CN101454457A - Fermentive production of four carbon alcohols - Google Patents

Abstract

Methods for the fermentive production of four carbon alcohols are provided. Specifically, butanol, preferably 2-butanol is produced by the fermentive growth of a recombinant bacteria expressing a 2- butanol biosynthetic pathway. The recombinant microorganisms and methods of the invention can also be adapted to produce 2-butanone, an intermediate in the 2-butanol biosynthetic pathways disclosed herein.

Description

The fermentative production of four carbon alcohols

The cross reference of related application

According to the 119th section of the 35th article of United States Code, the right of priority that present patent application requires to be filed in the U.S. Provisional Application case No.60/796816 on May 2nd, 2006 and is filed in the U.S. Provisional Application case No.60/871156 on December 21st, 2006.

Invention field

The present invention relates to the production of industrial microorganism field and alcohol.More particularly, the 2-butanols is that industrial fermentation by recombinant microorganism produces.Recombinant microorganism of the present invention and method can also be suitable for producing 2-butanone, and 2-butanone is the intermediate product in the 2-butanols biosynthetic pathway disclosed herein.

Background of invention

Butanols is a kind of important industrial chemical, can be used as chemical feedstocks in fuel dope, the plastics industry and the food grade extraction agent in food and the perfume industry.In every year, produce 10,000,000,000 pounds to 12,000,000,000 pounds butanols by the petroleum chemistry means, and may also can increase the demand of this household chemicals.2-butanone (being also referred to as methyl ethyl ketone (MEK)) is a kind of widely used solvent, and is the ketone that is only second to the most important commercial production of acetone.It is used as the solvent of paint, resin and tackiness agent, and the activator that is used as selective extractant and oxidizing reaction.

The chemical synthesis process of 2-butanone is known, for example synthetic by the dehydrogenation of 2-butanols, or therein the liquid catalyzed butane oxidation is generated synthetic in the technology of 2-butanone and acetate (Ullmann ' s Encyclopedia of Industrial Chemistry, the 6th edition, 2003, Wiley-VCHVerlag GmbH and Co., Weinheim, Germany, the 5th volume, 727-732 page or leaf).2-butanone also can be chemically converted to 2-butanols (people such as Breen, J.or Catalysis 236:270-281 (2005)) by hydrogenation.The chemical synthesis process of 2-butanols is known, for example the hydration by n-butene synthetic (Ullmann ' s Encyclopedia of IndustrialChemistry, the 6th edition, 2003, Wiley-VCHVerlag GmbH and Co., Weinheim, Germany, the 5th volume, 716-719 page or leaf).These technology utilizations are also expensive usually derived from the parent material of petroleum chemicals, and unfriendly to environment.Use starting material production 2-butanone and 2-butanols will make greenhouse gas emission reach the progress that minimum level also will be represented this area derived from plant.

The method of producing the 2-butanols by other organic chemicals of bio-transformation also is known.For example, people such as Stampfer (WO 03/078615) have described for example production method of 2-butanols of secondary alcohol, and this method is to produce secondary alcohol by the reduction by the alcoholdehydrogenase catalysis ketone that derives from Rhodococcus ruber (Rhodococcus ruber).Equally, people such as Kojima (EP0645453) have described and have produced for example method of 2-butanols of secondary alcohol, and this method is to prepare secondary alcohol by the reduction by the dehydrogenating para-alcohol enzyme catalysis ketone that derives from Candida parapsilosis (Candida parapsilosis).In addition, people such as Kuehnle (EP1149918) have described the technology that produces 1-butanols and 2-butanols, and this technology is that the multiple bacterial strain oxygenated hydrocarbon by Rhodococcus ruber produces.This technology produces the 1-butanols has 93.8% selectivity.

The method of producing the 2-butanols by some bacterial strain of lactobacillus (Lactobacilli) also is known (people such as Speranza, J.Agric.Food Chem. (1997) 45:3476-3480).The 2-butanols is by transforming meso-2,3-butyleneglycol and producing.Also discussed by these lactic bacilli strainss and produced the 2-butanols from acetylactis and acetoin.Yet, be designed for the recombinant microorganism of producing the 2-butanols and also do not report.

Therefore, need the production 2-butanols of environment-friendly type high performance-price ratio and the technology of 2-butanone.The present invention produces the host by finding the recombinant microorganism of expressing 2-butanols and 2-butanone biosynthetic pathway, thereby has satisfied this demand.

Summary of the invention

The invention provides recombinant microorganism with through engineering approaches 2-butanols biosynthetic pathway.The present invention also provides the recombinant microorganism with through engineering approaches 2-butanone biosynthetic pathway, and this route of synthesis is identical with the 2-butanols biosynthetic pathway that omits final step.The through engineering approaches microorganism can be used for the commercial production of 2-butanols or 2-butanone.Therefore, the invention provides the recombinant microorganism host cell, this host cell comprises the dna molecular of at least a coded polypeptide, and this polypeptide catalytic substrate is to the conversion of product, and described substrate to the conversion of product is selected from the group of being made up of following conversion:

I) pyruvic acid is converted into α-acetylactis;

Ii) α-acetylactis is converted into acetoin;

Iii) acetoin is converted into 2, the 3-butyleneglycol;

Iv) 2, the 3-butyleneglycol is converted into 2-butanone; With

V) 2-butanone is converted into the 2-butanols;

Wherein said at least a dna molecular and described microbial host cell are allogenic, and wherein said microbial host cell produces the 2-butanols.

The invention provides the recombinant microorganism host cell in another embodiment, this host cell comprises the dna molecular of at least a coded polypeptide, this polypeptide catalytic substrate is to the conversion of product, and described substrate to the conversion of product is selected from the group of being made up of following conversion:

I) pyruvic acid is converted into α-acetylactis;

Ii) α-acetylactis is converted into acetoin;

Iii) acetoin is converted into 2, the 3-butyleneglycol; With

Iv) 2, the 3-butyleneglycol is converted into 2-butanone;

Wherein said at least a dna molecular and described microbial host cell are allogenic, and wherein said microbial host cell produces 2-butanone.

In another embodiment, the invention provides the method for producing the 2-butanols, this method comprises:

1) provide the recombinant microorganism host cell, it comprises the dna molecular of at least a coded polypeptide, and this polypeptide catalytic substrate is to the conversion of product, and described substrate to the conversion of product is selected from the group of being made up of following conversion:

I) pyruvic acid is converted into α-acetylactis;

Ii) α-acetylactis is converted into acetoin;

Iii) acetoin is converted into 2, the 3-butyleneglycol;

Iv) 2, the 3-butyleneglycol is converted into 2-butanone; With

V) 2-butanone is converted into the 2-butanols;

Wherein said at least a dna molecular and described microbial host cell are allogenic; With

Host cell in (1) is contacted in fermention medium with the carbon substrate that can ferment under the condition that can produce the 2-butanols.

Equally, the invention provides the method for producing 2-butanone, this method comprises:

1) provide the recombinant microorganism host cell, it comprises the dna molecular of at least a coded polypeptide, and this polypeptide catalytic substrate is to the conversion of product, and described substrate to the conversion of product is selected from the group of being made up of following conversion:

I) pyruvic acid is converted into α-acetylactis;

Ii) α-acetylactis is converted into acetoin;

Iii) acetoin is converted into 2, the 3-butyleneglycol; With

Iv) 2, the 3-butyleneglycol is converted into 2-butanone;

Wherein said at least a dna molecular and described microbial host cell are allogenic; With

Host cell in (1) is contacted in fermention medium with the carbon substrate that can ferment under the condition that can produce 2-butanone.

In another embodiment, the invention provides the tunning substratum that contains 2-butanols or 2-butanone that produces by method of the present invention.

The explanation of accompanying drawing, table and sequence

Can more fully understand the present invention by following detailed description, accompanying drawing and the sequence description of enclosing, these detailed descriptions, accompanying drawing and sequence description have formed the part of present patent application.

Fig. 1 shows four kinds of different approaches of biosynthesizing 2-butanone and 2-butanols.

Fig. 2 shows the genealogical tree of the big subunit of total length of glycol/glycerol dehydratase, wherein removed and had the sequence of 95% identity (but having kept the function sequence that all have been verified by experiment), and show the concordance list of listing the identity of every sequence in this genealogical tree.Determine that through testing function is that the sequence of glycol or glycerol dehydratase highlights with black or light gray respectively.

Fig. 3 shows the genealogical tree of the medium subunit of total length of glycol/glycerol dehydratase, has wherein removed to have〉sequence of 95% identity, and show the concordance list of listing the identity of every sequence in this genealogical tree.Determine that through testing function is that the sequence of glycol or glycerol dehydratase highlights with black or light gray respectively.

Fig. 4 shows the genealogical tree of the total length small subunit of glycol/glycerol dehydratase, has wherein removed to have〉sequence of 95% identity, and show the concordance list of listing the identity of every sequence in this genealogical tree.Determine that through testing function is that the sequence of glycol or glycerol dehydratase highlights with black or light gray respectively.

Table 12 is tables of the big subunit profile of the α of glycol/glycerol dehydratase HMM (Profile HMM).Table 12 is to submit and be incorporated by reference this paper to spreadsheet.

Table 13 is tables of the medium subunit profile of the α of glycol/glycerol dehydratase HMM.Table 13 is to submit and be incorporated by reference this paper to spreadsheet.

Table 14 is tables of the α small subunit profile HMM of glycol/glycerol dehydratase.Table 14 is to submit and be incorporated by reference this paper to spreadsheet.

Following sequence is abideed by 37C.F.R.1.821-1.825 (" Requirements for PatentApplications Containing Nucleotide Sequences and/or Amino AcidSequence Disclosures-the Sequence Rules " (to containing the requirement-sequence rules of nucleotide sequence and/or the disclosed patent application of amino acid sequence)); And (World Intellectual Property Organization, WIPO) sequence list of ST.25 standard (1998) and EPO and PCT requires (the 208th joint and the appendix C of rule 5.2 and 49.5 (a-bis) and Administrative Instructions (administrative instruction)) to meet World IntellectualProperty Organization. Be used for the symbol of Nucleotide and amino acid sequence data and the rule that form is all listed in accordance with 37C.F.R. § 1.822.

Table 1

Nucleic acid and protein s EQ ID summary sheet

Explanation	SEQ ID nucleic acid	SEQ ID protein
			BudA is from the acetolactate decarboxylase of Klebsiella Pneumoniae (Klebsiella pneumoniae) ATCC 25955	1	2
AlsD is from the acetolactate decarboxylase of subtilis (Bacillus subtilis)	80	81
			BudA is from the acetolactate decarboxylase of kluyvera terrigena (Klebsiella terrigena)	82	83
BudB is from the acetolactate synthase of Klebsiella Pneumoniae ATCC 25955	3	4
			AlsS is from the acetolactate synthase of subtilis	76	77
BudB is from the acetolactate synthase of kluyvera terrigena	78	79
			BudC is from the butanediol dehydrogenation enzyme of Klebsiella Pneumoniae IAM1063	5	6
Butanediol dehydrogenation enzyme from bacillus cereus (Bacillus cereus)	84	85
			Butanediol dehydrogenation enzyme from bacillus cereus	86	87
ButB is from the butanediol dehydrogenation enzyme of Lactococcus lactis (Lactococcus lactis)	88	89
			PddA is from the butyleneglycol dehydratase α subunit of Klebsiella oxytoca (Klebsiella oxytoca) ATCC 8724	7	8
PddB is from the butyleneglycol dehydratase β subunit of Klebsiella oxytoca ATCC 8724	9	10
			PddC is from the butyleneglycol dehydratase γ subunit of Klebsiella oxytoca ATCC 8724	11	12
PduC is from the big subunit of B12 dependent form dioldehydrase of Salmonella typhimurium (Salmonella typhimurium)	92	93

PduD is from the medium subunit of B12 dependent form dioldehydrase of Salmonella typhimurium	94	95
			PduE is from the B12 dependent form dioldehydrase small subunit of Salmonella typhimurium	96	97
PduC is from the big subunit of B12 dependent form dioldehydrase of mound shape Bacterium lacticum (Lactobacillus collinoides)	98	99
			PduD is from the medium subunit of B12 dependent form dioldehydrase of mound shape Bacterium lacticum	100	101
PduE is from the B12 dependent form dioldehydrase small subunit of mound shape Bacterium lacticum	102	103
			PddC is from the adenosylcobalamin dependent form dioldehydrase α subunit of Klebsiella Pneumoniae	104	105
PddD is from the adenosylcobalamin dependent form dioldehydrase β subunit of Klebsiella Pneumoniae	106	107
			PddD is from the adenosylcobalamin dependent form dioldehydrase γ subunit of Klebsiella Pneumoniae	108	109
DdrA is from the big subunit of the dioldehydrase reactivate factor of Klebsiella oxytoca	110	111
			DdrB is from the dioldehydrase reactivate factor small subunit of Klebsiella oxytoca	112	113
PduG is from the big subunit of the dioldehydrase reactivate factor of Salmonella typhimurium	114	115
			PduH is from the dioldehydrase reactivate factor small subunit of Salmonella typhimurium	116	117
PduG is from the big subunit of the dioldehydrase reactivate factor of mound shape Bacterium lacticum	118	119
			PduH is from the dioldehydrase reactivate factor small subunit of mound shape Bacterium lacticum	120	121
SadH is from the butanols desaturase of Rhodococcus ruber (Rhodococcus ruber) 219	13	14
			AdhA is from the butanols desaturase of strong red-hot coccus (Pyrococcus furiosus)	90	91
ChnA is from the cyclohexanol dehydrogenation enzyme of acinetobacter bacterial classification (Acinteobacter sp.)	71	72
			YqhD is from colibacillary butanols desaturase	74	75
Amine from vibrio fluvialis (Vibrio fluvialis): pyruvic acid transaminase (acetoin aminase (aminase))	144 through codon optimized	122
			Amino alcohol kinases from the black shin subspecies (Erwinia carotovora subsp atroseptica) of carrot soft rot Erwinia	123	124
Amino alcohol O-phosphoric acid ester lyase from the black shin subspecies of carrot soft rot Erwinia	125	126
			BudC is from the acetoin reductase enzyme (butanediol dehydrogenation enzyme) of kluyvera terrigena (being called autochthonal Raoul bacterium (Raoultellaterrigena) now)	133	134
Glycerol dehydratase α subunit from Klebsiella Pneumoniae	145	146

Glycerol dehydratase β subunit from Klebsiella Pneumoniae	147	148
			Glycerol dehydratase γ subunit from Klebsiella Pneumoniae	149	150
From the glycerol dehydratase of the Klebsiella Pneumoniae big subunit of activating enzyme again	151	152
			From the glycerol dehydratase of Klebsiella Pneumoniae activating enzyme small subunit again	153	154

SEQ ID NO:15-65 is the nucleotide sequence of oligonucleotide PCR primer used among the embodiment, clone's primer, screening primer and sequencing primer.

SEQ ID NO:66 is the nucleotide sequence in the disappearance district of yqhD gene among the coli strain MG1655 Δ yqhCD described in the embodiment 11.

SEQ ID NO:67 is the nucleotide sequence of the variant of glucose isomerase promotor 1.6GI.

SEQ ID NO:68 is the nucleotide sequence of 1.5GI promotor.

SEQ ID NO:69 is the nucleotide sequence from the dioldehydrase operon of Klebsiella oxytoca.

SEQ ID NO:70 is the nucleotide sequence from the dioldehydrase reactivate factor operon of Klebsiella oxytoca.

SEQ ID NO:73 is the nucleotide sequence of the pDCQ2 described in the embodiment 9.

SEQ ID NO:127-132 is other oligonucleotide PCR primer used among the embodiment and the nucleotide sequence of clone's primer.

SEQ ID NO:155 is the kinase whose codon optimized coding region of amino alcohol of the black shin subspecies of carrot soft rot Erwinia.

SEQ ID NO:156 is the codon optimized coding region of the amino alcohol O-phosphoric acid ester lyase of the black shin subspecies of carrot soft rot Erwinia.

SEQ ID NO:157-163 is other oligonucleotide PCR primer used among the embodiment and the nucleotide sequence of clone's primer.

SEQ ID NO:275 is the nucleotide sequence from operation of the black shin subspecies of carrot soft rot Erwinia.

Table 2:

The big subunit of other glycerine and dioldehydrase, medium subunit and small subunit

a Explanation	b Subunit	Protein SEQ ID
			Corresponding subunits from same organisms c
Glycerol dehydratase α subunit from clostridium pasteurianum (Clostridium pasteurianum)	L	135
			Glycerol dehydratase β subunit from clostridium pasteurianum	M	136
Glycerol dehydratase γ subunit from clostridium pasteurianum	S	137
			Glycerol dehydratase α subunit from cockroach Escherichia (Escherichia blattae)	L	138
Glycerol dehydratase β subunit from the cockroach Escherichia	M	139
			Glycerol dehydratase γ subunit from the cockroach Escherichia	S	140
Glycerol dehydratase α subunit from citrobacter freundii (Citrobacter freundii)	L	141
			Glycerol dehydratase β subunit from citrobacter freundii	M	142
Glycerol dehydratase γ subunit from citrobacter freundii	S	143
			Dioldehydrase α subunit from short lactobacillus (Lactobacillus brevis)	L	164
Dioldehydrase β subunit from short lactobacillus	M	165
			Dioldehydrase γ subunit from short lactobacillus	S	166
Dioldehydrase α subunit from enteron aisle Salmonellas (Salmonella enterica) enteron aisle subspecies (enterica subsp.) hog cholera sera types (serovar Choleraesuis) bacterial strain SC-B67	L	167
			Dioldehydrase β subunit from enteron aisle Salmonellas enteron aisle subspecies hog cholera sera type bacterial strain SC-B67	M	168
Dioldehydrase γ subunit from enteron aisle Salmonellas enteron aisle subspecies hog cholera sera type bacterial strain SC-B67	S	169
			The big subunit of propanediol dehydratase from intestinal bacteria E24377A	L	170
From the medium subunit of glycol/glycerol dehydratase of intestinal bacteria E24377A	M	171
			Propanediol dehydratase small subunit from intestinal bacteria E24377A	S		172

The big subunit of dioldehydrase from shigella sonnei (Shigella sonnei) Ss046	L	173
			From the medium subunit of the dioldehydrase of shigella sonnei Ss046	M	174
Dioldehydrase small subunit from shigella sonnei Ss046	S	175
			The big subunit of propanediol dehydratase from Bai Shi Yersinia (Yersinia bercovieri) ATCC 43970	L	176
Putative protein YberA0_1000484 from Bai Shi Yersinia ATCC 43970	M	177
			Propanediol dehydratase small subunit from Bai Shi Yersinia ATCC 43970	S	178
The big subunit of propanediol dehydratase from Mohs Yersinia ATCC 43969	L	179
			Putative protein YmolA_01001292 from Mohs Yersinia ATCC 43969	M	180
Propanediol dehydratase small subunit from Mohs Yersinia ATCC 43969	S	181
			The big subunit of dioldehydrase from Yersinia enterocolitica (Yersinia enterocolitica) enterocolitis subspecies (subsp.enterocolitica) 8081	L	182
The medium subunit of dioldehydrase from Yersinia enterocolitica enterocolitis subspecies 8081	M	183
			Dioldehydrase small subunit from Yersinia enterocolitica enterocolitis subspecies 8081	S	184
The big subunit of propanediol dehydratase from Yersinia intermedia (Yersinia intermedia) ATCC 29909	L	185
			From the medium subunit of glycol/glycerol dehydratase of Yersinia intermedia ATCC 29909	M	186
Propanediol dehydratase small subunit from Yersinia intermedia ATCC 29909	S	187
			The big subunit of glycerol dehydratase from Listeria welshimeri (Listeria welshimeri) serotype 6b bacterial strain SLCC5334	L	188
The medium subunit of the dehydratase that utilizes propylene glycol from Listeria welshimeri serotype 6b bacterial strain SLCC5334	M	189
			The dehydratase small subunit that utilizes propylene glycol from Listeria welshimeri serotype 6b bacterial strain SLCC5334	S	190
Putative protein lin1117 from listera innocua (Listeria innocua) Clip11262	L	191
			Putative protein lin1118 from listera innocua Clip11262	M	192
Putative protein lin1119 from listera innocua Clip11262	S	193
			Putative protein 1mol153 from listerisa monocytogenes in mjme (Listeria monocytogenes) EGD-e	L	194

