CN101469346B - Construction of interleukin 1beta specific mouse optical imaging system and use thereof - Google Patents
Construction of interleukin 1beta specific mouse optical imaging system and use thereof Download PDFInfo
- Publication number
- CN101469346B CN101469346B CN 200710173613 CN200710173613A CN101469346B CN 101469346 B CN101469346 B CN 101469346B CN 200710173613 CN200710173613 CN 200710173613 CN 200710173613 A CN200710173613 A CN 200710173613A CN 101469346 B CN101469346 B CN 101469346B
- Authority
- CN
- China
- Prior art keywords
- animal
- interleukin
- gene
- mouse
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the field of biotechnology, and discloses the establishment of an optical imaging system for an interleukin 1beta specific molecular mouse and application of the optical imaging system. The invention also discloses application of a transgenic animal, which is used for screening a substance with anti-inflammation effect. A 5' upstream regulatory region containing an interleukin 1beta gene is taken as a promoter to drive a reporter gene to serve as a vector to transfer into an animal genome through transgenic technology to obtain the transgenic animal; and the animal can quickly and sensitively be detected the change of the reporter gene in the body in an in vivo imaging system, the expression condition of interleukin 1beta is reflected in the body in a real-time and effective mode. The animal transferred with the gene can be taken as a model and used for screening the substance with the anti-inflammation effect; and a screening method has the advantages of simple operation, intuitivity and high sensitivity, has small damage to the animal, and can observe the dynamic reaction process of the reporter gene driven by an interleukin 1beta promoter in the body of the animal under the action of related substances in a real-time and continuous mode.
Description
Technical field
The invention belongs to biological technical field, more specifically, the present invention relates to a kind of purposes of transgenic nonhuman mammal, and the method for utilizing described animal screening anti-inflammatory substance.
Background technology
Inflammation is meant that tissue or organ are to destructive stimulus or a kind of defensive raction that damage produced.This inflammatory reaction mechanism of body can be resisted the invasion of microorganism, promotes the reparation of tissue injury, but too violent inflammatory reaction but can make tissue necrosis, causes dysfunction, even can jeopardize patient's life rapidly, and as SARS, acute serious hepatitis etc.; And secular unsuitable inflammatory reaction is the important pathomechanism of many chronic diseases, as liver cirrhosis, chronic nephritis, rheumatic arthritis etc.Nearest research shows that also the generation of many tumours and development also have confidential relation with secular inflammatory reaction; And arteriosclerosis, nerve degenerative diseases, diabetes etc. also can be regarded a kind of inflammatory reaction as to a certain extent.
Inflammatory reaction is a very complicated process, and many details are still waiting further further investigation, wherein most typically be a large amount of inflammatory cells to the gathering of inflammation part and invade profit, and a large amount of inflammatory factor expression in vivo.
Therefore, foundation can be used for the model of inflammation research and anti-inflammatory medicaments screening, and for the new anti-inflammatory class medicine of research and development, the disease that treatment one big class relates to human great health problem is very valuable.And existing inflammation research model is not often because of being the body inner model interior inflammation process of antimer truly, perhaps need to study by animal model is slaughtered at different time points, complicated operation and research cost height have limited the exploitation of anti-inflammatory medicaments.
Summary of the invention
The object of the present invention is to provide a kind of purposes of transgenic nonhuman mammal.
Another object of the present invention is to provide and utilize described transgenic animal, the method for screening anti-inflammatory medicaments as model.
In a first aspect of the present invention, a kind of purposes of transgenic nonhuman mammal is provided, contains an expression casette in the genome of described animal, described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, reporter gene, terminator; Described transgenic animal are used to screen the material of anti-inflammatory.
In another preference, described non-human mammal is selected from: mouse, rat, rabbit, dog, ape and monkey.Preferably, described non-human mammal is a mouse; Mouse more preferably.
In another preference, in the described expression cassette, before interleukin-11 β promotor, also contain chicken cHS4 insulator gene.
In another preference, described expression cassette from 5 ' to 3 ' end is made of following element: interleukin-11 β promotor, reporter gene, terminator; Perhaps constitute: chicken cHS4 insulator gene, interleukin-11 β promotor, reporter gene, terminator by following element.Between each element, also can contain some sequences that do not influence genetic expression, as the partial sequence of the restriction enzyme site that is provided with in order to connect each element.
In another preference, described reporter gene is selected from: luciferase encoding gene, green fluorescent protein encoding gene, or red fluorescent protein encoding gene.Preferably, described reporter gene is the luciferase encoding gene.
In another preference, described interleukin-11 β promotor has interleukin-11 β transcription initiation site upstream (100 ± 99b)～(4.5 ± 0.5kb); Transcription initiation site upstream (50 ± 49b)～(4.5 ± 0.2kb) sequence preferably.
In another preference, described interleukin-11 β promotor has from interleukin-11 β transcription initiation site (promptly-1b) to the sequence of upstream-4.5kb.
In another preference, described terminator is poly-(A) termination signal (SV40late poly (A) signal) in the evening of simian virus 40.
In another preference, described inflammation is the inflammation of interleukin-11 beta mediated (or participation).
In a second aspect of the present invention, a kind of method for preparing transgenic nonhuman mammal is provided, described method comprises: an expression casette is changed in the zygote of animal, obtain described transgenic nonhuman mammal thereby cultivate described zygote;
Wherein, described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, reporter gene, terminator.
In another preference, in the described expression cassette, before interleukin-11 β promotor, also contain chicken cHS4 insulator gene.
In a third aspect of the present invention, a kind of method of screening the potential material (as compound) of anti-inflammatory is provided, described method comprises step:
(1) inflammatory reaction of initiation transgenic nonhuman mammal, contain an expression casette in the genome of described transgenic nonhuman mammal, described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, reporter gene, terminator;
(2) give transgenic nonhuman mammal with candidate substances;
(3) expression of reporter gene in the detection animal body; Wherein, if described candidate substances can suppress the expression of reporter gene, show that then this candidate substances is the potential material of anti-inflammatory.
In another preference, step (1) and step (2) can be carried out simultaneously; Or carry out successively, promptly carry out step (1) earlier and carry out step (2) again, or opposite.
In another preference, described reporter gene is the luciferase encoding gene, and in step (2), after giving transgenic nonhuman mammal with candidate substances, give animal fluorescein substrate, utilize the living imaging system to detect the intravital luciferase expression situation of animal.
In another preference, described method also comprises step: the potential material that obtains is carried out further animal experiment, cell experiment and/or clinical trial, with the anti-inflammatory effect of the described potential material of further conclusive evidence.
