote passing through and allowing these albumen is transferred to the brain venule from peripheral circulation of BBB as the part of H.8-Paz N-end or Laz.

Analysis is used under the condition of producer's suggestion

800CW (LI-CORBiosciences, Lincoln, Nebraska) all albumen of mark.Will with

The Paz of 800CW bonded 500 μ g, H.8-Paz with the Laz peritoneal injection in nude mice.Behind the 24h, put to death mouse, take out brain, and use LI-COR Infrared imaging system (84 μ m resolving power, 1mm side-play amount) detects the brain imaging.Flatly cut the mouse brain then, gather the detection that midbrain exterior lateral area image is used for the albumen existence of mark.

Quantitative the passing through of the quantitative fluorescence of the fluorescence of azurin used

Following measurement: the Lasso Tool by Photoshop selects a cell, obtains mean value from the red histogram of menu image.To at least three different cells of a sample measurement, base of calculation is poor.To use Infrared dyes

500 μ gPaz of 800CW (LI-COR Bioscience) mark, H.8-Paz with Laz albumen peritoneal injection in the nude mice that lives.Behind the 24h, put to death mouse, separate brain, and use LI-COR

Infrared imaging system is gathered image.Enter the brain venule slightly though find Paz, much more Laz and particularly H.8-Paz (above 4 times) under this condition, in brain, detect (Fig. 6), show that H.8 epi-position allows that fusion rotein enters the clearly effect of brain.

Embodiment 7. is when being present in the N-end, and H.8 epi-position allows that the bacterium surface of peripherin presents.

Whether facilitate its surface to present in order to study the terminal location of the N-in Laz of epi-position H.8, terminal and C-end (Fig. 5) and Paz (Fig. 2 and Fig. 3 A/B and 4A/B) have made up and have H.8 merged derivative as the N-at GST that describes among the embodiment 1.

The E.coli bacterial strain JM109 that the proteinic location that the surface exposes among the E.coli is carried the E.coli bacterial strain BL21 (DE3) of pET29a-gst, pET29a-H.8-gst or pET29a-gst-H.8 and carried pUC19-paz, pUC19-paz-H.8, pUC18-H.8-paz or pUC18-laz cultivates with 0.4mM isopropyl-(IPTG) at 37 ℃.Centrifugal one milliliter every kind these bacterial culturess are collected the bacterial mass that produces.With after the PBS washed twice, add and contain at the anti-GST antibody (1:2000) of GST derivative or at 1mL 1% FBS-PBS of the anti-azurin antibody (1:500) of azurin derivative.Cell suspension is hatched 1h on ice, use the PBS washed twice then.Apply at the GST derivative in conjunction with the anti-rabbit igg of FITC or at the anti-rabbit antibody in conjunction with FITC of azurin derivative, and hatched 30 minutes on ice.In order to remove unconjugated antibody,, fix with ethanol on ice with PBS washed cell twice.Under confocal microscope, observe the E.coli sample of handling with DAPI then.

Purifying is fusion rotein (Fig. 1 E and Fig. 7 A) H.8.Two kinds of the terminal and C-end of GST and the N-H.8 cellular localizations of fusions (H.8-GST and GST-H.8) in Fig. 7 B, have been shown.When using anti-GST antibody to detect by the Western trace, all three kinds of albumen overexpression in E.coli, and be present in the full cell pyrolysis liquid of E.coli (Fig. 7 B).When separating the pericentral siphon part and when checking three kinds of proteinic existence from E.coli, GST and GST-H.8 albumen are detected (Fig. 7 B with significant amount, the swimming lane 1 and 3 of pericentral siphon under partly), but only a spot of H.8-GST (Fig. 7 B, pericentral siphon partly under swimming lane 2) can detect in this pericentral siphon part.

For check remaining H.8-GST fusion rotein whether may be transported to the surface of E.coli cell, cultivate and three kinds of proteinic cells of results overexpression, washing comes the GST that exposes in conjunction with any surface with anti-GST antibody treatment, washs and use secondary antibody processing in conjunction with FITC once more.Expose if GST is the surface, anti-GST antibody will combine with them, and it can detect by the secondary antibody in conjunction with FITC then.In fact, (Fig. 7 C, H.8-GST), surface H.8 epi-position has promoted its transporte to cells surface in the existence of the N-of GST end only to carry the green fluorescence that H.8-GST E.coli cell shown that FITC produces.The H.8 part of the C-of GST end exist (GST-H.8) and GST itself main still be pericentral siphon with born of the same parents in, present (Fig. 7 C, GST and GST-H.8) without any the surface.