Putative protein lmo1154 from listerisa monocytogenes in mjme EGD-e	M	195
			Putative protein lmo1155 from listerisa monocytogenes in mjme EGD-e	S	196
The big subunit of glycerol dehydratase from enteron aisle Salmonellas enteron aisle subspecies antityphoid sera types (serovar Typhi) bacterial strain CT18	L	197
			The medium subunit of dioldehydrase from enteron aisle Salmonellas enteron aisle subspecies antityphoid sera type bacterial strain CT18	M	198
Dioldehydrase small subunit from enteron aisle Salmonellas enteron aisle subspecies antityphoid sera type bacterial strain CT18	S	199
			From the big subunit of colibacillary glycerol dehydratase of inferring	L	200
From the medium subunit of colibacillary dioldehydrase of inferring	M	201
			From colibacillary dioldehydrase small subunit of inferring	S	202
The big subunit of glycerol dehydratase from listerisa monocytogenes in mjme bacterial strain 4b F2365	L	203
			The medium subunit of the dehydratase that utilizes propylene glycol from listerisa monocytogenes in mjme bacterial strain 4b F2365	M	204
The dehydratase small subunit that utilizes propylene glycol from listerisa monocytogenes in mjme bacterial strain 4b F2365	S	205
			The big subunit pduC of the glycerol dehydratase of inferring from Streptococcus sanguis (Streptococcus sanguis) SK36	L	206
The medium subunit of the dehydratase that utilizes propylene glycol of inferring from Streptococcus sanguis SK36	M	207
			The B12-dependent form dioldehydrase small subunit of inferring from Streptococcus sanguis SK36	S	208
DhaB from Escherichia blattae	L	209
			DhaC from Escherichia blattae	M	210
From Escherichia blattae DhaE	S	211
			Actimide-big subunit of dependent form glycerol dehydrogenase from clostridium perfringens (Clostridium perfringens) bacterial strain 13	L	212
Actimide-medium subunit of dependent form glycerol dehydrogenase from clostridium perfringens bacterial strain 13	M	213
			Actimide-dependent form glycerol dehydrogenase small subunit from clostridium perfringens bacterial strain 13	S	214
The big subunit of propanediol dehydratase from yersinia frederiksenii (Yersinia frederiksenii) ATCC 33641	L	215
			Putative protein YfreA_01000478 from yersinia frederiksenii ATCC 33641	M	216
Propanediol dehydratase small subunit from yersinia frederiksenii ATCC 33641	S	217
			From thermophilic anaerobic ethanol bacillus (Thermoanaerobacter ethanolicus)	L	218

The glycerol dehydratase of X514
			The medium subunit of dehydratase from thermophilic anaerobic ethanol bacillus X514	M	219
Dehydratase small subunit from thermophilic anaerobic ethanol bacillus X514	S	220
			The big subunit GldC of glycerol dehydratase from lactobacillus hilgardii (Lactobacillus hilgardii)	L	221
From the medium subunit GldD of the glycerol dehydratase of lactobacillus hilgardii	M	222
			Glycerol dehydratase small subunit GldE from lactobacillus hilgardii	S	223
Glycerol dehydratase from lactobacillus reuteri (Lactobacillusreuteri) JCM1112	L	224
			Similar dioldehydrase γ subunit from lactobacillus reuteri JCM 1112	M	225
The dehydratase small subunit that utilizes propylene glycol from lactobacillus reuteri JCM 1112	S	226
			The big subunit GldC of glycerol dehydratase from Lactobacillus diolivorans	L	227
From the medium subunit GldD of the glycerol dehydratase of Lactobacillus diolivorans	M	228
			Glycerol dehydratase small subunit GldE from Lactobacillus diolivorans	S	229
The big subunit of propanediol dehydratase from lactobacillus reuteri	L	230
			From the medium subunit of the propanediol dehydratase of lactobacillus reuteri	M	231
Propanediol dehydratase small subunit from lactobacillus reuteri	S	232
			The big subunit of glycerol dehydratase from living slowly root nodule bacterium (Mesorhizobium loti) MAFF303099 in the Root or stem of Littleleaf Indianmulberry	L+M	233
Glycerol dehydratase small subunit from living slowly root nodule bacterium MAFF303099 in the Root or stem of Littleleaf Indianmulberry	S	234
			Glycerol dehydratase from Mycobacterium vanbaaleniiPYR-1	L+M	235
The dehydratase small subunit that utilizes propylene glycol from Mycobacterium vanbaaleniiPYR-1	S	236
			Glycerol dehydratase from mycobacterium bacterium MCS	L+M	237
Dehydratase small subunit from mycobacterium bacterium MCS	S	238
			The big subunit of dehydratase from little yellow mycobacterium (Mycobacterium flavescens) PYR-GCK: the medium subunit of dehydratase	L+M	239
The dehydratase small subunit that utilizes propylene glycol from little yellow mycobacterium PYR-GCK	S	240
			Glycerol dehydratase from mycobacteria strain JLS	L+M	241
Dehydratase small subunit from mycobacterium JLS	S	242
			From M. smegmatics (Mycobacterium smegmatis)	L	243

The big subunit of the glycerol dehydratase of bacterial strain MC2 155
			The medium subunit of dehydratase from M. smegmatics bacterial strain MC2 155	M	244
Dioldehydrase γ subunit from M. smegmatics bacterial strain MC2 155	S	245
Other subunit
			The big subunit of glycerol dehydratase from M. smegmatics bacterial strain MC2 155	L+M	246
The big subunit of glycerol dehydratase from M. smegmatics bacterial strain MC2 155	L+M	247
			Actimide-dependent form glycerol dehydrogenase small subunit from M. smegmatics bacterial strain MC2 155	S	248
Actimide-dependent form glycerol dehydrogenase small subunit from M. smegmatics bacterial strain MC2 155	S	249
			The medium subunit of dioldehydrase from enteron aisle Salmonellas enteron aisle subspecies Pparatyphoid A serotype (serovar Paratyphi A) strains A TCC 9150	M	250
Dioldehydrase small subunit from enteron aisle Salmonellas enteron aisle subspecies Pparatyphoid A serological type strain ATCC 9150	S	251
			Glycerol dehydratase β subunit from clostridium perfringens SM101	M	252
Glycerol dehydratase γ subunit from clostridium perfringens SM101	S	253
			PduC from enteron aisle Salmonellas enteron aisle subspecies mouse typhus serotypes (serovar Typhimurium)	L	254
The big subunit of glycerol dehydratase from listerisa monocytogenes in mjme bacterial strain 4b H7858	L	255
			DhaB from Escherichia blattae	L	256
From the DhaB of culturing bacterium not	L	257
			From the DhaB of culturing bacterium not	L	258
The big subunit GldC of glycerol dehydratase from mound shape Bacterium lacticum	L	259
			From the PduD of culturing bacterium not	M	260
From the PduD of culturing bacterium not	M	261
			From the DhaC of culturing bacterium not	M	262
From the DhaC of culturing bacterium not	M	263
			From the DhaC of culturing bacterium not	M	264
Actimide-medium subunit of dependent form glycerol dehydratase from clostridium perfringens ATCC 13124	M	265
			Unknown	M	266
Glycerol dehydratase β-subunit from Escherichia blattae	M	267
			From the PduE of culturing bacterium not	S	268

From the PduE of culturing bacterium not	S	269
			Dehydratase small subunit from listerisa monocytogenes in mjme bacterial strain 1/2a F6854	S	270
From the DhaE of culturing bacterium not	S	271
			From the DhaE of culturing bacterium not	S	272
From the DhaE of culturing bacterium not	S	273
			Dehydratase small subunit from listerisa monocytogenes in mjme FSLN1-017	S	274

^aIllustrate: from the GenBank note of sequence, may comprise correctly not that the life of glycerine or glycol claims, perhaps may not comprise subunit information.

^bSubunit: by identifying with the sequence homology of the big subunit of Klebsiella oxytoca enzyme, medium subunit or small subunit.

^cThe subunit that derives from same organism lists together and note is identical enzyme, perhaps has close GenBank number to show approaching in genome.

Detailed Description Of The Invention

The present invention relates to adopt recombinant microorganism to produce the method for 2-butanols. The present invention meets multiple business demand and industrial requirement. Butanols is a kind of essential industry household chemicals with multiple application, wherein its act as a fuel or the potentiality of fuel additive particularly important. Although butanols only is a kind of four carbon alcohols, it has the energy content similar to gasoline, and can mix with any fossil fuel. Butanols is preferred fuel or fuel additive, because it only generates CO when burning in standard internal combustion engines₂And a small amount of (or not generating) SO_XOr NO_X In addition, the corrosivity of butanols is not as good as ethanol, is most preferred fuel additive so far.

Butanols is except can be used as bio-fuel or fuel additive, and it also has the potentiality that affect the hydrogen assignment problem in emerging fuel cell industries. Nowadays, because there are potential safety hazard in transportation and the distribution of hydrogen, fuel cell is endured puzzlement to the fullest extent. Can be easily to butanols its hydrogen content of reforming, and can distribute with fuel cell or the required purity of car combustion engine by existing gas station.

At last, the present invention produces the 2-butanols from plant-derived carbon source, has avoided the negative ambient influnence relevant with the standard oil chemical technology of production of butanol.

The present invention also provides recombinant microorganism and the method for producing the 2-butanone, and the 2-butanone is the intermediate product in the 2-butanols biosynthesis pathway disclosed herein. The 2-butanone is also referred to as methyl ethyl ketone (MEK), can be used as the solvent of paint or other coating. The production that it also can be used for China Synthetic Rubber Industry and is used for paraffin.

Interpretation for claim and specification to give a definition and to abridge.

As used in this, term " invention " or " the present invention " are for non-limiting term and have no intention to refer to concrete any single embodiment of inventing, but contain all possible embodiment described in specification and claims.

Term " 2-butanols biosynthesis pathway " refers to produce from pyruvic acid the enzymatic pathway of 2-butanols.

Term " 2-butanone biosynthesis pathway " refers to produce from pyruvic acid the enzymatic pathway of 2-butanone.

Term " acetolactate synthase " also claims " acetohydroxy acid synthase ", refers to have the peptide species (or multiple polypeptides) that catalysis two molecule pyruvic acid are converted into a part α-acetolactic enzymatic activity. Acetolactate synthase, namely EC 2.2.1.6[was EC 4.1.3.18 originally] (Enzyme Nomenclature 1992, Academic Press, San Diego), its activity may depend on the co-factor diphosphothiamine. Applicable acetolactate synthase can derive from multiple source, for example, bacillus subtilis [GenBank No:AAA22222 NCBI (American National biotechnology information centre) amino acid sequence (SEQ ID NO:77), L04470 NCBI nucleotide sequence (SEQ ID NO:76)], kluyvera terrigena [GenBank No:AAA25055 (SEQ ID NO:79), L04507 (SEQ ID NO:78)] and Klebsiella Pneumoniae [GenBank No:AAA25079 (SEQ ID NO:4), M73842 (SEQ ID NO:3)].

Term " acetolactate decarboxylase " refers to have a peptide species (or multiple polypeptides) of the enzymatic activity that catalysis α-acetolactic acid is converted into 3-hydroxy-2-butanone. Acetolactate decarboxylase (being EC 4.1.1.5) can derive from for example bacillus subtilis [GenBank No:AAA22223 (SEQ ID NO:81), L04470 (SEQ ID NO:80)], kluyvera terrigena [GenBank No:AAA25054 (SEQ ID NO:83), L04507 (SEQ ID NO:82)] and Klebsiella Pneumoniae [GenBank No:AAU43774 (SEQ ID NO:2), AY722056 (SEQ ID NO:1)].

Term " 3-hydroxy-2-butanone aminase (aminase) " refers to have the peptide species (or multiple polypeptides) that the catalysis 3-hydroxy-2-butanone is converted into the enzymatic activity of 3-amino-2-butanols. The 3-hydroxy-2-butanone aminase can utilize co-factor P5P or NADH (NADH) or NADPH (NADPH). Products therefrom has (R) or (S) spatial chemistry No. 3 positions. Phosphopyridoxal pyridoxal phosphate dependent form enzyme can be with amino acid (for example alanine or glutamic acid) as amino donor. NADH dependent form and NADPH dependent form enzyme can be with ammonia as the second substrates. A suitable example of NADH dependent form 3-hydroxy-2-butanone aminase (being also referred to as the amino alcohol dehydrogenase) is described by the people such as Ito (U.S. Patent No. 6,432,688). An example of pyridoxal dependent form 3-hydroxy-2-butanone aminase is the amine of being described by Shin and Kim (J.Org.Chem.67:2848-2853 (2002)): pyruvate aminotransferase (is also referred to as amine: the pyruvic acid transaminase).

Term " butanols dehydrogenase " refers to have a peptide species (or multiple polypeptides) of the enzymatic activity that catalysis 2-butanone and 2-butanols change mutually. The butanols dehydrogenase is the subgroup in the huge alcohol dehydrogenase family. The butanols dehydrogenase can be NAD dependent form or NADP dependent form. NAD dependent form enzyme is called EC 1.1.1.1, can derive from for example Rhodococcus ruber [GenBank No:CAD36475 (SEQ ID NO:14), AJ491307 (SEQ ID NO:13)]. NADP dependent form enzyme is called EC 1.1.1.2, can derive from for example strong red-hot coccus [GenBank No:AAC25556 (SEQ ID NO:91), AF013169 (SEQ ID NO:90)]. In addition, the butanols dehydrogenase can derive from Escherichia coli [GenBank No:NP_417484 (SEQ ID NO:75), NC_000913 (SEQ ID NO:74)], the cyclohexanol dehydrogenation enzyme can derive from acinetobacter calcoaceticus [GenBank No:AAG10026 (SEQ ID NO:72), AF282240 (SEQ ID NO:71)].

Term " 3-hydroxy-2-butanone kinases " refers to have the peptide species (or multiple polypeptides) that the catalysis 3-hydroxy-2-butanone is converted into the enzymatic activity of phosphoric acid 3-hydroxy-2-butanone. The 3-hydroxy-2-butanone kinases can utilize ATP (atriphos) or PEP as the phosphodonor of this reaction. Although carrying out the enzyme of this reaction, the catalysis 3-hydroxy-2-butanone has no report, but the enzyme that exists the similar substrate dihydroxyacetone (DHA) of catalysis to carry out similar reaction, such as the enzyme that is called EC 2.7.1.29 (people such as Garcia-Alles, (2004) Biochemistry43:13037-13046).

Term " 3-hydroxy-2-butanone phosphate aminase " refers to have the peptide species (or multiple polypeptides) that catalysis phosphoric acid 3-hydroxy-2-butanone is converted into the enzymatic activity of 3-amino-2-butanols O-phosphate. 3-hydroxy-2-butanone phosphate aminase can utilize co-factor P5P, NADH or NADPH. Products therefrom has (R) or (S) spatial chemistry No. 3 positions. Phosphopyridoxal pyridoxal phosphate dependent form enzyme available amino acid is alanine or glutamic acid for example. NADH dependent form and NADPH dependent form enzyme can be with ammonia as the second substrates. Although carrying out the enzyme of this reaction, catalysis phosphoric acid 3-hydroxy-2-butanone has no report, but exist and it is reported phosphopyridoxal pyridoxal phosphate dependent form enzyme people such as (, (2001) Appl.Environ.Microbiol.67:4999-5009) Yasuta of similar reaction of the similar substrate phosphoric acid of catalysis serinol.

Term " amino butanol phosphate phosphoroclastic cleavage enzyme " also claims " amino alcohol O-phosphate lyases ", refer to have catalysis 3-amino-and 2-butanols O-phosphate is converted into a peptide species (or multiple polypeptides) of the enzymatic activity of 2-butanone. Amino butanol phosphate phosphoroclastic cleavage enzyme can utilize the co-factor P5P. Although can catalytic amino the butanols phosphate, the enzyme that carries out this reaction has no report, has reported that the similar substrate 1-amino of catalysis-2-propyl alcohol phosphate carries out the enzyme of similar reaction people such as (, (1973) Biochem is J.134:167-182) Jones. The invention describes a kind of amino butanol phosphate phosphoroclastic cleavage enzyme (SEQ ID NO:126) of new evaluation, it has illustrated its activity from the object carrot soft rot Erwinia among embodiment 15 of this paper.

Term " amino butanol kinases " refers to have the peptide species (or multiple polypeptides) that catalysis 3-amino-2-butanols is converted into the enzymatic activity of 3-amino-2-butanols O-phosphate. The amino butanol kinases can utilize ATP as phosphodonor. Although can catalysis 3-amino-2-butanols enzyme of carrying out this reaction report is not arranged, reported that the similar substrate monoethanolamine of catalysis and 1-amino-2-propyl alcohol carry out the enzyme of similar reaction people such as (, the same) Jones. The present invention has described in embodiment 14Carrot soft rotThe amino butanol kinases (SEQ ID NO:124) of the black shin subspecies of Erwinia. Term " butanediol dehydrogenation enzyme " (also claiming " 3-hydroxy-2-butanone reductase ") refers to have the peptide species (or multiple polypeptides) that the catalysis 3-hydroxy-2-butanone is converted into the enzymatic activity of 2,3-butanediol. The butanediol dehydrogenation enzyme is the subgroup in the huge alcohol dehydrogenase family. The butanediol dehydrogenation enzyme can to (R) in the pure product or (S) stereochemical generation have specificity. (S)-specific butanediol dehydrogenation enzyme is called EC 1.1.1.76, can derives from for example Klebsiella Pneumoniae (GenBank No:BBA13085 (SEQ ID NO:6), D86412 (SEQ ID NO:5)). (R)-specificity butanediol dehydrogenation enzyme is called EC 1.1.1.4, can derives from for example Klebsiella Pneumoniae [GenBank No.NP_830481 (SEQ ID NO:85), NC_004722 (SEQ ID NO:84); AAP07682 (SEQ ID NO:87), AE017000 (SEQ ID NO:86)] and Lactococcus lactis [GenBank No.AAK04995 (SEQ ID NO:89), AE006323 (SEQ ID NO:88)].

Term " Butanediol enzyme " (also claim " diodehydrase " or " propanediol dehydratase ") refers to have a peptide species (or multiple polypeptides) of the enzymatic activity that the catalysis 2,3-butanediol is converted into the 2-butanone. The Butanediol enzyme can utilize co-factor adenosylcobalamin (cobalamin). Adenosylcobalamin dependent form enzyme is called EC 4.2.1.28, can derive from for example Klebsiella oxytoca [GenBank No:BAA08099 (α subunit) (SEQ ID NO:8), D45071 (SEQ ID NO:7); BAA08100 (β subunit) (SEQ ID NO:10), D45071 (SEQ ID NO:9); And BBA08101 (γ subunit) (SEQ ID NO:12), D45071 (SEQ ID NO:11) (notes, all three kinds of subunits all are active necessary)], and Klebsiella Pneumoniae [GenBank No:AAC98384 (α subunit) (SEQ ID NO:105), AF102064 (SEQ ID NO:104); GenBank No:AAC98385 (β subunit) (SEQ ID NO:107), AF102064 (SEQ ID NO:106), GenBank No:AAC98386 (γ subunit) (SEQ ID NO:109), AF102064 (SEQ ID NO:108)]. Other suitable diodehydrase includes but not limited to B12 dependent form diodehydrase, and it can derive from Salmonella typhimurtum [GenBank No:AAB84102 (large subunit) (SEQ ID NO:93), AF026270 (SEQ ID NO:92); GenBank No:AAB84103 (medium subunit) (SEQ ID NO:95), AF026270 (SEQ ID NO:94); GenBank No:AAB84104 (small subunit) (SEQ ID NO:97), AF026270 (SEQ ID NO:96)]; And mound shape lactobacillus [GenBank No:CAC82541 (large subunit) (SEQ ID NO:99), AJ297723 (SEQ ID NO:98); GenBank No:CAC82542 (medium subunit) (SEQ ID NO:101); AJ297723 (SEQ ID NO:100); GenBank No:CAD01091 (small subunit) (SEQ ID NO:103), AJ297723 (SEQ ID NO:102)]; With from the enzyme of Lactobacillus brevis (especially bacterial strain CNRZ 734 and CNRZ 735, the people such as Speranza, the same), and the nucleotide sequence of the corresponding enzyme of encoding. The method of separating the diodehydrase gene is (such as U.S. Patent No. 5,686,276) known in the art. Other glycerol dehydratase is listed in table 2.

Term " glycerol dehydratase " refers to have a peptide species (or multiple polypeptides) of the enzymatic activity that catalyzing glycerol is converted into 3-HPA. Adenosylcobalamin-dependent form glycerol dehydratase is called EC 4.2.1.30. The glycerol dehydratase of EC 4.2.1.30 is similar to diodehydrase in sequence, and three kinds of subunits are also arranged. Glycerol dehydratase also can be used for 2,3-butanediol is converted into the 2-butanone. Some examples of the glycerol dehydratase of EC 4.2.1.30 comprise from those of following source: (α subunit, coding region sequence are SEQ ID NO:145 to Klebsiella Pneumoniae, and protein sequence is SEQ ID NO:146; β subunit, coding region sequence are SEQ ID NO:147, and protein sequence is SEQ ID NO:148; With the γ subunit, coding region sequence is SEQ ID NO:149, and protein sequence is SEQ ID NO:150); Clostridium pasteurianum [GenBank No:3360389 (α subunit, SEQ ID NO:135), 3360390 (β subunit, SEQ ID NO:136), and 3360391 (γ subunit, SEQ ID NO:137)]; Cockroach Escherichia [GenBank No:60099613 (α subunit, SEQ ID NO:138), 57340191 (β subunit, SEQ ID NO:139) and 57340192 (γ subunit, SEQ ID NO:140)]; And citrobacter freundii [GenBank No:1169287 (α subunit, SEQ ID NO:141), 1229154 (β subunit, SEQ ID NO:142), and 1229155 (γ subunit, SEQ ID NO:143)]. Notice that all these three kinds of subunits all are active necessary. Other glycerol dehydratase is listed in the table 2.

