CN101478974A - Methods and compositions for inducing torpor in a subject - Google Patents
Methods and compositions for inducing torpor in a subject Download PDFInfo
- Publication number
- CN101478974A CN101478974A CNA2007800089583A CN200780008958A CN101478974A CN 101478974 A CN101478974 A CN 101478974A CN A2007800089583 A CNA2007800089583 A CN A2007800089583A CN 200780008958 A CN200780008958 A CN 200780008958A CN 101478974 A CN101478974 A CN 101478974A
- Authority
- CN
- China
- Prior art keywords
- study subject
- mice
- described method
- pharmaceutical composition
- administration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The present invention relates to the discovery the 5'-AMP and analogues thereof can be used to induce a state of torpor or suspended animation in subjects, as exemplified by studies carried out in laboratory mice. In these studies, mice were injected with high doses of 5'-AMP, which was found to result in a decoupling of the animals' body temperature regulation mechanism accompanied by a reduction in the animals' core body temperature, which tended to lower towards the ambient environmental temperature. It was further discovered that the introduction of high levels of 5'-AMP resulted in an induction of fat regulation genes such as procolipase (Clps) in tissues and organs that do not normally express Clps, this in turn was accompanied by a shift in metabolism from a primarily glycolytic energy metabolism (which is inhibited at lower temperatures) to one that relied primarily on the liberation and metabolism of free fatty acids. Substantial medical and other applications that arise out of this discovery are also disclosed.
Description
Background technology
The U.S. Provisional Application series number that the application requires on January 16th, 2006 to submit to is that the series number of submission on August 4th, 60/759,480 and 2006 is 60/821,521 priority, and the content of these patent applications is incorporated this paper into way of reference.
According to NIH fund 1 R01 AG 20912-01A1, U.S. government has right to this invention.
1. technical field
Present invention relates in general to induced dormancy (torpor) or the state of giving birth to that stagnates, more specifically, the present invention relates to use 5 ' adenylic acid (" 5 '-AMP ") or its analog to regulate the compositions and the method for the core temperature and the accretion rate of study subject.
2. description of related art
By dormancy or stagnate to give birth to the mechanism that hibernation that state (the low-down state of a kind of body temperature) realizes is the extraneous and environment of the adaptation adopted of animal, thereby animal need and be survived in rugged environment with lower metabolism.Hibernation or dormancy make the period (for example winter) of animal at low temperature or deprivation of food, live through winter conditions by the metabolism that reduces them.
Usually, hibernation makes body fat that the body utilization stores but not glucose as main energy sources.Reducing body movement and reducing core temperature is the main mechanism that animal is used for reducing energy expenditure.The core temperature (" CBT ") of animal (for example, alpine marmot, Siberian hamster or suslik) can significantly be reduced to is higher than the ambient room temperature several years, for example is reduced to 32 degrees Fahrenheits from 98.6 degrees Fahrenheits.This makes and is generally used for keeping the energy of body temperature to be diverted other needs.Except body temperature reduced, heart rate and the breathing rate of animal also reduced.Energy source is confirmed in the metabolism of hibernation period animal by the variation of original glucose to more free (for example non-esterified) fatty acid.
Be similar to the main public health problem that on behalf of the U.S. and industrial society, fat metabolism relevant issues developing.At present, in the U.S., adult population's about 60% is regarded as obesity, and observe the adult population about 30% for morbid obesity.Fat and multiple disease association, these diseases comprise that insulin resistant type ii diabetes, hypertension, hyperlipidemia, heart disease and mortality rate increase.Obesity is the result owing to calorie intake (it is stored in the health subsequently) too much positive energy balance that causes for energy expenditure.
Multiple mechanism about obesity has been proposed.For example, discover certain gene (ob for example, f
a/ f
aWith the db gene) the sudden change disease of can causeing fat have complicated, clinical similar Phenotype.These Phenotypes show various features when obviously starting from about 1 month, comprise bulimia nervosa, glucose and insulin metabolism severely subnormal, thermoregulation difference and nothing tremble heat production and deep-sleep and underweight.As if by these research, dormancy is keeping also having played more important effect aspect fat and the body temperature, wherein the animal of dormancy for example has inbred mouse, and as NZO mice and Japanese KK mice, they are that appropriateness is fat.Some hybridize mice, for example the Wellesley mice is the instinct obesity.In addition, when raising desert rodent (for example neacomyss pinosus) according to the laboratory rearing method of standard, they become fat.Therefore, toleration good and simultaneously effectively the preparation of treatment and fat relevant disease can to the prevention and the treatment generation significant effects of fat diseases associated (for example hypertension, diabetes, heart disease and arteriosclerosis).
In addition, some reports with the method that solves above-mentioned needs have been proposed.For example, people's laid-open U.S. Patents such as Scanlan numbers 6,979,750 have instructed thyroxine derivant and analog can reduce core temperature and induced dormancy or hibernation-like state, it is believed that thyroxine derivant and analog can produce positive inotropic action and can not influence heart rate heart.This patent relates to the thyroxine derivant and the analog of thyroxin.Thyroxin is that vertebrates grows and homeostatic important regulator.In the adult, thyroxin exerts an influence to nearly all organizing all, and the important process such as metabolic speed, thermal conditioning, lipid total amount, cardiac function and bone are kept all can be subjected to the influence of thyroxin.Compare with normal (for example euthyroid) individuality of thyroxin content, too high (hyperthyroid) of the blood content of thyroxin be individual to have high rate of metabolism and body temperature, low serum cholesterol and the heart rate of quickening usually.On the contrary, compare with euthyroid contrast individuality, hypothyroidism can be characterized by low rate of metabolism and body temperature, high serum cholesterol and the heart rate that slows down.
The U.S. Patent application 2005/0136125 of Roth relates to the antagonist that uses oxygen and comes induced tissue and organ to stagnate.The antagonist of oxygen has reduced the amount of tissue or the available oxygen of organ, and in some embodiments, can use the inhibitor (for example carbon monoxide or hydrogen sulfide) of cytochrome c oxidase.In some occasion, the known toxicity of the antagonist of many oxygen can present the drawback of this method.For example, the antagonist of the oxygen such as Blausure (German) (it is used as chemical weapons) has toxicity, and under many occasions, this toxicity has limited their use.
Said method has obvious defects, because used chemical compound may have useless or unwanted secondary effect, and the disadvantageous effect that produces owing to their hormonal activity for example.These methods have been used non-natural chemical compound that produce or that the nonmammalian physiology uses usually.Therefore, existence is to can be used for inducing a large amount of needs of study subject (comprising people and laboratory animal) dormancy or stagnant compositions of giving birth to state and associated method, wherein said compositions (comprising the medium that fatty acid utilizes) for example has the ability that reduces the study subject metabolic activities, and/or body temperature is reduced.
Summary of the invention
The inventor recognizes a kind of like this needs, for example, regulates core temperature and metabolic speed by the dormancy of inducing study subject or the state of giving birth to that stagnates, thus the control metabolic pathway.Usually, in the period (for example winter) that food lacks or metabolism is slowed down, animal adopts hibernation or dormancy to preserve energy.In mammal, said process relates to biological clock, and this is because day dormancy (for example a kind of of short duration hibernation shape state) is relevant with body temperature rhythm.In addition, the mammiferous day dormancy rhythm and pace of moving things of photoperiodic adjustable in length and body weight.Classical hibernation mode is only observed in rodent such as suslik and the large mammal such as Bears.The laboratory mice, as the mankind, can not hibernation, but shallow dormancy can take place when slowing down (for example fasting) in metabolism in this mice, and this fundamental mechanism that shows some hibernation is retained.As used herein, " dormancy " is defined as extremely lethargy or the clear-headed state of forfeiture, and this state is relevant with the forfeiture of the normal thermoregulation ability of body, causes the peripherad ambient temperature of body temperature to change thus.It is said that usually, when the core temperature of animal (for example mice) is reduced at least about 31 ℃ or when lower, animal will be in resting state.As used herein, " reduction body temperature " is defined as having such core temperature (core body temperature), and this body temperature is lower than physiology's standard body temperature of this kind organism; Usually, when mammiferous core temperature is reduced to approximately below 37 ℃ the time, mammal can be in the state that reduces body temperature.In certain embodiments, can induce human reduction body temperature, thereby core temperature is reduced to about 15 ℃ to about 36 ℃, more preferably about 17 ℃ to about 35 ℃, more preferably about 25 ℃ to about 34 ℃, and in certain embodiments, human core temperature can be reduced to about 27 ℃ to about 33 ℃, and about 17 ℃, about 18 ℃, about 19 ℃, about 20 ℃, about 21 ℃, about 22 ℃, about 23 ℃, about 24 ℃, about 25 ℃, about 26 ℃, about 27 ℃, about 28 ℃, about 29 ℃, about 30 ℃, about 31 ℃, about 32 ℃, about 33 ℃, about 34 ℃, or any temperature that derives thus.It is said that when the mankind's core temperature is reduced to approximately below 28 ℃ or 28 ℃ the time, the mankind will be in " the serious temperature (severe hypothermia) of losing " state.
The present invention partly has been subjected to the inventor and mice is maintained at has continued down dark and the inspiration understanding that obtains, and the present invention has turned in the metabolism principle similar to viewed metabolic ultimate principle in being in the mammal of hibernation.For example, the most of homoiothermic animal such as mammal mainly relies on the glycolysis metabolism in oxidative phosphorylation and the glycolytic pathway that their energy demand is provided, and has wherein used glucose as preferred energy source.Yet the inventor observes the mice that is maintained under the lasting dark and has changed their metabolism, thereby relies on fatty acid metabolism more but not glucose metabolism.In fact, find that blood glucose of these mices and content of fatty acid are opposite with the content of mice under being maintained at regular cycle light and dark.In addition, compare with the mice under remaining on normal cycle light and dark, above-mentioned mice eat less and lose weight.
The inventor finds, when being remained on, mice continues dark state following time, the fat-splitting enzyme of coding control among the peripheral organ, particularly the gene of lipase (Clps) (and enzyme companion: pancreatic lipase associated protein 2 (plrp2), pancreatic lipase associated protein 1 (plrp1) and possible triacylglycerol lipases (PTL)) is activated, and this phenomenon does not then take place the mice that is under the cycle light and dark.Before the present invention, only show the situation that these enzymes are expressed in pancreas and gastrointestinal organ, and this is corresponding to their effects in the degraded of food fat.In addition, the inventor recognizes that biological clock has played main effect in this molecule of adjusting is replied.An above-mentioned a series of observed result and an importance of the present invention are to find that (5 '-AMP) is a kind of important medium of described signaling mechanism to 5 '-adenylic acid.
For example, have realized that for the mice under being maintained at conventional light-dark (" LD ") circulation, be maintained at the mice that continues under dark (" DD ") and have high-load blood 5 '-AMP.When 5 '-AMP was administered to mice with high consumption, mice just entered a kind of resting state, and this state is a kind of extreme lethargy and the clear-headed state of forfeiture significantly, and with the CBT that for normal core temperature (CBT), reduces.The metabolic variation of being regulated by 5 '-AMP and lasting dark may be a kind of evolutionary mechanism that mammal is adopted in order to preserve energy.For example, mice is made response dormancy the time has taken place in that metabolism is slowed down.For example, mice dormancy has taken place metabolism being slowed down make when responding, but dormancy does not but take place in mice under cycle light and dark during (for example) continues dark of short duration fasting down (for example 2-3 days).The generation that may also can influence dormancy such as size and the factor the ambient temperature of animal; For example, less thinner animal and lower ambient temperature may be quickened the generation of dormancy or carry out.In addition, as the response that this metabolism is slowed down, the content of blood 5 '-AMP sharply increases, and this shows that 5 '-AMP that the physiology regulates and control and dormancy reply medium relevant or that reply for dormancy.When being expelled to synthetic 5 '-AMP in the mice body, the content of glucose is regulated and is inverse correlation with the expression of lipase gene.
The inventor recognizes that 5 '-AMP is for regulating the switch of a key of the energy balance between glucose, glycogen and the fat in the mammal.5 '-AMP is the allosteric modulators of several rate-limiting enzymes in control glycolysis (phosphofructokinase (PFK)), gluconeogenesis (fructose-1 (FDP)) and glycogen degraded (glycogen phosphorylase (α subunit and β subunit)) process.The inventor also determines, the steatolysis gene (for example, lipase (CLPS), and enzyme companion: pancreatic lipase associated protein 2 (plrp2), pancreatic lipase associated protein 1 (plrp1) and possible triacylglycerol lipases (PTL)) be that mammal relies on the effect of 5 '-AMP and is in the metabolic mechanism of physiological rhythm under regulating.
One aspect of the present invention relates to the method for inducing study subject to produce hibernation, dormancy or the state of giving birth to that stagnates, comprise that will be used for induced dormancy or stagnant 5 '-AMP state, effective dose of giving birth to or non-natural analog (for example, wherein said analog is induced mClps, PTL, PLRP1 or PLRP2) that form, synthetic 5 '-AMP is administered to study subject.Described method can also comprise determines that study subject is in dormancy or the state of giving birth to that stagnates.In certain embodiments, described method also is included in to use and study subject is in after 5 '-AMP or the analog to be lower than about 30 ℃ ambient temperature (for example, temperature between about 25 ℃ and about 1 ℃; Or the temperature between about 20 ℃ and about 4 ℃) in.
In certain embodiments, can adopt a plurality of steps to change the speed that study subject body temperature changes.For example, in certain embodiments, surrounding can comprise water-bath, and wherein study subject is immersed in the water-bath at least in part.Change room temperature and also can provide the method that influences the body temperature of study subject pace of change.Can imagine, can also adopt the additive method that is used to change hibernation speed according to the present invention.
Described method comprises that also the core temperature with study subject is reduced to about 37 ℃ (for example, about 32 ℃ or lower, between about 15 ℃ and about 20 ℃, between perhaps about 13 ℃ and about 15 ℃).In certain embodiments, described dormancy is deep-sleep or the extremely low state of body temperature.
Can be by subcutaneous injection, intramuscular injection, intravenous injection, peritoneal injection, nasal mucosa medicine administration, intravaginal administration, intranasal administration, use 5 '-AMP or analog through bronchus administration, eye drops, in ear administration, intracranial administration, oral administration, parenteral, rectally, sublingual administration, topical, percutaneous dosing or their combination.5 '-AMP or analog can be with (for example) capsule, capsule sheet, soft gel, soft gelatin capsule, suppository, thin film, granule, colloid, lozenge, piller, chewable tablet, tablet, piece, dish, mastic sheet, Emulsion, washing liquid, ointment, aerosol sprays, roll and put formula liquid on the skin, roll and put formula rod, transdermal patch, subcutaneous implantation form, pad or their combining form on the skin and use.In certain embodiments, 5 '-AMP or analog tend to delay discharge in biodegradable carrier.
5 '-AMP or analog can be used with pharmaceutically useful dosage form, and described dosage form further comprises pharmaceutically useful carrier.In certain embodiments, pharmaceutically useful carrier comprises the aerosol spray that is selected from nitrogen, carbon dioxide, propane, butane, isobutene., pentane, different propane, fluorocarbon, dimethyl ether or their mixture.5 '-AMP or analog can be used further to comprise the dosage form that is selected from least a reagent in softening agent, water, inorganic powder, foaming agent, emulsifying agent, aliphatic alcohol, fatty acid and their combination.
In certain embodiments, study subject is behaved or laboratory animal (for example mice).The effective dose of 5 '-AMP or analog can for about 5mg/kg body weight to about 7.5gm/kg body weight, the 15mg/kg body weight is to about 1.5gm/kg body weight, about 5mg/kg body weight is about 15mg/kg body weight extremely, perhaps about 25mg/kg body weight is about 250mg/kg body weight extremely.Effective dose for about 5mg/kg to the embodiment of about 15mg/kg, described method may further include the body temperature (for example passing through the method for employing water-bath) of quick reduction study subject with the induced dormancy state.Described method may further include study subject is immersed in the water-bath at least in part, and wherein, the temperature of water-bath is lower than about 32 ℃.Described method may further include with cold blanket and covers the patient at least in part.
For example, the inventor determines, in mice, adopts at cooling stage (subsequently, body temperature can be maintained at required temperature, for example 4 ℃ to 28 ℃) under the condition of 4 ℃ of environment, is used for 5 ' of induced dormancy-AMP ED
50Be about 0.15mg/gram body weight, and 5 '-AMP ED
100Be about 0.25mg/g body weight.The inventor determines that also dosage can the inducing mouse deep-sleep for 5 '-AMP of about 5-7.5mg/g body weight.
Study subject can be for suffering from the state of disease, and these diseases can obtain medical treatment by the induced dormancy or the state of giving birth to that stagnates.For example, described morbid state can be the state of following disease: shock, wound, dysfunction of blood coagulation, chemotherapy side effect, poison, arrhythmia, hypothermia, burn, suffocate, inhalation injury, respiratory failure, pyemia, anxiety, insulin shock, infectious disease, cancer, tumor, drowning, heart disease, congestive heart failure, decompression sickness, asthma, hungry, apoplexy, severe trauma, injury of head, cerebral trauma, the cerebrovascular function damage, cerebrovascular (cerebrovascular trauma), neuropathy (nuerologicaltrauma), nerve injury, fever, heatstroke, eating disorders, anxiety, epilepsy, epilepsy, insomnia or sleep disorder, diabetes, obesity, hypertension, hyperthyroidism, hypothyroidism or their combination.Study subject can be transplant recipient, transplantation donor, need the object of appetite-suppressing, patient, postoperative patient or accepted or be about to accept the patient of chemotherapy before the art.
The consumption of 5 '-AMP or analog can reduce core temperature effectively, reduces outside body temperature, reduces metabolic speed, decreased heart rate and their combination.Described method may further include to study subject and uses second pharmaceutical preparation.Second pharmaceutical preparation can comprise adjuvant, heparin, anticoagulant, variable force medicament, medicament, analgesic, anesthetis, neuroprotective, antiarrhythmic medicament or calcium channel blocker when becoming.
Another aspect of the present invention relates to the method that reduces the study subject blood sugar concentration, comprise to study subject use be used to reduce by that 5 '-AMP individual blood sugar concentration, effective dose or non-natural form, (it can induce mClps to synthetic 5 '-AMP analog, PTL, PLRP1 or PLRP2).Study subject can suffer from diabetes, obesity or need appetite-suppressing.
Thereby another aspect of the present invention relates to change organizes metabolic state to accelerate the method for fatty acid metabolism in the tissue (for glycolysis in the tissue), comprise use to study subject be used to accelerate that fatty acid is metabolic, 5 '-AMP of effective dose or non-natural analog that produce, synthetic 5 '-AMP, wherein said analog can be induced mClps, PTL, PLRP1 or PLRP2.Described tissue can be contained in the study subject body.Study subject can be transplant recipient, transplantation donor, art preceding patient, postoperative patient or the patient who has accepted or be about to accept chemotherapy.In certain embodiments, described organizing taken out in the body of study subject.This tissue can comprise part or all of organ (for example, transplant organ).Described method may further include the metabolism of determining fatty acid in the study subject and is accelerated.In certain embodiments, described patient suffers from diabetes, obesity or needs appetite-suppressing.In certain embodiments, the described solid tumor that is organized as.