Use aforesaid constructed, we have determined that Paz and Paz-H.8 still are (Fig. 7 D in the born of the same parents, Paz and Paz-H.8), and H.8-Paz shown all that with Laz the surface presents, determined H.8 existence at the N-end, may need the free halfcystine to be used for lipidization, it is important arriving the surface for fusion rotein by the adventitia transhipment.

Embodiment 8. suffers from the patient's of cancer treatment

In suffering from the patient of cancer, carried out the H.8-Paz I/II clinical trial phase of fusions (research medicine).Especially, be azurin (paz) from the H.8 structural domain of gonococcal Laz encoding gene (laz) and cargo compound from Pseudomonas aeruginosa, produced fusion rotein " H.8-paz ".This fusion rotein will be as making up of describing among the embodiment 1.

Suffer from the brain cancer that confirms on the histology, after the abundant treatment of chemotherapeutic agent by current available FDA approval and therapy, represented clinical and four ten nine adult patients of radiation, will be incorporated into the open advanced research of using described research medicine according to imaging progress or recurrence.Enroll research for qualified, all patients have represented the gross tumor volume measured that improves after the chemotherapy of approval is finished the course of treatment.The evidence that the continuation of persistent transitivity deposition and/or size or volume increases must be organized with learning to be determined.This histology evidence can obtain by fine needle aspiration (FNA) biopsy.

From all patients according to the informed consent of the institutional review board of Chicago illinois university and FDA after with the begin treatment program.The patient does not have concurrent disease, for example other malignant tumours, previous malignant tumour history, blood dyscrasia, insulin-dependent diabetes mellitus or other serious cardiovascular disordeies, and it may disturb the convenient assessment of the effect of recommending treatment.The baseline blood work (complete blood count [CBC] and serum chemistry) that comprises Liver Function (LFT) will be carried out before the treatment beginning.All titular patients must not accept any cancer chemotherapy simultaneously at duration of test.

Goods by the pharmaceutically acceptable research medicine of intravenous injection every day come 12 weeks of study drug-administration, observe any dose limitation toxicity of experimenter.With 7 dosage levels that began in 10mg/kg/ days, increase 5mg/kg/ days up to 50mg/kg/ days maximal dose.The effectiveness of each dosage level will be in suffering from 7 patients that can measure cancer late period (advanced) record.

Can measure tumour by (a and b) measurement on 2 dimensions and come response estimator.1) whole disappearances of target tumor will be considered to complete reaction (CR); 2) 75% reduction will be considered to fabulous partial reaction (PR); And 3) sound response (PR) will be to handle back size minimizing to reach 50%.4) size last 25% reduction is considered to stable disease (SD), and 5)＜25% will be considered to reactionless (NR).The patient who has represented progression of disease will stop their treatment, but will follow the tracks of 12 extra weeks.

Whole disappearances of target tumor and any minimizing on the size will show that H.8-the azurin treatment is effective for the treatment cancer.H.8-azurin treatment effectively other indexs are decrements that new cerebral tumor occurs, with the minimizing of the vasculogenesis disease relevant with tumour.

The various modifications of the example of description of the invention and system and change are conspicuous for those skilled in the art, and do not deviate from scope and spirit of the present invention.Though described the present invention, should be understood that the present invention who asks for protection should excessively not be confined to these specific implementations in conjunction with embodiment.In fact, for those skilled in the relevant art significantly, be used to carry out the various modifications of the pattern of description of the invention, be intended within the scope of following claims.

Claims (44)

1. isolating transit peptides, it is Laz, Lip from Neisseria or variant, derivative or the structural equivalents of Pan 1, and it promotes the molecule that connects to enter Mammals brain cancer cells or pass through hemato encephalic barrier.

2. the transit peptides of claim 1, the H.8 zone (SEQ ID NO:24) of itself and Laz has at least 90% amino acid identity.

3. the transit peptides of claim 1, wherein said peptide is SEQ ID NO:24.

4. the transit peptides of claim 1, wherein said transit peptides are modified to prolong or to optimize the transformation period of described peptide in blood flow.

5. the transit peptides of an inclusion region, described zone not exclusively or is fully repeated to form by at least 4 of Ala-Ala-Glu-Ala-Pro (SEQID NO:25), and AAEAP (the SEQ ID NO:25) pentapeptide that each total length of described transit peptides has at least about 50% repeats.

6. the transit peptides of claim 5, wherein said repeat region has the identity at least about 90% with Ala-Ala-Glu-Ala-Pro (SEQ ID NO:25) the multiple peptide that comprises equal amts.

7. the transit peptides of claim 5, it is a synthetic.

8. the transit peptides of claim 5, wherein said transit peptides are modified to prolong or to optimize the transformation period of described peptide in blood flow.

9. mixture, it comprises at least a cargo compound and a kind of transit peptides, and wherein said transit peptides is the peptide of claim 5, and described transit peptides is connected with described cargo compound.