In another preference, give non-human mammal and be selected from (but being not limited to) reagent initiation inflammatory reaction of group down: lipopolysaccharides, zymosan, oxazolone.
In another preference, the formulation that causes the reagent of non-human mammal inflammatory reaction is: give medicament (as oral preparation, suppository) in the stomach, or injection reagent (as injection), or external application agent (as liniment).
In another preference, the formulation that gives non-human mammal fluorescein substrate is to give medicament (as oral preparation) in the stomach, or injection reagent (as injection).
In a fourth aspect of the present invention, a kind of cell that derives from described transgenic nonhuman mammal is provided, contains an expression casette in the genome of described cell, described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, reporter gene, terminator.
In another preference, described cell is non-embryonic stem cells or sexual cell.Preferably, described cell is a somatocyte.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1. the synoptic diagram of people's interleukin-11 β gene report carrier.The about 4.5kb of interleukin-11 beta gene expression control region is cloned into the upstream of luciferase gene.
Fig. 2. contain the carrier of the luciferase reporter gene of hIL-1 β driving.People's the about 4.5kb of interleukin-11 β upstream region of gene control region is cloned into the upstream of luciferase gene.
Fig. 3 .PCR identifies transgenic mice.1: 2,000 DNA marker; 2,3,4: the result that negative mouse is identified; 5,6,7,8: the result that positive mouse is identified.
Fig. 4. the consistency checking of the situation of the expression of external fluorescent signal of mouse and mouse endogenous interleukin-11 β.
A, the result of the histofluorescence of external fluoroscopic examination transgenic mice under LPS stimulates.
B, real-time quantitative PCR detect the changing conditions of endogenous interleukin-11 β under LPS stimulates in each tissue.
Fig. 5. (In vivo) measures the interior fluorescence of body of transgenic mice in the body.
Fig. 6. utilize the in-vivo imaging system to show the time changing curve figure of transgenic positive mouse under LPS stimulates.Wherein,
A, in-vivo imaging system show the fluorogram of transgenic positive mouse different time under LPS stimulates;
B, LivingImage software obtain chemoluminescence numerical value in the mouse body.
Fig. 7. detect the hIL1 β-expression of Luc transgenic mice in acute arthritis.Wherein,
A, the situation of the change in fluorescence of observation mouse joint under the living imaging instrument.
B, the LivingImage software processes shows the chemoluminescence situation of mouse joint.
Fig. 8. detect the hIL1 β-expression of Luc transgenic mice in slow fast allergy.Wherein,
A. the mouse living imaging shows the expression of luciferase;
The B.LivingImage software processes quantitatively shows the chemoluminescence situation at mouse ear place.
Fig. 9. dexamethasone is to the expression inhibiting of LPS inductive interleukin-11 β.
A. dexamethasone can suppress to be subjected in the mouse body expression of LPS inductive luciferase significantly.
B. pass through the expression of LivingImage computed in software whole body mouse luciferase.
Embodiment
The inventor is through extensive and deep research, find unexpectedly, interleukin 1 β (interleukin-11 β with the people, Interleukin 1 β, abbreviation IL-1 β) promoters driven reporter gene is a carrier, method by microinjection obtains to contain the transgenic animal of this kind carrier, and this transgenic animal can be simulated reflection IL-1 β expression in vivo well in the living imaging system.The animal that changes described gene over to can be used as animal model, be used to screen the medicine of anti-inflammatory, this screening method is simple to operate, directly perceived and highly sensitive, damage to animal is little, can realize the dynamic reaction process of the real-time continuous ground observation intravital interleukin 1 β of animal under the effect of relevant medicine, need not to slaughter animal.Finished the present invention on this basis.
Method of the present invention is carried out based on optical image technology in the living animal body (optical in vivo imaging), promptly directly monitors intravital cellular activity of living body biological and gene behavior by biological intravital optical imagery.With traditional to slaughter animal in different time points different in the mode that obtains data, in-vivo imaging is by carrying out record to same group of experimental subjects in different time points, follow the tracks of moving and variation of same object observing (labeled cell and gene), the data of gained are more genuine and believable.And, do not relate to radioactive substance and hot operation, as safe as a house.Optical imagery can utilize fluorescence or noclilucence to realize in the body, and fluorescence technique is to adopt fluorescence report group (GFP, RFP, Cyt and dyes etc.) to carry out mark, and noclilucence is with luciferase (Luciferase) genetic marker cell or DNA.
But, although optical image technology has been used to observe the expression of growth of tumor and transfer in the living animal, some specific gene etc. in the body, yet since at be living animal, for gene not of the same race, disease not of the same race, the interference reduction of how setting up suitable animal model, selecting what kind of gene expression ways, whether can correctly reflect expression conditions or lysis and how make proper interior other irrelevant factor all is the problems that need further investigation and inquire into.
Structure of model animal and uses thereof
The inventor selects the promoter region clone of human interleukins-11 β to be connected to 5 ' upstream of reporter gene coding region, be surprised to find that the transgenic animal that contain above-mentioned carrier, in the living imaging system, can simulate reflection IL-1 β expression in vivo well.IL-1 β is a kind of important inflammatory factor, participates in most of inflammation pathologic process, and plays an important role as a kind of generation, development of proinflammatory factor pair inflammation.In numerous disease such as rheumatoid arthritis, shock, all can detect the expression of IL-1 β; And many researchs show, suppress the generation that the expression of IL-1 β can inflammation-inhibiting.
Among the present invention, described non-human mammal is selected from: mouse, rat, rabbit, dog, ape and monkey; Described non-human mammal is at aspects and human approaching such as genomic composition, individual growth, metabolic way, anatomical organ, disease incidence mechanism.Preferably, described non-human mammal is a mouse; Mouse more preferably.
As optimal way of the present invention, with mouse as model animals, compare with the mankind, it is all very approaching with the mankind in genomic composition, individual growth, metabolic way, anatomical organ, disease incidence mechanism etc., therefore can be applied to aspects such as human diseases pathogenesis, pharmacopathology research well.
The construction process of described transgenic nonhuman mammal comprises: the method for an expression casette by microinjection imported in the zygote of animal, obtain described transgenic animal thereby cultivate described zygote; Wherein, described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, reporter gene, terminator.
Described interleukin-11 β promotor has interleukin-11 β transcription initiation site upstream (100 ± 99b)～(4.5 ± 0.5kb) (transcription initiation site upstream (50 ± 49b)～(4.5 ± 0.2kb) sequences preferably.This zone is the upstream regulatory region of interleukin-11 β, its with can instruct reporter gene expression in vivo well after reporter gene is connected, thereby can reflect the expression of animal body words spoken by an actor from offstage interleukin 1 beta truly, delicately.
