CN101481734A - Method for identifying single nucleotide polymorphism loci proportion - Google Patents
Method for identifying single nucleotide polymorphism loci proportion Download PDFInfo
- Publication number
- CN101481734A CN101481734A CNA2009100290573A CN200910029057A CN101481734A CN 101481734 A CN101481734 A CN 101481734A CN A2009100290573 A CNA2009100290573 A CN A2009100290573A CN 200910029057 A CN200910029057 A CN 200910029057A CN 101481734 A CN101481734 A CN 101481734A
- Authority
- CN
- China
- Prior art keywords
- single nucleotide
- nucleotide polymorphism
- snp
- loci
- proportion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a method of identifying SNP allelic site form and proportion. When two bases of the SNP allelic site are amplified at PCR, upstream and downstream primers are designed. On one hand, a 'molecular switch' mechanism is used, sulfur is adopted for the modification during the design and the detection of the SNP primers, and high-fidelity enzyme is combined to ensure the amplification specificities of the two bases to lay a foundation for the further detection; on the other hand, different fluorescent groups are respectively used for modifying the two primers, and a common fluorescence spectrophotometer photometer is creatively adopted for identifying the single nucleotide polymorphism allelic site form and proportion. The method has the advantages of low price, convenient operation and stable result, can be applied to common scientific research units and clinical hospitals and has larger popularization value and application prospect.
Description
Technical field
The present invention relates to a kind of method of identifying single nucleotide polymorphism loci proportion, relate in particular to a kind of method of identifying known SNP loci proportion.
Background technology
Single nucleotide polymorphism (Single Nucleotide Polymorphism is called for short SNP) mainly is meant on genomic level by the caused dna sequence polymorphism of the variation of single Nucleotide.It is modal a kind of in human heritable variation, accounts for more than 90% of all known polymorphisms.SNP extensively exists in human genome, just has 1 in average per 500～1000 base pairs, estimates that its sum can reach 3,000,000 even more.
The polymorphism that SNP showed only relates to the variation of single base, this variation can be caused by the conversion (transition) or the transversion (transversion) of single base, also can be by due to the insertion of base or the disappearance, but usually said SNP does not comprise back two kinds of situations.
Theoretically, SNP both may be two equipotential polymorphisms, also may be 3 or 4 equipotential polymorphisms, but in fact, both are very rare in the back, almost can ignore, and therefore, usually said SNP is two equipotential polymorphisms.This variation may be conversion, also may be transversion, and so-called conversion is meant the conversion between the homotype base, as (G → A), pyrimidine and the pyrimidine (replacement between T → C) of purine and purine; So-called transversion is meant and occurs in (the replacement between A → T, A → C, C → G, the G → T) of purine and pyrimidine.
People have carried out many explorations and improvement to the research method of SNP.The snp analysis technology mainly is divided into two big classes by its research object, that is:
(1) unknown SNP is analyzed, promptly look for the relation of unknown SNP or definite a certain unknown SNP and certain disease.Detecting unknown SNP has many kinds of methods to use, high performance liquid chromatography as temperature gradient gel elec-trophoresis (TGGE) (TGGE), denaturing gradient gel electrophoresis (DGGE), single strand conformation polymorphism (SSCP), sex change detects (DHPLC), restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), and the dna direct order-checking etc.
(2) known SNP is analyzed, promptly the base form to known SNP among the Different Individual DNA directly detects with the relation of discussion with disease.The method that detects known SNP has the allele specific oligonucleotide fragment to analyze (AS0), sudden change mispairing amplification check (MAMA), biochip technology (gene chips) etc.
Along with the Human Genome Project enforcement, many species have also been carried out genomic examining order, and have set up the mass data storehouse, relatively these sequences from different experiments chamber Different Individual just can be found SNP.At present, can mainly comprise for the open SNP internet resource that utilizes:
(1) by NIH (National Institutes of Health, what NIH) provide mainly is the candidate SNP database relevant with cancer and tumour: http://cgap.nci.nih.gov/GAI;
(2) the dbSNP polymorphism data of opening up by NIH that is suitable for biomedical research: http://www.ncbi.nlm.nih.gov/SNP;
(3) the human snp database that provides of De Guo HGBAS website: http://hgbas.Cgr.ki.sei etc.In addition, Japan has set up J STSNP database: http://snp.Ims.utolkyo.ac.jp; China has also started " 863 " plan at the bottom of calendar year 2001, carry out the structure and the research of the genome SNP of Chinese nation system directory.