Another aspect of the present invention relates to the method for the core temperature that reduces study subject, comprise using to study subject being used to reduce by the 5 '-AMP study subject core temperature, effective dose or non-natural analog that produce, synthetic 5 '-AMP, wherein said analog can be induced mClps, PTL, PLRP1 or PLRP2.Described method may further include the core temperature of determining study subject.Described study subject can be in the state of following disease: shock, wound, dysfunction of blood coagulation, chemotherapy side effect, poison, arrhythmia, hypothermia, burn, suffocate, inhalation injury, respiratory failure, pyemia, anxiety, insulin shock, infectious disease, cancer, tumor, drowning, heart disease, congestive heart failure, decompression sickness, asthma, hungry, need appetite-suppressing, apoplexy, severe trauma, injury of head, cerebral trauma, the cerebrovascular function damage, cerebrovascular, neuropathy, nerve injury, fever, heatstroke, eating disorders, anxiety, epilepsy, epilepsy, insomnia or sleep disorder, diabetes, obesity, hypertension, hyperthyroidism, hypothyroidism, be about to carry out surgical operation, the transplant patient, accepted or be about to accept the patient of chemotherapy, or their combination.
Another aspect of the present invention relates to the method that reduces the study subject rate of metabolism, comprise using to study subject being used for effectively reducing by the 5 '-AMP study subject rate of metabolism, effective dose or non-natural analog that produce, synthetic 5 '-AMP, wherein said analog can be induced mClps, PTL, PLRP1 or PLRP2.Described method may further include the metabolic speed of estimation study subject.Described study subject can be in the state of following disease: shock, wound, dysfunction of blood coagulation, chemotherapy side effect, poison, arrhythmia, hypothermia, burn, suffocate, inhalation injury, respiratory failure, pyemia, anxiety, insulin shock, infectious disease, cancer, tumor, drowning, heart disease, congestive heart failure, decompression sickness, asthma, hungry, apoplexy, severe trauma, injury of head, cerebral trauma, the cerebrovascular function damage, cerebrovascular, neuropathy, nerve injury, fever, heatstroke, eating disorders, anxiety, epilepsy, epilepsy, insomnia or sleep disorder, diabetes, obesity, hypertension, hyperthyroidism, hypothyroidism, be about to carry out surgical operation, the transplant patient, need appetite-suppressing, accepted or be about to accept the patient of chemotherapy, or their combination.
Another aspect of the present invention relates to pharmaceutical composition, comprising is enough to produce dormancy or the state of giving birth to that stagnates, reduces core temperature, heart is produced the 5 '-AMP or non-natural analog formation, synthetic 5 '-AMP of the medicine effective quantity of inotropic action, the cell that slows down growth, the metabolic speed that slows down, blood sugar lowering concentration or their combination, and wherein said analog can be induced mClps, PTL, PLRP1 or PLRP2.Described compositions can be with subcutaneous injection, intramuscular injection, intravenous injection, peritoneal injection, nasal mucosa medicine administration, intravaginal administration, intranasal administration, make through the administering mode of bronchus administration, eye drops, in ear administration, intracranial administration, oral administration, parenteral, rectally, sublingual administration, topical, percutaneous dosing or their combination.5 '-AMP or analog can be with capsule, capsule sheet, soft gel, soft gelatin capsule, suppository, thin film, granule, colloid, insert, chewable tablet, lozenge, piller, tablet, piece, dish, mastic sheet, Emulsion, washing liquid, ointment, aerosol sprays, roll and put formula liquid on the skin, roll and put formula rod, transdermal patch, subcutaneous implantation form on the skin, fill up or place biodegradable carrier to make with the form that is used to delay to discharge.
Described pharmaceutical composition can further comprise pharmaceutically useful carrier.Described pharmaceutically useful carrier can comprise the aerosol spray that is selected from nitrogen, carbon dioxide, propane, butane, isobutene., pentane, different propane, fluorocarbon, dimethyl ether or their mixture.Described pharmaceutically useful carrier can comprise at least a reagent that is selected from softening agent, water, inorganic powder, foaming agent, emulsifying agent, aliphatic alcohol, fatty acid and their combination.Described Pharmaceutical composition can be made with the form of injectable dosage.5 '-AMP or analog can be contained in bottle or the ampoule to measure dosage.In certain embodiments, 5 '-AMP or analog are dispersed in the aqueous solution.
In certain embodiments, described pharmaceutical composition further comprises one or more medicated premixs.This additive can comprise one or more buffer agents or physiology salt.Described bottle or ampoule can have barrier film.Can measure dosage, so that 1 to 5 consumption to be provided.Each consumption can comprise the 5 '-AMP or the analog of 1 to 500 gram or 2 to 20 grams.In certain embodiments, each consumption comprises and can pass to 5 '-AMP study subject, effective dose or analog with the amount of 15mg/kg to 7.5gm/kg body weight or 25mg/kg to 250mg/kg body weight.Described pharmaceutical composition can be produced and be positioned over and be used for inducing study subject dormancy or stagnant emitter of giving birth to state.In certain embodiments, described pharmaceutical composition further is restricted to and is applicable to the aerosol composition of inducing the 5 '-AMP study subject dormancy, that comprise medicine effective quantity and propellant.This aerosol composition can be the form of inhalant.
In certain embodiments, described pharmaceutical composition further comprises second activating agent.This second activating agent can be adjuvant, heparin, anticoagulant, variable force medicament, medicament, analgesic, anesthetis, neuroprotective, antiarrhythmic medicament or calcium channel blocker when becoming.
Another aspect of the present invention relates to the method that changes the study subject metabolic activities, comprise 5 '-AMP to study subject drug administration effective dose, wherein the precursor of this 5 '-AMP or this 5 '-AMP has changed the activity that is selected from one or more the metabolic enzymes in lipase, pancreatic lipase, pancreatic lipase associated protein, phosphofructokinase, fructose-1, glycogen phosphorylase and their combination.
Another aspect of the present invention relates to the anti-terrorism security system of the means of transport that is used for inducing one or more study subject dormancy on means of transport, comprising: the crew compartment; The main cabin; Be positioned over the pressurization security system in the main cabin, described main cabin comprises one or more outlets in the body of cabin, and wherein said pressurization security system is equipped with 5 ' of medicine effective quantity-AMP or 5 '-AMP precursor and propellant; One or more openers, wherein open the precursor that one or more openers can make 5 '-AMP or 5 '-AMP and be released in crew compartment and/or the main cabin, and make and when study subject sucks the precursor of 5 '-AMP or 5 '-AMP, induce this study subject dormancy; And the air-isolation system that in the crew compartment, is used for one or more drivers.Described one or more outlet can be configured to communicate with the air circulation system of means of transport.Described air-isolation system can have that one or more of being used for one or more drivers are all, the cockpit of sealing or their combination.In certain embodiments, described means of transport is aircraft, vehicle or watercraft.
Description of drawings
In order to understand the features and advantages of the present invention more completely, connection with figures is come with reference to detailed Description Of The Invention of the present invention, wherein now:
Fig. 1 a and 1b are the images of cDNA microarray;
Fig. 2 is illustrated in the autoradiographic image that the mClps generation is expressed in the liver that is in the mice under the cycle light and dark;
Fig. 3 is illustrated in to be in the image that mClps in the liver that continues the mice under dark expressed, formed thus the autoradiography speckle;
Fig. 4 a and 4b illustrate the autoradiographic image that the mClps generation is expressed in liver and fatty tissue respectively;
Fig. 5 is the figure that the situation of a certain moment liver Proteolytic enzyme triacylglycerol is shown;
Fig. 6 is illustrated in the autoradiographic image that the mClps generation is expressed in various peripheral tissues and the cerebral tissue;
Fig. 7 discloses the autoradiographic image that mClps and mPlrp2 express;
Fig. 8 is the chromatogram that is illustrated in the mice that is under the cycle light and dark and is in the retention time at the various peaks that adopt the reversed-phase HPLC analysis in the mice that continues under the dark;
Fig. 9 detects the absorptance at various HPLC peak and the whole day pattern of time;
Figure 10 is the block diagram of some absorptance constantly, and this figure demonstrates and is in the varying level that continues the mice under the dark and be in the mice under the cycle light and dark;
Figure 11 is more various samples and identify the figure of retention time that peak 2 is the chemical compound of 5 '-AMP;
Figure 12 induces the autoradiograph that mClps expresses in the liver for 5 '-AMP of the various concentration of proof;
Figure 13 is for showing that the observed mClps of arriving is by the autoradiograph of abduction delivering between about 3.5 to 4 hours after injection 5 '-AMP, and wherein said 5 '-AMP is relevant with blood sugar concentration;
Figure 14 uses the inverse transcription polymerase chain reaction technology for showing, can both detect the gel images of 5 '-AMP to the abduction delivering of mClps in all the sampled peripheral tissues except brain;
Figure 15 is to use adenosine receptor or transport protein to detect the image of RNA hybridization technique of the endocellular function of 5 '-AMP;
Figure 16 detects the autoradiograph of dipyridamole to the blocking-up situation of the inductive lipase expression of adenosine and 5 '-AMP, and wherein said dipyridamole is effective inhibitor of nucleoside transporter;
Figure 17 analyzes the autoradiograph of inducing situation that adenylic acid is expressed mClps in the liver;
Figure 18 is the figure of temperature and time after using 5 '-AMP;
Figure 19 is the figure of temperature and time after using 5 '-AMP;
Figure 20 is the figure of temperature and time after using 5 '-AMP, and it is used to build the effect that peace side metabolism slows down;
Figure 21 is the HPLC chromatogram of comparison size at 5 '-AMP peak during resting state and non-resting state;
Figure 22 is that the relative size to the HPLC peak of 5 '-AMP carries out quantitative block diagram;
Figure 23 a-23c is that to be subjected to that physiological regulating control and dormancy be subjected to inducing be the result's that slows down of metabolism figure to the content of proof 5 '-AMP; Figure 23 a is the figure of the temperature and time after using 5 '-AMP; Figure 23 b is the HPLC chromatogram, and it has compared the HPLC chromatogram that is in the size at 5 '-AMP peak during resting state and the non-resting state; Figure 23 c is that the relative size to the HPLC peak carries out quantitative block diagram, and wherein the size at peak has shown the content of 5 '-AMP;
Figure 24 a and 24b are the figure of the consumption of the food of every day and water;
Figure 25 is the figure of the body weight of every day;
Figure 26 is the figure of free fatty acid in the serum in a period of time;
Figure 27 is the figure of concentration of glucose in a period of time;
Figure 28 is the figure of concentration of glucose in a period of time inner blood;
Figure 29 is in the mice that shows under being in cycle light and dark, induces the active autoradiograph of 5 '-AMP of mClps expression;
Figure 30 is the figure that shows the effect of 5 '-AMP in metabolic signal transmits;
Figure 31 a and 31b are the figure that 5 '-AMP is expelled to the situation of interior food intake afterwards of morbid obesity mice body and body weight every day;
Figure 32 a and 32b are maintained at the food intake of the morbid obesity mice under the cycle light and dark under the lasting dark and that be maintained at rule and the figure of body weight;
Figure 33 shows in the outer mice body of-5 '-nucleotidase expression of gene level under being in cycle light and dark of born of the same parents it is high and to be maintained in the mice body that continues under the dark be low RNA hybridization technique image;
Figure 34 a and b illustrate the situation that enters of SA and the time span of SA is the function of 5 '-AMP concentration.Figure 34 a: under 4 ℃, in 60 minutes, the dosage of the 5 '-AMP that splashes into is that 5 '-AMP inducing mouse (n=4) enters the function of the ability of SA.The time span of Figure 34 b:SA is the function (microgram/gram body weight (mg/gbw)) of the implantation concentration of 5 '-AMP.In case mice enters SA, they just remain under 15 ± 0.5 ℃ up to observe spontaneous clear-headed till.The described clear-headed ability that mice spontaneously carries out RF that is defined as;
Figure 35 a, b and c illustrate the influence of AET to mice CBT and SA time span.Figure 35 a: be in the SA state after 2 hours, be maintained at the CBT of single mice under the AET of 14 ℃ or 15 ℃.Figure 35 b: the time span that is maintained at the mice SA under the AET of 14 ℃ or 15 ℃.Annotate: after 12 hours, be transferred to 20-22 ℃ ambient temperature and come mice is given treatment to, wait for that simultaneously mice is spontaneous clear-headed by the mice that will be in SA.Figure 35 c: remain on mice under the various AET by the clear-headed situation of SA and the rising situation of CBT.Make and respectively organize mice (n=4) and enter SA, then they are transferred in the calorstat that is under the described temperature, thereby observe the regeneration rate of CBT.In this research, use 5 '-AMP of 0.5mg/gbw to induce SA;
Figure 36 shows the interactional suggestion pattern that is used for explaining between 5 '-AMP during the SA and reduction body temperature.This pattern shows, 5 '-AMP (5 '-adenylic acid) is the important function in the adjustment process of rate-limiting enzyme in glucose metabolism, glycogen metabolism and fat metabolism respectively, wherein said rate-limiting enzyme is: fructose-1 (FDP), phosphofructokinase (PFK), glycogen phosphorylase (GP), lipase (CLPS) and pancreatic lipase associated protein 2 (PLRP2).Low temperature has influenced the activity of these important enzymes to some extent.The balance of adenylic acid accumulation (ATP+5 '-AMP<2ADP) regulated by adenylate kinase (AK), and the degraded of 5 '-AMP is undertaken by AMP deaminase (AMPD);
Figure 37 a and b by during being illustrated in mice and stagnate giving birth to and the activity expressed of the blood sugar content between lucid interval and lipase prove that blood glucose is in the spontaneous effect in clear-headed of mice.Figure 37 be illustrated in CBT remain under 37 ℃ (initial temperatures), under being in SA (state of giving birth to stagnates), by clear-headed (SA) the lipase expression mRNA down and in the liver of spontaneous clear-headed (RF) disposal mice down that heats up again.Figure 37 b shows by CBT and remains on 37 ℃ (initial temperatures), is in SA, passes through the blood sugar content that intensification is again regained consciousness (SA) and the mice of spontaneous clear-headed (RF) obtains.(n=5),*P<0.05。
Figure 38 a, b, c and d are the HPLC figure that adenylic acid in the erythrocyte and metabolite are shown.Figure 38 a is that CBT is 37 ℃ a control mice.Figure 38 b is the mice that regains consciousness.Figure 38 c is the mice that is in SA.Figure 38 d gives 5 '-AMP again and mice that put to death, that be in SA after 2 hours.Peak # 1 is ATP; Peak # 2 is a uric acid; Peak # 3 is a hypoxanthine; Peak # 4 is 5 '-AMP; Peak # 5 is an inosine.
Figure 39 a, b and c are the block diagrams that is illustrated in the ratio of adenylic acid in blood, liver and muscle during described three kinds of behavior states.Figure 39 a shows the ratio in blood.Figure 39 b shows the ratio in muscle.Figure 39 c shows the ratio in liver.**p<0.01,*p<0.05,n=5。
The specific embodiment
Definition
For the ease of understanding the present invention, with several terms of giving a definition.Term defined herein has the implication of generally being understood by those of ordinary skill in the related art of the present invention.Term such as " one ", " being somebody's turn to do " and " described " is not intended to only refer to one entity, but comprises the General category of the operable instantiation for explanation.The term of this paper is used to describe specific embodiments of the present invention, but their use can not limit the present invention, unless this term is generalized consistent with claims institute.
As used herein, term " study subject " or " a plurality of study subject " refer to multiple animal, comprise mammal, laboratory animal (for example mice) and preferred human.As used herein, term " purification " or " with purification " refer to pollutant are removed from sample.
As used herein, term " RNA hybridization technique " refers to analyze by the following method RNA, and described method is for to carry out agarose gel electrophoresis to RNA, thus according to the size of RNA with its classification; Then gained RNA is transferred on the solid carrier (for example nitrocellulose or nylon film) by gel.Survey immobilized RNA with label probe then, thereby detect and the complementary RNA kind of used probe.The RNA hybridization technique is molecular biological conventional tool (referring to Sambrook, et al., Molecular Cloning:A Laboratory Manual, ColdSpring Harbor, 1989).
As used herein, the composition of " pharmaceutically acceptable " refers to a kind of like this composition, and it is applicable to the mankind and/or animal, and does not have uncomfortable adverse side effect (for example toxicity, stimulation and allergy), and suitable, thereby induce study subject dormancy or hibernation with advantage of reasonable/risk ratio.
As used herein, term " treatment effective dose " refers to that chemical compound of the present invention can effectively produce the amount of required therapeutic response.For example, give birth in order to induce the study subject dormancy or to stagnate, the 5-AMP of effective dose or 5 '-AMP analog can provide in the mode of the maximum physiological reaction of minimum dosage generation.Obviously, concrete " treatment effective dose " will change along with the variation of following factor, described factor for example for sex and/or the body weight of the character of period of the mammiferous kind of actual conditions, the patient's of treatment physiological situation, treatment, treatment, treatment (if carrying out) simultaneously, animal, need induce the degree of study subject dormancy or hibernation or required time span, at these factors, can prepare concrete configuration thing and wait and use according to structure, its dissolubility, the metabolic half-life of chemical compound or derivatives thereof.
Term " organ " is used to its implication the most widely in this article, and it refers to carry out any part specific function, health, comprises tissue and cell or their part, for example cell line or organelle prepared product.Other examples comprise: causing circulatory, for example heart; Respiratory apparatus, for example lung; Urinary organs, for example kidney or bladder; Digestive organs, for example stomach, liver, pancreas or spleen; Genitals, for example scrotum, testis, ovary or uterus; Nervous organ, for example brain; Sexual cell, for example sperm or ovum; And somatic cell, for example epidermis cell, core cell, myocyte, neurocyte, brain cell or nephrocyte.
Term " 5 '-AMP analog " is used to refer to the modified outcome of metabolite and 5 '-AMP of precursor, 5 '-AMP of analog, 5 '-AMP of 5 '-AMP chemical compound, 5 '-AMP in this article, be preferably synthetic 5 '-AMP, the analog that more preferably such non-natural forms, this analog rely on them to stimulate or the expression of induced lipolysis enzyme (Clps) and/or pancreatic lipase associated protein 2 (Plrp2) or dormancy or the stagnant state of giving birth to that activity is induced study subject.Described these analog comprise, but be not limited to oligonucleotide, oligonucleoside, nucleotide, nucleoside and 5 '-AMP precursor (for example ADP and ATP), wherein said 5 '-AMP precursor can be transformed into by chemical method or enzyme process bioactive useful 5 '-AMP analog.Described modified outcome can comprise substitution product or other modified outcomes of part, linking group, phosphate group or their combination of sugar of heterocyclic base moiety (obtain thus non-natural form nucleoside base), the nucleoside of nucleoside.
When word " " in claims and/or description and term " comprised " logotype, used word " " can be represented " one ", but also was equivalent to " one or more ", " at least one " and " one 's or more than one " implication.