Diodehydrase and glycerol dehydratase may carry out suicide inactivation in catalytic process. Reactivation factor protein (being also referred to as in this article " reactivation enzyme ") can be used for the enzyme (people such as Mori, J.Biol.Chem.272:32034 (1997)) of reactivation inactivation. Preferably, the reactivation factor can derive from the source identical with used glycol or glycerol dehydratase. For example, the suitable diodehydrase reactivation factor can derive from Klebsiella oxytoca [GenBank No:AAC15871 (large subunit) (SEQ ID NO:111), AF017781 (SEQ ID NO:110); GenBank No:AAC15872 (small subunit) (SEQ ID NO:113), AF017781 (SEQ ID NO:112)]; Salmonella typhimurium [GenBank No:AAB84105 (large subunit) (SEQ ID NO:115), AF026270 (SEQ ID NO:114), GenBank No:AAD39008 (small subunit) (SEQ ID NO:117), AF026270 (SEQ ID NO:116)]; And mound shape lactobacillus [GenBank No:CAD01092 (large subunit) (SEQ ID NO:119), AJ297723 (SEQ ID NO:118); GenBank No:CAD01093 (small subunit) (SEQ ID NO:121), AJ297723 (SEQ ID NO:120)]. Large subunit and small subunit are active necessary. For example, the suitable glycerol dehydratase reactivation factor can derive from Klebsiella Pneumoniae (large subunit, coding region sequence is SEQ ID NO:151, protein sequence is SEQ ID NO:152; And small subunit, coding region sequence is: SEQ ID NO:153, protein sequence are SEQ ID NO:154).

Term " amphimicrobe " refers to the microorganism that not only can grow but also can grow in oxygen-free environment in aerobic environment.

Term " carbon substrate " or " carbon substrate can ferment " refer to can be by the carbon source of host organisms metabolism of the present invention, and particularly is selected from the carbon source of the group that is comprised of following material: monose, oligosaccharides, polysaccharide and a carbon substrate, or their mixture.

Term " gene " refers to be expressed as the nucleic acid fragment of specified protein, and it is optional to comprise regulating and controlling sequence (5 ' non-coding sequence) before the coded sequence and the regulating and controlling sequence (3 ' non-coding sequence) behind the coded sequence. " natural gene " refers to be present in the gene that nature has its oneself regulating and controlling sequence. " mosaic gene " refers to not be any gene of natural gene, and being included in occurring in nature is not regulating and controlling sequence and the coded sequence that exists together. Therefore, mosaic gene can comprise regulating and controlling sequence and the coded sequence that comes from separate sources, perhaps comprises to come from same source but to be different from regulating and controlling sequence and the coded sequence of arranging in the mode of occurring in nature. " endogenous gene " refers to be positioned at the natural gene of its original position in the genome of organism. " external " or " external source " gene refers to not be present in the host organisms under normal circumstances, but by the gene in the transgenosis importing host organisms. Alien gene can comprise the natural gene that is inserted in the non-natural organism, or mosaic gene. " transgenosis " is by the gene in the method for transformation quiding gene group.

As used herein, " nucleic acid fragment of separation " or " nucleic acid molecules of separation " or " gene construct " can Alternates, and will refer to strand-or double-stranded-RNA or DNA condensate, optionally contain nucleotide base synthetic, non-natural or that change. The nucleic acid fragment of the separation of DNA condensate form can be made of one or more fragments of cDNA, genomic DNA or synthetic DNA.

When the nucleic acid fragment of single stranded form under suitable temperature and solution ion strength condition can be annealed to another nucleic acid fragment, then nucleic acid fragment " can be hybridized " to another nucleic acid fragment, for example cDNA, genomic DNA or RNA molecule. Hybridization conditions and wash conditions are well-known, and at Sambrook, J., Fritsch, E.F. and Maniatis, T.Molecular Cloning:A Laboratory Manual, second edition, Cold Spring Harbor Laboratory:Cold Spring Harbor, NY (1989) illustrated, Chapter 11 especially wherein and table 11.1 (incorporating by reference its full content into this paper). Temperature and ionic strength conditions have been determined hybridization " stringency ". Can regulate stringency with the similar fragment of screening moderate the homologous sequence of outbreeding organism body (for example from), to the highly similar fragment of screening the gene of close relative organism copy function enzyme (for example from). Stringency is determined in washing after the hybridization. One group of preferred condition adopts a series of following washings: begin to adopt 6 * SSC, 0.5% SDS at room temperature to continue washing 15 minutes, and then use 2 * SSC, 0.5% SDS 45 ℃ of lower washings 30 minutes, use at last 0.2 * SSC, 0.5% SDS 30 minutes twice of 50 ℃ of lower repeated washing. Preferred one group of stringency adopts higher temperature, and wherein washing is identical with above-mentioned washing, and different is, and last temperature when washing 30 minutes twice in 0.2 * SSC, 0.5% SDS is added to 60 ℃. Another organizes preferred high stringency is that last twice washing is to carry out with 0.1 * SSC, 0.1% SDS under 65 ℃. For example, another group stringency is included in hybridization under 65 ℃ among 0.1 * SSC, 0.1% SDS, and with 2 * SSC, 0.1% SDS washing, uses subsequently 0.1 * SSC, 0.1% SDS washing.

Hybridization needs two kinds of nucleic acid to contain complementary series, but depends on the stringency of hybridization, between the base mispairing may occur. Be used for making the suitable stringency of nucleic acid hybridization to depend on the length of nucleic acid and the degree of complementation, described length and complementary degree are known variablees in this area. Article two, the similitude between the nucleotide sequence or homology degree are higher, and the Tm value of crossbred of nucleic acid with those sequences is larger. The relative stability of nucleic acid hybridization (corresponding higher Tm) reduces in the following order successively: RNA:RNA, DNA:RNA, DNA:DNA. Surpass the crossbred of 100 nucleotides for length, derived the formula that is used for calculating Tm (see also the people such as Sambrook, the same, 9.50-9.51). For the hybridization of shorter nucleic acid (oligonucleotides), the position of mispairing becomes more important, and the length of oligonucleotides determined its specificity (see also the people such as Sambrook, the same, 11.7-11.8). In one embodiment, but the length of hybrid nucleic acid is at least about 10 nucleotides. Preferably, but the minimum length of hybrid nucleic acid is at least about 15 nucleotides; More preferably at least about 20 nucleotides; And most preferably, length is at least about 30 nucleotides. In addition, the technical staff will recognize, can regulate temperature and wash solution salinity according to the factor such as probe length as required.

" essential part " of amino acid or nucleotide sequence is such part, the amino acid sequence of the polypeptide that this part comprises or the nucleotide sequence of gene are enough to can be by inferring to identify described polypeptide or gene, described discriminating or can be by those skilled in the art by the artificial sequence of estimating, perhaps utilize alignment algorithm (BLAST (Altschul for example, S.F. wait the people, J.Mol.Biol., 215:403-410 (1993)) finish by the comparison of computer automation sequence and discriminating. In general, infer differentiate polypeptide or nucleic acid whether with known protein or dna homolog, 10 or more continuous amino acid or 30 or more nucleotides need to be arranged. In addition, for nucleotide sequence, the gene specific oligonucleotide probe that comprises 20-30 continuous nucleotide can be used in the method for the gene identification (such as the DNA hybrid method) of sequence dependent and Gene Isolation (such as the hybridization in situ of bacterial clump or plaque). In addition, the short oligonucleotide of 12 to 15 bases can be used as amplimer in PCR, in order to obtain to comprise the specific nucleic acid fragment of this primer. Therefore, " essential part " of nucleotide sequence sequence of comprising is enough to differentiate specifically and/or separate the nucleic acid fragment that comprises this sequence. This specification has proposed the complete nucleotide sequence of complete amino acid sequence and the specific Fungal Protein of coding. According to sequence disclosed herein, the technical staff can utilize the whole or essential part of the disclosed sequence of the present invention now, to be used for purpose well-known to those skilled in the art. Therefore, the present invention includes the complete sequence as shown in the sequence table of enclosing, and the as mentioned essential part of definition of these sequences.

Term " complementation " is for the relation that can hybridize each other between the described nucleotide base. For example, for DNA, adenine and thymidine are complementary, and cytimidine and guanine are complementary.

Term " homology " and " homology " are used interchangeably in this article. They refer to such nucleotide fragments, i.e. the variation of wherein one or more nucleotide bases can not affect the ability that certain phenotype was expressed or produced to this nucleic acid fragment mediated gene. These terms also refer to the modification (for example lacking or insert one or more nucleotides) of nucleic acid fragment of the present invention, with respect to initial not modified nucleic acid fragment, basically can not change the functional characteristic of gained nucleic acid fragment. Therefore, just as the skilled artisan will appreciate, these concrete exemplary sequence are not only contained in the present invention.

In addition, the technical staff recognizes, the homologous nucleotide sequence that the present invention is contained also by them at medium stringent condition (such as 0.5 * SSC, 0.1% SDS, 60 ℃) under, with the ability of the exemplified sequence hybridization of this paper, or the ability of hybridization to any part of nucleotide sequence disclosed herein and hybridization to the sequence suitable with any nucleotide sequence function disclosed herein limits.

" codon degeneracy " refers to allow nucleotides sequence to be listed in and do not affect the character of the genetic code that changes in the situation of amino acid sequence of coded polypeptide. The technical staff understands " codon preference " that particular host cell demonstrates when using the nucleotides codon to determine given amino acid very much. Therefore, at synthetic gene when improving its expression in host cell, wish the design gene so that its codon usage frequency near preferred codon usage frequency in the host cell.

As known in the art, term " percentage homogeneity " be between two or more the peptide sequences or two or more polynucleotide sequences between relation, this relation is to determine by sequence is compared. In the art, " homogeneity " also represents the degree of serial correlation between polypeptide or the polynucleotide sequence, and as the case may be, it is determined by the matching degree between the sequence string of these sequences. " homogeneity " and " similitude " can easily be calculated by known method, described method includes but not limited to described in the Publication about Document those: 1.) Computational Molecular Biology (Lesk, A.M. edits) Oxford University:NY (1988); 2.) Biocomputing:Informatics and Genome Projects (Smith, D.W. edits) Academic:NY (1993); 3.) Computer Analysis of Sequence Data, Part I (H.G. edits for Griffin, A.M. and Griffin) Humania:NJ (1994); 4.) Sequence Analysis in MolecularBiology (von Heinje, G. edits) Academic (1987); And 5.) Sequence Analysis Primer (J. edits for Gribskov, M. and Devereux) Stockton:NY (1991).

The preferred method of determining identity is used to provide the optimum matching between the sequence to be tested.The method of identity and similarity of determining has been weaved into code in the computer program that can openly obtain.Can use LASERGENE information biology software for calculation bag (DNASTAR Inc., Madison, Madison, MegAlign WI) ^TMProgram is carried out the calculating of sequence alignment and per-cent identity.It is right to use " Clustal comparison method " to carry out the sequence multiple ratio, " Clustal comparison method _TContained multiple algorithm, comprised " Clustal V comparison method ", its correspondence be called as Clustal V (at Higgins and Sharp, CABIOS.5:151-153 (1989); Higgins, people such as D.G., Comput.Appl.Biosci. describes among the 8:189-191 (1992) to some extent), and be found in LASERGENE information biology software for calculation bag (DNASTAR Inc.) MegAlign ^TMComparison method in the program.Right for multiple ratio, default value is gap penalty (GAP PENALTY)=10 and room length point penalty (GAP LENGTH PENALTY)=10.The default parameters that adopts the Clustal method to carry out two sequence alignments and the calculating of protein sequence per-cent identity is KTUPLE=1, gap penalty=3, window size (WINDOW)=5 and DIAGONALS SAVED=5.And for nucleic acid, these parameters are KTUPLE=2, gap penalty=5, window size=4 and DIAGONALS SAVED=4.After Clustal V program aligned sequences, can obtain " per-cent identity " by checking " sequence distance (sequence the distances) " table in the same program.In addition, can also utilize " Clustal W comparison method ", its corresponding to be designated as Clustal W (at Higgins and Sharp, CABIOS.5:151-153 (1989); Higgins, people such as D.G. describe among the Comput.Appl.Biosci.8:189-191 (1992) to some extent), and be found in the MegAlign of LASERGENE information biology software for calculation bag (DNASTAR Inc.) ^TMComparison method in the v6.1 program.The default parameters that multiple ratio is right (gap penalty=10, room length point penalty=0.2, postpone transmitting sequence (%) (DelayDivergen Seqs (%))=30, DNA changes weight (DNA Transition Weight)=0.5, protein weight matrix (Protein Weight Matrix)=Gonnet series, DNA weight matrix (DNA Weight Matrix)=IUB).After use Clustal W program is compared to sequence, can obtain " per-cent identity " by checking " sequence distance " table in the same program.

Those skilled in the art is perfectly clear, and the sequence identity of multiple degree can be used for differentiating polypeptide that from other species wherein this class polypeptide has same or analogous function or activity.The available example of per-cent identity includes but not limited to: 24%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, or any integer per-cent between 24% to 100% all can be used for describing the present invention, for example 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.Suitable nucleic acid fragment not only has above-mentioned homology; and go back codified usually and have at least 50 amino acid whose polypeptide; preferably have at least 100 amino acid; more preferably have at least 150 amino acid; also more preferably have at least 200 amino acid, and most preferably have at least 250 amino acid.

Term " sequence analysis software " refers to can be used for any computerized algorithm or the software program of analysis of nucleotide or aminoacid sequence." sequence analysis software " commercially available acquisition or stand-alone development.Typical sequence analysis software includes but not limited to: 1.) GCG program routine package (Wisconsin PackageVersion 9.0, Genetics Computer Group (GCG), Madison, WI); 2.) BLASTP, BLASTN, BLASTX (people such as Altschul, J.Mol.Biol., 215:403-410 (1990)); 3.) DNASTAR (DNASTAR, Inc., Madison, WI); 4.) Sequencher (Gene Codes Corporation, Ann Arbor, MI); With 5.) integrated FASTA program (W.R.Pearson, Comput.MethodsGenome Res., [Proc.Int.Symp.] (1994) of Smith-Waterman algorithm, Meeting Date 1992,111-20, editor: Suhai, Sandor.Plenum:New York, NY).Should be appreciated that in the context of present application for patent except as otherwise noted, otherwise analytical results will be based on " default value " of program thereby when using sequence analysis software to analyze.Initial any value or the parameter set that loads of software when this used " default value " is meant at initializers first.

As used herein, term " encoding sequence " or " CDS " are meant the dna sequence dna of coding specific amino acids sequence." suitable regulating and controlling sequence " refers to be positioned at the upstream (5 ' non-coding sequence), centre of encoding sequence or the nucleotide sequence of downstream (3 ' non-coding sequence), its can influence transcribe, RNA processing or stability, the perhaps translation of correlative coding sequence.Regulating and controlling sequence can comprise that promotor, translation leader sequence, intron, polyadenylic acid recognition sequence, RNA process site, effector binding site and loop-stem structure.

Term " promotor " refers to control the dna sequence dna of the expression of encoding sequence or function RNA.In general, encoding sequence is positioned at 3 of promoter sequence ' end.Promotor can wholely come from natural gene, perhaps is made up of the different elements that comes from different naturally occurring promotors, perhaps even comprise the synthetic dna fragmentation.Those skilled in the art should be appreciated that different promotors can perhaps in the different etap, perhaps respond different envrionment conditionss or physiological condition and the expression of guiding gene in different tissues or cell type.The promotor that causes genetic expression most of the time in most cell types is commonly referred to " constitutive promoter ".Also should further recognize do not define fully as yet owing in most of the cases regulate the sequence boundary that cuts edge really, so the dna fragmentation of different lengths can have identical promoter activity.

Term " operably connects " association that refers to nucleotide sequence on the single nucleic acid fragment, so that the function of one of them nucleotide sequence is subjected to the influence of another nucleotide sequence.For example, when promotor can influence the expression (that is, this encoding sequence is subjected to the control of transcribing of this promotor) of encoding sequence, then this promotor operably was connected with this encoding sequence.Encoding sequence can justice or the orientation of antisense operably be connected to regulating and controlling sequence.

As used herein, term " expression " refers to come from the justice (mRNA) of nucleic acid fragment of the present invention or transcribing and stable gathering of sense-rna.Express and also can refer to mRNA is translated as polypeptide.

Used herein, term " conversion " refers to nucleic acid fragment is transferred in the host organisms, causes stable gene heredity.Contain the segmental host organisms of transformed nucleic acid and be called as " transgenosis " or " reorganization " or " conversion " organism.

Term " plasmid " and " carrier " refer to often carry the extrachromosomal inheritance element of the gene that is not the metabolic part of cell centre, and the segmental form of circular double stranded DNA normally.This class component can be the autonomously replicating sequence, genome integration sequence, phage or the strand that are derived from any source or the nucleotide sequence (linearity or ring-type) of double-stranded DNA or RNA, wherein a plurality of nucleotide sequences connected or a kind of unique design body of recombinating in, this unique design body can be introduced the promoter fragment and the dna sequence dna of selected gene product in the cell with corresponding 3 ' terminal non-translated sequence." conversion carrier " refers to contain alien gene and also contain the specific support of the element that helps transforming particular host cell except this alien gene.

As used in this, term " codon degeneracy " refers to that genetic code allows nucleotides sequence to be listed in the character that changes under the situation of the aminoacid sequence that does not influence encoded polypeptide.The technician understands " codon preference " that concrete host cell demonstrates when using the Nucleotide codon to determine given amino acid very much.Therefore, when improving its expression in host cell, wish the design gene at synthetic gene so that its codon usage frequency approaches preferred codon usage frequency in the host cell.

When term " codon optimized " relates to the gene of the nucleic acid molecule that is used to transform different hosts or coding region at it, finger is under situation about not changing by the polypeptide of dna encoding, and the gene or the codon in the coding region that change nucleic acid molecule use with the common codon of reflection host organisms.

Term " tunning substratum " refers to carry out therein fermentation and makes product be present in the substratum in the substratum.

Standard recombinant dna used herein and molecule clone technology are known in the art, and at Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning:ALaboratory Manual, second edition, Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY (1989) (hereinafter referred to as " Maniatis "); And Silhavy, T.J., Bennan, M.L. and Enquist, L.W., Experiments with Gene Fusions, ColdSpring Harbor Laboratory Press, Cold Spring Harbor, NY (1984); And Ausubel, people such as F.M. describe among the Current Protocols in Molecular Biology (GreenePublishing Assoc.and Wiley-Interscience publishes, (1987)) to some extent.

2-butanols and 2-butanone biosynthetic pathway

Utilize the microorganism of carbohydrate that glycolysis-(EMP) approach, En-Du Er Shi (Entner-Doudoroff) approach and phosphopentose Circulation are made central metabolic pathway to provide energy and cell precursors to growing and keeping.These approach all have common intermediate product glyceraldehyde 3-phosphate, and final, can the direct forming pyruvic acid or combine with EMP Embden Meyerbof Parnas pathway and to generate pyruvic acid.Sugar be converted into pyruvic acid the composite reaction generate energy (as 5 '-Triphosaden, ATP) and the reduced form equivalent (as, nicotinamide adenine dinucleotide reduced NADH, and NADPH salt NADPH).NADH and NADPH must be recycled to form its oxidised form and (be respectively NAD ⁺And NADP ⁺).Exist the inorganic electronic acceptor (as O ₂, NO ₃ ^-And SO ₄ ^2-) situation under, the reduced form equivalent can be used to increase the energy pond; Alternatively, may form reduced form carbon by product.

The present invention makes and can produce 2-butanone or 2-butanols from carbohydrate source with recombinant microorganism by providing from pyruvic acid to 2-butanone or the complete biosynthetic pathway of 2-butanols.Also having described other three kinds of approach states.Although known 2-butanols is not the primary product of any fermentation using bacteria, exist many possible approach to be used for generating the 2-butanols via known biochemical reaction type.These approach are shown in Figure 1.Following letter of quoting and Roman number are corresponding with letter and Roman number among Fig. 1, and they are respectively applied for describes step of converting and product.As described below, 2-butanone is the intermediate product of all these 2-butanols biosynthetic pathways.

All approach all start from two pyruvate molecules and generate α-acetolactic initial reaction (I), and the conversion (a) to product illustrates as substrate in Fig. 1.From α-acetylactis, exist 4 approach to generate 2-butanone (V), be referred to herein as the 2-butanone biosynthetic pathway:

Approach 1) I---〉II---〉III---〉IV---〉V (substrate is to conversion b, c, d, the e of product);

2) I---〉II---〉VII---〉IV---〉V (substrate is to conversion b, g, h, the e of product)

3) I---〉II---VIII---V (substrate is to conversion b, i, the j of product) this be route of synthesis of the present invention.

4) I---〉IX---〉X---〉V (substrate is to conversion k, l, the m of product)

2-butanols biosynthetic pathway is converted into 2-butanols (VI) with 2-butanone (V) to be finished.Be to the detailed argumentation of substrate in every kind of approach below to the conversion of product.

Approach 1:

(a) Pyruvic acid is converted into α-acetylactis:

Initial step in the approach 1 is by the enzyme catalysis of diphosphothiamine dependent form, and two molecule pyruvic acid are converted into a part α-acetylactis (Compound I among Fig. 1) and a part carbonic acid gas.This substrate of catalysis to the enzyme that product transforms (is commonly called acetolactate synthase or is called acetohydroxy acid synthase; EC 2.2.1.6[2002 was EC 4.1.3.18 in the past]) be well-known, and the biosynthetic pathway of their participation Argine Monohydrochloride leucines and Xie Ansuan, and participate in fermentation generation 2 in the multiple organism, the approach of 3-butyleneglycol and acetoin.