The investigator can select own interested SNP from various snp databases, adopt the technology of the known SNP of various sophisticated discriminating that sets up now that base form is wherein made evaluation, no matter more than work still is that clinical detection all is significant to fundamental research.But facing a stubborn problem during SNP detects now is exactly the type that conventional SNP authentication method can be identified loci, but these methods can not identify the proportionlity between the 2 kinds of bases in SNP site mostly.And the proportionlity that identifies between the 2 kinds of bases in SNP site is great to the Research Significance of some disease.
Chromosome abnormalty for example, as trisomy 21, numerical abnormalities of chromosomes such as 18 trisomes are diseases that a class has a strong impact on human health, antenatal they are made diagnosis, particularly adopting the atraumatic means to make diagnosis is the countries in the world questions of common concern.Utilize SNP as genetic marker, can make diagnosis this chromosomoid numerical abnormality disease.What be different from normal individual is: trisomy 21, the ratio of 2 kinds of bases of disease SNP loci such as 18 trisomes is not the relation of 1:1, and may be the relation of 1:2 or 2:1, therefore just relate to the problem of differentiating 2 kinds of base ratios of SNP loci (allelic ratio) in DNA or the RNA sequence.
At an above difficult problem, Pont-Kingdon etc. have reported and have utilized fluorescence labeling probe hybridization to determine that in conjunction with melt curve analysis the method for 2 kinds of relative proportions between the base is (referring to Clin Chem.2003; 49 (7): 1087-94.), reports such as Lo YM adopt the time-of-fight mass spectrometry instrument to determine that the method for 2 kinds of relative proportions between the base is (referring to Nat Med.2007; 13 (2): 218-23.), reports such as Go AT adopt the partially denaturing high performance liquid chromatography to determine that the method for 2 kinds of relative proportions between the base is (referring to Clin Chem.2008; 54 (2): 437-40.).But above method needs expensive equipment, and experiment condition is difficult to control, can't extend to clinical application.
Summary of the invention
The object of the invention provides a kind of method of identifying single nucleotide polymorphism loci proportion, reduces the requirement to equipment, reduces cost, and makes to identify easily realization, is suitable for common R﹠D institution and clinical hospital and uses.
For achieving the above object, the concrete technical scheme of the present invention is that a kind of method of identifying single nucleotide polymorphism loci proportion may further comprise the steps:
(1) extracting DNA that contains SNP or RNA to be measured, if be RNA, is cDNA with the RNA reverse transcription, obtains containing the amplification template of SNP; DNA or RNA can originate various tissues, cell, the body fluid of people and animal and plant;
(2) with the DNA that contains SNP of step (1) gained or cDNA as amplification template, contain 2 kinds of bases in the single nucleotide polymorphism loci, according to the required upstream primer A of a kind of base design amplification wherein, last 1 bit base of 5 ' end of upstream primer A is modified with the 1st fluorophor; According to a kind of required upstream primer B of base design amplification in addition wherein, last 1 bit base of 5 ' end of upstream primer B is modified with the 2nd fluorophor; According to the Position Design downstream primer C of single nucleotide polymorphism loci, downstream primer C is shared; Last 1 bit base of 3 ' end of upstream primer A and upstream primer B is all used sulfur modification;
Adopt 3 ' end base specific polymerase chain reaction to amplify the nucleic acid fragment that contains 2 kinds of bases among the SNP respectively, the enzyme that reacts used is the high-fidelity polysaccharase with 3 '-5 ' excision enzyme proofreading activity, after amplification is finished, remove the free primer that contains fluorescence, obtain containing the amplified production of fluorescence;
Described the 1st fluorophor and the 2nd fluorophor position of excitation peak in spectrum is disconnected from each other;
(3) utilize the spectrophotofluorometer analysis to contain the amplified production of fluorescence, get it right according to the position of fluorescence spectrum excitation peak and intensitometer and answer the ratio of amplified production, thereby judge the SNP loci proportion, judgment rule is as follows:
If only simple spike occurs, illustrate that the SNP site isozygotys at the 1st fluorescence or the 2nd fluorescent exciting spectral position;
If 2 peaks on the 1st fluorescence and the 2nd fluorescent exciting spectral position, occur, and intensity is equal substantially, illustrates that the SNP loci proportion is 1:1;
If 2 peaks occur on the 1st fluorescence and the 2nd fluorescent exciting spectral position, intensity is in a ratio of 1:n or n:1, illustrates that single nucleotide polymorphism loci proportion is 1:n or n:1; N=2,3 or 4 wherein.