In the application's full text, term " approximately " is used to represent that a value has comprised for device, determined the method that this value adopts or be present in the constant error variation that is had for the difference between object of study.
Though disclosure support relate to alternative only and " and/or " definition,, only be the situation of alternative or both are situation about repelling each other unless clearly indicate, otherwise the term that uses in claims " or " be used to represent " and/or ".
Summary of the invention
Usually, in one period (for example some months in winter) that food lacks, animal adopts hibernation to come storage power.
1Before the present invention, the physiology of regulation and control hibernation and biochemical signals process are mysteries always.In mammal, said process relates to biological clock, and this is because day dormancy (for example a kind of of short duration hibernation shape state) is relevant with body temperature rhythm.
2-3In addition, the evidence that relates to biological clock is to observe photoperiodic length dormancy in mammiferous day and body weight are regulated to some extent.
4-5Excision suprachiasmatic nucleus (SCN, it is a maincenter biological clock lock unit) can be eliminated the dormancy rhythm and pace of moving things.
6
Classical hibernation mode is only observed in rodent such as suslik and the large mammal such as Bears.Yet dormancy can take place in kinds of experiments chamber mice, and this shows that the fundamental mechanism of some hibernation obtains keeping in these organisms.
7-8The effect of biological clock in dormancy and signaling mechanism (it regulates described this biological phenomenon in vivo) is very interesting.For example, keeping continuing dark period, in the peripheral organ of mice, the fat-based of encoding murine lipase (mClps) and pancreatic lipase associated protein 2 (mPlrp2) is because of being activated, but during keeping cycle light and dark, these genes but are not activated, and in the mice of the gene generation defective that plays the biological clock function, and the regulation and control of said gene are eliminated.In the tissue of energy enrichment, observe lasting dark and induced plurality of enzymes, and these enzymes have been regulated the catabolism of fat (for example triacylglycerol).
The invention provides induced dormancy and stimulate the peripheral organ to express Clps, the 5 '-AMP (for example synthetic or natural) and the analog of induced dormancy or the state of giving birth to that stagnates thus.Thus, the invention provides a kind of can be by using the mechanism that 5 '-AMP or its analog are regulated metabolic function, wherein said 5 '-AMP or its analog make the regulation and control to thermoregulation mechanism be eliminated, thereby reduce core temperature (CBT).Inventor's supposition uses 5 '-AMP that the metabolism of human body is become fatty acid metabolism by original glycolysis metabolism, and this point is confirmed by the Clps expression product that induces.Then, above-mentioned signal makes the regulation and control to thermoregulation mechanism be eliminated, and this causes CBT to reduce successively, as body temperature with ambient temperature (AET) seeking balance.In case body temperature reaches about 31 ℃ or lower, the state that has just reached dormancy or stagnated and give birth to.
Usually, when the body temperature of animal was reduced to non-hibernation condition, animal presented dangerous arrhythmia with beginning, and finally causes ventricular fibrillation and death.Yet, similar to viewed situation in being in the animal of hibernation in the study subject that 5 '-AMP with high dose handles, do not observe the CBT reduction and cause severe complications or untoward reaction, for example arrhythmia.The inventor believes, is different from the metabolic fatty acid metabolism of glycolysis and has played certain effect in this protection effect.
By the situation by explanation shown in Figure 36, the inventor forms such theory, will destroy the balance of gathering of adenylic acid to 5 '-AMP of study subject administered with high dose, and this situation can be corrected by the generation that reduces cell ATP.This can destroy successively to thermotaxic defence, thereby causes CBT to descend.Serious reduction body temperature can produce different influences to the activity of important enzyme, and described enzyme comprises those that regulated by the 5 '-AMP institute allosteric that keeps glucose dynamic equilibrium.The activity of adenylate kinase (a kind of adjusting adenylic acid gathers equilibrated enzyme) is insensitive to low temperature.On the contrary, AMP deaminase (a kind of enzyme that 5 '-AMP is degraded into creatinine one phosphoric acid (IMP)) is suppressed by low temperature.Therefore, in serious reduction body temperature, high-load 5 '-AMP can not be degraded, so the generation of ATP is suppressed, and CBT keeps lower, and SA continues thus.Under the situation of serious reduction body temperature, ATP produces by glycolysis at first.Yet the activity of glycogen phosphatase (GP, a kind of rate-limiting enzyme that the glycogen that stores is degraded into Cori ester) is subjected to cryogenic inhibition.Under the condition of the glycogen that does not use storage as the glucose source, phosphofructokinase (PFK, a kind of glucolytic rate-limiting enzyme) is subjected to cryogenic inhibition, thereby stores blood glucose.
In order not carry out keeping blood glucose under the glycogenolytic condition, 5 '-AMP can activate the expression of lipase/pancreatic lipase.Low temperature can not suppress the activity of lipase/pancreatic lipase, and wherein said lipase/pancreatic lipase becomes fatty acid with the fat acid decomposition that stores.Acetyl-the CoA that is generated by fatty acid oxidation can promote gluconeogenesis successively, thereby produces glucose to be used for glycolysis.The activity of fructose-1 (FDP, a kind of gluconeogenetic rate-limiting enzyme) is insensitive to low temperature.Even under the state of serious reduction body temperature, low-level glycolysis also can generate ATP, this ATP can eliminate 5 '-AMP gradually adenylic acid is gathered the influence that balance causes.Along with the rising of ATP content, observe that CBT raises gradually in the SA state, this is because be used for the thermoregulation defence at the energy that generates at present.In case CBT is elevated to more than 17 ℃, the enzyme that is subjected to seriously to reduce the body temperature inhibition just recovers its activity gradually.This can further activate by the violent heat mechanism of giving birth to of trembling and presenting, thereby recovers the content of cell ATP and adenylic acid is gathered to turn back to its initial equilibrium ratio.The inventor's the ability that enters the SA state that studies show that is not that hibernator is distinctive, and this ability can obtain in non-hibernator.In the energy adjustment of all living body biologicals, adenylic acid gather balance (ATP+5 '-AMP<2ADP) conventional function well ground show that the mankind also reversible SA state can take place safely when being given 5 '-AMP and AET and hanging down.
This uncommon ability that 5 '-AMP that external source adds can reduce CBT safely is an importance of the present invention.For example, what can fully determine is, if CBT can be lower, can reduce significantly so by surgical operation or the cell injury that caused by wound (for example damage that is caused by contingency, damage or fight).The inventor forms such theory, and CBT is low to see that the conclusion that reduces cell injury is because due to the state of hypothermia makes that the activity of cell metabolism slows down.The invention provides and be used for induced dormancy, that have physiologically active or synthetic 5 '-AMP, wherein said dormancy makes CBT and ambient room temperature very approaching.
Another application of the invention comprises the treatment arrhythmia.The inventor recognizes when giving 5 ' of high concentration-AMP, can make decreased heart rate.When and a kind of Therapeutic Method (for example adenosine) that be used for above-mentioned purpose known with ability when comparing, 5 ' of highly-water-soluble-AMP is different with having, and the water solublity of adenosine is extremely low.In addition, different with adenosine, 5 '-AMP can not pass blood brain barrier, and therefore 5 '-AMP can not show unwanted neural effect.
Another application of the invention is treatment of obesity.The inventor recognizes that 5 '-AMP has induced the expression of the lipase among all sampled peripheral organs.The gene code of described lipase two kinds of peptides, for example, when this lipase of enzyme action, the lipase polypeptide forms colipase and is known as the terminal pentapeptide of N-of intestinal inhibin.At animal and human's apoplexy due to endogenous wind, the intestinal inhibin is known satiety inhibitor.The inventor recognizes that injection 5 '-AMP can induce the expression of the lipase among all sampled peripheral organs, has therefore regulated the generation of intestinal inhibin in the body.The intestinal inhibin is by the light of nature to satiety generation effect.This point can be by studies confirm that of the inventor, in described research, observe be maintained at cycle light and dark under mice compare, be maintained at the lipase that continues dark mice down express higher, and to the picked-up minimizing of food and water.
Can adopt the present invention, be used as 2 type insulin resistant treatment of diabetes methods by the concentration of regulating human blood glucose.For example, 5 '-AMP that the activation lipase is expressed is directly related with blood sugar concentration, and 5 '-AMP is the allosteric modulators of several important metabolic enzyme (for example PFK, FDP and GP) of interior glucose of control agent and glycogen concentration.
The present invention further provides the mechanism that is used to control mammal behavior and biological cascade thereof, for example, the dark that continues has activated the expression of Clps and Plrp2, shows the effectiveness of sort signal.The inventor finds that in being in the mice that continues under the dark, the activation of these lipocatabolic genes is subjected to (being defined as the regulation and control of 5 ' adenylic acid (5 '-AMP)) by the circulation molecule that physiological rhythm is regulated.For example, expression from mClps to the synthetic 5 '-AMP of injected in mice that can induce, and when 5 '-AMP of injection high dose, can make animal enter resting state.The animal of physiological rhythm defective demonstrates enhanced resting state when 5 '-AMP being made response, thereby has proved the effect of endobenthos clock in described molecule cascade.Food lacks with environment badly all to be regulated resting state to some extent, and this resting state also is to be in to continue the reaction that the mice under the dark is made, and shows that circulation 5 '-AMP has played the effect of energy adjustment agent.5 '-AMP shown the potentiality of its mediation dormancy to the action effect of mice.
In certain embodiments, the invention further relates to method and medicine or the veterinary composition that during operation on heart, cardiovascular diagnosis and treatment or therapeutic intervention, is used for collecting (arresting), protection and/or preserves organ (particularly heart).
The present invention also provides the method that alleviates the study subject morbid state by 5 '-AMP or analog to study subject administering therapeutic amount, and the wherein said state of palliating a disease is considered to using the response that 5 '-AMP or 5 '-the AMP analog is treated.Described morbid state can be fever, heart disease, eating disorders, anxiety, epilepsy, epilepsy, insomnia and sleep disorder, asthma, diabetes, arrhythmia, apoplexy, obesity, hypertension, hyperthyroidism, hypothyroidism and their combination.
In addition, the invention provides by the 5 '-AMP or the analog of study subject administering therapeutic amount that carries out medical treatment to needs reduce core temperature, reduce outside body temperature, reduce metabolic speed, decreased heart rate and their combination, the study subject of medical treatment produces dormancy or the method for the state of giving birth to that stagnates thereby derived need is carried out.This method can be used to reduce the core temperature of study subject, and therefore is of value to study subject.In addition, can change heart rate and metabolism and help study subject.In these occasions, described study subject can be mammal arbitrarily, can be human especially.
The present invention also provides by use its concentration to study subject is enough to the 5 '-AMP of medicine effective quantity of induced hypnotic or the method that analog comes Cure for insomnia.For example, the invention provides a kind of pharmaceutical composition.Described pharmaceutical composition comprises is enough to produce hibernation-like state, reduce core temperature, heart is produced the 5 '-AMP or the analog of the medicine effective quantity of inotropic action, the cell that slows down growth, the metabolic speed that slows down, blood sugar lowering concentration and their combination.
The invention provides and a kind ofly change metabolic active method by 5 '-AMP or 5 '-AMP analog to study subject drug administration effective dose, wherein said 5 '-AMP or analog have changed the activity that is selected from one or more the metabolic enzymes in lipase, pancreatic lipase, pancreatic lipase associated protein, phosphofructokinase, fructose-1, glycogen phosphorylase and their combination.
The present invention also further provides the method that is used to collect, protect and/or preserve organ, comprises to the study subject with described organ adding the compositions that comprises 5 ' of effective dose-AMP or analog.
The present invention also provides the tranquillizer compositions of using, be used to induce the study subject dormancy in emitter.Described emitter can be boomerang, shot, bullet, pin, thorn (stint), arrow, bead, grenade, pursue and attack and run or similarly emitter and their combination.In addition, described tranquillizer compositions can be the nano-particle of solid, powder, liquid, gel, gas, band coating or their combining form.Described tranquillizer compositions can be applied on other chemical compounds and the composition, be incorporated in other chemical compounds and the composition or with other chemical compounds and composition and combine, and described other chemical compounds and composition scribble the nano-particle of 5 '-AMP for (for example) or use smoke grenade or 5 '-AMP steam of the inside eruption of flash of light grenade.Described tranquillizer compositions comprises 5 ' of medicine effective quantity-AMP or analog and pharmaceutically useful carrier.
Compositions of the present invention is applicable in many different application, and described application is included in means of transport (for example automobile, aircraft, bus, lorry, train, yacht, boats and ships etc.) and building (for example office building, bank, public building, law court, general office, factory etc.) is gone up the anti-terrorism security system of using.In addition, compositions of the present invention is applicable in prison and the prevention instrument (correction facilities), thereby provides safely and effectively mechanism to control individuality, for example the rioter.For example, the present invention can be attached in the aircraft as the anti-terrorism security system.
Be provided for inducing aboard the aircraft anti-terrorism security system of one or more study subject dormancy.This anti-terrorism security system comprises the aircraft with fuselage, the main cabin adjacent with cockpit that is arranged in the cockpit of fuselage and is arranged in fuselage.The security system of will pressurizeing is placed in the aircraft and at the fuselage place and comprises one or more outlets.This pressurization security system comprises 5 ' of medicine effective quantity-AMP or analog and propellant.In addition, provide one or more openers.The unlatching of these one or more openers causes 5 '-AMP or 5 '-AMP analog to be released in cockpit and/or the main cabin, and induces them to produce dormancy when 5 '-AMP or 5 '-AMP analog is sucked by one or more study subjects.In addition, in cockpit, provide the air-isolation system for one or more drivers.
In addition, provide one or more openers, and these one or more openers can be connected to a plurality of site in the whole aircraft by rigid line.Though can connect opener by rigid line, this not necessarily can use wireless device (for example remote control, secret key chain etc.) and entrained by aerial guard, driver, aircraft staff etc.In some embodiments, one or more outlets are set are communicated with, make 5 ' of medicine effective quantity-AMP or analog and propellant aim at study subject with the air circulation system of aircraft.A kind of connection method comprises outlet directly is combined in the air circulation system.Owing to exist study subject may not be positioned at outlet position adjacent place with the air circulation system of aircraft, so independent outlet can be set in whole aircraft.In cockpit,, one or more drivers can be a kind of form of cockpit of sealing, its outlet of security system or of need not to pressurize attached to the veil in the air-isolation system for providing isolated air system.
The another kind of potential purposes of 5 '-AMP is the early treatment to apoplexy.Because 5 '-AMP can reduce CBT, heart rate and metabolic speed, so behind injection 5 '-AMP, can reduce because the blood that apoplexy causes flows into the amount in the brain.In addition, before the reduction of CBT will be limited in operation, operation neutralization operation back since to oxygen and other metabolism need the cell damage that causes of minimizing.
Pharmaceutical composition
Thereby the invention provides method by inducing the study subject dormancy to 5 '-AMP or the 5 '-AMP analog of study subject drug administration effective dose or stagnating and give birth to.5 '-AMP or analog are applicable to administration in the following ways, and described mode is subcutaneous injection, intramuscular injection, intravenous injection, peritoneal injection, nasal mucosa medicine administration, intravaginal administration, intranasal administration, through bronchus administration, eye drops, in ear administration, intracranial administration, oral administration, parenteral, rectally, sublingual administration, topical, percutaneous dosing or their combination.5 '-AMP or analog can be made into capsule, capsule sheet, soft gel, soft gelatin capsule, suppository, thin film, granule, colloid, insert, lozenge, piller, tablet, piece, dish, mastic sheet, Emulsion, washing liquid, ointment, aerosol spray, roll and put formula liquid on the skin, roll and put formula rod, transdermal patch, subcutaneous implantation form, pads or their combination on the skin.5 '-AMP or analog tend to delay discharge in biodegradable carrier.
The medicine effective quantity of 5 '-AMP or analog can also comprise one or more pharmaceutically useful carriers.For example, pharmaceutically useful carrier comprises water, aqueous solvent, aprotic solvent, proton solvent, hydrophilic solvent, hydrophobic solvent, polar solvent, non-polar solven, softening agent and/or their combination.
In some embodiments, pharmaceutically useful carrier comprises the aerosol spray that is selected from propane, butane, isobutene., pentane, different propane, fluorocarbon, dimethyl ether or their mixture.But, can known other aerosol sprays of operation technique personnel, for example ether, dimethyl ether C
1-C
6Saturated hydrocarbons, propane, butane, isobutene., pentane, different propane, hydrofluoroalkane, fluorocarbon and their mixture.
According to the concrete administering mode that study subject adopted, multiple different method and the structure of providing will be adopted.Usually the method that provides of 5 '-AMP or analog comprises chewable tablet, solid, fuse or disintegrating tablet, liquid, gel, tablet, capsule, powder, washing liquid, ointment, colloid, medicine piece and their combination.In addition, described compositions can comprise at least a reagent that is selected from softening agent, water, inorganic powder, foaming agent, emulsifying agent, aliphatic alcohol, fatty acid and their combination.
Described Pharmaceutical composition is applicable to following mode administration, and described mode is subcutaneous injection, intramuscular injection, intravenous injection, peritoneal injection, nasal mucosa medicine administration, intravaginal administration, intranasal administration, through bronchus administration, eye drops, in ear administration, intracranial administration, oral administration, parenteral, rectally, sublingual administration, topical, percutaneous dosing or their combination.Described pharmaceutical composition can be made into capsule, capsule sheet, soft gel, soft gelatin capsule, suppository, thin film, granule, colloid, insert, lozenge, piller, tablet, piece, dish, mastic sheet, Emulsion, washing liquid, ointment, aerosol spray, roll and put formula liquid on the skin, roll and put formula rod, transdermal patch, subcutaneous implantation form, pad or their combination on the skin.In addition, described pharmaceutical composition tends to delay discharge in biodegradable carrier.
The pharmaceutical composition that contains medicine effective quantity 5 '-AMP or 5 '-AMP analog can also comprise one or more pharmaceutically useful carriers.For example, pharmaceutically useful carrier comprises water, aqueous solvent, aprotic solvent, proton solvent, hydrophilic solvent, hydrophobic solvent, polar solvent, non-polar solven, softening agent and/or their combination.But other configuration things can comprise the modifier of optional stabilizing agent, pH regulator agent, surfactant, spice, astringent, base material of cosmetics, pigment, dyestuff biological utilisation and/or their combination.But other configuration things can comprise the modifier of optional stabilizing agent, pH regulator agent, surfactant, spice, astringent, base material of cosmetics, pigment, dyestuff biological utilisation and/or their combination.
In some embodiments, pharmaceutically useful carrier comprises the aerosol spray that is selected from propane, butane, isobutene., pentane, different propane, fluorocarbon, dimethyl ether or their mixture.But, can known other aerosol sprays of operation technique personnel, for example ether, dimethyl ether C
1-C
6Saturated hydrocarbons, propane, butane, isobutene., pentane, different propane, hydrofluoroalkane, fluorocarbon and their mixture.