As optimal way of the present invention, described reporter gene is selected from: luciferase encoding gene, green fluorescent protein encoding gene or red fluorescent protein encoding gene.Preferred, described reporter gene is the luciferase encoding gene, and the fluorescent signal that this gene catalytic substrate is sent is subjected to the interference of the intravital autofluorescence of animal little, can specially be detected delicately.Be cloned in 3 ' end of the upstream regulatory region of interleukin-11 β, be subjected to the upstream regulatory region of interleukin-11 β to instruct expression.
Described genetic expression also comprises terminator, and suitably the selection and the structure of terminator are technology well known in the art, can adopt terminator known in the art among the present invention.Preferably, described terminator is late poly (A) termination signal of simian virus 40.
As optimal way of the present invention, in the described expression cassette, before interleukin-11 β promotor, also contain the cHS4 gene.Described cHS4 gene is a kind of insulator gene, and its gene order is shown in SEQ ID NO:1.The adding of cHS4 can make described expression casette not be subjected to the interference of other gene on every side of karyomit(e) structure picture, particularly this expression cassette when expressing, and the insulation buffer action of placing insulator among the present invention before promotor is good.
Described expression casette is imported in the zygote of animal, thereby obtains described transgenic animal by cultivating described zygote.Cultivate the zygote intrauterine that zygote need be remigrated parent usually that makes it to grow and carry out, ripe back is by the parent childbirth, thereby obtains heritable genetically modified animal strain.Described transgenic animal also can be by mating, thereby obtains the offspring animal, can find out the animal of carrying described expression cassette in the genome from the offspring animal.
In an embodiment of the present invention, the inventor utilizes transgenic mice (reporter gene is a luciferase gene) to set up various inflammatory models, by the intravital fluorescent signal of these transgenic positive mouse of optical imagery instrument detecting in the living animal body, observe the expression of endogenous IL-1 β again by experiment in vitro RT-PCR and Western blot, found that: (1) described transgenic mice can successful expression reporter gene luciferase; (2) by the vivo and vitro experimental analysis, the fluorescent signal of this transgenic mice has verily reflected the expression of endogenic IL-1 β under corresponding inflammatory model; (3) in several typical inflammatory models-lipopolysaccharides shock, acute arthritis, delayed hypersensitivity, mouse can be reflected the process of corresponding inflammatory reaction faithfully.
The above results shows that the inventor is successfully reflected the changing conditions of IL-1 β gene in some typical inflammatory models in the body with reporter gene, has sensitivity, fast, and the economic dispatch advantage.And the living imaging system is to convenient, the no wound of detecting of animal fluorescence, the situation of can real-time continuous following the tracks of each time point.
The present invention also provides the purposes of described transgenic animal, and described transgenic animal are used to screen the medicine of anti-inflammatory.More particularly, described inflammation is the inflammation of the beta mediated participation of interleukin-11.
Described transgenic animal can be implemented in the migration situation of inflammatory cell when inflammation takes place that Real Time Observation is labeled in the live body, the expression of observing interleukin-11 β changes, and utilizing these indexs to study the effect of anti-inflammatory medicaments, screening has the material of potential anti-inflammatory action.
In addition, the present invention also provides a kind of cell that derives from described transgenic nonhuman mammal, contains an expression casette in the genome of described cell, and described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, reporter gene, terminator.Described cell is non-embryonic stem cells or sexual cell.Preferably, described cell is a somatocyte.
Screening method
The present invention utilizes transgenic technology, and acquisition contains the transgenic animal by the reporting system of the reporter gene of interleukin-11 β promoters driven, can use this animal and carry out the research of inflammatory disease and the screening of corresponding anti-inflammatory medicaments.The transgenic animal model screening of medicaments of utilizing the present invention to make up, have molecule or the facility of cell screening model aspect Mechanism Study concurrently, the advantage of animal model aspect disease simulation and medicine mass action arranged again, it is the good model of drug screening and evaluation, and for research and screening combination drug, for example the drug screening of Chinese medicine and compound thereof and research are significant.
As one aspect of the present invention, the method of the potential material (as compound) that a kind of screening has anti-inflammation effect is provided, described method comprises step: (1) causes the inflammatory reaction of transgenic animal, contain an expression casette in the genome of described transgenic animal, described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, reporter gene, terminator; (2) candidate substances is given the transgenic animal of step (1); (3) expression of reporter gene in the detection animal body; Wherein, if described candidate substances can suppress the expression of reporter gene, show that then this candidate substances is the potential material of anti-inflammatory.Wherein, step (1) and step (2) can be carried out simultaneously; Or carry out successively, promptly carry out step (1) earlier and carry out step (2) again, or opposite, and the priority of step is decided by test situation.
Because interleukin-11 β is a kind of important inflammatory factor, participate in most inflammation pathologic processes, therefore, the overwhelming majority can cause the material of inflammation all to can be used for the present invention causing the animal inflammatory reaction, and the present invention does not do special qualification.Preferably, described inflammatory reaction is the inflammatory reaction of the beta mediated participation of interleukin-11.As preferred implementation of the present invention, the reagent that can give group under the animal is to cause inflammatory reaction: lipopolysaccharides, zymosan, oxazolone.
Also have no particular limits for the method that causes the animal inflammatory reaction, can cause the inflammatory reaction of animal part or whole body by modes such as administrations in injection or the stomach.Therefore, the formulation that causes the reagent of animal inflammatory reaction is (but being not limited to): give medicament (as oral preparation, suppository) in the stomach, or injection reagent (as injection), or external application agent (as liniment).
As optimal way of the present invention, described reporter gene is the luciferase encoding gene, and in step (2), after giving transgenic animal with candidate substances, give animal fluorescein (as the substrate of luciferase), utilize the in-vivo imaging system to detect the intravital luciferase expression of animal.The method that gives of fluorescein has no particular limits, and can be undertaken by mode such as giving in abdominal injection or the intravenous injection stomach.Therefore, the formulation that gives the animal luciferase reagent is to give medicament (as oral preparation) in the stomach, or injection reagent (as injection).
The above-mentioned potential material that filters out can constitute a screening storehouse, can carry out further cell experiment, animal experiment and/or clinical trial to these materials, with the anti-inflammatory effect of the described potential material of further conclusive evidence.
With utilize traditional animal model to carry out drug screening to compare, utilize transgenic animal model of the present invention to screen can to realize adult flux ground to estimate relevant candidate substances.