In the technique scheme, extract DNA or RNA, with the RNA reverse transcription is cDNA, according to the required upstream primer of 2 bases design amplification of SNP loci and the method for downstream primer, modifies sulphur or fluorophor belongs to technology as well known to those skilled in the art on primer.
In the technique scheme, the position of excitation peak can not be identical in the 1st fluorophor and the 2nd fluorophor spectrum, can be selected from the fluorophor of different colours respectively, as green fluorescence group FAM, JOE etc. and red fluorescence radicals R OX, TAMRA etc., the ratio that can identify loci according to the position and the intensity of fluorescence spectrum excitation peak like this, the 1st fluorophor of the present invention and the 2nd fluorophor are not limited to above green or red fluorescence group.
Because the application of technique scheme, the present invention compared with prior art has following advantage:
The present invention during design upstream and downstream primer, utilizes " molecular switch " mechanism on the one hand in pcr amplification, when design detects the SNP primer, adopt sulfur modification, in conjunction with the high-fidelity enzyme, can guarantee the specificity of 2 kinds of base amplifications, lays a good foundation for further detecting; With different fluorophors 2 kinds of upstream primers have been done modification respectively on the other hand, and creatively adopt common spectrophotofluorometer to identify single nucleotide polymorphism loci form and ratio, cheap, and it is easy and simple to handle, the result is stable, be suitable for common R﹠D institution and clinical hospital and use, have bigger promotional value and application prospect.
Description of drawings
Fig. 1. the fluorescence spectrum figure of embodiment gained amplified production (SNP loci G:G isozygotys);
Fig. 2. the fluorescence spectrum figure of embodiment gained amplified production (SNP loci heterozygosis ratio is 1:1);
Fig. 3. the fluorescence spectrum figure of embodiment gained amplified production (SNP loci heterozygosis ratio is 1:2 or 2:1).
Embodiment
Below in conjunction with drawings and Examples the present invention is further described, but does not limit use range of the present invention:
Below appended embodiment serve as to identify object all with a SNP rs8130833 on the people PLAC4 gene, illustrate that respectively identification of dna and RNA go up the use of SNP, the PLAC4 gene is positioned at karyomit(e) No. 21, is in the key area that mongolism takes place, specifically expressing RNA in placenta tissue.
2 kinds of bases are respectively A and G in the rs8130833 loci, the evaluation of its loci proportion are helped the diagnosis of mongolism.
Embodiment one: identify rs8130833 loci A and G ratio among the amniocyte DNA
(1) amniocyte DNA extraction
Get 1.5ml amniotic fluid sample in Eppendorf tube, centrifugal 5 minutes, remove supernatant liquor, precipitation is washed once with the TE damping fluid.It is resuspended to add 50 μ l lysates (0.1mmol/L NaOH, 2mol/L NaCl) in the cell precipitation, the vibration cracking.100 ℃ were boiled 2 minutes, once more vibration.Removed cell debris in centrifugal 10 minutes, and got 5 μ l supernatant liquors and do gene amplification.
(2) polymerase chain reaction (PCR) amplification comprises the dna fragmentation in SNP site
The amplification of employing single base extension, for guaranteeing the accuracy of amplification, " molecular switch " mechanism of introducing, the upstream primer of amplification A is: 5 ' CACCATTTGGGTTAAATACAAGTTAGAT3 ', the last 1 bit base C of 5 ' end modifies with green fluorescence group FAM, the upstream primer of amplification G is: 5 ' ACCATTTGGGTTAAATACAAGTTAGAC3 ', the last 1 bit base A of 5 ' end modifies with red fluorescence radicals R OX, article 2,3 ' of primer last 1 bit base T and C all use sulfur modification, downstream primer is shared, and sequence is: 5 '-CCATAAAAGCCTGTACATAAGGGATCT-3 '.
The PCR reaction system is: total reaction volume is 25 μ l, include 10 times of reaction buffers, 2.5 μ l, dATP, dGTP, each 200 μ M of dCTP, dTTP, article 2, upstream primer and 1 each 25pmol of downstream primer, sal epsom is 2mM, amniocyte DNA extraction liquid 5 μ l, the high-fidelity DNA polymerase of 0.5 activity unit.Reaction conditions is 95 ℃ of pre-sex change 5 minutes, then 95 ℃ 40 seconds, 60 ℃ 30 seconds, 72 ℃ 30 seconds through 35 cyclic amplifications.