The technician will understand, and separate from the having the active polypeptide of acetolactate synthase and will can be used for the present invention of multiple source, and not rely on sequence homology.Some examples of suitable acetolactate synthase can derive from for example subtilis [GenBank No:AAA22222NCBI (American National biotechnology information center) aminoacid sequence (SEQ ID NO:77) of multiple source, L04470 NCBI nucleotide sequence (SEQ ID NO:76)], kluyvera terrigena [GenBankNo:AAA25055 (SEQ ID NO:79), L04507 (SEQ ID NO:78)] and Klebsiella Pneumoniae [GenBank No:AAA25079 (SEQ ID NO:4), M73842 (SEQID NO:3)].Preferred acetolactate synthase is those of identity that have 80%-85% at least with SEQ ID NO 4,77 and 79, wherein having at least, the identity of 85%-90% is preferred, and it is most preferred wherein having at least 95% identity based on Clustal W comparison method (adopt default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet 250 series).

(b) α-acetylactis is converted into acetoin:

By the effect of the enzyme such as acetolactate decarboxylase (EC 4.1.1.5), α-acetylactis (I) is converted into acetoin (II).Similar with acetolactate synthase, this enzyme also is a diphosphothiamine dependent form enzyme, and relates to multiple organism generation 2,3-butyleneglycol and acetoin.It is very diversified that the enzyme of different sources is regulated (for example, by the branched-amino acid activation) aspect in size (4.2E-20g (25kDa)-8.3E-20g (50 kilodalton)), oligomerization (dimer is to sexamer), position (in the cell or extracellular) and allosteric.With regard to purpose of the present invention, be positioned at cell and be better than being positioned at the extracellular, but other modification generally is acceptable.

The technician will understand, and separate from the having the active polypeptide of acetolactate decarboxylase and will can be used for the present invention of multiple source, and not rely on sequence homology.Some examples of suitable acetolactate decarboxylase can derive from multiple source, for example, subtilis [GenBank No:AAA22223 (SEQ ID NO:81), L04470 (SEQ ID NO:80)], kluyvera terrigena [GenBank No:AAA25054 (SEQ ID NO:83), L04507 (SEQ IDNO:82)] and Klebsiella Pneumoniae [GenBank No:AAU43774 (SEQ ID NO:2), AY722056 (SEQ ID NO:1)].

Preferred acetolactate decarboxylase is to have the identity of 80%-85% at least with SEQ ID NO 2,81 and 83, wherein having at least, the identity of 85%-90% is preferred, and wherein based on Clustal W comparison method (employing default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet 250 series), it is most preferred having at least 95% identity.

(c) Acetoin is converted into 3-amino-2-butanols:

Exist the biochemical reaction of two kinds of known types can realize the conversion of substrate acetoin (II) to product 3-amino-2-butanols (III), specifically, these two kinds of reactions are to utilize the pyridoxal phosphate dependent form transamination of auxiliary amino donor and reduction amination direct and that ammonia carries out.Under latter event, reducing equivalent is that the form with reduced form niacinamide cofactor (NADH or NADPH) provides.People such as Ito (U.S. Patent No. 6,432,688) have reported with the example of acetoin as the NADH dependent form enzyme of this reaction of substrate catalysis.Any stereospecificity of this enzyme is not estimated as yet.Shin and Kim (the same) have reported that the catalysis acetoin is converted into the example of the pyridoxal phosphate dependent form transaminase of 3-amino-2-butanols.Show among this paper embodiment 13 this kind of enzyme (R) isomer of acetoin can be converted into 3-amino-2-butanols (2R, 3S) isomer can be converted into (S) isomer of acetoin (2S, 3S) isomer of 3-amino-2-butanols again.The enzyme of arbitrary type (being transaminase or reduction amination enzyme) is considered to the acetoin aminase, and can be used to produce the 2-butanols.Other enzyme can have different stereospecificities in this group.

The technician will understand, and isolating from multiple source have the active polypeptide of acetoin aminase and can be used for the present invention, and irrelevant with sequence homology.A this active example is described in this article to some extent, and is accredited as SEQ ID NO:122.Therefore, preferred acetoin aminase is to have those enzymes of the identity of 80%-85% at least with SEQ ID NO:122, wherein having at least, the identity of 85%-90% is preferred, and wherein based on Clustal W comparison method (employing default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet250 series), it is most preferred having at least 95% identity.

(d) 3-amino-2-butanols is converted into 3-amino-2-butanols O-phosphoric acid ester:

Still there be not of the conversion of known substrate for enzymatic activity 3-amino-2-butanols (III) in this area to product 3-amino-2-butanols phosphoric acid ester (IV).Yet, the bacterial classification of some Rhodopseudomonass (Pseudomonas) and erwinia (Erwinia) has shown can express ATP dependent form ethanolamine kinase (EC 2.7.1.82), this kinases allows them to utilize thanomin or 1-amino-2-propyl alcohol as nitrogenous source people such as (, (1973) Biochem.J.134:167-182) Jones.Might this enzyme also have the active of 3-amino-2-butanols or can be realized this activity, the amino butanol kinases is provided thus by through engineering approaches.The present invention has described a kind of gene (SEQ ID NO:123) of the black shin subspecies of carrot soft rot Erwinia in embodiment 14, a kind of protein of this genes encoding (SEQ ID NO:24), and this protein has been accredited as the amino alcohol kinases.This enzyme can be used for 3-amino-2-butanols is converted into 3-amino-2-butanols O-phosphoric acid ester.

The technician will understand, and the polypeptide with amino butanol kinase activity that separates from multiple source will can be used for the present invention, and not rely on sequence homology.This active example is described in this article to some extent, and is accredited as SEQ ID NO:124.Therefore, preferred amino butanol kinases is to have those enzymes of the identity of 80%-85% at least with SEQ ID NO:124, wherein the identity of 85%-90% is preferred at least, and wherein based on Clustal W comparison method (employing default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet 250 series), it is most preferred having at least 95% identity.

(e) 3-amino-2-butanols phosphoric acid ester is converted into 2-butanone:

Though do not report that having the conversion of substrate for enzymatic activity 3-amino-2-butanols phosphoric acid ester (IV) to product 2-butanone (V), this substrate to be very similar to is present in those substrates that utilized by pyridoxal phosphate dependent form phosphorylethanolamine phosphoroclastic cleavage enzyme in a small amount of Rhodopseudomonas and the erwinia bacterial classification.These enzymes all have activity to two kinds of enantiomorphs (people such as Jones, (1973) Biochem.J.134:167-182) of phosphorylethanolamine and 2-phosphoric acid-1-aminopropane, but also 3-amino-2-butanols O-phosphoric acid ester is had activity.The invention describes the gene (SEQ ID NO:125) of the black shin subspecies of a kind of carrot soft rot Erwinia, this genes encoding and III class transaminase have the protein (SEQ ID NO:126) of homology.Embodiment 15 proof this kind of enzyme all have activity to aminopropanol phosphoric acid ester and amino butanol phosphoric acid ester substrate.The mixture of new endonuclease capable catalysis (R)-3-amino of identifying and characterizing-(S)-2-butanols O-phosphoric acid ester and (S)-3-amino-(R)-2-butanols O-phosphoric acid ester and (R)-3-amino-(R)-2-butanols O-phosphoric acid ester and (S)-3-amino- ^(S)-2-butanols ^O-The mixture of phosphoric acid ester is to the conversion of 2-butanone.The new enzyme of identifying and characterizing also can catalysis (R) and (S)-and 2-amino-1-propyl alcohol phosphoric acid ester is to the conversion of acetone, the conversion of preferentially catalysis (S)-2-amino-1-propyl alcohol phosphoric acid ester.When utilizing the natural substrate DL-1-amino of suggestion-2-propyl alcohol phosphoric acid ester, can be observed the highest activity, this substrate is converted into propionic aldehyde.

The technician will understand, and the polypeptide with amino butanol phosphoric acid ester phosphoroclastic cleavage enzymic activity that separates from multiple source will can be used for the present invention, and not rely on sequence homology.An example of suitable amino butanol phosphoric acid ester phosphoroclastic cleavage enzyme is described as SEQ ID NO:126 in this article.Therefore, preferred amino butanol phosphoric acid ester phosphoroclastic cleavage enzyme is to have those enzymes of the identity of 80%-85% at least with SEQ ID NO126, wherein the identity of 85%-90% is preferred at least, and wherein based on Clustal W comparison method (employing default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet 250 series), it is most preferred having at least 95% identity.

(f) 2-butanone is converted into the 2-butanols:

Final step from pyruvic acid generation 2-butanols in all approach is that 2-butanone (V) is reduced to 2-butanols (VI).This substrate is that these members can be called as the butanols desaturase by some the member's catalysis in the very wide class alcoholdehydrogenase (depending on enzyme, is to utilize NADH or utilize the type of NADPH as hydride source) to the conversion of product.Every kind of enzyme of catalysis 2-butanone reductive is well-known, as mentioned to described in the definition of butanols desaturase.

The technician will understand, and the polypeptide with butanols dehydrogenase activity that separates from multiple source will can be used among the present invention, and not rely on sequence homology.Some examples of suitable butanols desaturase can derive from multiple source, for example, and Rhodococcus ruber [GenBank No:CAD36475 (SEQID NO:14), AJ491307 (SEQ ID NO:13)].NADP dependent form enzyme is called EC1.1.1.2, can derive from for example strong red-hot coccus [GenBank No:AAC25556 (SEQ IDNO:91), AF013169 (SEQ ID NO:90)].In addition, the butanols desaturase can derive from intestinal bacteria [GenBank No:NP_417484 (SEQ ID NO:75), NC_000913 (SEQID NO:74)], the cyclohexanol dehydrogenation enzyme can derive from acinetobacter calcoaceticus [GenBank No:AAG10026 (SEQ ID NO:72), AF282240 (SEQ ID NO:71)].Preferred butanols desaturase is to have those enzymes of the identity of 80%-85% at least with SEQ ID NO14,91,75 and 72, wherein having at least, the identity of 85%-90% is preferred, and wherein based on Clustal W comparison method (employing default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet 250 series), it is most preferred having at least 95% identity.

Approach 2:

(a) Pyruvic acid is converted into α-acetylactis:

This substrate to the conversion of product with above described the same to approach 1.

(b) α-acetylactis is converted into acetoin:

This substrate to the conversion of product with above described the same to approach 1.

(g) Acetoin is converted into the phosphoric acid acetoin:

Although do not describe the enzyme of catalytic substrate acetoin (II) as yet to the conversion of product phosphoric acid acetoin (VII), but the structure of substrate acetoin and the structure of otan are very similar, so acetoin is a kind of acceptable substrate to dihydroxyacetone kinase (EC 2.7.1.29) (enzyme of catalysis otan phosphorylation).The protein engineering that is used to change the substrate specificity of enzyme is well-known (Antikainen and Martin (2005) Bioorg.Med.Chem.13:2701-2716), and can be used for producing and have required specific enzyme.In this conversion, the phosphoric acid part can be provided by any high-energy biological phosphodonor, and common substrate is phosphoenolpyruvic acid (as under the situation of intestinal bacteria dihydroxyacetone kinase) and ATP (as under the situation of citrobacter freundii dihydroxyacetone kinase) (people such as Garcia-Alles, (2004) Biochemistry43:13037-13045).

(h) The phosphoric acid acetoin is converted into 3-amino-2-butanols O-phosphoric acid ester:

Although do not describe the enzyme of catalytic substrate phosphoric acid acetoin (VII) as yet to the conversion of product 3-amino-2-butanols O-phosphoric acid ester (IV), but the structure of the structure of this substrate and di(2-ethylhexyl)phosphate pyruvic alcohol is very similar, the di(2-ethylhexyl)phosphate pyruvic alcohol is the substrate (people such as Yasuta, the same) of the coded phosphoric acid serinol transaminase of the 5 ' part by the rtxA gene of some bacterial classifications of Bradyrhizobium (Bradyrhizobium) that proposed.Therefore, phosphoric acid serinol transaminase can work in this step.

(e) 3-amino-2-butanols O-phosphoric acid ester is converted into 2-butanone:

This substrate to the conversion of product with above described the same to approach 1.

(f) 2-butanone is converted into the 2-butanols:

This substrate to the conversion of product with above described the same to approach 1.

Approach 3:

(a) Pyruvic acid is converted into α-acetylactis:

This substrate to the conversion of product with above described the same to approach 1.

(b) α-acetylactis is converted into acetoin:

This substrate to the conversion of product with above described the same to approach 1.

(i) Acetoin is converted into 2, the 3-butyleneglycol:

Substrate acetoin (II) is to product 2, and the conversion of 3-butyleneglycol (VIII) can be by the butyleneglycol hydrogen enzyme catalysis of dewatering, and the butanediol dehydrogenation enzyme can utilize NADH or utilize the source of NADPH as reducing equivalent when reducing.Acetoin is had active enzyme participate in producing 2, produce 2 in the organism of 3-butyleneglycol, the approach of 3-butyleneglycol.The enzyme of being reported (as the BudC (people such as Ui, (2004) Letters in Applied Microbiology39:533-537) from Klebsiella Pneumoniae) utilizes NADH usually.Can accept any cofactor is used for producing the 2-butanols by this approach.

The technician will understand, and the polypeptide with butanediol dehydrogenation enzymic activity that separates from multiple source will can be used for the present invention, and not rely on sequence homology.Some examples of suitable butanediol dehydrogenation enzyme can derive from multiple source, for example, and Klebsiella Pneumoniae (GenBank No:BBA13085 (SEQ ID NO:6), D86412 (SEQ ID NO:5)).(R)-specific butanediol dehydrogenation enzyme is called EC 1.1.1.4, can derives from for example bacillus cereus [GenBankNo.NP_830481 (SEQ ID NO:85), NC_004722 (SEQ ID NO:84); AAP07682 (SEQ ID NO:87), AE017000 (SEQ ID NO:86)] and Lactococcus lactis [GenBank No.AAK04995 (SEQ ID NO:89), AE006323 (SEQ IDNO:88)].Preferred butanediol dehydrogenation enzyme is to have those enzymes of the identity of 80%-85% at least with SEQ ID NO6,85,87 and 89, wherein the identity of 85%-90% is preferred at least, and wherein based on Clustal W comparison method (employing default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet 250 series), it is most preferred having at least 95% identity.

(j) 2, the 3-butyleneglycol is converted into 2-butanone:

Substrate 2,3-butyleneglycol (VIII) to the conversion of product 2-butanone (V) can be by dioldehydrase (EC 4.2.1.28) and glycerol dehydratase (EC 4.2.1.30) catalysis.The dioldehydrase that is preferably characterized is an actimide dependent form Klebsiella oxytoca enzyme, but similarly enzyme is present in the multiple intestinal bacteria.This Klebsiella oxytoca enzyme has demonstrated can accept meso-2, and the 3-butyleneglycol produces required product 2-butanone as substrate (people such as Bachovchin, (1977) Biochemistry16:1082-1092).Embodiment 17 has proved Klebsiella Pneumoniae dehydrating glycerin endonuclease capable with meso-2, and the 3-butyleneglycol is converted into 2-butanone.Three subunits of Klebsiella Pneumoniae glycerol dehydratase (α: SEQ ID NO:145 (coding region) and 146 (protein); β: SEQ IDNO:147 (coding region) and 148 (protein); And γ: SEQ ID NO:149 (coding region) and SEQ ID NO:150 (protein)) together with Klebsiella Pneumoniae glycerol dehydratase two subunits of activating enzyme (big subunit, SEQ ID NO:151 (coding region) and 152 (protein) again; And small subunit, SEQ ID NO:153 (coding region) and SEQ ID NO:154 (protein)) express together to provide active.

Also reported B12-dependent form dioldehydrase (people such as Hartmanis, (1986) Arch.Biochem.Biophys.245:144-152) in the document from clostridium glycolicum (Clostridium glycolicum).This enzyme is to 2, and the 3-butyleneglycol has activity, although this activity active 1% less than to ethylene glycol, can engineered this enzyme to improve this activity.The B12-dependent form dehydratase that is better characterized be from clostridium butylicum (Clostridium butyricum) glycerol dehydratase (O ' people such as Brien, (2004) Biochemistry43:4635-4645), it is to 1, and 2-propylene glycol and glycerine have high reactivity.This enzyme utilizes the source of S-adenosylmethionine as adenosyl.This enzyme is to 2, and the activity of 3-butyleneglycol does not have report as yet, but this activity (if also not existing) also can be carried out engineered.

The technician will understand, and the polypeptide with butanediol dehydrogenation enzymic activity that separates from multiple source will can be used for the present invention, and not rely on sequence homology.As noted above, multiple two pure and mild glycerol dehydratases are described in the literature and will be applicable to the present invention.Therefore, according to an aspect of the present invention, preferred two pure and mild glycerol dehydratases are that enzyme that subunit big with it, medium subunit and small subunit have following sequence respectively has those of 80%-85% identity at least:

A) SEQ ID NO:8, SEQ ID NO:10 and SEQ ID NO:12;

B) SEQ ID NO:93, SEQ ID NO:95 and SEQ ID NO:97;

C) SEQ ID NO:99, SEQ ID NO:101 and SEQ ID NO:103;

D) SEQ ID NO:105, SEQ ID NO:107 and SEQ ID NO:109;

E) SEQ ID NO:135, SEQ ID NO:136 and SEQ ID NO:137;

F) SEQ ID NO:138, SEQ ID NO:139 and SEQ ID NO:140;

G) SEQ ID NO:146, SEQ ID NO:148 and SEQ ID NO:150;

H) SEQ ID NO:141, SEQ ID NO:142 and SEQ ID NO:143; And

I) SEQ ID NO:164, SEQ ID NO:165 and SEQ ID NO:166.

Wherein having at least, the identity of 85%-90% is preferred, and wherein based on Clustal W comparison method (employing default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet 250 series), it is most preferred having at least 95% identity.

Similarly, preferred two pure and mild glycerol dehydratases are that enzyme that subunit big with it, medium subunit and small subunit have following sequence respectively has those of 80%-85% identity at least:

Big subunit: SEQ ID NO:8,99,105,135,138,141,146 and 164; Medium subunit: SEQ ID NO:10,101,107,136,139,142,148 and 165; Small subunit: SEQ ID NO:12,103,109,137,140,143,150 and 166; Wherein having at least, the identity of 85%-90% is preferred, and wherein based on Clustal W comparison method (employing default parameters: gap penalty=10, room length point penalty=0.1 and protein weight matrix are Gonnet 250 series), it is most preferred having at least 95% identity.

Other the two pure and mild glycerol dehydratase that can be used for biosynthetic pathway 3 of the present invention is to identify by information biology structure/functional analysis of describing below and in embodiment 18.

(f) 2-butanone is converted into the 2-butanols:

This substrate to the conversion of product with above described the same to approach 1.

The two pure and mild glycerol dehydratases that are used for biosynthetic pathway 3

Any enzyme as two pure and mild glycerol dehydratases can be used in the present invention with 2, and the 3-butyleneglycol is converted into 2-butanone.Structure/the functional relationship of two pure and mild glycerol dehydratases among enzyme type EC 4.2.1.28 and the EC 4.2.1.30 is set up in this paper embodiment 18 respectively.Function is provided by experimental data and structure provides by bioinformatic analysis.Analyzed and had active eight kind of two pure and mild glycerol dehydratase of proof by experiment.In this group enzyme (in table 10, listing), Klebsiella oxytoca dioldehydrase and Klebsiella Pneumoniae glycerol dehydratase all show 2, the 3-butyleneglycol is converted into 2-butanone (respectively people such as Bachovchin, (1977) show among Biochemistry16:1082-1092 and this paper 17), then utilize their natural substrate to carry out proving (reference provides) in table 10 to the activity of other six kinds of enzymes.Utilize the HMMER software package the hmmsearch algorithm (Janelia Farm Research Campus, Ashburn, VA) analyzed this group eight kind of two pure and mild glycerol dehydratase.With the Z parameter setting of this hmmsearch algorithm is 1,000,000,000.The output that the HMMER that utilizes a histone matter sequence to carry out analyzes is profile hidden Markov model (Profile Hidden Markov Model) (profile HMM (ProfileHMM)).The theory of profile HMM foundation is by people such as Durbin, Biological sequenceanalysis:probabilistic models of proteins and nucleic acids, CambridgeUniversity Press, 1998; People such as Krogh, 1994; J.Mol.Biol.235:1501-1531 is described (being incorporated by reference this paper), and the probability that this method occurs on each position in the comparison of protein collection based on every seed amino acid characterizes described protein collection.

Because every kind of enzyme of eight kind of two pure and mild glycerol dehydratase (glycol/glycerol dehydratase) of the function with experimental verification that is used for analyzing has three subunits (big subunit or α subunit, medium subunit or β subunit and small subunit or γ subunit), so every kind of subunit is made up independent profile HMM.The profile HMM (table 12) of big subunit is with having the SEQID NO:8,99,105,135,138,141 that describes in table 1 and the table 2,146 and 164 protein structure.Medium subunit profile HMM (table 13) is with having the SEQ ID NO:10 that describes in table 1 and the table 2,101,107,136,139,142,148 and 165 protein structure.Small subunit profile HMM (table 14) is with having the SEQ ID NO:12 that describes in table 1 and the table 2,103,109,137,140,143,150 and 166 protein structure.Provide the reference of functional examination method data in table 10, to provide.The profile HMM that makes up for big subunit has provided the structural characterization to the functional big subunit of glycol/glycerol dehydratase.Similarly, the profile HMM for medium subunit and small subunit structure has provided respectively the structural characterization of glycol/glycerol dehydratase to functional medium subunit and small subunit.Therefore, any protein that will have a remarkable coupling with the profile HMM of big subunit, medium subunit or small subunit directly with the function association of the corresponding subunit of described profile HMM.Have significance, the E-value that then described coupling has is 0.01 or littler, and the usage of other " coupling " is construed as and meets this E-value standard.Thereby can be used for glycol of the present invention/dehydrating glycerin enzyme subunit is the protein of the such profile HMM of coupling, and promptly this profile HMM makes up with the protein with SEQ ID NO listed above, and wherein the E-value is 0.01 or littler.