In a preferred embodiment of the invention, utilize at present verified compound checking can suppress the to be inflamed expression of the reporter gene in the middle of the transgenic animal model of reaction with anti-inflammatory action, thereby verify the susceptibility of transgenic animal model of the present invention, and the anti-inflammatory action mechanism of anti-inflammatory compound, the antiphlogistic effects of evaluation anti-inflammatory compound.Particularly, the inventor utilizes the verified influence that the dexamethasone of anti-inflammatory action is arranged luciferase expression in lipopolysaccharides (LPS) the inductive inflammation transgenic mice body.Experimental result shows that dexamethasone can suppress the activity of interleukin-11 β promotor, thereby inhibition is subjected to the expression of the luciferase of interleukin-11 β regulation and control.
Detect the expression of reporter gene in the animal body and can adopt technology known in the art, preferably adopting in vivo, optical image technology detects or observes.Among the present invention, described optical imaging system is a kind of tissue of launching light and can making light breakthrough experiment animal, can be quantized the system of detected light intensity simultaneously by instrument.Usually, described optical imaging system mainly is made up of camera lens, imaging camera bellows and software system.Described optical imaging system can obtain by the mode that is purchased.
Major advantage of the present invention is:
(1). the inventor finds that unexpectedly being cloned into 5 ' of reporter gene with the promotor of people's interleukin-11 β holds upstream to drive the carrier of the expression of corresponding reporter gene, such carrier is imported the corresponding transgenic animal of acquisition in the fertilised non-human eggs by transgenic technology, the expression of detected corresponding reporter gene can verily reflect IL-1 β expression in vivo, and the interference of other irrelevant factor is few in the acceptor, specificity is very strong, than passing through the Northern trace, it is convenient that traditional molecular biology methods such as Western trace detect the reaction that endogenic IL-1 β response stimulates.
(2). because the intravital fluorescence of animal can detect by optical imaging system in the living animal body, and do not need to dissect animal, so just can realize the situation of each time point animal of real-time follow-up.Traditional animal experiment method need be slaughtered laboratory animal to obtain data at different time points, obtains the experimental result of a plurality of time points.By contrast, the visible light in-vivo imaging is followed the tracks of moving and variation of same object observing (labeled cell and gene) by same group of experimental subjects carried out record in different time points, and the data of gained are more genuine and believable.
(3). on live body, directly reporter gene is measured, therefore simple to operate, detection method is general, speed is fast, highly sensitive.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
Design following primer:
IL-1 β upstream primer (SEQ ID NO:2):
5’AAATGAGTGACTTCCCCATGACGGC 3’；
IL-1 β downstream primer (SEQ ID NO:3):
5’CCCTGGATAAGTGGTACCAGAGCCC 3’；
From the huge genome of having a liking for clone U937 (purchasing cell bank) of people's monokaryon, amplify IL-1 β from the transcription initiation site upstream regulatory region (SEQ ID NO:8) of about 4.5kb upwards by conventional round pcr in biochemical cell institute of the Chinese Academy of Sciences, utilize the upstream of the luciferase reporter gene (luciferase) that is inserted into the carrier pGL3-Basic (Promega) that cuts through same enzyme behind Kpn I and the Bgl II double digestion then, obtain a reporter gene carrier pGL3-IL-1 β by the control of people IL-1 β upstream regulatory region.
Design following primer:
CHS4 upstream primer (SEQ ID NO:4):
5’GCTGGTACCTCACTGACTCCGTCCT 3’；
CHS4 downstream primer (SEQ ID NO:5):
5’ATCGGGCCCGGAGCTCACGGGGACAGC 3’；
From the genome of chicken, amplify insulator cHS4 gene by conventional round pcr, be inserted among the carrier pGL3-IL-1 β that cuts through same enzyme after utilizing Kpn I and Apa I double digestion then, obtain carrier pIL1 β-Luc-SV40 late poly (A), be used for the preparation of follow-up transgenic mice.CHS4 can prevent near the interference of the sequence of transgenic insert locus to transgene carrier, and its gene order is shown in SEQ ID NO:1.
2.1 linearized vector
Cut carrier with Not I and Sal enzyme, obtain linearizing pIL1 β-Luc-SV40 late poly (A), and the purpose segment is reclaimed in rubber tapping.
2.2 the microinjection of transgenosis plasmid
Obtain containing the transgenic positive mouse (hIL1 β-Luc transgenic mice) of above-mentioned carrier by microinjection technique, transgenic mice preparation experiment method concrete grammar is as follows:
1, choose 7～8 age in week female mice, vaginal tract sealing, as donor, about afternoon 3:00, every mouse peritoneal injection pregnant mare serum PMSG (10U).
2, after 47～48 hours, every mouse peritoneal is injected human body suede (hair) film gonad-stimulating hormone HCG (0.8U), and mates with normal public mouse; The only of the right age female mouse of peek (more than 2 monthly ages) is as acceptor in addition, and the vaginal tract flush mates with the public mouse of ligation.
3, observe donor, acceptor before the next morning 9:00, have smart bolt person to take out standby.The acceptor cage is taken out and is performed quarantine measures.
4, about 10:30, disconnected neck is put to death donor, and whole uterine tube is taken out in operation, puts into Unidasa M2 liquid.Microscopically is torn ampulla of uterine tube with tweezers, and zygote is promptly together flowed out in company with granulosa cell.
5, examine and be placed on Unidasa M2 liquid (Sigma, the M5910) zygote in when the granulosa cell around the zygote breaks away from, with the zygote sucking-off, are put into M2 liquid and washed, and (Sigma puts into 5%CO in M7292) to be placed on M16 liquid at last
2, 37 ℃ of incubators are cultivated.
6, examine under a microscope, it is full to select cell, and zona pellucida is clear, and the apparent zygote of male pronucleus is stand-by.
7, install and to hold ovum pin and entry needle, make its end be parallel to Stage microscope, splash into a M2 liquid, cover paraffin oil, move into zygote to be injected in the central authorities of depression slide.The bubble of DNA in entry needle of pIL1 β-Luc-SV40 late poly (A) should be walked by formerly whole bullets.
8, under high power lens, entry needle is touched ovum holding tube, the DNA of pIL1 β-Luc-SV40 late poly (A) is slowly flowed out and control its flow; Pressure-vaccum zygote makes it be in the optimum position repeatedly, and entry needle is thrust the male pronucleus of zygote, promptly withdraws from until seeing that protokaryon expands, and injection finishes, and puts into 5%CO2, and 37 ℃ of incubators are cultivated.