(3) purifying of amplified production
Adopt Shanghai to give birth to the UNIQ-10 pillar PCR product purification test kit purifying amplified production of worker company, remove unnecessary primer etc.
(4) fluorescent spectroscopy
Amplified production with purifying, be diluted with water to 500 μ l, adopt the position and the intensity of the excitation spectrum of the F4500 of Hitachi fluorescent spectrophotometer assay product, the excitation spectrum wavelength of green fluorescence group FAM is 520nm, the excitation spectrum wavelength of red fluorescence radicals R OX is 605nm, the intensity reflects of excitation peak the relation of A and two kinds of amplified production amounts of G.
As shown in Figure 1,1 excitation peak only near 605nm, occurs, show SNP loci G:G isozygoty (in like manner can identify A:A isozygotys);
As shown in Figure 2,2 excitation peaks appear near 520nm and 605nm, and equal highly substantially, show that SNP loci heterozygosis ratio is the relation of 1:1;
As shown in Figure 3, when the height of 2 excitation peaks is 1:2 or 2:1, show that SNP loci heterozygosis ratio is 1:2 or 2:1.
Embodiment two: identify rs8130833 loci A and G ratio among the placenta tissue RNA
(1) placenta tissue RNA extracts and reverse transcription
Get about 100mg fresh human placenta tissue sample, liquid nitrogen exist in mortar, grind down after, adopt Trizol reagent to extract total RNA, add 25ul and contain in the water that tetra-sodium diethyl ester (DEPC) handles, adopt the DNase I of Invitrogen company to remove DNA then and pollute.Adopt Shanghai to give birth to the first chain cDNA synthetic agent box of worker company at last through the synthetic cDNA of reverse transcription reaction.
Following steps are with the step among the embodiment 1 (2), (3), (4).
Claims (3)
1. method of identifying single nucleotide polymorphism loci proportion is characterized in that may further comprise the steps:
(1) preparation contains the amplification template of single nucleotide polymorphism to be measured, contains 2 kinds of bases in the single nucleotide polymorphism loci, and according to a kind of required upstream primer A of base design amplification wherein, last 1 bit base of 5 ' end of upstream primer A is modified with the 1st fluorophor; According to a kind of required upstream primer B of base design amplification in addition wherein, last 1 bit base of 5 ' end of upstream primer B is modified with the 2nd fluorophor; According to the Position Design downstream primer C of single nucleotide polymorphism loci, downstream primer C is shared; Last 1 bit base of 3 ' end of upstream primer A and upstream primer B is all used sulfur modification;
Adopt 3 ' end base specific polymerase chain reaction to amplify the nucleic acid fragment that contains 2 kinds of bases among the SNP respectively, the enzyme that reacts used is the high-fidelity polysaccharase with 3 '-5 ' excision enzyme proofreading activity, after amplification is finished, remove the free primer that contains fluorescence, obtain containing the amplified production of fluorescence;
Described the 1st fluorophor and the 2nd fluorophor position of excitation peak in spectrum is disconnected from each other;
(2) utilize the spectrophotofluorometer analysis to contain the amplified production of fluorescence, according to kind and the ratio that the position and the intensitometer of fluorescence excitation spectrum are got it right and answered amplified production, judge the ratio of single nucleotide polymorphism loci, judgment rule is as follows:
If simple spike occurs at only the 1st fluorescence or the 2nd fluorescent exciting spectral position, illustrate that single nucleotide polymorphism loci isozygotys;
If 2 peaks on the 1st fluorescence and the 2nd fluorescent exciting spectral position, occur, and intensity is equal substantially, illustrates that single nucleotide polymorphism loci proportion is 1:1;
If 2 peaks occur on the 1st fluorescence and the 2nd fluorescent exciting spectral position, the intensity at 2 peaks is in a ratio of 1:n or n:1, illustrates that single nucleotide polymorphism loci proportion is 1:n or n:1; N=2,3 or 4 wherein.
2. the method for evaluation single nucleotide polymorphism loci proportion according to claim 1 is characterized in that:
The method for preparing the amplification template that contains SNP to be measured in the step (1) is: extract the DNA that contains single nucleotide polymorphism to be measured, be the amplification template that contains single nucleotide polymorphism to be measured.