According to concrete administering mode, multiple different method and the structure of providing will be adopted.Usually the method that provides of 5 '-AMP or analog comprises chewable tablet, solid, fuse or disintegrating tablet, liquid, gel, tablet, capsule, powder, washing liquid, ointment, colloid, medicine piece and their combination.In addition, described compositions can comprise at least a reagent that is selected from softening agent, water, inorganic powder, foaming agent, emulsifying agent, aliphatic alcohol, fatty acid and their combination.
Pharmaceutically useful carrier can be water, aqueous solvent, aprotic solvent, proton solvent, hydrophilic solvent, hydrophobic solvent, polar solvent, non-polar solven, softening agent and/or their combination.But other configuration things can comprise the modifier of optional stabilizing agent, pH regulator agent, surfactant, spice, astringent, base material of cosmetics, pigment, dyestuff biological utilisation and/or their combination.
The invention provides and be applicable to the aerosol composition of inducing the study subject dormancy.This aerosol composition comprises 5 ' of medicine effective quantity-AMP or analog and propellant.In some embodiments, described aerosol composition is the form of inhalant; But, can adopt other systems.
The pharmaceutical composition that contains medicine effective quantity 5 '-AMP or 5 '-AMP analog can also comprise one or more pharmaceutically useful carriers or other active agents.For example, pharmaceutically useful carrier comprises water, aqueous solvent, aprotic solvent, proton solvent, hydrophilic solvent, hydrophobic solvent, polar solvent, non-polar solven, softening agent and/or their combination.But other configuration things can comprise the modifier of optional stabilizing agent, pH regulator agent, surfactant, spice, astringent, base material of cosmetics, pigment, dyestuff biological utilisation and/or their combination.The example of other active agents is included in cited those herein, and is that the technical staff is known.
In some embodiments, described pharmaceutically useful carrier comprises the aerosol spray that is selected from propane, butane, isobutene., pentane, different propane, fluorocarbon, dimethyl ether or their mixture.But, can known other aerosol sprays of operation technique personnel, for example ether, dimethyl ether C
1-C
6Saturated hydrocarbons, propane, butane, isobutene., pentane, different propane, hydrofluoroalkane, fluorocarbon and their mixture.
The present invention also provides the aerosol that is used to reduce the study subject core temperature.For child who often mismatches pharmaceutical treatment and animal, aerosol is particularly advantageous.The present invention also provides the aerosol that is used to reduce the study subject core temperature.This aerosol comprises the aerosol container with one or more and opener.This aerosol container can be any form easily.In some scenarios, described aerosol container is the aerosol atomizer similar to the hairspray bottle, and in other embodiment, described aerosol container can be sphere.5 ' of medicine effective quantity-AMP or analog are housed in aerosol container.
The pharmaceutical composition that contains medicine effective quantity 5 '-AMP or 5 '-AMP analog can also comprise one or more pharmaceutically useful carriers or other active agents.In addition, described aerosol container comprises the propellant of packing into wherein.In some embodiments, pharmaceutically useful carrier comprises the aerosol spray that is selected from propane, butane, isobutene., pentane, different propane, fluorocarbon, dimethyl ether or their mixture.But, can known other aerosol sprays of operation technique personnel, for example ether, dimethyl ether C
1-C
6Saturated hydrocarbons, propane, butane, isobutene., pentane, different propane, hydrofluoroalkane, fluorocarbon and their mixture.
The pharmaceutical composition of the present invention that is applicable to the injection purposes comprises aseptic aqueous solution or dispersion liquid and the sterilized powder that is used for temporarily preparing aseptic injectable solution or dispersion liquid.In all cases, described compositions all must be aseptic, and must flow to the degree that can inject easily.Described carrier can be solvent or disperse medium, comprises (for example) water, ethanol, polyhydric alcohol (for example glycerol, propylene glycol, liquid polyethylene glycol etc.), their suitable mixture and vegetable oil.
The method that aseptic injectable solution of the present invention can be incorporated in the suitable solvent by the present composition with aequum prepares, and wherein said solvent contains one or more compositions cited or that the technical staff is known herein.Usually, dispersion liquid is incorporated in the sterile carrier and is prepared from the composition that wherein said sterile carrier comprises basic disperse medium and is selected from other needs in above-mentioned those materials of enumerating by treating chemical compound.Using sterilized powder to prepare under the situation of aseptic injectable solution, preparation method can comprise vacuum drying, spray drying, cryospray and lyophilization, and these methods can obtain the powder of active component (for example treating chemical compound) and the powder of any required supplementary element that obtained by aseptic filtration solution before.
Pharmaceutical composition of the present invention also is applicable to the oral administration mode of using inert diluent for example or edible and absorbable carrier.Described treatment chemical compound and other compositions can also be encapsulated in duricrust or the soft shell gel capsule, be pressed in the tablet or directly be incorporated in the food of study subject.For the mode of per os treatment administration, the treatment chemical compound can be mixed with excipient, and can use to swallow forms such as sheet (ingestible tablet), buccal tablet, lozenge, capsule, elixir, suspension, serosity, film.The content of treatment chemical compound in compositions and prepared product certainly changes, and this point is known for technicians.The consumption of treatment chemical compound in described medicative compositions is such amount, and this consumption makes that proper dosage will obtain keeping.
Consistent with maintenance dosage in order to be easy to administration, the compositions of the present invention of employing parenteral mode can adopt the form of dosage unit.As used herein, dosage unit refers to the unit through physical separation, and this unit is the unit dose that is suitable for as study subject use to be treated; Each dosage unit all comprises the treatment chemical compound of scheduled volume and required pharmaceutical carrier, and wherein said scheduled volume is the amount that can produce required therapeutic effect through calculating.
Solution of the present invention can be prepared from the water that suitably is mixed with surfactant (for example hydroxy propyl cellulose).Dispersion liquid can also and/or be prepared from oil at glycerol, liquid polyethylene glycol and/or their mixture.Under common storage and/or service condition, these prepared products contain the antiseptic that suppresses growth of microorganism.
For oral administration, be contained in for the mode of oral administration and sublingual administration, the pharmaceutical composition of the present invention of soft gelatin capsule, capsule sheet, tablet, capsule or powder type can be with the form administration of solution or suspension.For the mode of rectally, for chemical compound being discharged in intestinal, sigmoid colon and/or the rectum, chemical compound of the present invention can be with suppository, ointment, enema, tablet and Emulsion form administration.For example, when making suppository, can use the compositions of Cera Flava/glycerol, thereby form the soluble suppository of body to see through rectum or urethra.
In conventional other additives that use can be contained in pharmaceutical composition, these additives were known in the art.Described additive comprises (for example): antitack agent (antiplastering aid, fluidizer, flow promortor, lubricant), for example Talcum, magnesium stearate, fumed silica, silica particle, Polyethylene Glycol, surfactant, wax, stearic acid, stearate, stearic acic derivative, starch, hydrogenated vegetable oil, sodium benzoate, sodium acetate, leucine, PEG-4000 and lauryl magnesium sulfate.
Other additives comprise: binding agent (for example binding agent), promptly, give the reagent of powdered form material adhesion by granule-granule combination, for example substrate binding agent (for example dry state starch, dry state sugar), film adhesive (for example PVP, gelatinized corn starch, cellulose, bentonite and sucrose) and Chemical Felter (cellulose derivative of polymer, for example carboxymethyl cellulose, HPC and HPMC; Syrup; Semen Maydis pulp, water soluble polysaccharide, for example Radix Acaciae senegalis, tragacanth, guar gum and alginate esters; Gel; The gel hydrolyzate; Agar; Sucrose; Dextrose; And non-cellulose class binding agent, for example PVP, PEG, vinylpyrrolidone copolymer, pre-gelatinized starch, Pyrusussuriensis alcohol and glucose).
For some is active, what come in handy provides buffer agent (or buffer), wherein acid is pharmaceutically useful acid, hydrochloric acid for example, hydrobromic acid, hydroiodic acid, sulphuric acid, nitric acid, boric acid, phosphoric acid, acetic acid, acrylic acid, adipic acid, alginic acid, alkanesulfonic acid, aminoacid, ascorbic acid, benzoic acid, boric acid, butanoic acid, carbonic acid, citric acid, fatty acid, formic acid, fumaric acid, gluconic acid, hydroquinone sulphuric acid, arabo-ascorbic acid, lactic acid, maleic acid, methyl-sulfuric acid, oxalic acid, to bromophenyl sulphuric acid, propanoic acid, the p-toluenesulfonic acid, salicylic acid, stearic acid, succinic acid, tannic acid, tartaric acid, TGA, toluenesulfonic acid and uric acid, wherein alkali is pharmaceutically useful alkali, aminoacid for example, amino-acid ester, ammonium hydroxide, potassium hydroxide, sodium hydroxide, sodium bicarbonate, aluminium hydroxide, calcium carbonate, magnesium hydroxide, Magnesiumaluminumsilicate, synthetic aluminium silicate, synthetic brucite, the hydrogen-oxygen magnalium, diisopropyl ethyl amine, ethanolamine, ethylenediamine, triethanolamine, triethylamine, triisopropanolamine, perhaps pharmaceutically useful cation and acetic acid, acrylic acid, adipic acid, alginic acid, alkanesulfonic acid, aminoacid, ascorbic acid, benzoic acid, boric acid, butanoic acid, carbonic acid, citric acid, fatty acid, formic acid, fumaric acid, gluconic acid, hydroquinone sulphuric acid, arabo-ascorbic acid, lactic acid, maleic acid, methyl-sulfuric acid, oxalic acid, to bromophenyl sulphuric acid, propanoic acid, the p-toluenesulfonic acid, salicylic acid, stearic acid, succinic acid, tannic acid, tartaric acid, TGA, the salt that toluenesulfonic acid and uric acid form.
The dosage form of liquid can also comprise one or more chelating agen.The example of chelating agen comprises (for example) polyacrylic acid, citric acid, ethylenediaminetetraacetic acid, disodiumedetate etc.In use, chelating agen and activating agent can be provided simultaneously, thereby original position is preserved and the protection activating agent.Liquid active agent in chelating agen and porous particle configuration thing can be combined, perhaps chelating agen can be incorporated in the medicine layer that wherein is dispersed with porous particle.
Liquid configuration thing can also comprise one or more surfactants, for example nonionic surfactant, anion surfactant and cationic surfactant or their combination.The example that is applicable to the non-toxicity anionic surfactant that forms liquid basigamy glove comprises that (for example) is known as Triton
TMAlkylating aryl Aethoxy Sklerol; Polysorbate, for example polysorbate80; Polyoxyethylene uncle dodecyl thioether, available is Nonic
TMFatty and amic condensation substance or Alrosol
TMThe condensation substance of aromatic series polyglycol ether or Neutronyx
TMFatty acid chain alkanolamine or Ninol
TMSorbitan mono-laurate or Span
TMPolyoxygenated ethylidene sorbitan esters or Tweens
TMSpan60 polyoxyethylene or Tween 20
TMDehydrating sorbitol monooleate polyoxyethylene or Tween 80
TMPolyoxygenated propylidene-polyoxygenated ethylidene or Pluronic
TMThe glyceride of Pegylation, for example Labraosol; Polyoxyethylated castor oil, for example Cremophor and polyoxypropylene-polyoxyethylene-8500 or Pluronic
TMFor example, anion surfactant comprises (for example) sulfonic acid and sulphonic acid ester salt, for example sodium lauryl sulfate, sulfur ethyl enuatrol, dioctyl sodium sulphosuccinate, sodium hexadecyl sulfate, sodium tetradecyl sulfate; Sulphation ether; Sulfated amide; The sulphation alkanol; Sulfuric ester; The sulphation carboxylic acid; Sulphation aromatic hydrocarbon; Sulphation ether etc.The cationic surfactant that is used for liquid configuration thing comprises (for example) hexadecylpyridinium chloride; Cetyl trimethyl ammonium bromide; Diethylmethyl cetyl chloride ammonium; Benzalkonium chloride; Benzalkonium bromide; The primary alkyl ammonium salt; Secondary alkylammonium salt; Tertiary alkyl ammonium salt, season alkylammonium salt; The acidylate polyamine; The salt of heterocyclic amine; The carnitine Hexadecanoyl chloride; Methyl-sulfuric acid mountain Yu acid Disnalon (Ferrer). etc.Per 100 parts activating agent provides the surfactant of 0.01 weight portion to 1000 weight portion usually; But the technical staff recognizes that per 100 parts activating agent also can use the surfactant of other concentration and other weight portions.
The example that is used for activating agent of the present invention comprises: pain stop and anti-inflammation agent, for example acetaminophen, aspirin, salicylic acid, cresotic acid, choline salicylate, glycol salicylate, the 1-menthol, Camphora, mefenamic acid, flufenamic acid, indometacin, diclofenac, chlorophenol acid, ibuprofen, ketone Lip river phenol isopropyl ester, naproxen, Lip river, pula phenol, fenoprofen, sulindac, fenbufen, the acid of epoxy indenes, flurbiprofen, indoprofen, Pirocrid, fentiazac, tolmetin, tiaprofenic acid, bendazac; bufexamac; piroxicam; Phenylbutazone; crovaril; clofezone; pentazocine; epirizole etc.Reagent to central nervous system's generation effect for example has tranquilizer, hypnotic, antianxiety drug, analgesic and anesthetis, for example too slave, nicotine etc. of Chloral, Lepetan, naloxone, haloperidol, fluphenazine, pentobarbital, phenobarbital, quinalbarbitone, amobarbital, cydobarbital, codeine, lignocaine, tetracaine, dyclonine, cinchocaine, cocaine, procaine, mepivacaine, bupivacaine, etidocaine, prilocaine, benzocaine, sweet smell.Local anesthetic for example has benzocaine, procaine, cinchocaine, lignocaine etc.
Hydryllin or anti-antiallergic agent for example have diphenhydramine, dimenhydrinate, perphenazine, Pro-entra, pyrilamine, chloreyclizine, phenergan, carbinoxamine, Pyribenzamine, brompheniramine, hydroxyzine, cyclizine, mechlizine, clorprenaline, teldane, chlorpheniramine etc.Anti-allergic agent for example has antazoline, sleepwell, chlorpheniramine, pyrilamine, pheniramine etc.Alleviate congested agent phenylephrine, ephedrine, naphazoline, tetrahydrozoline etc. are for example arranged.Antipyretic for example has aspirin, salicylamide, Non-Steroidal antiinflammatory etc.Anti-migraine medicament for example has dihydroergotamine, pizotifen etc.Acetone class antiinflammatory for example has hydrocortisone, cortisone, dexamethasone, fluocinolone acetonide, omcilon, medrysone, prednisolone, flurandrenolide, prednisone, halcinonide, methyl meticortelone, fludrocortisone, Adrenalone, paramethasone, betamethasone, ibuprofen, naproxen, fenoprofen, fenbufen, BTS-18322, indoprofen, ketoprofen, suprofen, indometacin, piroxicam, aspirin, salicylic acid, diflunisal, the cresotinic acid acid esters, phenylbutazone, sulindac, mefenamic acid, Meclofenamic Acid, Tuo Maiting etc.
The muscular flaccidity agent for example has tolperisone, baclofen, dantamacrin, cyclobenzaprine.Steroid for example has: androgen steroid, for example testosterone, methyl testosterone, fluoxymesterone; Estrogen, for example conjugated estrogen, esterified estriol, estrone sulfuric ester piperazine, 17-, 17-valerate, 1,3,5,7-estratetraen-3-ol-17-one, norquen mestranol, estrone, estriol, 17 β-ethinyl estradiol, diethylstilbestrol; Progestational hormone medicament, for example progesterone, 19-norprogesterone, norethindrone, norethindrone acetate, melengestrol, chlorination progesterone, anhydrohydroxyprogesterone, medroxyprogesterone acetate, hydroxyprogesterone caproate, ethynodiol diacetate, Norethynodrel, 17-α-hydroxyprogesterone caproate, dydrogesterone, dimethisterone, lynestrenol, methylnorethindron, demegestone, promegestone, megestrol acetate etc.
Breathe medicament theophylline and β2-Shen Shangxiansu agonist, for example albuterol, terbutaline, alotec, ritodrine, carbuterol, fenoterol, quinprenaline, rimiterol, Salmefamol, soterenol, tretoquinol etc. are for example arranged.Sympatheticomimetic medicine for example has dopamine, norepinephrine, phenylpropanolamine, phenylephrine, Pseudoephedrine, amphetamine, propylhexedrine, arecoline etc.Antimicrobial agent comprises: antibacterial agent, antifungal, antimycotic agent and antiviral agent; Tetracycline (for example oxytetracycline), penicillin (for example ampicillin), cephalosporin (for example cefalotin), aminoglycoside antibiotics (for example kanamycin), Macrocyclolactone lactone kind medicine (for example erythromycin), chloromycetin, iodide, nitrofurantoin, nystatin, amphotericin, fradiomycin, sulfonamide, pyrrolnitrin, clotrimazole, miconazole, chloromycetin, sulfacetamide, sulfamerazine, sulfadiazine, sulfamethyldiazine, sulfamethizole and sulfafurazole; Antiviral drugs comprises iodouracil desoxyriboside, clarithromycin and other anti-infectives (comprising nitrofural etc.).
Antihypertensive agents for example has clonidine, alpha-methyldopa, reserpine, syrosingopine, rauwolfine, cinnarizine, hydrazine, prazosin etc.The resisting hypertension diuretic for example has diuril, Hydrochlorothiazide, bendroflumethiazide, trichlormethiazide, furosemide, tripamide, methyclothiazide, benzene fluorine diuril (penfluzide), three hydroxyl thiazines (hydrothiazide), spironolactone, Mei Tuola hydrazone etc.Cardiac tonic for example has Folium Digitalis Purpureae, ubidecarenone, dopamine etc.Coronary artery diastole medicament for example has: organic nitrates (for example nitroglycerine, sorbide nitrate, erythrityl tetranitrate and pentaerythritol tetranitrate), dipyridamole, dilazep, trapidil, trimetazidine etc.The vasoconstriction medicament for example has dihydroergotamine, dihydroergotoxine etc.Beta blocker or arrhythmia medicament for example have timolol, pindolol, propranolol etc.Body fluid class medicament for example has prostaglandin, natural and synthetic (for example) PGE1, PGE2 α and PGF2 α, and the misoprostol that is similar to PGE1.Anti-spasmodics for example have atropine, methantheline, papaverine, cinnamedrine, Methscopolamine (methscopolamine) etc.Calcium ion antagonist and other cardiovascular preparation agent for example have captopril, diltiazem, nifedipine, nicardipine, verapamil, bencyclane, Ifenprodil Tartrate, molsidomine, clonidine, prazosin etc.Anticonvulsant for example has nitrodiazepam, peacefulness, phenytoin etc.