9, with acceptor anesthesia, injected dose is 1% vetanarcol 0.01ml/g, abdominal injection.Operation is taken out ovary and is connected uterine tube, fixes with fatty tweezer, finds the uterine tube opening at microscopically.Draw injection after cultivate the zygote that survives, the absorption method is to inhale one section long M2 earlier, inhales a bubble, draws zygote then, closely arranges as far as possible, inhales one section liquid again, inhales a bubble, inhales one section liquid again, three bubbles of totally four sections liquid.Remove long that section liquid, remaining liquid is roughly about 1cm, about bubble 0.2cm.To transplant the mouth of pipe and insert the uterine tube mouth, gently the liquid in the grafts will be blown into, and see that ampulla of uterine tube expands and clearly see three bubbles, promptly transplant successfully.Ovary is put back to the abdominal cavity together with uterine tube, suture muscles and skin.
10, acceptor was weighed once every a week, when increasing than weighing for the first time for the second time, can tentatively judge pregnancy.The newborn mouse childbirth in 19～21 days of operation back treats that newborn mouse after 3 weeks, cuts ear, numbering, cuts tail, detects.
2.3 the evaluation of transgenic mice
Identify in the newborn mouse that obtains whether have positive mouse with the method for PCR earlier, the PCR primer is:
Luc-upstream primer (SEQ ID NO:6):
5’TTCCGCCCTTCTTGGCCTTTATGA 3’；
Luc-downstream primer (SEQ ID NO:7):
5’CAGCTATTCTGATTACACCCGAGG 3’；
Through identifying, obtained 6 the head person of building mouse species altogether, the part qualification result as shown in Figure 3.
2.4 the heterozygote mouse breeds, screens
Above-mentioned positive mouse that identifies and c57 mouse (available from Shanghai Slac Experimental Animal Co., Ltd.) are hybridized, breed the next generation of the corresponding head person of building mouse; Offspring to corresponding mouse species carries out fluorometric investigation in the body then, and filtering out can the satisfactory head person of building.
The screening model that the inventor selects for use is lipopolysaccharides (LPS) irritant test.It is minimum to obtain the fluorescent signal of the little mouse's head person of building when firm lps injection is intact at last, and as a child fluorescent signal was the strongest through LPS stimulation 5.In order to strengthen the susceptibility of fluoroscopic examination signal, the inventor selects male mouse (hIL1 β-Luc mouse) to be used for follow-up test after this head person's of building mouse and Balb/c mouse (available from Shanghai Slac Experimental Animal Co., Ltd.) were hybridized for 5 generations.
2.5 detect transgenic mice can antimer in the situation of IL-1 β
The instrument that the inventor is used for the detection of fluorescent signal in the mouse body is NightOWL (live body) cold light fluoroscopic image analyser.Can utilize NightOWL (live body) cold light fluoroscopic image analyser for proof and detect the fluorescence of transgenic mice, whether the signal that this instrument detecting arrives consistent with the detected signal of external common instrument, and prove this instrument detecting to signal to transcribe characteristic similar with endogenic IL-1 β; Be the situation of transcribing that this transgenic mice has to what extent reproduced endogenous IL-1 β on earth, carried out the detection test of external luciferase and the mensuration of RT-PCR.
The female adult mice (n=3) of transgenic positive, the lipopolysaccharides of abdominal injection 3mg/kg (LPS) after 5 hours, is dissected rapidly and is taken out each internal organs: heart, liver, spleen, lung, kidney, duodenum, stomach, brain, cerebellum.Homogenizer is milled on ice, and is frozen at-70 ℃ rapidly.Carry out external fluorescent test (Ex vivoLuc assay) again.Measure the protein content of respective organization again with the Bradford method.Same procedure measure do not inject LPS transgenic positive mouse respective organization in contrast, see Fig. 4 A.
Get the female adult mice (n=3) of transgenic positive, the LPS of abdominal injection 3mg/kg after 5 hours, dissects rapidly and takes out each internal organs: heart, liver, spleen, lung, kidney, duodenum, stomach, brain, cerebellum.Extract corresponding mRNA, utilize the reverse transcription of reverse transcription test kit to become corresponding cDNA then.Then, the method for the real-time quantitative PCR by routine is determined interleukin-11 β expression of gene situation in the respective organization, sees Fig. 4 B.
Measurement result shows that the expression of luciferase is consistent with intravital interleukin-11 beta gene expression situation, expresses higher at spleen and lung.
Stimulate transgenic mice (abdominal injection 3mg/kg) with LPS, with the transgenic mice that do not stimulate in contrast, under the live body optical detection, can find that luciferase raises rapidly in the transgenic mice body, as shown in Figure 5, the transgenic positive mouse can significantly observe the expression of the intravital luciferase of mouse after LPS stimulates 5 hours, wild-type mice then can not detect any tangible fluorescent signal.This has illustrated that hIL1 β-Luc transgenic mice can expressing luciferase and can respond the stimulation of LPS.
The process of mouse living imaging is as follows: the luciferase substrate (concentration 15mg/ml) of abdominal injection 150ul in the mouse body, begin anesthetized mice after 5 minutes, in 12-15 minute, mouse is put in the camera bellows of imaging system (the true living imaging IVIS of system 100 of smart promise is available from Xenogen company) and begins imaging.
The research of embodiment 3 lipopolysaccharides shock
Grow up female hIL1 β-Luc mouse by abdominal injection LPS (3mg/kg), then, utilize the in-vivo imaging system to show the situation of different luciferase expressions constantly in the mouse body.
The results are shown in Figure 6, the result shows that under the stimulation of LPS, the intravital luciferase of mouse was just expressed rapidly, reached the climax in 3 hours, began then to land lentamente in 1 hour.
In addition, by with embodiment 1 and 2 similar methods, the inventor has prepared the carrier of the luciferase reporter gene that drives with 1-4460 position in the SEQ ID NO:8 sequence and has changed mouse over to, and the situation of different luciferase expressions constantly is identical with the transgenic mice that adopts embodiment 1 and 2 preparations in this mouse body as a result.
The research of embodiment 4 acute arthritises
Carry out the acute arthritis model research, at the right crus of diaphragm intracavitary administration zymosan (300 μ g/ only) of 3 female adult hIL1 β-Luc mouse, left foot is then by injection contrast damping fluid (PBS that contains 5% glucose).Then, under the living imaging instrument, observe the situation of the change in fluorescence of mouse joint.
The results are shown in Figure 7, the inventor finds, can not detect tangible fluorescent signal in the zymosan injection in 1 hour.In 2 hours, begin to detect fluorescent signal, reached the climax by 8 hours; Then, beginning landing lentamente.
The research of embodiment 5 delayed hypersensitivitys
Carry out the research of delayed hypersensitivity, female adult hIL1 β-Luc transgenic mice abdominal injection 2% oxazolone (oxazolone) 50 μ l (6d) at 3.After 6 days (0d), inject 1% the oxazolone of 10 μ l, inject acetone/sweet oil (4: 1 volume ratios) of 10 μ l at left ear at right ear.Detect the changing conditions of the luciferase of mouse ear at corresponding time point.