10. mixture, it comprises at least a cargo compound and a kind of transit peptides, and wherein said transit peptides is the peptide of claim 1, and described transit peptides is connected with described cargo compound.

11. the mixture of claim 10, wherein said cargo compound is a cupredoxin, and described cupredoxin is selected from azurin, plastocyanin, iron sulphur bacterium azurin, false azurin, green element and the azurin sample albumen of subduing of orange.

12. the mixture of claim 11, wherein said cargo compound are the azurins from Pseudomonas aeruginosa (Pseudomonas aeruginosa).

13. the mixture of claim 10, wherein said mixture are modified to prolong or to optimize the transformation period of described peptide in blood flow.

14. the mixture of claim 10, it comprises cupredoxin derived transit peptides in addition.

15. the mixture of claim 10, wherein said cargo compound be selected from protein, lipoprotein, polysaccharide, nucleic acid, dyestuff, particulate, receive grain, toxin and medicine.

16. the mixture of claim 10, wherein said cargo compound is a protein, and described transit peptides is connected with described cargo compound to form fusion rotein.

17. the mixture of claim 15, wherein said cargo compound is a toxin.

18. the mixture of claim 10; wherein said cargo compound is the therapeutical agent that is used for treatment of diseases, described disease be selected from dysthymia disorders, affective disorder, chronic pain, epilepsy, alzheimer's disease, apoplexy/neuroprotective, brain and Spinal injury, brain cancer, brain HIV infection, the ataxic imbalance of various generation, amyotrophic lateral sclerosis (ALS), Huntington Chorea, influence children's congenital heredity mistake, Parkinson's disease and/or the multiple sclerosis of brain.

19. the mixture of claim 10, wherein said cargo compound are detectable materials.

20. the mixture of claim 19, wherein said detectable material can detect by being selected from fluorometric assay, microscopy, X ray CT, MRI and ultransonic method.

21. a pharmaceutical composition, it comprises the mixture of the claim 10 in the carrier that pharmaceutically is fit to.

22. the pharmaceutical composition of claim 21, wherein said pharmaceutically acceptable carrier is suitable for intravenously and uses.

23. the pharmaceutical composition of claim 21, wherein said pharmaceutically acceptable carrier are suitable in the tricorn or intracerebral injection.

24. a method comprises the mixture exposing cell with claim 10.

25. the method for claim 24, wherein said cell is from the tumour of central nervous system.

26. the method for claim 24, wherein said cell is a cancer cells, and described cancer is selected from astrocytoma, glioblastoma, meningioma, oligodendroglioma, prominent astrocytoma, glioma, ependymoma, tumor of spinal cord, ganglioglioma, neurocytoma and medulloblastoma less.

27. a treatment suffers from the patient's of cancer method, comprises the mixture to the claim 10 of described patient's administering therapeutic significant quantity.

28. the method for claim 27, wherein said mixture is used in the mode that is selected from intravenously, body surface, subcutaneous, intramuscular and enters tumour.

29. the method for claim 27 further comprises and uses another kind of cancer therapy jointly.

30. one kind is used for the patient imaged method for cancer, comprises mixture from claim 19 to described patient that use, and detects the position of described cargo compound in described patient.

31. the method for claim 30, wherein said cargo compound is an x-ray contrast agent, and the position of described cargo compound is detected by X ray CT.

32. the method for claim 30, wherein said cargo compound is a magnetic resonance imaging contrast, and the position of described cargo compound is detected by MRI.

33. the method for claim 30, wherein said cargo compound is an acoustic contrast agent, and the position of described cargo compound is detected by ultra sonic imaging.

34. the method for a diagnosing cancer comprises the mixture exposing cell with claim 19, and detects the cell position of described cargo molecule.

35. a test kit comprises reagent, described pack contains right and requires 1 transit peptides.

36. the test kit of claim 35 further comprises reagent, described pack contains pharmaceutically acceptable carrier.

37. the test kit of claim 35 further comprises the instrument that is used to use described reagent.

38. a nucleic acid molecule, the transit peptides of its coding claim 1.

39. a nucleic acid molecule, the transit peptides of its coding claim 5.

40. a nucleic acid molecule, the mixture of its coding claim 10.

41. the method for the treatment of or diagnosing the patient who suffers from the brain relative disease comprises transit peptides and at least a cargo compound of using claim 1 to described patient jointly.

42. the method for claim 41 is wherein used cupredoxin derived transit peptides in addition jointly.

43. the method for the treatment of or diagnosing the patient who suffers from the brain relative disease comprises transit peptides and at least a cargo compound of using claim 5 to described patient jointly.

44. the method for claim 43 is wherein used cupredoxin derived transit peptides in addition jointly.

Images