Be used for dizzy medicament isoproterenol, betahistine, scopolamine etc. are for example arranged.For example there are adelserpine, chlorpromazine and Benzodiazepine antianxity in the tranquillizer, for example alprazolam, chlordiazepoxide, chlordiazepoxide, halazepam, oxazepan, prazepam, clonazepam, flurazepam, triazolam, lorazepam, stable etc.Stable medicament for example has the thiophene piperazine, comprise that thiopropazate, chlorpromazine, triflupromazine, mesoridazine, piperazine pool reach thiazine (piperracetazine), thioridazine, acephenazine, fluphenazine, perphenazine, trifluoperazine and other main tranquillizer, for example chlorprothixene, thiothixene, haloperidol, bromperidol, loxapine and molindone, and those medicaments of feeling sick in treatment, using with low dosage in the vomiting etc.Anti-tumor agents for example has 5-fluorouracil and derivant thereof, krestin, Picibanil, ancitabine, cytosine arabinoside etc.Estrogen antagonist or hormone antagonist class medicament for example have tamoxifen or human chorionic gonadotropin etc.Miotic for example has pilocarpine etc.The cholinomimetic antagonist for example has choline, acetylcholine, methacholine, carbachol, urecholine, pilocarpine, hydroxycholine, arecoline etc.The cholinomimetic function blocking agent of anti-hydroxycholine or hydroxycholine for example has atropine, scopolamine, melyltropeine, Methscopolamine, homatropine methylbromide, methantheline, Ciclolux, N-ethyl-N-(.gamma.-picolyl)tropamide, Propantheline, Anisotropine, dicycloverine (dicyclomine), eucatropine etc.Mydriatic for example has atropine, Ciclolux, melyltropeine, scopolamine, N-ethyl-N-(.gamma.-picolyl)tropamide, eucatropine, hydroxyamphetamine etc.Psychic energizer for example has 3-(2-aminopropyl) indole, 3-(2-ammonia butyl) indole etc.
The antidepressant medicament for example has isocarbossazide, phenelzine, tranylcypromine, imipramine, amitriptyline, trimeprimine, doxepin, desipramine, nortriptyline, protriptyline, Amoxapine, Ma Pu for mark, trazodone etc.The anti-diabetic medicament for example has insulin, and anticancer agent for example has tamoxifen, methotrexate etc.The anorexigenic agent for example has dextroamphetamine, methamphetamine, phenylpropanolamine, Fenfluramine, amfepramone, Mazindol, phentermine etc.The malaria medicament for example has 4-quinolin-2-ylamine, alpha-amido quinoline, chloroquine, pyrimethamine etc.Antiulcer agents for example has a meter Suo Pute, omeprazole, enprostil etc.Antiulcer agents for example has allantoin, aldioxa, alcloxa, N-epoxytropine tropate metilsulfate etc.The anti-diabetic medicament for example has insulin etc.
The above-mentioned medicine of mentioning can be used in combination as required.In addition, above-mentioned medicine can use with the form of former state, if or above-mentioned medicine can the salifiable words of shape, then can be to use with suitable acid or the salifiable form of alkali shape.If above-mentioned medicine has carboxyl, can use their ester.
Embodiment
Be for related research in research and development process of the present invention is described, and for the preferred embodiments of the invention are shown in following examples are included in.What it should be appreciated by those skilled in the art is, disclosed technology has been represented in order to implement the present invention preferably by the technology that the inventor invented in following examples, therefore, can think that these technology have constituted and be used to implement preference pattern of the present invention.Yet, open according to the present invention, those skilled in the art will appreciate that under the situation that does not break away from the spirit and scope of the invention, in disclosed specific embodiments, can make many modifications, and the embodiment of these modifications still can obtain similar or close result.
The expression of mClps and mPlrp2 is activated by the dark state that continues
Usually, in the hibernation process, animal is away from cycle light and dark, and enters into a kind of environment of lasting dark.
9Fig. 1 a is the analysis to cDNA microarray images among Fig. 1 b, determines thus be maintained at the liver that continues the mice under the dark surrounds and be maintained in the liver of the mice under light-dark situation, and whether expression of gene there are differences pattern.The gene of being analyzed comprises the gene of the CLPS that encodes, and this CLPS is the enzyme companion of PLRP2, is that the food fat acid decomposition is needed in the gastrointestinal organ.
10Because this expression of gene that studies confirm that before has tissue specificity and is confined to pancreas and the gastrointestinal organ,
10-11So the expression of viewed mClps is unexpected in liver.
Fig. 2 is the image of RNA hybridization technique, and this image shows at zeitgeber action time (ZT), at wild type, the invalid (mPer1 of mPer1
-/-), the mPer2 (mPer2 that suddenlys change
M/m) and two the sudden change (for mPER1 and mPER2 defective (mPer1
-/-/ mPer2
M/m) mice) among the liver mRNA of mice, mClps expresses.
12-13The RNA hybridization technique the analysis showed that to have among the following genotypic liver mRNA that is in the mice under the cycle light and dark, and mClps does not express, and described genotype is: wild type, mPer1
-/-And mPer2
M/mBut, lack fully the biological clock function, be in three mPer1 under the cycle light and dark
-/-/ mPer2
M/mIn the mouse genotypes,
12Observing mClps gives full expression to.Therefore, the expression of mClps may be subjected to the control of biological clock, and this point is confirmed by continuing dark research.The dark that continues has activated the expression of mClps and mPlrp2 in the mouse liver.In the mice under being in cycle light and dark, study the expression of mClps and mPlrp2 by the RNA hybridization analysis.Annotate: for mPer1
-/-/ mPer2
M/mThe sample mice, preceding 6 corresponding mRNA that swimming lane is a nephridial tissue from left to right.
Fig. 3 is the image of RNA hybridization technique, and this image shows that mClps expresses in being in the liver that continues the mice under the dark.The RNA hybridization technique shows that in above-mentioned four kinds of mouse genotypes, in the time point of being studied round the clock (CT), mClps expresses.The expression of mClps and mPlrp2 is as follows in being in the mice that continues under the dark: be in wild type, mPer1 under cycle light and dark as described herein or the lasting dark
-/-, mPer2
M/mAnd mPer1
-/-/ mPer2
M/mIn the mice, obtained a liver rna in per 4 hours, and detect Gapdh mRNA and regulate and control as inside.And in being in the wild-type mice that continues under the dark, the expression of mClps shows tangible physiological rhythm pattern, and at the mPer1 of physiological rhythm defective
-/-, mPer2
M/mAnd mPer1
-/-/ mPer2
M/mMice in, this concussion overview is eliminated.The analysis of molecules that carried out in many days confirms further that biological clock has been regulated and is in the expression that continues the mClps in the dark mice down that for example referring to the hybridization of the RNA among Fig. 4 a image, this image shows mClps expression in the liver.The expression of mClps is collaborative mutually with the expression of its enzyme companion mPlrp2.The RNA hybridization technique shows, the expression pattern of mPlrp2 is consistent with the expression pattern of mClps seen in Fig. 2 and 3.Therefore, molecule and gene studies confirm that the expression of mClps and mPlrp2 all is under the regulation and control of biological clock in the liver, and are activated by the dark state that continues.MClps regulates the catabolism of fat, and induces through the blood signal by the dark state that continues.
Fig. 4 b is the image of RNA hybridization technique, and it is similar during the biorhythm of lipase expression mutually among a plurality of peripheral organs of the mice under being in lasting dark that this image shows.Adopt the RNA hybridization technique to continue expression down dark and that be in mClps among the mice peripheral organ under the cycle light and dark and the analysis showed that to being in, only find in the pancreas stomach function regulating of the mice under being in cycle light and dark that mClps expresses, therefore, this phenomenon is consistent with their original function in the food fat degraded.
10-11Distinct therewith is in being in the mice that continues under the dark, except the diet organ, all observing mClps in skeletal muscle, fatty tissue, heart, liver and lung sufficient expression has taken place.As the RNA hybridization technique finding among Fig. 6, in brain and kidney, do not find the expression of mClps.The peripheral tissues that to take a sample when ZT12 carries out the RNA hybridization technique analysis that mClps expresses.
Fig. 5 illustrates at a time, the figure of the triacylglycerol substrate analogue of the hydrolysis that under the effect of liver albumen, forms, this figure shows that fat acid decomposition relates to the expression of mClps in the liver, wherein in the extract activity of lipase be by by the triacylglycerol substrate (for example [
3H] glycerol trioleate) the radioactivity free fatty that discharges records.The LEx that is obtained by the mice that is under the cycle light and dark does not demonstrate lipase active (data not shown goes out) to glycerol trioleate.Distinctly therewith be, demonstrate that the activity of lipase has the biorhythm pattern for the LEx of the mice under successive lasting dark.Detecting Gapdh mRNA regulates and control as inside.Mice under being in cycle light and dark and being in the liver fat enzymatic activity that continues the mice under the dark, range of error is expressed as SEM (n=3).
Also the light inhibition kinetics that lipase in being in the mice that continues under the dark is expressed is measured, to determine signaling mechanism.As Fig. 7 finding, the RNA hybridization technique the analysis showed that, in 1st hour in being exposed to light, it is higher that the expression of mClps and mPlrp2 keeps, but in being exposed to light after about 5 to 7 hours, the expression of mClps and mPlrp2 reduces.Determine that by the RNA hybridization technique light to mClps and mPlrp2 expression suppresses to start from CT7 in the DD mice.The being seen biobelt of use mPlrp2 probe shows the cross reaction with its isoform mPlrp1.Detecting Gapdh mRNA regulates and control as inside.Distinct therewith is that the being in mice that continues under the dark that is not exposed in the light demonstrates mClps and mPlrp2 high level expression.Consider the wide expression pattern of lipase in being in the mice that continues under the dark, in being in the mice that continues under the dark, the expression of lipase may be subjected to the adjusting of cycle signal so.The cycle signal of supposing may be respectively plays the inhibitor that mClps and mPlrp2 express or the effect of activator in cycle light and dark or lasting dark cycle.For example, when the activator with supposition was expelled in the mice body that is under the cycle light and dark, this activator was just induced the mClps expression of gene.Equally, in the time of in the inhibitor with supposition is expelled to the mice body that is under the lasting dark, this inhibitor just suppresses the expression of mClps.
In being in the mouse blood that continues under the dark, physiological rhythm is regulated molecule and is increased
Non-polypeptide class water organic moiety to the blood extract that obtained by mice when each ZT and the CT is analyzed, and identifies the circulation regulator of supposition.Fig. 8 is the chromatograph that the retention time at a plurality of peaks that obtained by the reversed-phase HPLC analysis is shown.The representative profile diagram of high pressure liquid chromatography (HPLC) is the analysis situation of the blood extract obtained in by the mice that is under the cycle light and dark when ZT0 and ZT12.Annotate: peak # 2 shows the circadian rhythm concussion.
After by reversed-phase HPLC dissolving extract, except retention time when the initial void volume less than about 5 minutes incomplete isolating peak, has 4 highly peaks (for example being labeled as #1, #2, #3 and #4) of reproduction.As shown in Figure 8, in the sample of ZT and CT sampling, have a peak (#2) all to have significant circadian rhythm pattern, the circadian rhythm of peak #4 changes then not too obvious.Shown in the curve among Fig. 9, the analysis showed that of peak #1 and #3 there is not significantly pattern round the clock.Figure 10 is the bar graph of the absorptance under special time for being in the mice that continues the mice under the dark and be in cycle light and dark.Be in cycle light and dark and be in the formed #1 of mice, #2, #3 and the #4HPLC peak area that continue under the dark quantitatively (it is about being in cycle light and dark and being in the inside protein concentration that continues the mice under dark (A for example
260nm/ mg albumen)) in, range of error is expressed as SD (n=2).To compare with the size (n=4) that obtains peak #2 and #4 by the mice that is in cycle light and dark by the size (n=4) of peak #2 that is in the mice acquisition that continues under the dark and #4, show with the mice that is in cycle light and dark and compare, in being in the mice that continues under the dark, have only peak #2 obviously higher, it has the corresponding to feature of cycle signal with supposition, for example referring to Fig. 8,9 and 10.
The signal that physiological rhythm is regulated is 5 '-adenylic acid
Figure 11 is the HPLC chromatogram of the retention time of contrast several samples and chemical standard chemical compound.The spectral scan that peak #2 is carried out is presented at the 260nm place and has maximum absorbance, and this shows that it is a nucleoside base molecule.Adopt the nucleoside standard of chemistry definition to carry out the HPLC analysis, the retention time of peak #2 and #4 was respectively about 8.5 minutes and about 12.5 minutes.(5 '-AMP) is relevant with the retention time of adenosine, referring to the drawing board above Figure 11 with 5 '-adenylic acid respectively at these peaks.Similar situation is, peak #1 and adenosine 5 '-diphosphonic acid (ADP) is complementary, and retention time is about 8 minutes (data not shown goes out).In order to confirm evaluation to peak #2, use snake venom 5 '-nucleotidase to handle sample, wherein said snake venom 5 '-nucleotidase is by AMP-agarose chromatography affinity purification.HPLC the analysis showed that peak #2 is by the degraded of 5 '-nucleotidase, and peak #4 strengthens.This proof peak #2 is 5 '-AMP, and peak #4 is an adenosine, referring to the intermediary and following drawing board of Figure 11.The retention time of ring-AMP or ATP is approximately about 13 minutes respectively and about 3 minutes (data not shown goes out), has therefore got rid of ring-AMP or the ATP possibility relevant with peak #2.
5 '-AMP induces expression and the hibernation of the mClps in the mice that is under the cycle light and dark
External source 5 '-AMP is expelled to tests inducing of expressing of mClps in the mice body that is under the cycle light and dark and prove that 5 '-AMP is a conditioning signal.The image that Figure 12 analyzes for the RNA hybridization technique, this image have proved that 5 '-AMP of various concentration has induced the expression of mClps in the liver.Implement RNA hybridization to being used to test the liver rna that mClps expresses, injection had the wild-type mice of 5 '-AMP of normal saline or various dosage when wherein liver rna got comfortable ZT8.Detecting the content of Gapdh regulates and control as inside.
Figure 13 is the image of RNA hybridization technique, and this image shows after injection 5 '-AMP observes mClps by abduction delivering between about 3.5 to 4 hours.Figure 14 is a gel images, and it shows use RT-PCR technology, can both detect the abduction delivering of 5 '-AMP to mClps in all the sampled peripheral tissues except brain.Outer-the 5 '-nucleotidase of born of the same parents is the glycosyl-phosphatidyl inositol that is anchored on the plasma membrane, and it is converted into adenosine in the extracellular with 5 '-AMP.
14
Figure 15 is to use adenosine receptor or transport protein to detect the RNA hybridization technique figure of the endocellular function of 5 '-AMP.Figure 15 shows, is injected into the expression that the intravital adenosine of the mice that is under the cycle light and dark also can be induced mClps in the liver, but that the result is a concentration is lower.Different therewith is that when this effective adenosine receptor antagonist was expelled in the mice body that is under the cycle light and dark with NECA, this antagonist can not be induced liver fat expression of enzymes (data not shown goes out).
Figure 16 detects the RNA hybridization technique of dipyridamole to the blocking-up situation of adenosine induced lipolysis expression of enzymes, and wherein said dipyridamole is effective inhibitor of nucleoside transporter.
15Figure 17 analyzes other adenylic acids whether also can induce the RNA hybridization technique that mClps expresses in the liver.With ATP, ADP or the c-AMP of injected in mice same concentrations, the RNA hybridization technique the analysis showed that these nucleotide can not induce that mClps expresses in the liver.The mice under the cycle light and dark of being in that is given high dose 5 '-AMP shows body temperature and is starkly lower than the mice of handling through normal saline, shows that animal is in resting state.A distinctive feature of dormancy be core temperature (CBT) in the time of about 37 ℃, lost the heat absorption of this core temperature control.For example, when the CBT of laboratory mice is about 31 ℃ or when lower, think that this mice is in resting state.
7-8Therefore, CBT is lower than about 31 ℃ and is used as the quantitative parameter of studying resting state.5 ' of high dose-AMP induces the apparent sleep behavior of mice, and in first hour, the CBT of mice drops to about 27 ℃ (ambient room temperature is 24 ℃) by about 37 ℃.
Figure 18 is core temperature and time relation figure after using 5 '-AMP.The time span of dormancy depends on the dosage of the 5 '-AMP that is injected.In same time, the mice that is injected into normal saline does not show body temperature and fluctuates by 37 ℃ in phase.After the CBT of dormancy mice turned back to 37 ℃, not observing these mices had tangible ill effect.The core temperature of the wild-type mice after the 5 '-AMP that injects normal saline or various dosage, range of error is expressed as SEM (n=3).
Figure 19 is the graph of a relation of temperature and time after using 5 '-AMP, and it is used for detecting the effect in this mechanism biological clock.To mPer1
-/-/ mPer2
M/mInjected in mice with induce 5 '-AMP of the same dose of wild-type mice dormancy.The measured value of CBT shows among Figure 19, at mPer1
-/-/ mPer2
M/mIn the mice, the inductive dormancy time of 5 '-AMP is 2 times of dormancy time of wild-type mice.Wild-type mice and mPer1 after 5 '-AMP of injecting normal saline or about 1.5 μ mol/ gram body weight
-/-/ mPer2
M/mIn the core temperature of mice, range of error is expressed as SEM (n=3).To sum up, these studies show that the biorhythm signal that 5 '-AMP expresses for mClps among the adjusting peripheral organ, and have induced the mice dormancy.
5 '-AMP has regulated the homeostasis energy of mice
Figure 20 is the graph of a relation of temperature and time after using 5 '-AMP, and it is used to detect the effect that metabolism slows down.With arbitrarily the behavior that is in the mice under the lasting dark of raising and the behavior of the mice that metabolism slows down compare.Described metabolism slows down and is to form by the fasting that begins short-term when the CT2.Under ambient room temperature was about 23 ℃ condition, during 12 hours, on the feed and be in and continue down dark and fasting and being in continues in the dark mice down, the CBT of per approximately 4 hours sampling and measurings demonstrated the variations by about 37 ℃ of generation minimums.To fasting second day, the CBT measured value showed that 1 fasting mice enters resting state naturally, referring to Figure 20.In ambient temperature (between for example about 23 ℃ to about 24 ℃) with under about 4 ℃, obtain and be in the feed mice that continues under dark and each CBT measured value of fasting mice.Annotate, the time span between the CT0-CT2 is extended.But by the 3rd day, all fasting mices showed as resting state, and CBT is lower than about 31 ℃, and the CBT of feed mice is maintained at about 37 ℃.
Figure 21 is the HPLC chromatogram, and it has compared the retention time of being answered by the content back of 5 '-AMP in being in dormancy mice that continues under the dark and the mice that is in the not dormancy under the lasting dark.The blood extract of dormancy mice (top plate) and dormancy mice (following plate) is not carried out representative HPLC to be analyzed.HPLC the analysis showed that, compares with being in the not dormancy mice that continues under the dark, and the content of 5 '-AMP significantly increases in the dormancy mice.To quantitatively showing of the relative size at HPLC peak, in being in the dormancy mice that continues under the dark, the content of 5 '-AMP is enhanced about 3 times, shown in the block diagram among Figure 22.In being in dormancy mice that continues under the dark and the 5 '-AMP relative amount that is in the not dormancy mice under the lasting dark, the meansigma methods of 5 '-AMP content of dormancy mice is set at 1 at random with deriving from not.Range of error is expressed as SEM (n=3).