The result in the delayed hypersensitivity, can detect the expression of luciferase as shown in Figure 8 in the injection site of mouse ear, its expression pattern is consistent with mouse ear swelling reaction.
The research of embodiment 6 relevant anti-inflammatory drugs
With the dexamethasone is trial drug, observes the application of transgenic mice in anti-inflammatory drug research.
Two groups of male mices; Inject LPS (3mg/kg) and dexamethasone (3mg/kg) in one group of mouse peritoneal simultaneously; Another group is then injected LPS and physiological saline simultaneously.
The result as shown in Figure 9, the inventor's result shows, dexamethasone can effectively suppress the chemiluminescent amount of the transgenic mice that LPS causes.The medicine injection is after 5 hours, and the expression intensity of the luciferase of discovery test group is lower more than 3 times than control group.Illustrate that dexamethasone can suppress the activity of hIL-1 β promotor, thereby inhibition is subjected to the expression of the luciferase of hIL-1 β regulation and control.
According to the literature, dexamethasone can suppress the expression (Krakauer of IL-1 β in the body really, T., Inhibition of toxic shock syndrome toxin-1-induced cytokine productionand T cell activation by interleukin-10, interleukin-4, anddexamethasone.J Infect Dis, 1995.172 (4): p.988-92.).Therefore, conclusion of the present invention is correct.In addition, can verify of the influence of other substances, thereby filter out useful medicine according to aforementioned identical method for the expression of the luciferase of hIL-1 β regulation and control.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.
＜120〉foundation and the application thereof of interleukin-11 β special molecular mouse optical imaging system
<130>076900
<160>7
<170>PatentIn version 3.3
<210>1
<211>1247
<212>DNA
＜213〉chicken (gallus)
<400>1
ggagctcacg gggacagccc ccccccaaag cccccaggga tgtaattacg tccctccccc 60
gctagggggc agcagcgagc cgcccggggc tccgctccgg tccggcgctc cccccgcatc 120
cccgagccgg cagcgtgcgg ggacagcccg ggcacgggga aggtggcacg ggatcgcttt 180
cctctgaacg cttctcgctg ctctttgagc ctgcagacac ctggggggat acggggaaaa 240
agctttaggc tgaaagagag atttagaatg acagaatcat agaacggcct gggttgcaaa 300
ggagcacagt gctcatccag atccaacccc ctgctatgtg cagggtcatc aaccagcagc 360
ccaggctgcc cagagccaca tccagcctgg cctcgaatgc ctgcagggat ggggcatcca 420
cagcctcctt gggcaacctg ttcagtgcgt caccaccctc tgggggaaaa actgcctcct 480
catatccaac ccaaacctcc cctgtctcag tgtaaagcca ttcccccttg tcctatcaag 540
ggggagtttg ctgtgacatt gttggtctgg ggtgacacat gtttgccaat tcagtgcatc 600
acggagaggc agatcttggg gataaggaag tgcaggacag catggacgtg ggacatgcag 660
gtgttgaggg ctctgggaca ctctccaagt cacagcgttc agaacagcct taaggataag 720
aagataggat agaaggacaa agagcaagtt aaaacccagc atggagagga gcacaaaaag 780
gccacagaca ctgctggtcc ctgtgtctga gcctgcatgt ttgatggtgt ctggatgcaa 840
gcagaagggg tggaagagct tgcctggaga gatacagctg ggtcagtagg actgggacag 900
gcagctggag aattgccatg tagatgttca tacaatcgtc aaatcatgaa ggctggaaaa 960
gccctccaag atccccaaga ccaaccccaa cccacccacc gtgcccactg gccatgtccc 1020
tcagtgccac atccccacag ttcttcatca cctccaggga cggtgacccc cccacctccg 1080
tgggcagctg tgccactgca gcaccgctct ttggagaagg taaatcttgc taaatccagc 1140
ccgaccctcc cctggcacaa cgtaaggcca ttatctctca tccaactcca ggacggagtc 1200
agtgaggatg ggggaatatc aagcttatcg ataccgtcga cctcgag 1247
<210>2
<211>25
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>2
aaatgagtga cttccccatg acggc 25
<210>3
<211>25
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
ccctggataa gtggtaccagagccc 25
<210>4
<211>25
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
gctggtacct cactgactcc gtcct 25
<210>5
<211>27
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
atcgggcccg gagctcacgg ggacagc 27
<210>6
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
ttccgccctt cttggccttt atga 24
<210>7
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>7
cagctattct gattacaccc gagg 24
<210>8
<211>4663
<212>DNA
＜213〉homo sapiens (Homo Sapies)
<400>8
tgtacctgaa acatttatta tctggccctt tacagaaaat gtttccagac cctggataag 60
tggtaccaga gccccctctg tttgtggtcc ccctctctta tacccactag gtgtgagaaa 120
agacatagag taggagagcc ctgccatcca tcttacccac ccaggggctt tttctgatgg 180
atccaaagga aggacaaggt cttattggtc tcccagaact gacataacaa ctccgacatc 240
agggaaaagc cattggagac tacatagctc gccagcccca gccacctgct catatatcta 300
agccctcctt gttctagacc agggaggaga atggaatgtc ccttggactc tgcatgtccc 360
caatctgaga acctggatcc aagagggaga agaagcccat tggagatgat gccataaagg 420
aagtggaagc gatatgataa aaatcatagt gcccattccc aaataatccc agaagcagaa 480
gggaaaggag agaaatatcc acaaagacag gtgtgggtac acacaacatt tttcatactt 540
taagatccca gagggactca tggaaatgat acaagaaaat gactcataag aacaaatatt 600
aggaagccag tgccaagaat gagatgggaa attggggaaa atgttggggg cagattgctt 660
agttctgttc taagcaagag ggtgaacaag gaaggaacag ctcactacaa agaacagaca 720
tcactgcatg tacacacaat aatataagaa ctaacccatg attattttgc ttgtcttctt 780
gttcaaaatg attgaagacc aatgagatga gatcaacctt gataactggc tgcgaagccc 840
atgattagac acaagatggt atcagggcac ttgctgcttt gaataaatgt cagtctcctg 900
tcttggaaga atgacctgac agggtaaaga ggaacttgca gctgagaaag gctttagtga 960