Total length and protein have function association with the big subunit of described glycol/glycerol dehydratase by mating big subunit profile HMM includes but not limited to have SEQ ID NO:93,167,170,173,176,179,182,185,188,191,194,197,200,203,206,209,212,215,218,221,224,227,130,243,254,255,256,257,258 and 259 protein.Total length and protein have function association with the medium subunit of described glycol/glycerol dehydratase by mating medium subunit profile HMM includes but not limited to have SEQ ID NO:95,168,171,174,177,180,183,186,189,192,195,198,201,204,207,210,213,216,219,222,225,228,231,244,250,252,260,261,262,263,364,265,266 and 167 protein.Total length and have the protein of function association by coupling small subunit profile HMM with the small subunit of described glycol/glycerol dehydratase, include but not limited to have SEQ ID NO:97,169,172,175,178,181,184,187,190,193,196,199,202,205,208,211,214,217,220,223,226,229,232,234,236,238,240,242,245,248,249,251,253,268,270,271,272,273 and 274 protein.In addition, total length and protein that have function association by mating big subunit and medium subunit profile HMM with the big subunit and the medium subunit of described glycol/glycerol dehydratase includes but not limited to have SEQ ID NO:233,235,237,239,241,246 and 247 protein.

Because above-mentioned profile HMM provides the structure/functional relationship of glycol/glycerol dehydratase, the protein that mates the new evaluation of these profiles HMM also can be used for the present invention.In addition, can be used for glycol of the present invention/glycerol dehydratase protein subunit matter sequence and comprise that the amino acid that has changes the protein that the subunit function is had minimum influence, it is substantially similar to the sequence of SEQ ID NO listed above.It will be understood by those skilled in the art that be common to coded proteinic functional performance amino acid that do not exert an influence, chemical equivalence in the displacement of given site.Be purpose of the present invention, will provide similar substantially proteinic displacement to be defined as exchange in following five groups one group:

1. little aliphatic non-polar residue or faint polar residue: Ala, Ser, Thr (Pro, Gly);

2. polar, electronegative residue and their acid amides: Asp, Asn, Glu, Gln;

3. polar, positively charged residue: His, Arg, Lys;

4. big aliphatic non-polar residue: Met, Leu, Ile, Val (Cys); With

5. big aromatic moieties: Phe, Tyr, Trp.

Thereby, can estimate that another amino acid of amino-acid substitution in these groups produces the protein of function equivalence.In many cases, the variation that causes proteinic N-end and C-end parts to change also will be estimated can not change activity of proteins.

Can be on aminoacid sequence have 90% or 95% identity with the basic similarly protein of those SEQ ID of coupling profile HMM, and these protein can be used for the present invention with a kind of protein that mates wherein.

Those skilled in the art can identify easily that one group can one be used from and provides functional glycol/glycerol dehydratase three kinds of subunits.Especially suitable is the combination of the big subunit from same organisms, medium subunit and small subunit, and the position of their coding region in genome is approaching mutually.These subunits will most possibly form natural glycol or glycerol dehydratase.Many big subunits, medium subunit and small subunit divide into groups in this mode in the table 2.Combination from the subunit of approaching bacterial strain of sibship or species is suitable for constituting dioldehydrase or glycerol dehydratase.Can use catalysis 2, the 3-butyleneglycol is converted into any subunit combinations of 2-butanone.By aminoacid sequence comparison and/or functional examination method, those skilled in the art can easily determine effective subunit combinations.

Therefore, the invention provides two pure and mild glycerol dehydratases, it has the aminoacid sequence of the big subunit that comprises total length, medium subunit and small subunit, the E value parameter that each described subunit obtains when utilizing the profile hidden Markov model to inquire about is 0.01 or littler, and wherein said profile hidden Markov model makes up with following subunit: SEQ ID NO:8,99,105,135,138,141,146 and 164 big subunit; SEQ ID NO:10,101,107,136,139,142,148 and 165 medium subunit; With SEQ ID NO:12,103,109,137,140,143,150 and 166 small subunit; It is that 1,000,000,000 hmmsearch algorithm carries out that Z parameter setting is wherein adopted in each inquiry.

Select as another kind, the invention provides two pure and mild glycerol dehydratases, it has the aminoacid sequence of identifying by the following method:

A) comparison from the aminoacid sequence of big subunit, medium subunit and the small subunit of corresponding two pure and mild glycerol dehydratases produces the profile hidden Markov model, wherein:

I) big subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:8,99,105,135,138,141,146 and 164;

Ii) medium subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:10,101,107,136,139,142,148 and 165; And

Iii) small subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:12,103,109,137,140,143,150 and 166;

B) utilize wherein the Z parameter setting be 1,000,000,000 and the E value parameter be set at 0.01 hmmsearch algorithm, inquire about at least one disclosed protein sequence database that contains two pure and mild glycerol dehydratase sequences with the hidden Markov model of (a), to identify first data set of two pure and mild glycerol dehydratase aminoacid sequences; And

C) first data set from (b) removes any part sequence to produce second data set of two pure and mild glycerol dehydratase aminoacid sequences, and wherein dioldehydrase and glycerol dehydratase are identified.

For the big subunit of of the present invention two pure and mild glycerol dehydratases, this enzyme can comprise so big subunit, this big subunit comprises the aminoacid sequence that has at least 95% identity with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:8,93,99,105,135,138,141,146,164,167,170,173,176,179,182,185,188,191,194,197,200,203,206,209,212,215,218,221,224,227,130,243,254,255,256,257,258 and 259, described sequence identity is based on Clustal W comparison method and calculates, this comparison method uses following default parameters: gap penalty=10, room length point penalty=0.1, and the protein weight matrix is Gonnet 250 series.

For the medium subunit of of the present invention two pure and mild glycerol dehydratases, this enzyme can comprise so medium subunit, this medium subunit comprises the aminoacid sequence that has at least 95% identity with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:10,95,101,107,136,139,142,148,165,168,171,174,177,180,183,186,189,192,195,198,201,204,207,210,213,216,219,222,225,228,231,244,250,252,260,261,262,263,364,265,266 and 167, described sequence identity is based on Clustal W comparison method and calculates, this comparison method uses following default parameters: gap penalty=10, room length point penalty=0.1, and the protein weight matrix is Gonnet 250 series.

For of the present invention two pure and mild glycerol dehydratase small subunits, this enzyme can comprise such small subunit, this small subunit comprises the aminoacid sequence that has at least 95% identity with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:12,97,103,109,137,140,143,150,166,169,172,175,178,181,184,187,190,193,196,199,202,205,208,211,214,217,220,223,226,229,232,234,236,238,240,242,245,248,249,251,253,268,270,271,272,273 and 274, described sequence identity is based on Clustal W comparison method and calculates, this comparison method uses following default parameters: gap penalty=10, room length point penalty=0.1, and the protein weight matrix is Gonnet 250 series.

Alternatively, dioldehydrase or glycerol dehydratase can comprise the big subunit of fusion, medium subunit and small subunit, the big subunit of this fusion, medium subunit and small subunit comprise the aminoacid sequence that has at least 95% identity with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:233,235,237,239,241,246 and 247, described sequence identity is based on Clustal W comparison method and calculates, this comparison method uses following default parameters: gap penalty=10, room length point penalty=0.1, and the protein weight matrix is Gonnet 250 series.

Select as another kind, this dioldehydrase or glycerol dehydratase can comprise the big subunit of fusion, medium subunit and small subunit and have at least 95% identity with the aminoacid sequence of whole three aminoacid sequences that comprise encode big subunit, medium subunit and small subunit, and wherein said three aminoacid sequences are selected from the group of being made up of following sequence:

A) SEQ ID NO:8, SEQ ID NO:10 and SEQ ID NO:12;

B) SEQ ID NO:93, SEQ ID NO:95 and SEQ ID NO:97;

C) SEQ ID NO:99, SEQ ID NO:101 and SEQ ID NO:103;

D) SEQ ID NO:105, SEQ ID NO:107 and SEQ ID NO:109;

E) SEQ ID NO:135, SEQ ID NO:136 and SEQ ID NO:137;

F) SEQ ID NO:138, SEQ ID NO:139 and SEQ ID NO:140;

G) SEQ ID NO:146, SEQ ID NO:148 and SEQ ID NO:150;

H) SEQ ID NO:141, SEQ ID NO:142 and SEQ ID NO:143; And

I) SEQ ID NO:164, SEQ ID NO:165 and SEQ ID NO:166;

Described sequence identity is based on Clustal W comparison method and calculates, this comparison method uses following default parameters: this comparison method uses following default parameters: gap penalty=10, room length point penalty=0.1, and the protein weight matrix is Gonnet 250 series.

Approach 4:

(a) Pyruvic acid is converted into α-acetylactis:

This substrate to the conversion of product with above described the same to approach 1.

(k) α-acetylactis is converted into 2,3-dihydroxyl-2-Methyl Butyric Acid:

Substrate acetylactis (I) is to product 2, and the conversion of 3-dihydroxyl-2-Methyl Butyric Acid (IX) is this area the unknown.Yet, the product of this conversion has had report (people such as Ziadi as the component of fermenting broth substratum, (1973) Comptes Rendus des Seances de l ' Academiedes Sciences, Serie D:Sciences Naturelles276:965-8), mechanism the unknown that still forms.Possible formation mechanism is to reduce acetylactis with NADH or NADPH as electron donor.Utilize this approach to produce the 2-butanols, then need to identify or the enzyme of engineered this reaction of catalysis.Yet, confirmed to the precedent of the enzymatic reduction reaction of alcohol about ketone.

(l) 2,3-dihydroxyl-2-Methyl Butyric Acid is converted into 2-hydroxy-2-methyl-3-phosphate butyric acid:

But still do not know catalytic substrate 2, the enzyme that 3-dihydroxyl-2-Methyl Butyric Acid (IX) transforms to product 2-hydroxy-2-methyl-3-phosphate butyric acid (X).Yet there is a large amount of kinases in occurring in nature, and they have diversified specificity.Therefore, might separate or engineered and obtain having this active enzyme.

(m) 2-hydroxy-2-methyl-3-phosphate butyric acid is converted into 2-butanone:

But still do not know the enzyme that catalytic substrate 2-hydroxy-2-methyl-3-phosphoric acid butyric acid (X) transforms to product 2-butanone (V).The combination of this reaction and last reaction is very similar to by the catalytic polystep reaction of mevalonate-5-pyrophosphate (M5PP) decarboxylase, this polystep reaction comprises at first the M5PP phosphorylation being converted into 3-phosphate mevalonic acid-5-PP and relying on decarboxylation subsequently removes phosphoric acid people such as (, (1982) Biochemistry21:4646-4650) Alvear.

(f) 2-butanone is converted into the 2-butanols:

This substrate to the conversion of product with above described the same to approach 1.

Thereby, many reorganization approach that provide from pyruvic acid to the 2-butanols, exist multiple choices to realize each step of converting, and those skilled in the art can utilize the sequence and the sequence disclosed herein that can openly obtain to make up relational approach.Above provided in the table 1 and 2 known in the art and can be used for making up the tabulation of numerous representative genes of 2-butanols biosynthetic pathway.

Be used to produce the microorganism host of 2-butanols and 2-butanone

The microorganism host that is used to produce 2-butanols or 2-butanone can be selected from bacterium, cyanobacteria, filamentous fungus and yeast.The microorganism host that is used to produce 2-butanols or 2-butanone should be able to tolerate the product that is produced, thereby productive rate is not limited host's toxicity by product can.The selection that is used to produce the microorganism host of 2-butanols will be described in detail below.Same standard also is applicable to the selection to the host who produces 2-butanone.

The active microorganism of metabolism is not for known in the art under the 2-of high titre level butanols.Although separated butanols tolerance mutant from produce solvent clostridium (solventogenic Clostridia), the information of the butanols tolerance aspect of relevant other potential available bacterial isolates does not almost have.Major part about the comparison of bacterium alcohol tolerance studies show that, the toxicity of butanols is greater than ethanol (people such as de Cavalho, people such as Microsc.Res.Tech.64:215-22 (2004) and Kabelitz, FEMS Microbiol.Lett.220:223-227 (2003)).People such as Tomas (J.Bacteriol.186:2006-2018 (2004)) report, the productive rate of 1-butanols may be subjected to the toxic restriction of butanols between clostridium acetobutylicum (Clostridium acetobutylicum) yeast phase.The 1-butanols is to destroy film function people such as (, Appl.Environ.Microbiol.50:1238-1243 (1985)) Hermann to the main influence of clostridium acetobutylicum.

The microorganism host that selection is used to produce the 2-butanols should be able to tolerate the 2-butanols and should be able to utilize the biosynthetic pathway of introducing that carbohydrate is changed into the 2-butanols.Select suitable microorganism host's standard to comprise as follows: to the intrinsic tolerance of 2-butanols, to the high utilization rate of carbohydrate, the operability of genetic tool that is used for genetically manipulated and the ability that produces stable chromosomal variation.

Suitable host bacterial strain with 2-butanols tolerance can be identified by screening based on the intrinsic tolerance of bacterial strain.Microorganism can be by being determined at when cultivating in the minimum medium to the intrinsic tolerance of 2-butanols, and the 2-butanol concentration (IC50) that causes growth rate 50% to suppress is measured.The IC50 value can utilize methods known in the art to determine.For example, can allow the microorganism of being paid close attention under the situation of the 2-butanols that contains multiple amount, grow, monitor growth rate by the optical density(OD) of measuring under 600 nanometers.Doubling time can calculating and measuring as growth rate fractional part from growth curve.The concentration that produces 50% growth inhibiting 2-butanols can be measured the graphic representation of 2-butanol concentration from growth-inhibiting per-cent.Preferably, host strain should be greater than about 0.5% IC50 to the IC50 of 2-butanols.More suitably be greater than about 1.5% host strain to the IC50 of 2-butanols.Especially suitable is to the IC50 of 2-butanols greater than about 2.5% host strain.

The microorganism host that is used to produce the 2-butanols also tackles glucose and/or other carbohydrate has high utilization rate.Most of microbe can both be utilized carbohydrate.Yet some environmental microorganism can not effectively utilize carbohydrate, and thereby will can not be appropriate host.

Genetic modification host's ability is very crucial concerning the generation of any recombinant microorganism.Adoptable gene transfer technique pattern comprises electroporation, joint, transduction or transforms naturally.Can utilize multiple host's connectivity plasmid and drug resistance mark.Based on can be in the host character of the antibiotics resistance mark of generation effect, be used for the cloning vector of organism at this host organisms customization.

Also microorganism host can be handled so that by making the several genes inactivation make the approach inactivation of competition carbon stream.This just need exist transposon or chromosomal integration vector in order to the guiding inactivation.In addition, by the screening of chemomorphosis and mutant strain, be subjected to the production host of chemomorphosis may experience the raising of intrinsic 2-butanols tolerance.

Based on above-mentioned standard, the suitable microorganism host who is used to produce 2-butanols and 2-butanone includes but not limited to: fusobacterium (Clostridium), zymomonas (Zymomonas), Escherichia (Escherichia), salmonella (Salmonella), Rhod (Rhodococcus), Rhodopseudomonas (Pseudomonas), bacillus (Bacillus), genus lactubacillus (Lactobacillus), enterococcus spp (Enterococcus), Pediococcus (Pediococcus), Alkaligenes (Alcaligenes), klebsiella spp (Klebsiella), class Bacillus (Paenibacillus), genus arthrobacter (Arthrobacter), corynebacterium (Corynebacterium), brevibacterium sp (Brevibacterium), Pichia (Pichia), mycocandida (Candida), the member of Hansenula (Hansenula) and yeast belong (Saccharomyces).Preferred host comprises: intestinal bacteria, alcaligenes eutrophus (Alcaligenes eutrophus), Bacillus licheniformis (Bacillus licheniformis), Paenibacillus macerans (Paenibacillus macerans), Rhodococcus (Rhodococcuserythropolis), pseudomonas putida (Pseudomonas putida), plant lactobacillus (Lactobacillus plantarum), faecium (Enterococcus faecium), Enterococcus gallinarum (Enterococcus gallinarium), enterococcus faecalis (Enterococcus faecalis), Pediococcus pentosaceus (Pediococcus pentosaceus), pediococcus acidilactici (Pediococcusacidilactici), subtilis (Bacillus subtilis) and yeast saccharomyces cerevisiae (Saccharomyces cerevisiae).

Produce host's structure

Can adopt technique construction known in the art to contain the coding carbon substrate that can ferment and be converted into the recombinant organisms of indispensable gene of the enzymatic pathway of 2-butanols or 2-butanone.In the present invention, enzyme (acetolactate synthase, acetolactate decarboxylase, butanediol dehydrogenation enzyme, butyleneglycol dehydratase and butanols desaturase) in the coding 2-butanols biosynthetic pathway 3 or coding omission the gene of enzyme of 2-butanone biosynthetic pathway 3 of butanols desaturase can separate multiple source from as mentioned above.

The method that obtains required gene from bacterial genomes is commonly used and well known in the biology field.For example,, then can design primer and adopt amplification method (for example polymerase chain reaction (U.S. Patent No. 4,683,202)) the required sequence that increases of the primer guiding of standard, to obtain to be suitable for cloning the DNA of the amount in the expression vector into if gene order is known.If separate and the allogenic gene of known array, then can produce suitable genomic library and can screen by digestion with restriction enzyme with the probe that has with required gene order complementary sequence.In case separated sequence, promptly the amplification method (for example polymerase chain reaction (U.S. Patent No. 4,683,202)) that can guide with the primer of standard comes DNA amplification, to obtain to be suitable for cloning the DNA of the amount in the expression vector into, then this expression vector is converted in the proper host cell.

In addition, during given proteinic aminoacid sequence with required enzymic activity, then can be by the encoding sequence of determining of this protein sequence of reverse translation.The dna fragmentation that contains this encoding sequence can and be cloned in the expression vector by synthetic preparation, then this expression vector is transformed in the required host cell.

When preparation contains the synthetic DNA fragment of encoding sequence, can optimize this sequence in order in target host cell, to express.Being used for optimizing codon is easy to obtain with the instrument at the heterologous host cell inner expression.Some codon optimized instruments can obtain based on the GC content of host organisms.Provided the GC content of some exemplary microorganism host in the table 3.

Table 3

The GC content of microorganism host

Bacterial strain	％GC
		Bacillus licheniformis	46
Bacillus subtillis	42
		Clostridium acetobutylicum	37
Intestinal bacteria	50
		Pseudomonas putida	61
Alcaligenes eutrophus	61
		Paenibacillus macerans	51
Rhodococcus	62
		Bacillus brevis belongs to	50
Many sticking class bacilluss (Paenibacillus polymyxa)	50

In case identify and separated the gene of relational approach, they can be transformed in the suitable expressive host by method as known in the art.The carrier that can be used for transforming multiple host cell is common and can be commercially available from some companies, for example

(Madison, WI), Invitrogen Corp. (Carlsbad, CA), Stratagene (LaJolla, CA) and New England Biolabs, Inc. (Beverly, MA).Usually, carrier contains selected marker and allows in required host self-replicating or the sequence of chromosomal integration.In addition, suitable carriers comprises promoter region and the Transcription Termination control region with transcription initiation controlled function, can insert the coding region dna fragmentation between this promoter region and Transcription Termination control region, so that the expression of inserting this coding region to be provided.These two kinds of control regions all can derive from and transformed host cells homologous gene, but should be appreciated that it is the gene of non-natural that this control region also may derive from concerning selected do production host's specific species.

Can be used for driving initial control region or the promotor expressed in required host cell the relational approach coding region has a lot, and is familiar with by those skilled in the art.In fact, the any promotor that drives these genetic elements all is applicable to the present invention, and described promotor includes but not limited to come from the promotor of following gene: CYC1, HIS3, GAL1, GAL10, ADH1, PGK, PHO5, GAPDH, ADC1, TRP1, URA3, LEU2, ENO, TPI, CUP1, FBA, GPD and GPM (be used in the Saccharomycodes and express); AOX1 (be used in the pichia spp Pseudomonas and express); And lac, ara, tet, trp, IP _L, IP _R, T7, tac and trc promotor (be used in intestinal bacteria, Alkaligenes and the Rhodopseudomonas and express); Amy, apr and npr promotor, and multiple phage promoter (be used in Bacillus subtillis, Bacillus licheniformis and the Paenibacillus macerans and express); NisA (be used in the gram-positive microorganism and express, people such as Eichenbaum, Appl.Environ.Microbiol.64 (8): 2763-2769 (1998)); And synthetic P11 promotor (be used in the plant lactobacillus and express, people such as Rud, Microbiology152:1011-1019 (2006)).

Stop the control region and also can come from the natural several genes of preferred host.Randomly, termination site may be unnecessary, yet, be most preferred if contain termination site.

Some carrier can duplicate and can shift by joint in the host bacteria widely.Can utilize the complete and annotated sequence of pRK404 and three kinds of related vector: pRK437, pRK442 and pRK442 (H).These derivatives have been proved to be to carry out the useful tool (people such as Scott, Plasmid50 (1): 74-79 (2003)) of genetic manipulation in Gram-negative bacteria.Several plasmids of deriving of the IncP4 plasmid RSF1010 of broad host range also can obtain, and it has the promotor of performance function in a series of Gram-negative bacterias.Plasmid pAYC36 and pAYC37 have active promotor and multiple clone site is expressed in Gram-negative bacteria to allow heterologous gene.