Identical studies show that of under about 4 ℃ ambient temperature, implementing, in fasting after one day, be in the mice that continues under the dark dormancy takes place, and compare with the control mice of not dormancy, it is also very high to be in the blood 5 '-AMP that continues the mice under the dark, for example, referring to Figure 23 a, Figure 23 b and Figure 23 c, these figure prove, under the condition that metabolism slows down, the content of 5 '-AMP is subjected to physiological regulating control, and 5 '-AMP of this content has induced the mice that is under the lasting dark that dormancy takes place.Figure 23 a is the graph of a relation of the temperature and time after using 5 '-AMP, and it is used to detect the effect that metabolism slows down.Figure 23 b is the HPLC chromatogram, and it has compared the retention time of being answered by 5 '-AMP content back in the blood that is in the mice under the lasting dark.To quantitatively showing of the relative size at HPLC peak, in being in the dormancy mice that continues under the dark, the content of 5 '-AMP is enhanced about 3 times, shown in the figure among Figure 23 c.
Stopping to take food and producing internal energy by fat is a part of physiological characteristics of deep-sleep animal
Method:
Animal: with wild type (for example C57/B6), the mPer1 in about 8 to 10 ages in week
-/-, mPer2
M/mAnd mPer1
-/-/ mPer2
M/mThe female Mus of type is raised in the zoopery equipment of standard, and be in about 12 hours/about 12 hours light/dark cycling condition under.
12-13For carry out about 12 hours/about 12 hours dark-dark or continue dark research, when CT12 with mice in the physiological rhythm chamber, be in and continue to place 48 hours under the dark state, then mice is used for described research.Under about 15 watts HONGGUANG, carry out all processing to being in the mice that continues dark,
30And meet the animal bill HSC-AWC 04-022 of mechanism approval.
RNA hybridization technique and RT-PCR analyze: collection organization, and it is freezing and be kept at pact-80C in liquid nitrogen.From mouse liver, extract total RNA according to standardization program.
31Go out total RNA of 20 micrograms by electrophoretic separation, and it is transferred on the nylon membrane.As described above, use
32The cDNA probe and the dot blot hybridization of P-labelling wash then and are exposed to x-ray film.
30The lipase probe is complete cDNA (for example Genbank No:BC042935); The Gapdh probe is the Pst I fragment of rat Gapdh cDNA.
32Be used to detect the primer of lipase expression to being SEQID NO:1 5 ' TTGTTCTTCTGCTTGTGTCCCT 3 ' and SEQ ID NO:2 5 ' AGTCGAGGCAGATGCCATAGTT 3 '.The primer that is used to detect the Gapdh expression of regulating and control as inside is to being SEQ ID NO:3 5 ' AAGCCCATCACCATCTTCCA 3 ' and SEQ ID NO:4 5 ' ATGGCATGGACTGTGGTCAT 3 '.Use derives from few fragment LipaseF SEQID NO:5 5 '-CGGTTGGACCCATCGGATGCCATG-3 ' and LipasaeR SEQ ID the NO:65 '-GAACTCTTTCCCGTC TTTACCGCG-3 ' of liver mRNA, is formed for the 720bp probe of mice pancreatic lipase associated protein 2 (mPlrp2) by RT-PCR.
34
Hepatic lipase is active to be detected: at surround lighting (for example at ZT0 and ZT12 time light) or under about 15 watts HONGGUANG (for example at CT0 and CT12 time light) condition, take out mouse liver, and according to described preparation protein extract before.
33With sample about 65 ℃ the heating about 15 minutes, from but endogenous lipase inactivation.Adopt BCA method (Pierce company) to measure the protein content of extract.According to described before, use [
3H] glycerol trioleate measures the situation that exists of lipase in the sample of heated and inactivated as substrate.
HPLC to adenylic acid analyzes: obtain the intravital blood of mice fast, and it is freezing in liquid nitrogen.As described above, use the perchloric acid of 0.4N by extracting nucleotide in the freezing sample.
35In brief, about 425 μ l are added in the blood sample that is frozen with the perchloric acid of the refrigerated about 0.4N of ice, and mix.After taking out 10 μ l and being used for protein determination, with remaining mixture at about 4 ℃, 14, under the condition of 000xg centrifugal 10 minutes.(for example 305 μ l) are transferred in the clean pipe with supernatant, with about 0.6M KHCO of about 178 μ l
3/ about 0.72M KOH neutralization, and with about 0.18M ammonium phosphate solution (pH 5.1) and a phosphoric acid,diluted acidify of about 55 μ l.Sample is centrifugal, and analyze being used under supernatant deposited in approximately-80 ℃.Separating blood extract, adenylic acid (ATP, ADP, AMP, c-AMP) and adenosine (for example derive from Sigma, MO, USA), and at the anti-phase C of Partisphere chemically bonded phase
18Be to carry out under 1.5ml/ minute the condition quantitatively on the post, at flow velocity.
36Mobile phase is 0.02M NH
4H
2PO
4, pH 5.1, and synergetic methanol gradient is: be about 8-20% for about 0%, about 4-6 minute for about 0-8%, about 6-8 minute and about 8-18 minute be about 20% in about 0-4 minute.
Injection 5 '-AMP, adenosine, NECK and dipyridamole: by intraperitoneal (IP) injection, (for example derive from Sigma, MO USA) is administered in the C57/B6 mice body that is in cycle light and dark with 5 ' of described dosage-AMP, adenosine, NECK and dipyridamole.After the injection, with the time of mice live box need, then with its execution.The total RNA that separates liver organization, and adopt the RNA hybridization technique
19With RT-PCT it is analyzed.Before per injection and after the injection, all use the rectal temperature meter to come measurement core body temperature (CBT) down in ambient room temperature (for example about 23 to about 24 ℃).
The research that metabolism is slowed down: during fasting, the content of AMP in two groups of core temperatures that are in the mice that continues dark cycle and the blood is measured.Employing is in the feed mice that continues under the dark and organizes in contrast.From CT2, take out the food that is in the fasting group mice under the lasting dark.Determine dormancy by measuring CBT, and will be in the mice of dormancy or be used to provide blood sample or the 3rd CT2 by hello to food.Continuous 6 days, when each ZT2 or CT2, all measure with the food that is in the mice that continues dark cycle and the intake and the body weight of water being in cycle light and dark.Use derives from BioAssay Systems (Hayward, CA, glucose kit USA) and derive from Roche Applied Science (Penzberg, Germany) free fatty test kit measure the content of glucose and free fatty in the serum.
Deriving from the final activity that is in the mice lipase under the lasting dark is physiologically active, and this is 2 kinds of peptides because this lipase mRNA has encoded, and these 2 kinds of peptides are important for above-mentioned biological event.Amino-end sequence of mClps is 5-peptide (VPDPR), and this 5-peptide is formed by the back enzyme action of transcribing of lipase.This 5-peptide is known as the intestinal inhibin, is a kind of satiety inhibitor.
16For example, Figure 24 a and 24b are the food of consumption every day and the figure of water, show that the mice that is under the lasting dark is than mice consumption food and the water still less that is in cycle light and dark.This is identical with viewed phenomenon in the rat that is in cycle light and dark previously in being in the rat that continues under the dark.
17
Figure 25 is the figure of mice body weight every day, and this figure shows through corresponding study period, is in the weight loss that continues the mice under the dark.Figure 26 is the figure of free fatty acid in the mice serum in a period of time, show and be in free lipotrophy in the serum that continues the mice under the dark, the situation that Figure 26 reacted is identical with recent observed situation, described recent observed situation is that the large mammal that is maintained in continuing under the dark has than the more free serum fatty acid of large mammal that is maintained in the cycle light and dark environment.
18
The film grappling and born of the same parents that regulated by physiological rhythm are outer-5 '-nucleotidase controlled 5 '-AMP is at extracellular content, and regulate 5 '-AMP is in intracellular effect.
14,19,20,21RNA hybridization technique analytical proof, born of the same parents are outer-5 '-expression of nucleotidase gene in being in the mice of cycle light and dark regulated in the mode of physiological rhythm, and the expression of this gene in being in the mice that continues under the dark is suppressed (data not shown goes out).Born of the same parents are outer-5 '-nucleotidase catalysis 5 '-the AMP dephosphorylate, form adenosine into, and adenosine is brought in the cell by nucleoside transporter.
22Intracellular adenosine at first by Adenosine kinase by phosphorylation, thereby form 5 '-AMP, this is because Adenosine kinase and adenosine K
mThan ADA Adenosine deaminase and adenosine K
mLittle about 1 or 2 order of magnitude.
19In metabolic dynamic equilibrium, the research of little musculus cdna has related to biological clock.
23-245 '-AMP is clearly determined the regulating action of 4 kinds of related allosteric enzymess of metabolism.A kind of this type of allosteric enzymes is the protein kinase (AMPK) that AMP relies on, and it is activated by 5 '-AMP.
25Known, AICAR (5-aminoimidazole-4-carbozamide nucleoside, the analog of a kind of 5 '-AMP) can increase oxidation of fatty acids in the rat muscle by AMPK.
26
Except AMPK, 5 '-AMP is respectively the positive modulators and the negative regulator of fructose-1 (FDP) and these two kinds of allosteric enzymess of phosphofructokinase (PFK).
27FDP is gluconeogenetic rate-limiting enzyme, and with fructose-1, the 6-diphosphonic acid changes into D-fructose-6-phosphoric acid.FDP has 35 '-AMP binding sites, and 5 '-AMP has suppressed the enzymatic activity of FDP, and FDP has limited gluconeogenesis thus.Along the rightabout of this reaction, PFK is glucolytic rate-limiting enzyme.Utilize the ATP molecule, PFK changes into fructose-1 with D-fructose-6-phosphoric acid, the 6-diphosphonic acid.Opposite with FDP, the activity of PFK is strengthened by 5 '-AMP, increases glucolytic speed thus.
Figure 27 is the figure of concentration of glucose in a period of time, the figure shows being in the mice that continues under the dark that 5 '-AMP increases, be in the blood sugar concentration that continues dark mice down and be lower than the blood sugar concentration of the mice that is in cycle light and dark, and be in the blood sugar concentration that continues dark mice down with carry out before under being in lasting dark with the research of the rat that is in cycle light and dark in the blood sugar concentration that obtains consistent.
28Figure 28 is the figure of concentration of glucose in a period of time inner blood, and Figure 29 is RNA hybridization figure, shows in the mice under being in cycle light and dark, induces activity and the blood sugar content of 5 '-AMP of mClps expression to be relative to each other.In the time of in 5 '-AMP being expelled to the mice body that is under the cycle light and dark, the activity of FDP is suppressed, and has blocked gluconeogenesis thus.Different therewith is that 5 '-AMP has activated PFK, thereby has increased glucolytic speed.To sum up, active and active positive interaction of FDP and negative interaction have caused the consumption of blood glucose accumulation to 5 '-AMP to PFK respectively.The of short duration rising of viewed blood sugar concentration may be because the result of the metabolism of top level (its response for the consumption of described accumulation is made).Glycogen phosphorylase (it is a Cori ester with the glycogenolysis that stores) as rate-limiting enzyme is another kind of by the activatory allosteric enzymes of 5 '-AMP.
29When stored glycogen use arrived critical stage, blood sugar content reduced.In order to keep the necessary glucose of brain function (for example referring to Fig. 6 and Figure 14), for the peripheral organ, the energy source of Gong selecting for use that is obtained by catabolism of fat then is activated, and wherein said catabolism of fat can obtain monitoring (for example referring to Fig. 4 b) by the expression of mClps.
Figure 30 is the figure that shows the effect of 5 '-AMP in the metabolism signal transmits.5 '-AMP is a kind of important metabolism signal, and its cyclical level has determined the body energy condition of supplying between glucose, glycogen and fat.In the mankind, the effect of 5 '-AMP and analog thereof can form the new healing potion that is used for human obesity disease and glucagon type 2 diabetes mellitus of a class.By accident, fight and impact and during the important operation or urgent injury response that need, the ability of 5 '-AMP induced dormancy is the useful tool of CBT control.In addition, in metabolic biochemistry, " invalid circulation " consumed the ATP molecule between FDP activity and the PFK activity.
27But intrinsic biological clock has been controlled the content of 5 '-AMP, and therefore, " invalid circulation " is the metabolism circulation with physiological rhythm.
In addition, every day 5 '-AMP is expelled to the morbid obesity mice (O that lacks leptin
b/ O
b) in the body, cause the O of these mices and injecting normal saline
b/ O
bMice is compared, lose weight and the satiety degree lower, referring to Figure 31 a and 31b.Figure 31 a and 31b after to be every day be expelled to 5 '-AMP in the Ob/Ob mice body body weight and the figure of food intake situation.At first day and second day, 5 '-AMP of injection 5umol/gbw.After this, in the research of remainder, this dosage is reduced to 2.5umol/gbw.After 2 weeks, have in the mice of 5 '-AMP in injection, increasing gradually of food intake shows a kind of new energy balance.
In addition, with the light that is maintained at rule-dark (12:12 hour) circulation O
b/ O
bMice is compared, and is maintained at the O that continues under the dark
b/ O
bMice also consumes less food, and the weight increase minimizing, referring to Figure 32 a and 32b.Figure 32 a and 32b are that the dark that continues is to O
b/ O
bThe figure of the influence of the supersaturation body weight of mice.For the O that is maintained at normal light-dark (LD) circulation and continues 27 ages in week under dark (DD)
b/ O
bFemale Mus, their cumulative food consumption every day (gram) and weight increase (gram) of monitoring in one corresponding period.Annotate: in the reduction of the food wastage in bulk or weight of the mice that is in the DD state and the speed of weight increase.
In addition, the present invention can be used for treating cancer.Late period and big tumor are actually the height hypoxia, and this is to be restricted because of the oxygen supply to lump.These tumor cells mainly produce the energy that it needs by glycolytic cycle (being known as the Wa Shi hypothesis).Different therewith is that normal cell utilizes oxidative phosphorylation to produce its required a large amount of ATP.Studies show that in many types and a large amount of human tumor cell, the content of the glycolysis enzyme such as PFK and FDP is very high.About the utilization of glucose and free fatty, compare with the mice that is in cycle light and dark, be maintained at the mice that continues under the dark and have opposite metabolism parameter.Compare with the mice that is in cycle light and dark, the present invention shows the content height of blood glucose and the low situation of the content of free fatty, thereby has imitated viewed situation in the mammal of hibernation.This to continue the dark mice and the adjusting of extracellular 5 '-AMP content of the mice that is in cycle light and dark down relevant with the expression of outer-the 5 '-nucleotidase of born of the same parents to being in, and wherein said born of the same parents-5 '-nucleotidase outward are degraded into adenosine with 5 '-AMP.
Figure 33 is the image of RNA hybridization technique, and this image shows that outer-the 5 '-nucleotidase expression of gene level of born of the same parents is high and to be maintained in the mice body that continues under the dark be low in being in the mice body of cycle light and dark.Therefore, purpose is to make outer-the 5 '-nucleotidase gene expression of born of the same parents, activation or stable and make outer-5 '-nucleotidase activation of born of the same parents or stable medicine can change the content of the outer 5 '-AMP of cells in vivo.In addition, the injection of 5 '-AMP has reduced the content of blood glucose, therefore, make the patient be under the lasting dark state or give to suppress outer-the 5 '-nucleotidase gene expression of born of the same parents, activation or stable and suppress outer-5 '-nucleotidase activation of born of the same parents or stable medicine and give 5 '-AMP to suppress the supply of glucose, and the increase normal cell utilizes the switch of fatty acid as energy source to lump.Therefore, the tumor cell that can not obtain enough glucoses will necrose and postpone its growth, prolong patient's vital stage thus from the process of disease.
Embodiment 7
The mammiferous controlled stagnant life of non-hibernation
In embodiment before, show 5 '-AMP and regulate dormancy and can induce non-hibernator to produce resting state.In the present embodiment, show and can give 5 '-AMP and control and keep the stagnant living state (SA) of non-hibernator in conjunction with reducing CBT, and by using the laboratory mice to illustrate.When the defence of thermal conditioning is subjected to that 5 '-AMP suppresses and CBT when being reduced to below 17 ℃, mice enters SA.The time span of SA is kept by CBT, and wherein said CBT keeps than high 1-2 ℃ of ambient temperature (AET).As AET during at least 15 ℃, it is spontaneous returning to clear-headed by SA, when AET below 14 ℃ the time, clear-headed being suppressed.Enter SA and recover clear-headed all with significantly physiological reaction and behavior by SA.Be in mice under the SA to tactual stimulation, urinate and show that the subconsciousness behavior reacts to some extent.When clear-headed fully, experience SA and the behavior of not experiencing the mice of SA are indiscriminate.Our research provides the basis of such conclusion, and described conclusion is: all mammals, comprise the mankind, and reversible SA can take place.Based on research before, the inventor has studied ambient temperature low when heat is restricted enters the SA ability to mice influence.
Method
Animal: the main female Mus (C57/B6) of using for 10 to 16 ages in week of this research.In male Mus, also observe identical reaction to 5 '-AMP of injection.Mice is raised in the zoopery equipment of standard, and is in 12 hours/light/dark cycling condition of 12 hours under.
Experimental arrangement: to the described before dosage of every mouse mainline (IP) (for example 0.05-1.5mg/g body weight), be dissolved in by 5 '-AMP in the normal saline of phosphate-buffered (Sigma catalog# A1752-25G).These mices are put at once in the beaker of one 500ml pre-cooling, wherein said beaker is placed in 4 ℃ the chamber.Under this condition, the 5 '-AMP of concentration more than 0.25mg/gbw blocked all thermal conditioning reactions, and makes CBT be reduced to 15 ± 1.0 ℃ in 60 ± 10 minutes.Use digital thermometer (FisherScientific, USA, catalog 15-077-8), detect the CBT of mice by miniature rustless steel probe (1mm), wherein said probe is placed into the 1cm place of mice rectum opening.After inserting probe, read temperature during second at 15-20.In case the CBT of mice is reduced to 15 ± 1.0 ℃, mice just is transferred in the regular mouse cage that is covered with straw mattress, and is maintained at temperature and is set in the environmental chamber of 14 ± 0.5 ℃ or 15 ± 0.5 ℃.Range estimation is in the clear-headed situation of the mice under the SA.In case obviously clear-headed, just mice is sent back in the feeding facility of standard.Behind 12 hours SA of experience, with mice send back to give arbitrarily food and water, AET is in 20-22 ℃ the feeding facility.In continuous 4 days behind SA, after each 24 hours of ZT2, all measure food intake by the weight differential of fresh food and water.The breathing rate of mice is measured in the inside of the 50ml pipe by mice being placed on opening, counts the number of times that sucks and breathe out by the interval that experiences 10 seconds, thereby measures the frequency of respiration of mice.
The result
When the AET that is maintained at 4 ℃, the CBT that the mice of dormancy is taken place when CT0 is reduced to 25 ℃, and these mices spontaneously return to 37 ℃ CBT then.These observed results show by the limited inductive dormancy of heat and in conjunction with low AET can not make mice produce SA.