ctcaagagct gaataattcc ccaaaagctg gagcatcctg gcatttccag ctccccatct 1020
ctgcttgttc cacttccttg gggctacatc accatctaca tcatcatcac tcttccactc 1080
cctcccttag tgccaactat gtttatagcg agatattttc tgctcattgg ggatcggaag 1140
gaagtgctgt ggcctgagcg gtctccttgg gaagacagga tctgatacat acgttgcaca 1200
acctatttga cataagaggt ttcacttcct gagatggatg ggatggtagc agatttgggt 1260
ccaggttaca gggccaggat gagacatggc agaactgtgg agactgttac gtcagggggc 1320
attgccccat ggctccaaaa tttccctcga gcgaaagcat caggggctca tgcaacctgg 1380
atactagtgc tgcttcaacc acactgtgct attggatgag tcacttccac cctcctagcc 1440
ttgatttctt cgtctgctgt tcacattcaa atagctattc atgtcttcat ctctgtggtc 1500
ccaccatatc ccaccagaca atcattaggg ctcctcttag ctggcagatt ctgaggtcct 1560
ggatgctaca attggaagat ggagaagtag aagctcaagg tttctgacct gtatcccaag 1620
tcccagaagc agaatggact aactcagagc tgatgctcgg gtcccttgca tatctccctt 1680
cctgtcactg gctttgatcc tccttcgttc agcttgtaat cacatcaaca gaccaaagac 1740
atctctgtgt tctgtcagga gagttcacag agccaccaac cctccagacc ctgctggttg 1800
ccgcataaag actctgagga agggtttgag gctgctgtga tcatgcaatg aatgcatgat 1860
tgtaccactg cactccagcc tgggggataa aggtagatcc tgtctaggag agagagagag 1920
agaaagagaa agagagagag aagggaggga gagacaaaga aaaagagaga gagggaggga 1980
gaaagaaaga gagaaagaaa agagaaaaga aagaaaaaga aagaaagaga gagagggagg 2040
gagggagaga gaaagaaaga aagaaagaga aagagagaaa gagagaaaga gaaagaaagg 2100
aagaaagaaa gaaagaaaga aagaaagaaa gaaagaaaga aagaaaagaa aagaaagaaa 2160
gagagagaga aagaaaaaga aagaggaagg aaggaaggaa ggaagaaaga caggctctga 2220
ggaaggtggc agttcctaca acgggagaac cagtggttaa tttgcaaagt ggatcctgtg 2280
gaggcaaaac agaggagtcc cctaggccac ccagacaggg cttttagcta tctgcaggac 2340
cagacaccaa atttcaggag ggctcagtgt taggaatgga ttatggctta tcaaattcac 2400
aggaaactaa catgttgaac agcttttaga tttcctgtgg aaaatataac ttactaaaga 2460
tggagttctt gtgactgact cctgatatca agatactggg agccaaatta aaaatcagaa 2520
ggctgcttgg agagcaagtc catgaaatgc tctttttccc acagtagaac ctatttccct 2580
cgtgtctcaa atacttgcac agaggctcac tcccttggat aatgcagagc gagcacgata 2640
cctggcacat actaatttga ataaaaatgc tgtcaaattc ccattcaccc attcaagcag 2700
caaactctac cacctgaatg tacatgccag gcactgtgct agacttggct caaaaagatt 2760
tcagtt tcct ggaggaacca ggaggagcaa ggtttcaact cagtgctata agaagtgtta 2820
caggctggac acggtggctc acgcctgtaa tcccaacact ttgggaggcc gaggcgggca 2880
gatcacaagg tcaggagatc gagaccatcc tggctaacat ggtgaaaccc tgtctctact 2940
aaaaatacaa aaaattagcc gggcgtggcg gcaggtgcct gtagtcccag ctgctgggga 3000
ggctgaggca ggagaatggt gtgaacccgg gaggcggaac ttgcaggggg ccgagatcgt 3060
gccactgcac tccagcctgg gcgacagagt gagactctgt ctcaaaaaaa aaaaaaaagt 3120
gttatgatgc agacctgtca aagaggcaaa ggagggtgtt cctacactcc aggcactgtt 3180
cataacctgg actctcattc attctacaaa tggagggctc ccctgggcag taccctggag 3240
caggcacttt gctggtgtct cggttaaaga gaaactgata actcttggtt ggtattacca 3300
agagatagag tctcagatgg atattcttac agaaacaata ttccactttt cagagttcac 3360
caaaaaatca ttttaggcag agctcatctg gcattgatct ggttcatcca tgagattggc 3420
tagggtaaca gcacctggtc ttgcagggtt gtgtgagctt atctccaggg ttgccccaac 3480
tccgtcagga gcctgaaccc tgcataccgt atgttctctg ccccagccaa gaaaggtcaa 3540
ttttctcctc agaggctcct gcaattgaca gagagctcct gaggcagaga acagcaccca 3600
aggtagagac ccacaccctc aatacagaca gggagggcta ttggcccttc attgtaccca 3660
tttatccatc tgtaagtggg aagattccta aacttaagta caaagaagtg aatgaagaaa 3720
agtatgtgca tgtataaatc tgtgtgtctt ccactttgtc ccacatatac taaatttaaa 3780
cattcttcta acgtgggaaa atccagtatt ttaatgtgga catcaactgc acaacgattg 3840
tcaggaaaac aatgcatatt tgcatggtga tacatttgca aaatgtgtca tagtttgcta 3900
ctccttgccc ttccatgaac cagagaatta tctcagttta ttagtcccct cccctaagaa 3960
gcttccacca atactctttt cccctttcct ttaacttgat tgtgaaatca ggtattcaac 4020
agagaaattt ctcagcctcc tacttctgct tttgaaagcc ataaaaacag cgagggagaa 4080
actggcagat accaaacctc ttcgaggcac aaggcacaac aggctgctct gggattctct 4140
tcagccaatc ttcattgctc aagtatgact ttaatcttcc ttacaactag gtgctaaggg 4200
agtctctctg tctctctgcc tctttgtgtg tatgcatatt ctctctctct ctctctttct 4260
ttctctgtct ctccctctcc ttccctctct gcctccctct ctcagctttt tgcaaaaatg 4320
ccaggtgtaa tataatgctt atgactcggg aaatattctg ggaatggata ctgcttatct 4380
aacagctgac accctaaagg ttagtgtcaa agcctctgct ccagctctcc tagccaatac 4440
attgctagtt ggggtttggt ttagcaaatg cttttctcta gacccaaagg acttctcttt 4500
cacacattca ttcatttact cagagatcat ttctttgcat gactgccatg cactggatgc 4560
tgagagaaat cacacatgaa cgtagccgtc atggggaagt cactcatttt ctccttttta 4620
cacaggtgtc tgaagcagcc atggcagaag tacctgagct cgc 4663
Claims (3)
1. a method for preparing transgenic nonhuman mammal is characterized in that, described method comprises: an expression casette is changed in the zygote of animal, obtain described transgenic nonhuman mammal thereby cultivate described zygote;
Wherein, described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, and reporter gene, terminator,
And described non-human mammal is selected from mouse and rat, described interleukin-11 β promotor is a human interleukin-11 β promotor, the sequence of described interleukin-11 β promotor is the 62-4609 position of SEQ ID NO.:8, and described reporter gene is selected from: the luciferase encoding gene, green fluorescent protein encoding gene, or red fluorescent protein encoding gene.