The chromogene displacement tool also can extensively obtain.For example, the thermo-sensitivity variant of the replicon pWV101 of broad host range improved with structure be used in the plasmid pVE6002 that realizes gene substitution in a series of gram-positive microorganisms people such as (, J.Bacteriol.174 (17): 5633-5638 (1992)) Maguin.In addition, external swivel base body (for example can derive from commercial source

), in order in the range gene group, to produce random mutation.

Carried out below 2-butanols biosynthetic pathway being expressed in multiple preferred microorganism host describing in more detail.For the expression of 2-butanone biosynthetic pathway, below describe same being suitable for, but omitted of the conversion of last substrate 2-butanone to product 2-butanols.

2-butanols or the expression of 2-butanone biosynthetic pathway in intestinal bacteria

The carrier that can be used for transformed into escherichia coli is very general and can be commercially available from above-mentioned company.For example, the gene of 2-butanols biosynthetic pathway can be separated from above-mentioned multiple source, be cloned on the pUC19 carrier of improvement and transform among the intestinal bacteria NM522, as described in embodiment 6 and 7.Alternatively, the gene of coding 2-butanols biosynthetic pathway can be divided to a plurality of operons, be cloned on the expression vector, and be converted in the multiple coli strain, described in embodiment 9,10 and 11.The 2-butanone biosynthetic pathway also can similarly be expressed, but omits the butanols desaturase.

2-butanols or the expression of 2-butanone biosynthetic pathway in Rhodococcus

A series of intestinal bacteria-rhodococcus shuttle vectors is used in the Rhodococcus and expresses, and described shuttle vectors includes but not limited to pRhBR17 and pDA71 (people such as Kostichka, Appl.Microbiol.Biotechnol.62:61-68 (2003)).In addition, a series of promotors can be used for heterologous gene and express in Rhodococcus (referring to people such as for example Nakashima, Appl.Environ.Microbiol.70:5557-5568 (2004), and people such as Tao, Appl.Microbiol.Biotechnol.2005, DOI10.1007/s00253-005-0064).Target gene in the Rhodococcus chromogene interrupts (Targeted gene disruption) and can utilize the described methods of people (Appl.Envion.Microbiol.66:2029-2036 (2000)) such as people's (the same) such as Tao and Brans to produce.

The required heterologous gene of aforesaid generation 2-butanols can be cloned in pDA71 or the pRhBR71 at first, and transform in the intestinal bacteria.Then, can carrier be transformed in the Rhodococcus, as described in people such as Kostichka (the same) by electroporation.Recombinant chou can be grown in containing the synthetic medium of glucose, and can utilize fermentation process known in the art to produce the 2-butanols subsequently.The 2-butanone biosynthetic pathway also can similarly be expressed, but omits the butanols desaturase.

2-butanols or the expression of 2-butanone biosynthetic pathway in subtilis

The method that genetic expression and sudden change produce in the subtilis also is known in the art.For example, the gene of 2-butanols biosynthetic pathway can separate from multiple source, as mentioned above, it is cloned in the intestinal bacteria-bacillus shuttle vectors of into improvement, transforms in the subtilis BE1010, as described in embodiment 8 then.Required gene clone can be advanced in the Bacillaceae expression vector and it is transformed into and produce the host with preparation in the bacterial strain.Alternatively, can utilize condition replicon well known by persons skilled in the art or suicide vector that gene integration is arrived in the bacillus karyomit(e).For example, Bacillus Genetic Stock Center (genus bacillus heredity preservation center) has numerous integrative vectors.The 2-butanone biosynthetic pathway also can similarly be expressed, but omits the butanols desaturase.

2-butanols or the expression of 2-butanone biosynthetic pathway in Bacillus licheniformis

Most of plasmids that duplicate in subtilis and shuttle vectors can be used for transforming Bacillus licheniformis by protoplast transformation or electroporation.Producing the required gene of 2-butanols can be advanced in plasmid pBE20 or the pBE60 derivative people such as (, Genel14:121-126 (1992)) Nagarajan by the clone.The method that transforms Bacillus licheniformis be known in the art (for example, referring to people such as Fleming, Appl.Environ.Microbiol., 61 (11): 3775-3780 (1995)).Structure is used for can being transformed in the Bacillus licheniformis to produce the recombinant microorganism host that can produce the 2-butanols at the plasmid that subtilis is expressed.The 2-butanone biosynthetic pathway can be expressed similarly, but omits the butanols desaturase.

2-butanols or the expression of 2-butanone biosynthetic pathway in Paenibacillus macerans

Can make up plasmid about the description of in subtilis, expressing according to top, and this plasmid is used to transform Paenibacillus macerans, to produce the recombinant microorganism host that can produce the 2-butanols by the protoplast transformation method.The 2-butanone biosynthetic pathway can be expressed similarly, but omits the butanols desaturase.

2-butanols or the expression of 2-butanone biosynthetic pathway in alcaligenes eutrophus

It is known in the art (referring to people such as for example Taghavi, Appl.Environ.Microbiol., 60 (10): 3585-3591 (1994)) being used for carrying out genetic expression and producing the method for suddenling change at alcaligenes eutrophus.The gene clone of 2-butanols biosynthetic pathway can be advanced in the carrier of above-mentioned any broad host range, and be converted in the alcaligenes eutrophus to form the recombinant chou of producing the 2-butanols by electroporation.Poly butyric ester approach in the Alkaligenes has a detailed description, and the genomic genetic technique of multiple improvement alcaligenes eutrophus is known, and these instruments can be applied to through engineering approaches 2-butanols biosynthetic pathway.The 2-butanone biosynthetic pathway also can similarly be expressed, but omits the butanols desaturase.

2-butanols or the expression of 2-butanone biosynthetic pathway in pseudomonas putida

The method of expressing gene is (referring to people such as for example Ben-Bassat, U.S. Patent No. 6,586,229 is incorporated the document into this paper by reference) known in the art in pseudomonas putida.The gene of 2-butanols biosynthetic pathway can be inserted in the pPCU18, and the electric transformed competence colibacillus cell that the DNA of this connection can be converted into pseudomonas putida DOT-T1C5aAR1 by electroporation can be produced the recombinant chou of 2-butanols with generation.The 2-butanone biosynthetic pathway also can similarly be expressed, but omits the butanols desaturase.

2-butanols or the expression of 2-butanone biosynthetic pathway in plant lactobacillus

Lactobacillus belongs to lactobacillaceae (Lactobacillales), and is used to transform subtilis and streptococcic many plasmids and carrier and can be used for transforming lactobacillus.The limiting examples of suitable carrier comprises pAM β 1 and derivative vector (people such as Renault, Gene183:175-182 (1996); And people such as O ' Sullivan, Gene137:227-231 (1993)); The derivative vector pHW800 of pMBB1 and pMBB1 (people such as Wyckoff, Appl.Environ.Microbiol.62:1481-1486 (1996)); Conjugative plasmid pMG1 (people such as Tanimoto, J.Bacteriol.184:5800-5804 (2002)); PNZ9520 (people such as Kleerebezem, Appl.Environ.Microbiol.63:4581-4584 (1997)); PAM401 (people such as Fujimoto, Appl.Environ.Microbiol.67:1262-1267 (2001)); And pAT392 (people such as Arthur, Antimicrob.Agents Chemother.38:1899-1903 (1994)).Several plasmids (people such as vanKranenburg, Appl.Environ.Microbiol.71 (3): 1223-1230 (2005)) that derive from plant lactobacillus have also been reported.

The several genes of 2-butanols biosynthetic pathway can be assembled in any suitable carriers, for example above-mentioned those carriers.Can be based on the codon index optimizing codon of deriving from the genome sequence of plant lactobacillus or Lactobacillus arizonensis to be used for expression.Can utilize methods known in the art that plasmid is introduced in the host cell, electroporation (people such as Cruz-Rodz for example, Molecular Genetics and Genomics 224:1252-154 (1990), people such as Bringel, Appl.Microbiol.Biotechnol.33:664-670 (1990); People such as Alegre, FEMSMicrobiology letters241:73-77 (2004)) and bonding method (people such as Shrago, Appl.Environ.Microbiol.52:574-576 (1986)).Can also utilize integrative vector with 2-butanols biosynthetic pathway gene integration (people such as Hols, Appl.Environ.Microbiol.60:1401-1403 (1990) to Bacterium lacticum karyomit(e); People such as Jang, Micro.Lett.24:191-195 (2003)).The 2-butanone biosynthetic pathway also can similarly be expressed, but omits the butanols desaturase.

2-butanols or 2-butanone biosynthetic pathway are at faecium, Enterococcus gallinarum and excrement intestines ball Expression in the bacterium

Enterococcus spp belongs to lactobacillaceae, above-mentionedly is used to transform Bacterium lacticum, subtilis and streptococcic multiple plasmid and carrier also can be used for faecalis.Can also use the expression vector that be used for enterococcus faecalis (people such as Eichenbaum, the Appl.Environ.Microbiol.64:2763-2769 (1998) of employing from the nisA gene of lactococcus (Lactococcus).In addition, can use the carrier (people such as Nallaapareddy, Appl.Environ.Microbiol.72:334-345 (2006)) that is used for carrying out gene substitution at faecium karyomit(e).

The several genes of 2-butanols biosynthetic pathway can be assembled in any suitable carriers, for example above-mentioned those carriers.Can express being used for based on the codon index optimizing codon of deriving from enterococcus faecalis or faecium genome sequence.Plasmid can utilize methods known in the art to introduce host cell, electroporation for example, as (MolecularGenetics and Genomics 224:1252-154 (1990)) or bonding method as described in the people such as Cruz-Rodz, as (Microbiol.Mol.Biol.Rev.67:277-301 (2003)) as described in the people such as people such as Tanimoto (J.Bacteriol.184:5800-5804 (2002)) and Grohamann.The 2-butanone biosynthetic pathway also can similarly be expressed, but omits the butanols desaturase.

2-butanols or the table of 2-butanone biosynthetic pathway in Pediococcus pentosaceus and pediococcus acidilactici Reach

Pediococcus belongs to lactobacillaceae (Lactobacillales), and above-mentionedly is used to transform subtilis and streptococcic multiple plasmid and carrier and also can be used for the conversion plate Coccus.The non-limiting example of suitable carrier is pHPS9 (people such as Bukhtiyarova, Appl.Environ.Microbiol.60:3405-3408 (1994)).Several plasmids (people such as Alegre, FEMS Microbiol.Lett.250:151-156 (2005) have been reported from the sheet coccus; People such as Shareck, Crit.Rev Biotechno.24:155-208 (2004)).

The gene of 2-butanols biosynthetic pathway can be assembled in any suitable carriers, for example above-mentioned those carriers.Can be based on the codon index optimizing codon of deriving from the Pediococcus pentosaceus genome sequence to be used for expression.Plasmid can utilize methods known in the art to introduce host cell, and for example electroporation is (referring to people such as for example Osmanagaoglu, J.Basic Microbiol.40:233-241 (2000); People such as Alegre, FEMS Microbiol.Lett.250:151-156 (2005)) and joint (Gonzalez and Kunka, Appl.Environ.Microbiol.46:81-89 (1983)).Can also utilize integrative vector with 2-butanols biosynthetic pathway gene integration (people such as Davidson, Antonie van Leeuwenhoek 70:161-183 (1996)) to the karyomit(e) of Pediococcus.The 2-butanone biosynthetic pathway also can similarly be expressed, but omits the butanols desaturase.

Fermention medium

Fermention medium among the present invention must contain suitable carbon substrate.Suitable substrate can include but not limited to monose, for example glucose and fructose; Oligosaccharides, for example lactose or sucrose; Polysaccharide, for example starch, Mierocrystalline cellulose or their mixture; And from the not purified mixture of renewable raw materials, for example cheese whey penetrant, corn steep liquor, beet sirup and barley germ.In addition, carbon substrate can be a carbon substrate or the methyl alcohol such as carbonic acid gas of crucial biochemical intermediate product by metabolic conversion for proving also.Except carbon and two carbon substrates, the methylotroph body is also known can to utilize multiple other carbon compound, for example methylamine, glycosamine and be used for the multiple amino acids of Metabolic activity.For example, the methylotrophy yeast is known is used to carbon from methylamine and forms trehalose or glycerine (people such as Bellion, Microb.Growth C1 Compd., [Int.Symp.], the 7th (1993), 415-32, editor: Murrell, J.Collin; Kelly, Don P.Publisher:Intercept, Andover, UK).Similarly, the multiple species of mycocandida will metabolism L-Ala or oleic acid (people such as Sulter, Arch.Microbiol.153:485-489 (1990)).Therefore, the carbon source utilized among the present invention of imagination can contain and variously contains carbon substrate and will only be subject to the selection of organism.

Although expect that all above-mentioned carbon substrates and their mixture all are applicable to the present invention, preferred carbon substrate is glucose, fructose and sucrose, and these sugared mixtures arbitrarily.Sucrose can obtain from the raw material such as sugarcane, beet, cassava and sweet sorghum.Glucose and dextrose can obtain by the saccharification of starch-based initial material (comprising the cereal such as corn, wheat, naked barley, barley and oat).

In addition, fermentable sugars can obtain from cellulose series biomass and wood fiber biomass by pre-treatment and Mashing process, as for example own together and common unsettled U.S. Patent application US20070031918A1 described in, incorporate this patent application into this paper by reference.Biomass refer to any cellulose substances or lignocellulose material and comprise and comprise Mierocrystalline cellulose, and the optional material that comprises hemicellulose, xylogen, starch, oligosaccharides and/or monose in addition.Biomass can also comprise supplementary component, for example protein and/or lipid.Biomass can be derived from single source, or biomass can comprise the mixture that comes from more than one sources; For example, biomass can comprise the mixture of corn cob and maize straw, or the mixture of grass and leaf.Biomass include but not limited to: bioenergy crop, agricultural residue, municipal solid wastes, industrial solid castoff, waste sludge from paper mill, flower garden waste, timber and forestry waste.The example of biomass includes but not limited to: corn grain, corn cob, crop residues (for example corn husk, maize straw), dogstail, wheat, wheat straw, barley, barley stalk, hay, straw, switchgrass, waste paper, bagasse, jowar, soybean, composition, trees, branch, tree root, leaf, wood chip, sawdust, shrub and the bush, vegetables, fruit, flower and the barnyard manure that obtain from the cereal of milling.

Except suitable carbon source, fermention medium also must contain mineral substance, salt, cofactor, buffer reagent and other component that is suitable for the culture growth and promotes to produce 2-butanols or the necessary enzymatic pathway of 2-butanone well known by persons skilled in the art.

Culture condition

Usually, cell is cultivated in suitable medium to about 40 ℃ temperature range at about 25 ℃.Suitable growth medium is the substratum of common commercial production, for example LuriaBertani (LB) meat soup, Sabouraud Dextrose (SD) meat soup or yeast extract medium (YM) meat soup among the present invention.Also can use that other is determined or the synthetic growth medium, the technician in microbiology or fermentation science field will know the suitable culture medium that is used for concrete microorganism growth.The known reagent that can directly or indirectly regulate catabolite repression, as cyclic amp 2 ': 3 '-single phosphoric acid, also can mix in the fermention medium.

To between the pH9.0, wherein pH6.0 to pH8.0 is preferably as initial condition at pH5.0 for the pH scope that is suitable for fermenting.

Fermentation can be carried out under aerobic or anaerobic condition, and anaerobism or little oxygen condition are preferred.

Industry batch fermentation and continuously fermenting

Process using batch fermentation method of the present invention.Classical batch fermentation is a closed system, and wherein the composition of substratum is set when the fermentation beginning and do not carried out the manual change during the fermentation.Therefore when the fermentation beginning, substratum is inoculated, under system adds the situation of any material, do not fermented with required organism.Yet as a rule, " in batches " fermentation is meant that the interpolation of carbon source is in batch, but often attempts to control the factor such as pH and oxygen concn.In the batch fermentation system, meta-bolites and biomass are formed lasting the change when fermentation ends.In batch culture, cell slowly arrives the high-speed rapid growth logarithmic phase by static lag phase, and reaches stationary phase at last, and growth velocity is slowed down or stopped at this moment.If do not handled, the cell of stationary phase will be final dead.Usually, the interim cell of exponential growth is responsible for producing most of end product or intermediate product.

A kind of modification of standard batch system is feed supplement-batch system.Feed supplement-batch fermentation technology also is applicable to the present invention, and comprises typical batch system, and different is along with course of fermentation incrementally adds substrate.Often suppress the metabolism of cell at meta-bolites, and when wherein expecting to have in the substratum limited amount substrate, feed supplement-batch system is useful.Actual concentration of substrate in feed supplement-batch system is difficult to measure and thereby can measures factor (pH, dissolved oxygen and waste gas CO for example for example according to some ₂Dividing potential drop) assess.Batch fermentation and feed supplement-batch fermentation are that use always and well-known in this area, and example is found in following document: Thomas D.Brock, Biotechnology:A Textbook of IndustrialMicrobiology, second edition, (1989), Sinauer Associates, Inc., Sunderland, MA. or Deshpande, Mukund V, Appl.Biochem.Biotechnol., 36:227, (1992) incorporate these two pieces of documents into this paper by reference.

Although the present invention carries out with batch mode, also imagining this method will be applicable to continuous ferment process.To continuously ferment be a kind of open system, wherein the fermention medium that configures added in the bio-reactor continuously, and shift out the substratum that equivalent adapted to simultaneously and be used for processing.Continuously ferment and usually culture is maintained constant high density.

Continuously fermenting allows to regulate the factor of a kind of factor or arbitrary number, these growth of factor affecting cell or end product concentration.For example, a kind of method will be kept limiting nutrient material (for example carbon source or nitrogen level) and allow all other parameter appropriateness with fixed speed.In other systems, can continuously change many factors of influence growth, keep constant cell concn (by the turbidimetry of substratum) simultaneously.Continuous system make every effort to keep stable state growth conditions and thereby, during the fermentation since substratum be removed the loss cell that causes must with the growth rate maintenance balance of cell.Being used for regulating the nutritive substance of continuous fermentation process and the method for somatomedin and the method that makes product form speed maintenance highest level is that the industrial microorganism field is well-known, and several different methods is being described in detail by Brock (the same).

Imagination can or adopt batch fermentation, feed supplement-batch fermentation or adopts continuous fermentation process to put into practice and execute the present invention, and any known fermentation pattern all will be suitable for.In addition, imagination can be with cell fixation on substrate and as complete cell catalyst and allow it stand fermentation condition to be used to produce 2-butanols or 2-butanone.

The method of from fermention medium, separating 2-butanols and 2-butanone

Adopt ABE fermentation process known in the art (referring to for example Durre, Microbiol.Biotechnol.49:639-648 (1998), people such as Groot, Process Biochem.27:61-75 (1992), and reference wherein), can be from fermention medium the 2-butanols that produces of separating bio.For example, can shift out solid substance from fermention medium by methods such as centrifugal, filtration, decantations.Then, use such as distillation, component distillation, liquid-liquid extraction, absorption, gas carry, 2-butanols in the method separate fermentation substratum such as thin film evaporation or pervaporation.These methods are equally applicable to the 2-butanone that separating bio produces from fermention medium.

Embodiment

The present invention will further limit in the following embodiments.Should be appreciated that these embodiment when describing the preferred embodiments of the invention, only are to provide in illustrational mode.According to top argumentation and these embodiment, those skilled in the art can determine essential characteristic of the present invention, and under the premise without departing from the spirit and scope of the present invention, can make multiple variation and modification makes it be applicable to multiple use and condition to the present invention.

General method

Standard recombinant dna technology described in the embodiment and molecule clone technology are well-known in the field, and in following document, describe to some extent: Sambrook, J., Fritsch, E.F. and Maniatis, T.Molecular Cloning:A Laboratory Manual; Cold SpringHarbor Laboratory Press:Cold Spring Harbor, NY, (1989) (Maniatis) and T.J.Silhavy, M.L.Bennan and L.W.Enquist, Experiments with GeneFusions, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1984) and Ausubel, F.M. wait the people, Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience publish (1987).

Suitable bacterial cultures is kept and the material and the method for growing are well-known in the field.The technology that is suitable among the following embodiment is found in following document: Manual of Methodsfor General Bacteriology (Phillipp Gerhardt, R.G.E.Murray, Ralph N.Costilow, Eugene W.Nester, Willis A.Wood, Noel R.Krieg and G.BriggsPhillips (editor)), American Society for Microbiology, Washington, DC. (1994) or Thomas D.Brock, Biotechnology:A Textbook of IndustrialMicrobiology, second edition, Sinauer Associates, Inc., Sunderland, MA (1989).Except as otherwise noted, otherwise described all reagent, restriction enzyme and the material that is used for bacterial cell growth and keeps all derives from Aldrich Chemicals (Milwaukee, WI), BDDiagnostic Systems (Sparks, MD), LifeTechnolo gies (Rockville, MD) or Sigma Chemical Company (St.Louis, MO).Except as otherwise noted, otherwise bacterial isolates all derive from American Type Culture Collection (American type culture collection) (ATCC, Manassas, VA).