Then, study the influence of low AET and 5 '-AMP to the mice behavior.Injection there is the mice of normal saline or 5 '-AMP under 4 ℃ AET, kept about 60 minutes.Visibly different behavior reaction takes place in the AET that has observed 4 ℃.Have in the mice of normal saline in injection, observe such as body movement, the opposing of the thermal conditioning holding up hair follicle, the attitude of crispaturaing and trembling.The CBT that measured in per 20 minutes demonstrates apart from 37 ℃ minimum variation has taken place.Different therewith is that injection has the mice of 5 '-AMP to keep the attitude of loosening, and does not significantly tremble.CBT shows as quick decline, and with significantly behavior variation.When CBT dropped to below 31 ℃, mice kept quite conscious reaction to tactual stimulation, has shown dormancy (T) state.Yet when CBT was reduced to 18-22 ℃, mice had been lost their kinematic dexterity largely, and when still placing or being sidelong when mice is faced upward, they have (RF) ability of upset (reverse flip), thereby they oneself are turned over to the right.When CBT is reduced to below 17 ℃, this RF Disability, mice enters the SA state.When mice being sidelong or face upward placement, mice shows as the stagnant living state that extremity are overhanging and breathing rate is low that is in.Especially, under SA, the breathing rate of about 120 breathings of normal per minute has reduced 2/3.What is interesting is that the mice that is under the SA responds to tactual stimulation.When placing mice no matter the time, they can periodically show the behavior of the meaning of diving, and for example hind leg of lower body scratching, the back of stirring and twist, roar or yawn and piss.
Therefore, these behaviors show that even when CBT is reduced to below 17 ℃, mice still keeps many nerves and physiological function.If further cooling, when CBT reduced to below 13 ℃, then mice can not survive the long time.When mice being remained on 15 ℃ AET or when higher, by SA recover clear-headed can spontaneous generation.When mice regained the ability of carrying out RF (perhaps spontaneous carry out or rely on tactual stimulation to carry out), waking state was obvious.Under waking state, measure CBT, find that CBT spontaneously is elevated to more than 17 ℃.Then, instantaneous with very intensive tremble (S) for a moment, thisly tremble that intensity alleviates along with the rising of CBT.When CBT was higher than more than 27 ℃, the themogenesis that produces by trembling was no longer obvious, and the normal mice behavior apparition such as self grooming.
These observed results have proposed the Relative Contribution problem about 5 '-AMP, AET and CBT in the process of regulating SA.In order to address this problem, people have studied the relation between 5 '-AMP and the SA.At first, determine when mice is kept 60 minutes under 4 ℃ AET the time, be reduced in 15 ℃ the process degree of dependence at least the concentration of 5 '-AMP at adjusting CBT.Under this condition, induce effective dose (ED50) that at least 50% mice enters 5 ' of SA-AMP for 0.125mg/gbw (a) referring to Figure 34.
Then, the time span of testing SA is to the degree of dependence of the concentration of 5 '-AMP.With 5 groups of mices (n=5) injected dose is 0.25 to 5 ' of 1.5mg/gbw-AMP, 4 ℃ of down coolings, is reduced to below 17 ℃ until the CBT of mice then, then these mices is transferred under 15 ± 0.5 ℃ the AET, waits for that mice is spontaneous clear-headed.The people is that between the non-linear concentration of these 5 '-AMP, recovery time has sizable lap (referring to Figure 34 b) in surprise in addition.These observed results show that the maintenance of SA is not to drive by the concentration of 5 '-AMP is direct.Consider behavior reaction, the inventor proposes, and 5 '-AMP has at first blocked the internal heat of regulating CBT and regulated opposing.Consistent with these observed results, be used for the inductive 5 '-AMP concentration curve of SA and demonstrate one " point of setting " or saturated reaction profile.
In order to determine the driver of SA, people have studied CBT of mice and the relation between the AET.In case mice is in SA, just hold them under the AET of 14 ± 0.5 ℃ or 15 ± 0.5 ℃.After 2 hours, the measurement of CBT is shown, mice kept than the high 1-2 of AET ℃ body temperature (a) referring to Figure 35.Then, contrast is maintained at the waking reaction of the mice under the AET of 14 ± 0.5 ℃ or 15 ± 0.5 ℃.The most of mice that is maintained under 15 ± 0.5 ℃ the AET can spontaneously recover clear-headed (referring to Figure 35 b) from SA.Different therewith is that even after 12 hours, the most of mice that is maintained under 14 ± 0.5 ℃ can not recover clear-headed from SA.When subsequently these mices being placed on higher following time of AET, they are spontaneous clear-headed and can enter the S stage.SA time and the mice of being longer than 14 hours enters the decline of ability in S stage after regaining consciousness by intensification relevant.The mice that can not enter the S stage is dead in 24 hours.The basic reason of this death is not clear.
To sum up, above-mentioned studies show that made low AET in the process of direct response, and CBT is the main driver of SA.In order to obtain other supports to this conclusion, people have studied the influence of AET to the regeneration rate of SA.With CBT is that about 15 ℃ several groups of mices (n=4) that are in SA are transferred in the environment that AET raising.The CBT that measures every mice returns to 37 ℃ of needed times (referring to Figure 35 c).Can find out that degree that AET raises becomes positive correlation with regeneration rate by SA.In order to determine whether there is the long-term negative interaction that is caused by the SA recovery, in some days, the picked-up of measurement food and body weight are as the indirect assessment of health.The mice (n=4) of spontaneous disengaging SA is used for above-mentioned research.In first day after being recovered by SA, observing food intake has moderate minimizing, but body weight does not have significant difference.
To sum up, as laboratory mice institute example, present embodiment has proved initiation, kept and has finished the ability of study subject SA.
Stagnant blood glucose dynamic equilibrium and adenylic acid balance of giving birth to mice under the state
Animal: the main female Mus (C57/B16) of using for 10 to 16 ages in week of this research.In male Mus, also observe identical reaction to 5 '-AMP of injection.Mice is raised in the zoopery equipment of standard, and is in 12 hours/light/dark cycling condition of 12 hours under.
Experimental arrangement: to every mouse mainline (IP) suitably dosage (for example 0.05-1.5mg/g body weight), be dissolved in by 5 '-AMP in the normal saline of phosphate-buffered (Sigmacatalog# A1752-25G).These mices are put at once in the beaker of one 500ml pre-cooling, wherein said beaker is placed in 4 ℃ the chamber.Under this condition, the 5 '-AMP of concentration more than 0.25mg/gbw blocked all thermal conditioning reactions, and makes CBT be reduced to 15 ± 1.0 ℃ in 60 ± 10 minutes.Use digital thermometer (FisherScientific, USA, catalog 15-077-8), detect the CBT of mice by miniature rustless steel probe (1mm), wherein said probe is put into the 1cm place of mice rectum opening.After inserting probe, read temperature during second at 15-20.In case the CBT of mice is reduced to 15 ± 1.0 ℃, mice just is transferred in the regular mouse cage that is covered with straw mattress, and is maintained at temperature and is set in the environmental chamber of 14 ± 0.5 ℃ or 15 ± 0.5 ℃.CBT unexpectedly is reduced to below 13 ℃, shows that mice can not survive the long period.Range estimation is in the clear-headed situation of the mice under the SA.In case obviously clear-headed, just mice is sent back in the feeding facility of standard.Behind 12 hours SA of experience, with mice send back to give arbitrarily food and water, AET is in 20-22 ℃ the feeding facility.In continuous 4 days behind SA, when each 24 hours of ZT2, all measure food intake by the weight differential of fresh food.Measure the breathing rate of mice by the inside in the 50ml pipe that mice is placed on opening, count the number of times that sucks and breathe out, thereby measure the frequency of respiration of mice by the interval that experiences 10 seconds.These researchs are to carry out under the animal bill HSC-AWC 04-022 that meets mechanism's approval.
Stagnant blood glucose dynamic equilibrium of giving birth under the state
To when giving Siberia hamster 2-deoxyglucose, this animal observed result that dormancy easily takes place shows that biological processes is relevant with glycolysis.5 '-AMP is the important allosteric modulators of several rate-limiting enzymes related in glucose dynamic equilibrium, has further hinted the important of blood glucose.
Analyze taking from the mice serum glucose sample that enters behind the SA 2-3 hour, the serum glucose level of this mice is the serum glucose level high about 60% of 37 ℃ control mice than CBT.But when clear-headed, its serum blood sugar content is reduced to the serum blood sugar content low 40% of comparison according to mice to this mice spontaneous.It is identical (referring to Figure 37 a) with the blood sugar content of the mice that is in SA that the mice that regains consciousness by heating up again demonstrates its blood sugar content.These observed results show, with reach by heating up again clear-headed different, spontaneous clear-headed relevant with the needs of keeping blood glucose dynamic equilibrium.The reduction of blood sugar content can reduce major organs the needs of glucose are reversed by increasing gluconeogenesis and the beta oxidation by fatty acid.Lipase active and enzyme companion's thereof active catalytic lipogenesis fatty acid, and the new expression of lipase in major organs hinted the transformation that is utilized to fatty acid by carbohydrate.Adopt the RNA hybridization technique, analyze the expression of lipase by the liver rna of normal condition mice, SA mice, the mice that regain consciousness by heating up again and spontaneous clear-headed mice acquisition.Only in spontaneous clear-headed mice, the expression that detects lipase very high (referring to Figure 37 b).Therefore, low blood content is relevant with lipometabolic activation in the major organs.
Stagnant adenylic acid balance of giving birth under the state
For the understanding of the biological chemistry action that will be risen in SA the 5 '-AMP that is injected into compiles, people have analyzed at CBT and have been 37 ℃ control mice, are in the adenylic acid in blood, liver and the muscle of mice under the SA and spontaneous clear-headed mice and the content of metabolite thereof.HPLC to control mice the analysis showed that normal adenylic acid content is different in described three kinds of organs, wherein the ATP content in liver and the blood demonstrates than the ATP content in the muscle high a lot (referring to Figure 38 a to d).But only during SA, the relative ratio of AMP and ATP has improved about 5 times in the blood, and is not like this (referring to Figure 39 a) in liver or muscle.Under three all behavior states, the ratio of the adenylic acid in liver and the muscle changes very little or does not change.The rapid rising of 5 '-AMP, the reduction of the appropriateness of ATP content have illustrated the AMP/ATP ratio that raises in the blood during SA.Under spontaneous clear-headed condition, the ratio of the AMP/ATP of rising returns to normal value (referring to Figure 39 a to c).Institute in a organized way with all behavior states under, the ratio of ADP and ATP keep relative stability (data not shown goes out).During SA, the existence of purine catabolite in the blood (comprising inosine, hypoxanthine and uric acid) has further hinted the absorption of the 5 '-AMP that is injected and catabolism (referring to Figure 38 c and 38d).HPLC analyzes and further to illustrate, and injects content that 5 '-AMP demonstrates ATP sharply descend (referring to Figure 38 d) for the second time to being in mice under the SA.This low ATP content may be owing to the erythrocyte insufficiency of function, and may be the reason owing to described lethal effect.In addition the people is in surprise, and the content of 5 '-AMP remains on its level that begins, and its excessive part decomposed fast, and this can be shown by the inosine content that significantly raises.This discovery and 5 '-AMP is excessive, and can not to prolong the observed result of SA consistent.To sum up, these observed results show, even under the disadvantageous condition of metabolism, the balance of adenylic acid still regulated ATP and 5 '-AMP content (ATP+5 '-AMP<2ADP).
It should be understood that specific embodiment as herein described illustrates by way of example, these embodiments can not constitute limitation of the invention.Under the condition that does not depart from the scope of the present invention, in various embodiments, can utilize principal character of the present invention.Those skilled in the art will be familiar with a plurality of equivalents that maybe can distinguish specific program as herein described, and what wherein these equivalents were used is conventional experimental technique.These equivalents are considered within the scope of the invention, and are contained by appending claims.
According to the disclosure, under the condition that does not experimentize undeservedly, disclosed herein and claimed all compositionss and/or method can be produced and implement.Although described the compositions and methods of the invention according to the preferred embodiments of the invention, but it will be evident to one skilled in the art that, under the condition that does not break away from notion of the present invention, spirit and scope, multiple variation can be applied in the order of step in step in compositions as herein described and/or method and the method or the method.Conspicuous all these similar alternative forms of those skilled in the art and modification all are considered within the spirit that is limited by the accompanying claims, scope and notion.
List of references
Incorporate this paper below with reference to document clearly into way of reference, its degree is replenished in detail for providing on exemplary, the program or otherwise to the listed content of this paper.
1.Heldmaier,G.,Ortmann,S.,and?Elvert,R.,Natural?hypometabolism?duringhibernation?and?daily?torpor?in?mammals.Respir?Physiol?Neurobiol.141,317-329(2004).
2.Perret,M.,and?Aujard,F.,Daily?hypothermia?and?torpor?in?a?tropical?primate:synchronization?by?24-h?light-dark?cycle.Am?J?Physiol?Regul?Integr?Comp?Physiol.281,1925-1933(2001).
3.Heller,H.C.,and?Ruby,N.F.,Sleep?and?circadian?rhythms?in?mammalian?torpor.Annu?Rev?Physiol.66,275-289(2004).
4.Wassmer,T.,and?Wollni?k,F.Timing?of?torpor?bouts?during?hibernation?inEuropean?hamsters(Cricetus?cricetus?L.).J?Comp?Physiol[B].167,270-279(1997).
5.Morgan,P.J.,Ross,A.W.,Mercer,J.G.,and?Barrett,P.,Photoperiodicprogramming?of?body?weight?through?the?neuroendocrine?hypothalamus.J?Endocrinol.177,27-34(2003).
6.Ruby,N.F.,Dark,J.,Burns,D.E.,Heller,H.C.,and?Zucker,I.,Thesuprachiasmatic?nucleus?is?essential?for?circadian?body?temperature?rhythms?inhibernating?ground?squirrels.J?Neurosci.22,357-364(2002).
7.Gavrilova,O.,et?al.,Torpor?in?mice?is?induced?by?both?leptin-dependent?and-independent?mechanisms.Proc?Natl?Acad?Sci?U?S?A.96,14623-14628.(1999).
8.Overton,J.M.,and?Williams,T.D.,Behavioral?and?physiologic?responses?tocaloric?restriction?in?mice.Physiol?Behav.81,749-754(2004).
9.Ruby,N.F.,Dark,J.,Heller,H.C.,and?Zucker,I.,Ablation?of?suprachiasmaticnucleus?alters?timing?of?hibernation?in?ground?squirrels.Proc?Natl?Acad?Sci?U?S?A.93,9864-9868(1996).
10.Lowe,M.E.,Molecular?mechanisms?of?rat?and?human?pancreatic?triglyceridelipases.J?Nutr.127,549-557(1997).
11.Lowe,M.E.,Rosenblum,J.L.,McEwen,P.,and?Strauss,A.W.,Cloning?andcharacterization?of?the?human?colipase?cDNA.Biochemistry.29,823-828(1990).
12.Zheng,B.,et?al.,Nonredundant?roles?of?the?mPerland?mPer2?genes?in?themammalian?circadian?clock.Cell.105,683-694(2001).
13.Zheng,B.,et?al.,The?mPer2?gene?encodes?a?functional?component?of?themammalian?circadian?clock.Nature.400,169-173(1999).
14.Thompson,L.F.,Ruedi,J.M.,Glass,A.,Low,M.G.,and?Lucas,A.H.,Antibodies?to?5’-nucleotidase(CD73),a?glycosyl-phosphatidylinositol-anchoredprotein,cause?human?peripheral?blood?T?cells?to?proliferate.J?Immunol.143,1815-1821(1989).
15.Thorn,J.A.,and?Jarvis,S.M.,Adenosine?transporters.Gen?Pharmacol.27,613-620(1996).
16.Erlanson-Albertsson,C.,and?Larsson,A.,The?activation?peptide?of?pancreaticprocolipase?decreases?food?intake?in?rats.Regul?Pept.22,325-331(1988).
17.Stoynev,A.G.,and?Ikonomov,O.C.,Effect?of?constant?light?and?darkness?on?thecircadian?rhythms?in?rats:I.Food?and?water?intake,urine?output?and?electrolyteexcretion.Acta?Physiol?Pharmacol?Bulg.9,58-64(1983).
18.Alila-Johansson,A.,Eriksson,L.,Soveri,T.,and?Laakso,M.L.,Daily?and?annualvariations?of?free?fatty?acid,glycerol?and?leptin?plasma?concentrations?in?goats(Caprahircus)under?different?photoperiods.Comp?Biochem?Physiol?A?Mol?Integr?Physiol.138,119-131(2004).
19.Arch,J.R.and?Newsholme,E.A.,Activities?and?some?properties?of?5’-nucleotidase,adenosine?kinase?and?adenosine?deaminase?in?tissues?from?vertebratesand?invertebrates?in?relation?to?the?control?of?the?concentration?and?the?physiologicalrole?of?adenosine.Biochem.J.174,965-977(1978).
20.Schnebli,H.P.,Hill,D.L.,and?Bennett,L.L.Jr.,Purification?and?properties?ofadenosine?kinase?from?human?tumor?cells?of?type?H.Ep.No.2.J?Biol?Chem.242,1997-2004(1967).
21.von?Mayersbach,H.and?Klaushofer,K.,Circadian?variations?of?5’-nucleotidaseactivity?in?rat?liver.Cellular?and?Molecular?Biology,Including?Cyto-enzymology?24,73-79(1979).
22.Thorn,J.A.and?Jarvis,S.M.,Adenosine?transporters.Gen.Pharmacol.27,613-620(1996).
23.Rudic,R.D.,et?al.,BMALl?and?CLOCK,two?essential?components?of?thecircadian?clock,are?involved?in?glucose?homeostasis.PLoS?Biol.2,e377(2004).
24.Turek,F.W.,et?al.,Obesity?and?metabolic?syndrome?in?circadian?Clock?mutantmice.Science.308,1043-1045(2005).
25.Lindsley,J.E.,and?Rutter,J.,Nutrient?sensing?and?metabolic?decisions.CompBiochem?Physiol?B?Biochem?Mol?Biol.139,543-559(2004).
26.Kaushik,V.K.,et?al.,Regulation?of?fatty?acid?oxidation?and?glucose?metabolismin?rat?soleus?muscle:effects?of?AICAR.Am?J?Physiol?Endocrinol?Metab.281,335-340(2001).
27.Lehninger,A.L.,Biochemistry:The?biosynthesis?of?carbohydrates,pp?623-657.2
nd?eds,Worth?Publishers,Inc?Park?Avenue?South,NY(1977).
28.Ahlersova,E.,Ahlers,I.,Toropila,M.,and?Smajda,B.,Influence?of?lightregimens?on?circadian?changes?in?the?blood?glucose?and?tissue?glycogen?concentrationin?the?rat.Physiol?Bohemoslov.31,57-64(1982).
29.Garcia-Fuentes,L.,Camara-Artigas,A.,Lopez-Mayorga,O.,and?Baron,C.,Thermodynamic?characterization?of?5’-AMP?binding?to?bovine?liver?glycogenphosphorylase?a.J?Biol?Chem.271,27569-27574(1996).