2. the method for claim 1 is characterized in that, in the described expression cassette, before interleukin-11 β promotor, also contains chicken cHS4 insulator gene.
3. a cell that derives from transgenic nonhuman mammal is characterized in that, contains an expression casette in the genome of described cell, and described expression cassette from 5 ' to 3 ' end has following element successively: interleukin-11 β promotor, and reporter gene, terminator,
Wherein, described non-human mammal is selected from mouse and rat, described interleukin-11 β promotor is a human interleukin-11 β promotor, the sequence of described interleukin-11 β promotor is the 62-4609 position of SEQ ID NO.:8, and described reporter gene is selected from: the luciferase encoding gene, green fluorescent protein encoding gene, or red fluorescent protein encoding gene; And described cell is a somatocyte.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710173613 CN101469346B (en) | 2007-12-28 | 2007-12-28 | Construction of interleukin 1beta specific mouse optical imaging system and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710173613 CN101469346B (en) | 2007-12-28 | 2007-12-28 | Construction of interleukin 1beta specific mouse optical imaging system and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101469346A CN101469346A (en) | 2009-07-01 |
| CN101469346B true CN101469346B (en) | 2013-07-24 |
Family
ID=40827151
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200710173613 Active CN101469346B (en) | 2007-12-28 | 2007-12-28 | Construction of interleukin 1beta specific mouse optical imaging system and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101469346B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103926224B (en) * | 2014-03-26 | 2016-04-13 | 北京市心肺血管疾病研究所 | The method of composition of transgenic plants whether is contained in a kind of auxiliary detection food |
| CN104017818B (en) * | 2014-06-24 | 2017-02-22 | 中山大学 | Inflammasome activity reporting system for sub-cellular localization and application thereof |
| CN112704492A (en) * | 2019-10-25 | 2021-04-27 | 上海交通大学 | Method for evaluating levels of several interleukins in serum based on skin autofluorescence |
-
2007
- 2007-12-28 CN CN 200710173613 patent/CN101469346B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| 郭甫坤.IL-1抑制剂的研究进展.《国外医学：生理病理科学与临床分册》.1999,(第5期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101469346A (en) | 2009-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sherlock et al. | IL-23 induces spondyloarthropathy by acting on ROR-γt+ CD3+ CD4− CD8− entheseal resident T cells | |
| Park et al. | Optical imaging of pancreatic beta cells in living mice expressing a mouse insulin I promoter‐firefly luciferase transgene | |
| CN101469346B (en) | Construction of interleukin 1beta specific mouse optical imaging system and use thereof | |
| Callander et al. | Silencing relaxin-3 in nucleus incertus of adult rodents: a viral vector-based approach to investigate neuropeptide function | |
| Krasinski et al. | Rat lactase-phlorizin hydrolase/human growth hormone transgene is expressed on small intestinal villi in transgenic mice | |
| JP5542928B2 (en) | Method for producing transformed earthworm using worm's gonad regeneration ability, transformed earthworm produced thereby, and method for producing recombinant protein from body fluid of transformed earthworm | |
| US8487087B2 (en) | Model animal in which state of disease condition is observable in real time, gene construct for achieving the same and use of the same | |
| Heffernan et al. | Characterization of the GfaABC1D promoter to selectively target astrocytes in the rhesus macaque brain | |
| CN105671079A (en) | Mouse with human nerve growth factor transgenes as well as preparation method and application of mouse | |
| CN109055374A (en) | Specificity inhibits shRNA and the application of OCT1 gene expression | |
| CN108998452B (en) | A kind of method that substantia nigra gene knockout quickly establishes animal model for parkinsonism | |
| US10765094B2 (en) | Inflammation reporter system | |
| CN106456674A (en) | Transgenic pig islets and uses thereof for treating diabetes | |
| CN103947606A (en) | Non-human mammal model with input UCP1-1cuiferase (uncoupling protein 1-1cuiferase) gene as well as construction method and application thereof | |
| CN101993895A (en) | Construction and application method of efficient double promoter PLEGFP-N1-spMyoD1 green fluorescence retrovirus vector | |
| Schlesinger-Laufer et al. | A simple adeno-associated virus-based approach for the generation of cardiac genetic models in rats | |
| CN108315350A (en) | It is overexpressed COX5A/ low expression BDNF transgenic mouse models and its construction method and application | |
| CN108396036A (en) | A kind of overexpression COX5A transgenic mouse models and its construction method and application | |
| CN102321600B (en) | Modified beta-secretase and application thereof | |
| CN101204585A (en) | Method of building animal model for parkinsonism | |
| CN102296072A (en) | Mouse model for transduction of highly specific expression of iASPP-FL (inhibitor of Apoptosis Stimulating Proteins of P53-Full Length) cancer gene in hemopoietic system and preparation method as well as application thereof | |
| CN104059887A (en) | Application of long non-coding RNA (ribonucleic acid) Ovo12-AS | |
| KR101447524B1 (en) | Transgenic mouse model with peroxisome-proliferator-activated receptor gamma co-activator-1 alpha(PGC-1α) promoter-reporter | |
| CN101899445A (en) | Specificity overexpression mouse model of transduction iASPPsv cancer gene in hemopoietic system and preparation method and use thereof | |
| CN105837678A (en) | D type human M1 forkhead protein isomer and encoding gene thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 201203 Shanghai city Pudong Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee after: Shanghai Lab. Animal Research Center Patentee after: Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd. Address before: 201203 Shanghai city Pudong Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee before: Shanghai Southern Biological Research Center Patentee before: Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd. |
|
| CP01 | Change in the name or title of a patent holder | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 201203 Shanghai city Pudong Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee after: Shanghai Lab. Animal Research Center Patentee after: Shanghai biomodel Polytron Technologies Inc Address before: 201203 Shanghai city Pudong Zhangjiang Cailun Road No. 88 2 4 floor Co-patentee before: Shanghai Lab. Animal Research Center Patentee before: Shanghai Biomodel Organism Science & Technology Co.,Ltd. |
|
| CP01 | Change in the name or title of a patent holder |