Oligonucleolide primers described in the following examples provides in table 4.All oligonucleoside (Woodlands TX) synthesizes the acid primer by Sigma-Genosys.Table 4

Clone's primer and screening primer

Gene	The primer title	Sequence	SEQ IDNO：	Describe
					budB	B1	CACCATGGACAAACAGTATCCGGTACGCC		15	The budB forward primer

budB	B2	CGAAGGGCGATAGCTTTACCAATCC		16	The budB reverse primer
						budA	B3	CACCATGAATCATTCTGCTGAATGCACCTGCG		17	The budA forward primer
budA	B4	GATACTGTTTGTCCATGTGACC		18	The budA reverse primer
						budC	B5	CACCATGAAAAAAGTCGCACTTGTTACC		19	The budC forward primer
budC	B6	TTAGTTAAATACCAT		20	The budC reverse primer
						pddA	B7	CACCATGAGATCGAAAAGATTTG		21	The pddABC forward primer
pddC	B8	CTTAGAGAAGTTAATCGTCGCC		22	The pddABC reverse primer
						sadh	B9	CACCATGAAAGCCCTCCAGTACACC		23	The sadh forward primer
sadh	B10	CGTCGTGTCATGCCCGGG		24	The sadh reverse primer
						budA	B11	GATCGAATTCGTTTAAACTTAGTTTTCTACCGCACG		25	The budABC forward primer
budC	B12	GATCGCATGCAAGCTTTCATATAGTCGGAATTCC		26	The budABC reverse primer
						pddA	B13	GATCGAATTCGTTTAAACAAAGGAGGTCTGATTCATG AGATCG		27	The pddABC forward primer
pddC	B14	GATCGGATTCTTAATCGTCGCC	28	The pddABC reverse primer
					sadh	B15	GATCGGATCCAAAGGAGGTCGGGCGCATGAAAGCC C	29	The sadh forward primer
sadh	B16	GATCTCTAGAAAGCTTTCAGCCCGGGACGACC		30						The sadh reverse primer
					--	BenF	ACTTTCTTTCGCCTGTTTCAC	31	--
--	BenBPR	CATGAAGCTTGTTTAAACTCGGTGACCTTGAAAATAA TGAAAACTTATATTGTTTTGAAAATAATGAAAACTTATATTG	32	--
					budAB	BABC F	GAGCTCGAATTCAAAGGAGGAAGTGTATATGAATCATTC	33	The budAB forward primer
budAB	BAB R	GGATCCTCTAGAATTAGTTAAATACCATCCCGCCG	34	The budAB reverse primer
					budC	BC Spe F	ACTAGTAAAGGAGGAAAGAGTATGAAGAAGGTCGCACT	40	The budC forward primer
budC	BC Xba R	TCTAGAAAGCAGGGGCAAGCCATGTC		41						The budC reverse primer
					pddABC- ddrAB	DDo For	AAGCTTAAAGGAGGCTGATTCATGAGATCGAAAAGATT	44	The pddABC-ddrAB forward primer
pddABC- ddrAB	DDo Rev	TCTAGATTATTCATCCTGCTGTTCTCC	45	The pddABC-ddrAB reverse primer
					chnA	ChnA F	CATCAATTGACTACGTAG TCGTACGTGTAAGGAGGT TTGAAATGGAAAAAATTAT	54	The chnA forward primer

		G
					chnA	ChnA R	CATGCTAGCCCCGGGTAT CTTCTACTCATTTTTTATTTCG	55	The chnA reverse primer
--	Top ter F1	CTAGAAGTCAAAAGCCTCCGACCGGAGGCTTTTGA	58	Forward primer
					--	Top ter F2	CTGCTCGAGTTGCTAGC AAGTTTAAACAAAAAAAAGCCCGCTCATTAGGCGG GCTGAGCT	59	Forward primer
--	Bot ter R1	CAGCCCGCCTAATGAGC GGGCTTTTTTTTGTTTAAAC	60	Reverse primer
					--	Bot ter R2	TTGCTAGCAACTCGAGCAGTCAAAAGCCTCCGGTC GGAGGCTTTTGACTT	61	Reverse primer
KA-AT	OT872	CTCCGGAATTCATGTCTGACGGACGACTCACCGCA	127	Amino alcohol kinases/lyase operon forward primer
					KA-AT	OT873	TTCCAATGCATTGGCTGCAGTTATCTCTGTGCACGAGTGCCGATGA	128	Amino alcohol kinases/lyase operon reverse primer
KA	OT879	AACAGCCAAGCTTGGCT GCAGTCATCGCGCATTCTCCGGG	129	Amino alcohol kinases reverse primer
					AT	OT880	TCTCCGGAATTCATGACGTCTGAAATGACAGCGACAGAAG	130	Amino alcohol lyase forward primer
pBAD.HisB	OT909	GCTAACAGGAGGAAGAATTCATGGGGGGTTCTC	131	Add the EcoRI site to replace the NcoI site
					pBAD.HisB	OT910	GAGAACCCCCCATGAATTCTTCCTCCTGTTAGC	132	Add the EcoRI site to replace the NcoI site
BudAB	N84seqR3	GGACCTGCTTCGCTTTATCG	15g	Reverse primer
					APT	APTfor	GCGCGCCCGGGAAGAAG GAGCTCTTCACCATGAACAAACCACAGTCTTGG	162	The APT forward primer
APT	APTrev	GCGCGCCCGGGTTCATGCCACCTCTGCG	163	The APT reverse primer

Table 5

Sequencing primer

Title	Sequence	Gene specific	SEQ ID NO：
				The M13 forward primer	GTAAAACGACGGCCAGT	--	35
The M13 reverse primer	AACAGCTATGACCATG	--	36
				N83 SeqF2	GCTGGATTACCAGCTCGACC	--	37
N83 SeqF3	CGGACGCATTACCGGCAAAG	--	38
				N84 Seq R2	GCATCGAGATTATCGGGATG	--	65
N84 SeqR4	CGAAGCGAGAGAAGTTATCC	--	39

Trc F	TTGACAATTAATCATCCGGC	All	42
				Trc R	CTTCTCTCATCCGCCAAAAC	All	43
DDko seq F2	GCATGGCGCGGATTTGACGAAC	pddABC- ddrAB	46
				DDko seq F5	CATTAAAGAGACCAAGTACGTG	pddABC- ddrAB	47
DDko seq F7	ATATCCTGGTGGTGTCGTCGGCGT	pddABC- ddrAB	48
				DDko seq F9	TCTTTGTCACCAACGCCCTGCG	pddABC- ddrAB	49
DDko seq R1	GCCCACCGCGCTCGCCGCCGCG	pddABC- ddrAB	50
				DDko seq R3	CCCCCAGGATGGCGGCTTCGGC	pddABC- ddrAB	51
DDko seq R7	GGGCCGACGGCGATAATCACTT	pddABC- ddrAB	52
				DDko seq R10	TTCTTCGATCCACTCCTTAACG	pddABC- ddrAB	53
chnSeq F1	CTCAACAGGGTGTAAGTGTAGT	chnA	56
				chnSeq R1	CGTTTTGATATAGCCAGGATGT	chnA	57
pCL1925 vec F	CGGTATCATCAACAGGCTTACC	All	62
				pCL1925 vec R1	AGGGTTTTCCCAGTCACGACGT	All	63
pCL1925 vec R2	CGCAATAGTTGGCGAAGTAATC	All	64
				APTseqRev	GCTAGAGATGATAGC	APT	160
APTseqFor	GGAAGAGACTATCCAGCG	APT	161

The method of 2-butanols and 2-butanone concentration in the mensuration substratum

Can be by the concentration of 2-butanols and 2-butanone in the several different methods mensuration substratum known in the art.For example, utilize the Shodex SH-1011 chromatographic column have Shodex SH-G guard column (all can be from the special highly effective liquid phase chromatography (HPLC) of Waters Corporation (Milford MA) buys), this chromatographic instrument uses specific refractory power (RI) detector.Use 0.01M H ₂SO ₄As moving phase, flow velocity is 0.5mL/min, and chromatogram column temperature is 50 ℃ and realizes chromatographic separation.Under employed condition, the retention time of 2-butanone and 2-butanols was respectively 39.5 and 44.3 minutes.Alternatively, also can utilize vapor-phase chromatography (GC).For example, (30mx0.53mm internal diameter, film thickness are 1 μ m, AgilentTechnologies, Wilmington, vapor-phase chromatography DE), this chromatographic instrument use flame ionization detector (FID) to utilize the HP-INNOWax chromatographic column.Carrier gas is a helium, and flow velocity is 4.5mL/min, under constant outlet pressure in 150 ℃ of measurements; 200 ℃ of following sample introduction splitting ratios are 1:25; Oven temperature was kept 1 minute at 45 ℃, rise to 45-220 ℃, kept 5 minutes at 220 ℃ then with 10 ℃/min; Helium make-up gas with 26mL/min carries out the FID detection under 240 ℃ then.The retention time of 2-butanone and 2-butanols was respectively 3.61 minutes and 5.03 minutes.

Also can be by deriving and detect 2-butanone with 3-methyl-2-[4-morpholinodithio ketone hydrazone (MBTH).The aqueous solution that will contain 2-butanone mixes in 375mM glycine-hydrochloric acid (pH2.7) with isopyknic 6mg/mLMBTH aqueous solution, and hatches 3 minutes under 100 ℃.Go up the MBTH deutero-sample of analyzing gained with moving phase (55% acetonitrile solution, flow velocity are 1mL/min) in 25cm * 4.6mm (internal diameter) Supelosil LC-18-D55 μ m chromatographic column (Supelco).The 2-butanone derivative is shown as two peaks (cis and trans-isomer(ide)), and retention time was respectively about 12.3 and 13.3 minutes, and the absorbancy maximum value is 230 and 307nm.

The connotation of abbreviation is as follows: " s " represent second, " min " expression minute, and " h " represents hour, " psi " represents pound/square inch, " nm " represents nanometer, and " d " represents the sky, and " μ L " represents microlitre, " mL " represents milliliter, " L " represents to rise, and " mm " represents millimeter, and " nm " represents nanometer, " mM " represents millimolar concentration, " M " represents volumetric molar concentration, and " mmol " represents mmole, and " μ mol " represents the micromole, " g " represents gram, " μ g " represents microgram, and " ng " represents nanogram, and " PCR " represents polymerase chain reaction, " OD " represents optical density(OD), " OD ₆₀₀" optical density(OD) that records during expression wavelength 600nm; " kDa " represent kilodalton; " g " represent gravity constant; " bp " represents base pair, and " kbp " represents that kilobase is right, and " %w/v " represents weight/volume percent; " %v/v " represents volume/volume per-cent; " wt% " represents weight percent, and " HPLC " represents high performance liquid chromatography, and " GC " represents vapor-phase chromatography.Term " mole selectivity " is the mole number of the product that generates of every mole of sugared substrate, and in per-cent.

Embodiment 1

The clone of acetolactate synthase and expression

The purpose of present embodiment is the budB gene of cloning and expressing encoding acetolactate synthase in intestinal bacteria.The budB gene is to utilize PCR to obtain from the amplification of Klebsiella Pneumoniae strains A TCC 25955 genomic dnas.

The budB sequence of encoding acetolactate synthase utilizes primer that B1 (SEQ ID NO:15) and B2 (SEQ ID NO:16) are come from the amplification of Klebsiella Pneumoniae (ATCC 25955) genomic dna by PCR.Other pcr amplification reagent is (as Kod HiFi archaeal dna polymerase (Novagen Inc., Madison, WI; Goods number 71805-3)) can from the test kit of manufacturers, obtain, and use according to the method that manufacturers provides.The Klebsiella Pneumoniae genomic dna is with Gentra Puregene Puregene test kit (Gentra Systems, Inc., Minneapolis, MN; Goods number D-5000A) preparation.(PE Applied Biosystems, Foster city carry out in CA) at DNA thermal cycler GeneAmp 9700 in amplification.The nucleotide sequence of open reading frame (ORF) and the predicted amino acid sequence of enzyme are respectively SEQ IDNO:3 and SEQ ID NO:4.

For expression study, used the Gateway clone technology (Novagen Inc., Carlsbad, CA).Entering carrier (entry vector) pENTR/SD/D-TOPO allows to carry out directed cloning and provides SD sequence for the gene of being paid close attention to.Purpose carrier pDEST14 has used the T7 promotor to be used to express marker-free.Forward primer next-door neighbour translation initiation codon place has integrated four bases (CACC), to allow budB acetolactate synthase coding region PCR product directed cloning to pENTR/SD/D-TOPO (Invitrogen), has produced plasmid pENTRSDD-TOPObudB.The pENTR construct is converted in intestinal bacteria Top10 (Invitrogen) cell, and according to the recommend method spread plate of manufacturers.Make the transformant overnight growth and use QIAprep Spin Miniprep test kit (Qiagen, Valencia, CA; Goods number 27106) recommend method according to manufacturers prepares plasmid DNA.In order to produce cloning by expression, (Invitrogen, Carlsbad CA) by vitro recombination, are transferred to the pDEST14 carrier with the budB coding region from pENTRSDD-TOPObudB to utilize LR Clonase enzyme mixture (LR Clonase mix).The carrier pDEST14budB of gained is converted in the BL-21-AI cell (Novagen Inc.).Under the control of pectinose induction type araBAD promotor, the BL-21-AI cell carries the chromosome copies of T7 RNA polymerase.

Be seeded in the LB substratum that has added 50 μ g/mL penbritins transformant and incubated overnight.The aliquots containig of overnight culture is seeded in the LB substratum that 50mL added 50 μ g/mL penbritins.At 37 ℃ of these cultures of following shaking culture, up to OD ₆₀₀Reach 0.6-0.8.Culture is divided into two 25mL parts, and pectinose is added one of them flask to final concentration is 0.2%w/v.The negative control flask is induced without pectinose.Flask vibration under 37 ℃ was hatched 4 hours.Be resuspended in 50mM MOPS, the pH7.0 damping fluid by centrifugal cell harvesting and with the cell precipitation particle.Cell can break by ultrasonication or by French press (French Pressure Cell).Each product of cell lysis is carried out centrifugal generation supernatant liquor and deposit seeds or do not dissolve part.The aliquots containig of each several part (from the whole cell lysate of inducing cell and control cells) is resuspended to SDS (MES) sample-loading buffer (Invitrogen)) in, being heated to 85 ℃ kept 10 minutes, and accept SDS-PAGE and analyze (NuPAGE 4-12% Bis-Tris gel, goods number NP0322Box, Invitrogen).There is the protein (this molecular weight is derived from nucleotide sequence and obtained) of expection molecular weight in the inducing culture thing, then do not have in the inductive object of reference.

Measure acetolactate synthase activity in cell-free extract people such as (, (1964) Biochim.Biophys.Acta92:142-149) Bauerle with the described method of people such as Bauerle.(CA) as standard, (Sigma, goods number are BCA-1 by Bradford method or Bicinchoninic test kit for Bio-Rad, Hercules with bovine serum albumin (BSA); St.Louis MO) measures protein concn.

Embodiment 2

The clone of acetolactate decarboxylase and expression

The purpose of present embodiment is the budA gene of cloning and expressing the encoding acetolactate decarboxylase in intestinal bacteria.The budA gene is to utilize round pcr, obtains from the amplification of Klebsiella Pneumoniae strains A TCC25955 genomic dna.

With with embodiment 1 in the budA sequence of the identical mode clones coding acetolactate decarboxylase of budB is described, the primer that different is is used for pcr amplification is B3 (SEQ ID NO:17) and B4 (SEQ ID NO:18).The nucleotide sequence of open reading frame (ORF) and the predicted amino acid sequence of enzyme are respectively SEQ ID NO:1 and SEQ ID NO:2.The plasmid called after pENTRSDD-TOPObudA of gained.

With the acetolactate decarboxylase activity in the method measurement cell-free extract of people such as Bauerle (the same) description.

Embodiment 3 (Deuteronomic)

The clone of butanediol dehydrogenation enzyme and expression

The purpose of this prophesy property embodiment is to describe the budC gene of how to clone and to express coding butanediol dehydrogenation enzyme in intestinal bacteria.The budC gene is to utilize PCR to obtain from the amplification of Klebsiella Pneumoniae bacterial strain IAM1063 genomic dna.

The budC sequence of coding butanediol dehydrogenation enzyme be with embodiment 1 in describe the identical mode of budA and clone and express, the primer that different is is used for pcr amplification is B5 (SEQ IDNO:19) and B6 (SEQ ID NO:20), genomic templates DNA (can derive from Institute of Applied Microbiology CultureCollection from Klebsiella Pneumoniae IAM1063, Tokyo, Japan).Klebsiella Pneumoniae IAM1063 genomic dna is with Gentra Puregene Puregene test kit (Gentra Systems company limited, Minneapolis, MN; Goods number D-5000A) preparation.The nucleotide sequence of open reading frame (ORF) and the predicted amino acid sequence of enzyme are respectively SEQ ID NO:5 and SEQ IDNO:6.

Under the 340nm absorbancy, measure the activity of butanediol dehydrogenation enzyme in the cell-free extract according to the consumptive use spectrophotometry of NADH.

Embodiment 4 (Deuteronomic)

The clone of butyleneglycol dehydratase and expression

The purpose of this prophesy property embodiment is to describe pddA, pddB and the pddC gene of how to clone and to express coding butyleneglycol dehydratase in intestinal bacteria.PddA, pddB and pddC gene are to utilize PCR to obtain from the amplification of Klebsiella oxytoca ATCC 8724 genomic dnas.

PddA, the pddB of coding butyleneglycol dehydratase and pddC sequence be with embodiment 1 in describe the identical mode of budA and clone and express, different is genomic templates DNA is from Klebsiella oxytoca ATCC 8724, and primer is B7 (SEQ ID NO:21) and B8 (SEQ ID NO:22).The Klebsiella oxytoca genomic dna is with Gentra PuregenePuregene test kit (Gentra Systems, Inc., Minneapolis, MN; Goods number D-5000A) preparation.The clone comprises the single PCR product of all three open reading frame (ORF), so that express from the single promotor on the expression plasmid as an operon all three coding regions.The predicted amino acid sequence that the nucleotide sequence of the open reading frame of three subunits is respectively SEQ IDNO:7,9 and 11, three enzyme subunits is respectively SEQ ID NO:8,10 and 12.

Measure the activity of butyleneglycol dehydratase in the cell-free extract by the ketone product of deriving with 2,4 dinitrophenyl hydrazine (DNPH).In brief, by the DNPH cancellation 100 μ L reaction mixtures that add 0.05 weight % among isopyknic 1.0N HCl, this reaction mixture contains cell extract, 40mM potassium phosphate buffer (pH 8.0), 2 μ g adenosylcobalamins, the 5 μ g 2 of about 0.0005 unit enzyme, 3-butyleneglycol and 1 μ g bovine serum albumin.After at room temperature 15 minutes, develop the color by adding 100 μ L 4N NaOH.Compare with the typical curve for preparing with 2-butanone, whole solution absorbency is determined the amount of product when being 550nm according to wavelength.Institute responds and all carries out under dark red light in 37 ℃.

Embodiment 5 (Deuteronomic)

The clone of butanols desaturase and expression

The purpose of this prophesy property embodiment is to describe the sadh gene of how to clone and to express coding butanols desaturase in intestinal bacteria.The sadh gene is to utilize PCR to obtain from the amplification of Rhodococcus ruber bacterial strain 219 genomic dnas.

The sadh sequence of coding butanols desaturase be with embodiment 1 in describe the identical mode of budA and clone and express, different is that genomic templates DNA is from Rhodococcus ruber bacterial strain 219 (Meens, Institut fuer Mikrobiologie, Universitaet Hannover, Hannover, Germany), and primer be B9 (SEQ ID NO:23) and B10 (SEQID NO:24).The Rhodococcus ruber genomic dna is to use Ultra Clean ^TMMicrobial DNA separating kit (Ultra Clean ^TMMicrobial DNA Isolation Kit) (MO BIOLaboratories Inc., Carlsbad, CA) the method preparation that provides according to manufacturers.The nucleotide sequence of open reading frame (ORF) and the predicted amino acid sequence of enzyme are respectively SEQ IDNO:13 and SEQ ID NO:14.

The activity of butanols desaturase is according to when enzyme and NAD and 2-butanols are hatched in the cell-free extract, and NAD is converted into the increase of the 340nm wavelength place absorbancy that NADH causes and measures.

Embodiment 6 (Deuteronomic)

The structure of conversion carrier that is used for the gene of 2-butanols biosynthetic pathway

The purpose of this prophesy property embodiment is to describe the preparation of the conversion carrier of the gene that is used for 2-butanols biosynthetic pathway (being above-mentioned approach 3).Similar with most of organisms, intestinal bacteria are pyruvic acid with conversion of glucose at first.By approach 3 pyruvic acid is converted into the required enzyme of 2-butanols (being acetolactate synthase, acetolactate decarboxylase, butanediol dehydrogenation enzyme, butyleneglycol dehydratase and butanols desaturase) by budA, budB, budC, pddA, pddB, pddC and sadh genes encoding.In order to simplify the structure of 2-butanols biosynthetic pathway in the recombinant organisms, the gene of five steps in this approach of coding is divided to two operons.Upstream pathway comprises by enzymatic first three step of acetolactate synthase, acetolactate decarboxylase and butanediol dehydrogenation.Downstream pathway comprises by butyleneglycol dehydratase and the catalytic latter two steps of butanols desaturase.

By round pcr amplification coding sequence, the primer of use has been integrated restriction enzyme site being used for clone afterwards, and forward primer contains the intestinal bacteria ribosome bind site (AAAGGAGG) of optimization.PCR product TOPO is cloned in the pCR4 Blunt-TOPO carrier, and transforms in the Top10 cell (Invitrogen).Plasmid DNA is from TOPO clone preparation, and check clone's PCR fragments sequence.According to the recommend method of manufacturers use Restriction Enzyme and T4 dna ligase (New England Biolabs, Beverly, MA).For cloning experimentation, (QIAquick Gel Extraction kit) (Qiagen) carries out gel-purified with restriction fragment with the QIAquick gel extraction kit.