30.Kaasik,K.,and?Lee,C.C.,Reciprocal?regulation?of?haem?biosynthesis?and?thecircadian?clock?in?mammals.Nature.430,467-471(2004).
31.Chirgwin,J.M.,Przybyla,A.E.,MacDonald,R.J.,and?Rutter,W.J.Isolation?ofbiologically?active?ribonuclei?cacid?from?sources?enriched?in?ribonuclease.Biochemistry.18,5294-5299(1979).
32.Fort.P.,et?al.,Various?rat?adult?tissues?express?only?one?major?mRNA?speciesfrom?the?glyceraldehyde-3-phosphate-dehydrogenase?multigenic?family.NucleicAcids?Res.13,1431-1442(1985).
33.D’Agostino,et?al.,Decreased?postnatalsurvival?and?altered?body?weightregulation?in?procolipase?deficient?mice.J.Biol.Chem.277:7170-7177(2002).
34.Lowe,M.E.,in?Methods?in?MolecularBiology:Lipase?and?PhospholipaseProtocols(Doolittle,M.H.and?Reue,K.,eds),pp.59-70,Humana?Press?Inc.,Totowa,NJ.(1998).
35.Blackburn,M.R.,Datta,S.K.,and?Kellems,R.E.,1998.Adenosine?deaminase-deficient?mice?generated?using?a?two-stage?genetic?engineering?strategy?exhibit?acombined?immunodeficiency.J.Biol.Chem.273:5093-5100.
36.Knudsen,T.B.et?al.,Effects?of(R)-deoxycoformycin(pentostatin)onintrauterine?nucleosidec?atabolism?and?embryo?viability?in?the?pregnant?mouse.Teratology.45:91-103(1992).
Sequence table
<110>Lee,Cheng?Chi
Zhang,Jianfa
<120〉be used to induce the method and composition of study subject dormancy
<130>UTFH:269WO
<140>PCT/US07/60588
<141>2007-01-16
<150>US60/759,480
<151>2006-01-16
<150>US60/821,521
<151>2006-08-04
<160>6
<170>PatentIn?version?3.1
<210>1
<211>22
<212>DNA
<213〉artificial sequence
<220>
<223〉primer
<400>1
<210>2
<211>22
<212>DNA
<213〉artificial sequence
<220>
<223〉primer
<400>2
<210>3
<211>20
<212>DNA
<213〉artificial sequence
<220>
<223〉primer
<400>3
<210>4
<211>20
<212>DNA
<213〉artificial sequence
<220>
<223〉primer
<400>4
<210>5
<211>24
<212>DNA
<213〉artificial sequence
<220>
<223〉primer
<400>5
<210>6
<211>24
<212>DNA
<213〉artificial sequence
<220>
<223〉primer
<400>6
Claims (71)
1. a method of inducing study subject to reduce body temperature, dormancy or the state of giving birth to that stagnates comprises the 5 '-AMP that uses the effective dose that is used for induced dormancy or stagnates the state of giving birth to.
2. the described method of claim 1, it further comprises determines that study subject is in dormancy or the state of giving birth to that stagnates.
3. the described method of claim 1, it further is included in to use and study subject is in after 5 '-AMP to be lower than under about 30 ℃ ambient temperature.
4. the described method of claim 3, wherein said study subject be in about 25 ℃ to about 1 ℃ ambient temperature.
5. the described method of claim 4, wherein said study subject be in about 20 ℃ to about 4 ℃ ambient temperature.
6. the described method of claim 1, it comprises further that core temperature with described study subject is reduced to and is lower than about 37 ℃.
7. the described method of claim 1, it comprises further that core temperature with described study subject is reduced to and is low to moderate about 32 ℃ or lower.
8. the described method of claim 6, the described core temperature of wherein said study subject is reduced between about 15 ℃ to about 20 ℃.
9. the described method of claim 8, the described core temperature of wherein said study subject is reduced between about 13 ℃ to about 15 ℃.
10. the described method of claim 1, wherein said dormancy is a deep-sleep.
11. the described method of claim 1, wherein use described 5 '-AMP in the following manner, described mode is subcutaneous injection, intramuscular injection, intravenous injection, peritoneal injection, nasal mucosa medicine administration, intravaginal administration, intranasal administration, through bronchus administration, eye drops, in ear administration, intracranial administration, oral administration, parenteral, rectally, sublingual administration, topical, percutaneous dosing or their combination.
12. the described method of claim 1, wherein said 5 '-AMP uses with following form, and described form is capsule, capsule sheet, soft gel, soft gelatin capsule, suppository, thin film, granule, colloid, lozenge, piller, chewable tablet, tablet, piece, dish, cream, film, Emulsion, washing liquid, ointment, aerosol spray, roll and put formula liquid on the skin, roll and put formula rod, transdermal patch, hypodermic implant, pad or their combination on the skin.
13. the described method of claim 12, wherein said 5 '-AMP delays to discharge in biodegradable carrier.
14. the described method of claim 1, wherein said 5 '-AMP uses with pharmaceutically useful dosage form, and wherein said dosage form further comprises pharmaceutically useful carrier.
15. the described method of claim 14, wherein said pharmaceutically useful carrier comprises the aerosol propellants that is selected from nitrogen, carbon dioxide, propane, butane, isobutene., pentane, different propane, fluorocarbon, dimethyl ether or their mixture.
16. the described method of claim 1, wherein said 5 '-AMP uses with following dosage form, and described dosage form further comprises at least a reagent that is selected from softening agent, water, inorganic powder, foaming agent, emulsifying agent, aliphatic alcohol, fatty acid and their combination.
17. the described method of claim 1, wherein said study subject is behaved.
18. the described method of claim 1, wherein said study subject are laboratory animal.
19. the described method of claim 18, wherein said laboratory animal are mice.
20. the described method of claim 1, the effective dose of wherein said 5 '-AMP are that about 5mg/kg body weight is to about 7.5mg/kg body weight.
21. the described method of claim 1, the effective dose of wherein said 5 '-AMP are that about 15mg/kg body weight is to about 1.5mg/kg body weight.
22. the described method of claim 21, the effective dose of wherein said 5 '-AMP are that about 25mg/kg body weight is to about 250mg/kg body weight.
23. the described method of claim 20, the effective dose of wherein said 5 '-AMP are that about 5mg/kg is to about 15mg/kg.
24. the described method of claim 23, wherein said method further comprise described study subject to small part is immersed in the water-bath, the temperature of wherein said water-bath is for being lower than about 32 ℃.
25. further comprising with cold blanket to small part, the described method of claim 23, wherein said method cover the patient.
26. the described method of claim 1, wherein said study subject suffer from the morbid state for the treatment of by the induced dormancy or the state of giving birth to that stagnates.
27. the described method of claim 26, wherein said morbid state is the state of following disease, and described disease is shock, wound, dysfunction of blood coagulation, chemotherapy side effect, poison, arrhythmia, hypothermia, burn, suffocate, inhalation injury, respiratory failure, pyemia, anxiety, insulin shock, infectious disease, cancer, tumor, drowning, heart disease, congestive heart failure, decompression sickness, asthma, hungry, apoplexy, severe trauma, injury of head, cerebral trauma, the cerebrovascular function damage, cerebrovascular, neuropathy, nerve injury, fever, heatstroke, eating disorders, anxiety, epilepsy, epilepsy, insomnia or sleep disorder, diabetes, obesity, hypertension, hyperthyroidism, hypothyroidism or their combination.
28. the described method of claim 1, wherein said study subject be transplant recipient, transplantation donor, need the object of appetite-suppressing, patient, postoperative patient or accepted or be about to accept the patient of chemotherapy before the art.
29. the described method of claim 1, the amount of wherein said 5 '-AMP is for reducing core temperature, reduce outside body temperature, reduce rate of metabolism, reducing heart rate and their combination is effective.
30. the described method of claim 1, it further comprises to described study subject uses second pharmaceutical agent.
31. the described method of claim 30, wherein said second pharmaceutical agent comprise adjuvant, anticoagulant, variable force medicament, medicament, analgesic, anesthetis, neuroprotective, antiarrhythmic medicament or calcium channel blocker when becoming.
32. a method that reduces the study subject blood sugar content comprises the 5 '-AMP that uses the effective dose that is used to reduce individual blood sugar content to study subject.
33. the described method of claim 32, wherein said study subject suffer from diabetes, obesity or need appetite-suppressing.
34. thereby a change organizes metabolic state to accelerate the metabolic method of fatty acid in this tissue, comprise study subject used the 5 '-AMP that is used to accelerate the metabolic effective dose of fatty acid that the metabolism of wherein said quickening fatty acid is for the glycolysis in this tissue.
35. the described method of claim 34, wherein said tissue is comprised in the body of study subject.
36. the described method of claim 34, wherein said study subject are transplant recipient, transplantation donor, art preceding patient, postoperative patient or the patient who has accepted or be about to accept chemotherapy.
37. the described method of claim 34, wherein said organizing taken out in the study subject body.
38. the described method of claim 37, wherein said tissue comprises part or all of organ.
39. the described method of claim 38, wherein said organ are transplant organ.
40. the described method of claim 34, it further comprises determines that the intravital fatty acid metabolism of described study subject accelerates.
41. the described method of claim 34, wherein said patient suffers from diabetes, obesity or needs appetite-suppressing.
42. the described method of claim 34, the wherein said entity tumor that is organized as.
43. a method that reduces the study subject core temperature comprises the 5 '-AMP that uses the effective dose that is used to reduce this study subject core temperature to described study subject.
44. the described method of claim 43, it further comprises the core temperature of measuring described study subject.
45. the described method of claim 43, wherein said study subject is in the state of following disease, and described disease is shock, or has a wound, dysfunction of blood coagulation, chemotherapy side effect, poison, arrhythmia, hypothermia, burn, suffocate, inhalation injury, respiratory failure, pyemia, anxiety, insulin shock, infectious disease, cancer, tumor, drowning, heart disease, congestive heart failure, decompression sickness, asthma, hungry, apoplexy, severe trauma, injury of head, cerebral trauma, the cerebrovascular function damage, cerebrovascular, neuropathy, nerve injury, fever, heatstroke, eating disorders, anxiety, epilepsy, epilepsy, insomnia and sleep disorder, diabetes, obesity, hypertension, hyperthyroidism, hypothyroidism, be about to carry out surgical operation, the transplant patient, need appetite-suppressing, accepted or be about to accept the patient of chemotherapy, or their combination.
46. a method that reduces the metabolic speed of study subject comprises the 5 '-AMP that uses the effective dose of the rate of metabolism that is used to reduce this study subject to described study subject.
47. the described method of claim 46, it further comprises the metabolic speed of estimating described study subject.
48. the described method of claim 46, wherein said study subject is in the state of following disease, and described disease is shock, or has a wound, dysfunction of blood coagulation, chemotherapy side effect, poison, arrhythmia, hypothermia, burn, suffocate, inhalation injury, respiratory failure, pyemia, anxiety, insulin shock, infectious disease, cancer, tumor, drowning, heart disease, congestive heart failure, decompression sickness, asthma, hungry, need appetite-suppressing, apoplexy, severe trauma, injury of head, cerebral trauma, the cerebrovascular function damage, cerebrovascular, neuropathy, nerve injury, fever, heatstroke, eating disorders, anxiety, epilepsy, epilepsy, insomnia and sleep disorder, diabetes, obesity, hypertension, hyperthyroidism, hypothyroidism, be about to carry out surgical operation, the transplant patient, accepted or be about to accept the patient of chemotherapy, or their combination.
49. a pharmaceutical composition, comprising is enough to produce dormancy or the state of giving birth to that stagnates, reduces core temperature, heart is produced 5 '-AMP of the medicine effective quantity of inotropic action, the cell that slows down growth, the metabolic speed that slows down, blood sugar lowering concentration or their combination.
50. being produced, the described pharmaceutical composition of claim 49, wherein said compositions be used for following administering mode: subcutaneous injection, intramuscular injection, intravenous injection, peritoneal injection, nasal mucosa medicine administration, intravaginal administration, intranasal administration, through bronchus administration, eye drops, in ear administration, intracranial administration, oral administration, parenteral, rectally, sublingual administration, topical, percutaneous dosing or their combination.
51. the described pharmaceutical composition of claim 49, wherein said 5 '-AMP is prepared to following form: capsule, capsule sheet, soft gel, soft gelatin capsule, suppository, thin film, granule, colloid, insert, chewable tablet, lozenge, piller, tablet, piece, dish, cream, film, Emulsion, washing liquid, ointment, aerosol spray, roll and put formula liquid on the skin, roll and put formula rod, transdermal patch, subcutaneous implantation form, pad on the skin or be arranged to the form that delays to discharge in biodegradable carrier.
52. the described pharmaceutical composition of claim 49, it further comprises pharmaceutically useful carrier.
53. the described pharmaceutical composition of claim 52, wherein said pharmaceutically useful carrier comprises the aerosol spray that is selected from nitrogen, carbon dioxide, propane, butane, isobutene., pentane, different propane, fluorocarbon, dimethyl ether or their mixture.
54. the described pharmaceutical composition of claim 52, wherein said pharmaceutically useful carrier comprises at least a reagent that is selected from softening agent, water, inorganic powder, foaming agent, emulsifying agent, aliphatic alcohol, fatty acid and their combination.
55. the described pharmaceutical composition of claim 49, it is prepared to injectable dosage form.
56. the described pharmaceutical composition of claim 49, wherein said 5 '-AMP is contained in bottle or the ampoule with quantitative dosage.
57. the described pharmaceutical composition of claim 56, wherein said 5 '-AMP is dispersed in the aqueous solution.
58. the described pharmaceutical composition of claim 57, it further comprises one or more medicated premixs.
59. the described pharmaceutical composition of claim 58, wherein said additive comprise one or more buffer agents or physiology salt.
60. the described pharmaceutical composition of claim 56, wherein said bottle or ampoule have barrier film.
61. the described pharmaceutical composition of claim 56 wherein carries out quantitatively dosage, thereby 1 to 5 dosage is provided.
62. the described pharmaceutical composition of claim 61, wherein each dosage all comprises 5 ' of 1gm to 500mg-AMP.
63. the described pharmaceutical composition of claim 62, wherein each dosage all comprises 5 ' of 2gm to 20mg-AMP.
64. the described pharmaceutical composition of claim 61, wherein each dosage all comprises and is used for discharging the 5 '-AMP of 15mg/kg body weight to the effective dose of 7.5mg/kg body weight to study subject.
65. the described pharmaceutical composition of claim 61, wherein each dosage all comprises and is used for discharging the 5 '-AMP of 25mg/kg body weight to the effective dose of 250mg/kg body weight to study subject.
66. the described pharmaceutical composition of claim 49, it is prepared and is positioned over is used for inducing study subject dormancy or stagnant emitter of giving birth to state.
67. the described pharmaceutical composition of claim 49, it further is restricted to and is applicable to the aerosol composition of inducing the study subject dormancy, and said composition comprises 5 ' of medicine effective quantity-AMP and propellant.
68. the described pharmaceutical composition of claim 67, wherein said aerosol composition are the form of inhalant.
69. the described pharmaceutical composition of claim 30, it further comprises second activating agent.
70. the described method of claim 69, wherein said second activating agent are adjuvant, anticoagulant, variable force medicament, medicament, analgesic, anesthetis, neuroprotective, antiarrhythmic medicament or calcium channel blocker when becoming.
71. method that changes the study subject metabolic activities, comprise 5 '-AMP to study subject drug administration effective dose, wherein said 5 '-AMP has changed the activity that is selected from one or more metabolism enzymes in former lipase, pancreatic lipase, pancreatic lipase associated protein, phosphofructokinase, fructose-1, glycogen phosphorylase and their combination.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US75948006P | 2006-01-16 | 2006-01-16 | |
US60/759,480 | 2006-01-16 | ||
US60/821,521 | 2006-08-04 |
Publications (1)
Publication Number | Publication Date |
---|---|
CN101478974A true CN101478974A (en) | 2009-07-08 |
Family
ID=40839494
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNA2007800089583A Pending CN101478974A (en) | 2006-01-16 | 2007-01-16 | Methods and compositions for inducing torpor in a subject |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101478974A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102895254A (en) * | 2012-08-31 | 2013-01-30 | 王云龙 | Use of 5'-AMP in septicemia treatment |
-
2007
- 2007-01-16 CN CNA2007800089583A patent/CN101478974A/en active Pending
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102895254A (en) * | 2012-08-31 | 2013-01-30 | 王云龙 | Use of 5'-AMP in septicemia treatment |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Gold et al. | Evaluation of the cocaine-like discriminative stimulus effects and reinforcing effects of modafinil | |
Palenicek et al. | Increased sensitivity to the acute effects of MDMA (“ecstasy”) in female rats | |
Kiryanova et al. | Increased aggression, improved spatial memory, and reduced anxiety-like behaviour in adult male mice exposed to fluoxetine early in life | |
Murai et al. | Control of postprandial hyperglycaemia by galactosyl maltobionolactone and its novel anti-amylase effect in mice | |
NZ238277A (en) | Veterinary agent for retarding age-dependent deterioration comprising 1-deprenyl | |
RU2464977C2 (en) | Method of reducing demage to nervous cells | |
CN106999601A (en) | Film product based on straight-chain polysaccharide | |
CN106470679A (en) | Treat chronic hepatic diseases complication with Caspase inhibitors | |
ES2773834T5 (en) | Methods and compositions for treating depression using cyclobenzaprine | |
CN109982686A (en) | More purposes determined for treating RETT syndrome of Puli | |
KR20160037169A (en) | R e t t syndrome and treatments therefore | |
US20110059916A1 (en) | Methods and Compositions for Inducing Torpor in a Subject | |
EP1891961B1 (en) | Use of 5'-methylthioadenosine (mta) in the prevention and/or treatment of autoimmune diseases and/or transplant rejection | |
Hecht et al. | Alterations in the reinforcing efficacy of cocaine in adult rats following prenatal exposure to cocaine. | |
Mayersohn | Principles of drug absorption | |
Glatt et al. | Prenatal cocaine exposure alters behavioral and neurochemical sensitization to amphetamine in adult rats | |
Tigani et al. | Effects of wortmannin on airways inflammation induced by allergen in actively sensitised Brown Norway rats | |
Nyhan | Lesch–Nyan syndrome | |
CN101478974A (en) | Methods and compositions for inducing torpor in a subject | |
Ramanathan et al. | Hyperglycaemia in pregnancy: effects on the offspring behaviour with special reference to anxiety paradigms | |
Nair | Prenatal exposure to drugs: effect on the development of brain monoamine systems | |
Shekim et al. | Catecholamine metabolites in congenital sensory neuropathy with anhydrosis | |
Giboda et al. | Experimental schistosomiasis mansoni: modulation of granulomas by inhibition of collagen cross-link formation. Preliminary report | |
Mascarenhas et al. | Effects of plant-derived analgesic compounds sinomenine and salvinorin A in infant rats | |
US20030157162A1 (en) | Liposome-encapsulated opioid analgesics |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090708 |