3. the method for evaluation single nucleotide polymorphism loci proportion according to claim 1 is characterized in that:
The method for preparing the amplification template that contains SNP to be measured in the step (1) is: extracting the RNA that contains single nucleotide polymorphism to be measured, is cDNA through reverse transcription, is the amplification template that contains single nucleotide polymorphism to be measured.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100290573A CN101481734A (en) | 2009-01-16 | 2009-01-16 | Method for identifying single nucleotide polymorphism loci proportion |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100290573A CN101481734A (en) | 2009-01-16 | 2009-01-16 | Method for identifying single nucleotide polymorphism loci proportion |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101481734A true CN101481734A (en) | 2009-07-15 |
Family
ID=40879024
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2009100290573A Pending CN101481734A (en) | 2009-01-16 | 2009-01-16 | Method for identifying single nucleotide polymorphism loci proportion |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101481734A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103403530A (en) * | 2011-03-01 | 2013-11-20 | 特瑞恩股份有限公司 | DNA and/or RNA determination from UV-VIS spectrophotometer data |
| CN103911445A (en) * | 2014-03-20 | 2014-07-09 | 刘小芳 | AS-PCR primer design method, gene polymorphism detection method and kit |
-
2009
- 2009-01-16 CN CNA2009100290573A patent/CN101481734A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103403530A (en) * | 2011-03-01 | 2013-11-20 | 特瑞恩股份有限公司 | DNA and/or RNA determination from UV-VIS spectrophotometer data |
| CN103403530B (en) * | 2011-03-01 | 2016-01-13 | 特瑞恩股份有限公司 | Carry out DNA and/or RNA from UV-VIS spectrophotometric data to determine |
| CN103911445A (en) * | 2014-03-20 | 2014-07-09 | 刘小芳 | AS-PCR primer design method, gene polymorphism detection method and kit |
| CN103911445B (en) * | 2014-03-20 | 2015-08-12 | 上海科亦生物科技有限公司 | A kind of AS-PCR primer design method, gene pleiomorphism detecting method and test kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200255892A1 (en) | Multiplex y-str analysis | |
| EP2551356B1 (en) | Method for detecting target base sequence using competitive primer | |
| US8999644B2 (en) | Method for detecting the presence of a DNA minor contributor in a DNA mixture | |
| EP1686190A1 (en) | Methods of genotyping using differences in melting temperature | |
| Miller et al. | High-density single-nucleotide polymorphism maps of the human genome | |
| US11542556B2 (en) | Single nucleotide polymorphism in HLA-B*15:02 and use thereof | |
| US20160258001A1 (en) | Kits and Reaction Mixtures for Analyzing Single-Stranded Nucleic Acid Sequences | |
| CA2695264A1 (en) | Enrichment of a target sequence | |
| US9574227B2 (en) | Method for detecting variation of gene for non-diagnostic purpose based on fluorescence quenching and probe thereof | |
| JP2011507488A (en) | Oligonucleotides and uses thereof | |
| CN104293920A (en) | Kit for quickly detecting polymorphism of human VKORC1 and CYP2CP genes and using method of kit | |
| US20190271026A1 (en) | Compositions, methods, and kits for detecting and identifying mycobacteria | |
| Trama et al. | Detection and identification of Candida species associated with Candida vaginitis by real-time PCR and pyrosequencing | |
| US20080076130A1 (en) | Molecular haplotyping of genomic dna | |
| CN104830852A (en) | Multiplex real-time fluorescent PCR (polymerase chain reaction) method for detecting HLA-B*15:02 alleles | |
| EP2821503B1 (en) | Method for detecting hla-a*31:01 allele | |
| US10907203B1 (en) | DNA methylation assays for body fluid identification | |
| CN101481734A (en) | Method for identifying single nucleotide polymorphism loci proportion | |
| Ivanova et al. | Novel multiplex bead-based assay with LNA-modified probes for detection of MPL exon 10 mutations | |
| Palha et al. | Fourteen short tandem repeat loci Y chromosome haplotypes: Genetic analysis in populations from northern Brazil | |
| Ye et al. | Prenatal diagnosis of trisomy 21 by quantitatively pyrosequencing heterozygotes using amniotic fluid as starting material of PCR | |
| CN107400722A (en) | A kind of competitive real-time fluorescence PCR SNP probes for detecting human genome | |
| US20120053064A1 (en) | Determining the identity of terminal nucleotides | |
| RU2652895C2 (en) | Set of synthetic ologonucleotide samples for determination of human mitochondrial dna genotype | |
| Meng et al. | Fidelity genotyping of point mutation by enhanced melting point difference using DNA ligase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Open date: 20090715 |