After confirming sequence, with this coding region subclone to the pUC19 carrier of improvement as cloning platform.The pUC19 carrier digests by HindIII/SapI, then by handling with the Klenow archaeal dna polymerase to mend flat terminal the improvement.The 2.4kB carrier segments is carried out gel-purified and reconnected the 19dHS with generation pUC.Alternatively, the pUC19 carrier is handled to form flat end with the Klenow archaeal dna polymerase then and is improved by with SphI/SapI digestion.The 2.4kB carrier segments is carried out gel-purified and reconnected to produce pUC19dSS.Described digestion has removed the lac promotor of contiguous MCS (multiple clone site), and operon transcribes on the inhibition carrier.

Upstream pathway:

From the Klebsiella Pneumoniae genomic dna cloning, the primer that this PCR adopts is respectively SEQ ID NO:25 and SEQ ID NO:26 to being B11 and B12 (table 4) by PCR in the budABC coding region.Forward primer has been integrated EcoRI restriction enzyme site and ribosome bind site (RBS).Reverse primer has been integrated the SphI restriction enzyme site.The PCR product cloning is produced pCR4 Blunt-TOPO-budABC to pCR4 Blunt-TOPO.

In order to make up the upstream pathway operon, pCR4 Blunt-TOPO-budABC is digested with EcoRI and SphI, discharge the 3.2kbpbudABC fragment.The pUC19dSS carrier also with EcoRI and SphI digestion, discharges the 2.0kbp carrier segments.Utilize T4DNA ligase enzyme (New EnglandBiolabs) that budABC fragment and carrier segments are joined together to form pUC19dSS-budABC.

Downstream pathway:

The pddABC coding region from the amplification of Klebsiella oxytoca ATCC 8724 genomic dnas, produces the 2.9kbp product by PCR, and this PCR uses primer B13 and B14 (table 4), is respectively SEQ ID NO:27 and SEQ ID NO:28.Forward primer has been integrated EcoRI and PmeI restriction enzyme site and RBS.Reverse primer has been integrated the BamHI restriction enzyme site.The PCR product cloning to pCRBluntII-TOPO, is produced pCRBluntII-pdd.

The sadh gene from the amplification of Rhodococcus ruber bacterial strain 219 genomic dnas, produces the 1.0kbp product by PCR, and this PCR uses primer B15 and B16 (table 4), is respectively SEQ ID NO:29 and SEQ ID NO:30.Forward primer has been integrated BamHI restriction enzyme site and RBS.Reverse primer has been integrated the XbaI restriction enzyme site.The PCR product cloning is formed pCRBluntII-sadh to pCRBluntII-TOPO.

In order to make up the downstream pathway operon, will be from the 2.9kbp EcoRI of pCRBluntII-pdd and BamHI fragment, link together from the 1.0kbp BamHI of pCRBluntII-sadh and XbaI fragment and from the EcoRI of pUC19dHS and the big fragment of XbaI digestion.This three tunnel connection has produced pUC19dHS-pdd-sadh.

The pUC19dSS-budABC carrier with PmeI and HindIII digestion, is discharged the 3.2kbp fragment, with this fragment cloning to pBenBP (intestinal bacteria-subtilis shuttle vectors).Plasmid pBenBP produces by improvement pBE93 carrier, and Nagarajan describes (WO93/2463, embodiment 4) to some extent to this.In order to produce pBenBP, bacillus amyloliquefaciens (Bacillus amyloliquefaciens) neutral protease promotor (NPR) signal sequence and phoA gene are removed from pBE93 with NcoI/HindIII digestion.With primer BenF and BenBPR (being respectively SEQ ID NO:31 and 32) from pBE93 pcr amplification NPR promotor.Primer BenBPR has integrated BstEII, PmeI and HindIII site in the promotor downstream.The PCR product is digested with NcoI and HindIII, and with the corresponding site of fragment cloning to the carrier pBE93 to produce pBenBP.With PmeI and the HindIII site of upstream operon fragment subclone to the pBenBP, generate pBen-budABC.

The pUC19dHS-pdd-sadh carrier with PmeI and HindIII digestion, is discharged the 3.9kbp fragment, this fragment cloning is entered PmeI and the HindIII site of pBenBP, generation pBen-pdd-sadh.

Embodiment 7 (Deuteronomic)

The expression of 2-butanols biosynthetic pathway in intestinal bacteria

The purpose of this prophesy property embodiment is to describe how at expression in escherichia coli 2-butanols biosynthetic pathway.

To transform respectively among the intestinal bacteria NM522 (ATCC No.47000) by the plasmid pBen-budABC of embodiment 6 described preparations and pBen-pdd-sadh, analyze and enzyme assay is monitored expression of gene in each operon by SDS-PAGE.After confirming all expression of gene, digest pBen-budABC to discharge NPR promotor-budABC fragment with EcoRI and HindIII.Klenow fragment (New England Biolabs, goods number are M0210S) with archaeal dna polymerase is equalled endization with this fragment.Put down its end to generate linearizing flat terminal carrier segments with EcoRI digested plasmid pBen-pdd-sadh and same the benefit.Connection carrier and NPR-budABC fragment generate p2BOH.This plasmid is converted into generation intestinal bacteria NM522/p2BOH in the intestinal bacteria NM522, and the expression of monitoring gene as indicated above.

NM522/p2BOH is seeded to the 250mL that the 50mL substratum is housed shakes in the bottle, and under 35 ℃, shake with 250rpm.Substratum is made up of following material: dextrose, 5g/L; MOPS, 0.05M; Ammonium sulfate, 0.01M; Potassium primary phosphate, 0.005M; The S10 metal mixture, 1% (v/v); Yeast extract, 0.1% (w/v); Casamino acids, 0.1% (w/v); VitB1,0.1mg/L; Proline(Pro), 0.05mg/L; And vitamin H 0.002mg/L, and with the KOH titration to pH 7.0.The S10 metal mixture contains: MgCl ₂, 200mM; CaCl ₂, 70mM; MnCl ₂, 5mM; FeCl ₃, 0.1mM; ZnCl ₂, 0.1mM; Thiamine hydrochloride, 0.2mM; CuSO ₄, 172 μ M; CoCl ₂, 253 μ M; And Na ₂MoO ₄, 242 μ M.After 18 hours, with method known in the art (" general method " part is described as mentioned) by HPLC and GC analyzing and testing 2-butanols.

Embodiment 8 (Deuteronomic)

The expression of 2-butanols biosynthetic pathway in subtilis

The purpose of this prophesy property embodiment is to describe how to express 2-butanols biosynthetic pathway in subtilis.

To be converted into subtilis BE1010 (J.Bacteriol.173:2278-2282 (1991)) respectively and as expression of gene in each operon of monitoring as described in the embodiment 7 by the plasmid pBen-budABC of embodiment 6 described preparations and pBen-pdd-sadh.With EcoRI and HindIII digested plasmid pBen-budABC to discharge NPR promotor-budABC fragment.Klenow fragment (New England Biolabs, goods number are M0210S) with archaeal dna polymerase is equalled endization with this fragment.Put down its end to generate linearizing flat terminal carrier segments with EcoRI digested plasmid pBen-pdd-sadh and same the benefit.Connection carrier and NPR-budABC fragment generate p2BOH.This plasmid is transformed in the subtilis BE1010 producing subtilis BE1010/p2BOH, and the expression of monitoring gene as indicated above.

Subtilis BE1010/p2BOH is inoculated the 250mL that the 50mL substratum into is housed shake in the bottle, and under 35 ℃, shake 18h with 250rpm.Substratum is made up of following material: dextrose, 5g/L; MOPS, 0.05M; L-glutamic acid, 0.02M; Ammonium sulfate, 0.01M; Potassium phosphate buffer, 0.005M; S10 metal mixture (as described in embodiment 7), 1% (v/v); Yeast extract, 0.1% (w/v); Casamino acids, 0.1% (w/v); Tryptophane, 50mg/L; Methionine(Met), 50mg/L; And Methionin, 50mg/L, and with the KOH titration to pH7.0.After 18 hours, with method known in the art (" general method " part is described as mentioned) by HPLC and GC analyzing and testing 2-butanols.

Embodiment 9

The structure of conversion carrier that is used for the gene of 2-butanols biosynthetic pathway

The purpose of present embodiment is the recombination bacillus coli host that the gene in the 2-butanols biosynthetic pathway (being above-mentioned approach 3) is carried in preparation.Similar with most of organisms, intestinal bacteria are pyruvic acid with conversion of glucose at first.The enzyme (being acetolactate synthase, acetolactate decarboxylase, butanediol dehydrogenation enzyme and butyleneglycol dehydratase) that in the approach 3 pyruvic acid is converted into 2-butanone is by budA, budB, budC, pddA, pddB and pddC genes encoding.In the final step of this approach, the butanols desaturase is converted into the 2-butanols with 2-butanone.The desaturase of carrying out this final step is widely, and can find in many organisms.In order to simplify the structure of 2-butanols biosynthetic pathway in the recombinant organisms, the gene of 5 steps in this approach of coding is divided to a plurality of operons.The upstream pathway operon comprises by enzymatic first three step of acetolactate synthase, acetolactate decarboxylase and butanediol dehydrogenation, and this operon is cloned on the expression vector.The downstream pathway operon comprises by butyleneglycol dehydratase (comprising the reactivate factor (people such as Mori, J.Biol.Chem.272:32034 (1997))) and the catalytic latter two steps of butanols desaturase.In the catalytic process, dioldehydrase may suicide property inactivation.Understand the enzyme of reactivate inactivation by the reactivate factor protein of ddrA and ddrB (GenBank AF017781, SEQ ID NO:70) coding.DdrA and ddrB gene are in the both sides of dioldehydrase operon.Perhaps the operon of dehydratase/reactivate factor and butanols desaturase is cloned on another expression vector, perhaps is cloned into dehydratase/reactivate factor operon on another expression vector separately and last step is provided by the endogenous activity of demonstration among the host.

The structure of carrier pTrc99a-budABC:

From Klebsiella Pneumoniae ATCC 25955 genomic dnas amplification budAB coding region, generate the 2.5kbp product by round pcr, this PCR uses primer to BABC F and BABR (be respectively SEQ ID NO:33 and 34, see Table 4).Forward primer has been integrated SacI and EcoRI restriction enzyme site and ribosome bind site (RBS).Reverse primer has been integrated the SpeI restriction enzyme site.The PCR product cloning is advanced among the pCR4 Blunt-TOPO, produced pCR4Blunt-TOPO-budAB.Prepare plasmid DNA from the TOPO clone, and verify the sequence of gene with primer M13Forward (SEQ ID NO:35), primer M13 Reverse (SEQ ID NO:36), N83 SeqF2 (SEQ ID NO:37), N83 SeqF3 (SEQ ID NO:38) and N84 SeqR4 (SEQ ID NO:39) (referring to table 5).

By round pcr, be template with Klebsiella Pneumoniae ATCC 25955 genomic dnas, to BC Spe F and BC Xba R amplification budC coding region, generate the 0.8kbp product with primer, wherein the SEQ ID NO of BC Spe F and BC Xba R is respectively 40 and 41.Forward primer has been integrated SpeI restriction enzyme site, RBS, and modifies CDS by the second and the 3rd codon is changed into AAG from AAA.Reverse primer comprises the XbaI restriction enzyme site.This PCR product cloning is advanced among the pCR4 Blunt-TOPO, generated pCR4 Blunt-TOPO-budC.By TOPO clone preparation plasmid DNA, with the sequence of primer M13 Forward (SEQ ID NO:35) and primer M13 Reverse (SEQ ID NO:36) checking gene.

In order to make up the budABC operon,, discharge the 1.0kbpbudC fragment with SnaBI and XbaI digestion pCR4Blunt-TOPO-budC.With SmaI and XbaI digested vector pTrc99a people such as (, Gene69 (2): 301-315 (1988)) Amann, generate 4.2kbp linearized vector fragment.Carrier is connected with the budC fragment with generation pTrc99a-budC, and it is converted in the intestinal bacteria Top10 cell (Invitrogen).Analyze the 1.2kbp product by transformant being carried out pcr amplification, embed existing of sequence to confirm budC with primer Trc F (SEQID NO:42) and Trc R (SEQ ID NO:43).Obtain the 2.5kbp EcoRI/SpeI fragment of budAB gene from pCR4 Blunt-TOPO-budAB subclone.With EcoRI and SpeI digested vector pTrc99a-budC, and the 5.0kbp carrier segments of gained carried out gel-purified.The carrier of purifying is connected with the budAB insertion sequence, and is converted in the intestinal bacteria Top10 cell excessively.Utilize primer Trc F (SEQ ID NO:42) and N84 Seq R2 (SEQ ID NO:65), by pcr amplification screening transformant, to determine whether to produce pTrc99a-budABC.In this plasmid, bud A, B and C coding region are adjacent one another are in this order between Trc promotor and rrnB terminator sequence.

The result:

Check three of intestinal bacteria Top10/pTrc99a-budABC independently strain isolated whether produce butyleneglycol, with intestinal bacteria Top10/pCL1925-Kodd-ddr (hereinafter described) as negative control.Bacterial strain is grown in the LB substratum that contains 100 μ g/mL Pyocianils.The cell of gained is used for shaking bottle (the about 175mL of cumulative volume) inoculation, and this shakes the TM3a/ dextrose culture-medium that the bottled 125mL of having contains 100 μ g/mL Pyocianils.In addition, the flask with the inoculation of carrying pTrc99a-budABC also fills 0.4mM isopropyl ss-D-1-thiogalactoside (IPTG).TM3a/ dextrose culture-medium (every liter) contains: 10g glucose, 13.6gKH ₂PO ₄, 2.0g citric acid monohydrate compound, 3.0g (NH ₄) ₂SO ₄, 2.0g MgSO ₄7H ₂O, 0.2g CaCl ₂2H ₂O, 0.33g ferric ammonium citrate, 1.0mg VitB1 .HCl, 0.50g yeast extract and 10mL trace element solution are used NH ₄OH is adjusted to pH6.8.Trace element solution contains: citric acid .H ₂O (4.0g/L), MnSO ₄H ₂O (3.0g/L), NaCl (1.0g/L), FeSO ₄7H ₂O (0.10g/L), CoCl ₂6H ₂O (0.10g/L), ZnSO ₄7H ₂O (0.10g/L), CuSO ₄5H ₂O (0.010g/L), H ₃BO ₃(0.010g/L) and Na ₂MoO ₄2H ₂O (0.010g/L).Initial OD with about 0.03 unit ₆₀₀To inoculating, and under 34 ℃, hatch, shake with 300rpm simultaneously with the end capped flask of ventilating cover.

Induced the back about 23 hours, by HPLC (Shodex Sugar SH1011 post) and GC (HP-INNOWax), use with " general method " part in the same procedure described, 2-butanols and 2-butanone in the analysis meat soup aliquots containig.Analytical results is table 6 illustrate.Three escherichia coli clonings are acetoin and meso-2 with conversion of glucose, the 3-butyleneglycol, and this is the desired intermediate product of this approach, the mole selectivity is 14%.Viewed selectivity is high about 35 times in the intestinal bacteria control strain of this selectivity ratios shortage budABC.

Table 6

Intestinal bacteria Top10/pTrc99a-budABC

The acetoin and the meso-2 that produce, the 3-butyleneglycol

Bacterial strain	OD 600	Acetoin, mM	Meso-2,3-butyleneglycol, mM	The mole selectivity a，％
Negative control	1.4	0.07	0.03	0.4
Strain isolated #1	1.5	0.64	1.3	14
					Strain isolated #2	1.4	0.70	1.2	14
Strain isolated #3	1.4	0.74	1.3	15

^aMole selectivity=(acetoin+meso-2,3-butyleneglycol)/(glucose of consumption).

The structure of carrier pL1925-KoDD-ddr:

Utilize primer DDo For (SEQ ID NO:44) and DDoRev (SEQ ID NO:45), with dioldehydrase (GenBank D45071, SEQ ID NO:69) and the reactivate factor (GenBank AF017781, SEQ ID NO:70) operon as single unit from Klebsiella oxytoca ATCC 8724 pcr amplifications.Forward primer has been integrated intestinal bacteria RBS and the HindIII restriction enzyme site optimized.Reverse primer comprises the XbaI restriction enzyme site.5318bp PCR product cloning is advanced among the pCR4Blunt-TOPO, and the pCR4Blunt-TOPO-Kodd-ddr of gained clone checked order, the primer is M13 Forward (SEQ ID NO:35), M13 Reverse (SEQ ID NO:36), DDko seq F2 (SEQID NO:46), DDko seq F5 (SEQ ID NO:47), DDko seq F7 (SEQ IDNO:48), DDko seq F9 (SEQ ID NO:49), DDko seq R1 (SEQ ID NO:50), DDko seq R3 (SEQ ID NO:51), DDko seq R7 (SEQ ID NO:52) and DDko seq R10 (SEQ ID NO:53).Identified clone with the inset that contains expected sequence.

For expressing, dioldehydrase/reactivate factor gene subclone is advanced among the pCL1925 (U.S. Patent No. 7,074,608), pCL1925 is a kind of low copy plasmid that carries the grape sugar isomerase promotor that derives from streptomyces (Streptomcyes).Digest pCR4Blunt-TOPO-Kodd-ddr with HindIII and XbaI, and the 5.3kbp Kodd-ddr fragment of gained is carried out gel-purified.With HindIII and XbaI digested vector pCL1925, and the 4539bp carrier segments of gained carried out gel-purified.Connection carrier and Kodd-ddr fragment, and it is transformed among the intestinal bacteria Top10.Utilize primer DDko Seq F7 (SEQ ID NO:48) and DDko seqR7 (SEQ ID NO:52) by round pcr screening transformant.The product of the about 797bp of plasmid (pCL1925-Kodd-ddr) generation of this inset is carried in amplification.

By at room temperature in 80mM HEPES (pH8.2) with cell extract (gross protein is～0.8mg/mL) with 10mM butyleneglycol and 12mM coenzyme B ₁₂Hatch 17h, measure dioldehydrase to meso-2, the activity of 3-butyleneglycol.The formation of passing through the definite expection of HPLC product 2-butanone described in " general method ".

The structure of carrier pCL1925-KoDD-ddr::T5 chnA ter:

The activity of allos ethanol dehydrogenase is provided, to be cloned in the pCL1925 carrier with dioldehydrase operon pCL1925-Kodd-ddr from the chnA gene (people such as Cheng, J.Bacteriol.182:4744-4751 (2000)) of acinetobacter calcoaceticus coding collar hexanol desaturase.With primer ChnA F (SEQ ID NO:54) and ChnA R (SEQ ID NO:55) from pDCQ2 (carrying the clay of hexalin gene cluster from acinetobacter calcoaceticus) amplification chnA gene (SEQ IDNO:71 (GenBank No:AF282240, SEQ ID NO:73)).In pCR4Blunt-TOPO and produce pCR4Blunt-TOPO-chnA, and utilize primer M13 Forward (SEQ ID NO:35) and primer M13 Reverse (SEQID NO:36) to screen transformant the 828bpPCR product cloning of gained by bacterium colony PCR.Correct clone produces the PCR product of about 1kbp, and checks order with primer M13Forward (SEQ ID NO:35) and primer M13 Reverse (SEQ ID NO:36).

PCR4Blunt-TOPO-chnA is checked order with after confirming that sequence is correct the MfeI/SmaI fragment of the 813bp of subclone chnA gene from plasmid.Digest expression vector pQE30 (Qiagen) with MfeI and SmaI, and the 3350bp carrier segments of gained is carried out gel-purified.The carrier of chnA fragment and purifying is connected, and is transformed in the intestinal bacteria Top10 cell.At the PCR product of 494bp, transformant is carried out bacterium colony PCR screening with primer chnSeq F1 (SEQ ID NO:56) and chnseqR1 (SEQ ID NO:57).This clone the chnA gene is placed under the T5 promotor control of plasmid pQE30-chnA.

Prepare the pCL1925 carrier that carries two operons, add terminator to this carrier.Utilize primer Top ter F1 (SEQ ID NO:58), Top ter F2 (SEQ ID NO:59), Bot ter R1 (SEQ ID NO:60) and Bot ter R2 (SEQ ID NO:61) to prepare tonB terminator-mcs-trpA terminator fragment by oligonucleotide annealing.(Embi-tec, San Diego carry out gel-purified on CA) at the 6%PAGE gel with annealed DNA.With SacI and XbaI digested vector pCL1925 and carry out gel-purified.Connect annealed DNA and carrier segments to generate pCL1925-ter.By adopting the colony PCR amplification of primer pCL1925 vec F (SEQ ID NO:62) and pCL1925 vec R1 (SEQ ID NO:63), screen transformant at the existence of the PCR product of about 400bp.Utilizing identical primer that PCR is screened resulting positive colony checks order.

With XhoI and PmeI digested vector pCL1925-ter, the 4622bp fragment of gained is carried out gel-purified.Digest pQE30-chnA with NcoI, and it is flat terminal to produce to handle this DNA with the Klenow archaeal dna polymerase.Digest pQE30-chnA with XhoI then, and T5 promotor-chnA fragment of the 1.2kbp of gained is carried out gel-purified.PCL1925-ter carrier and chnA operon fragment are linked together with generation pCL1925-ter-T5chnA, and it is transformed among the intestinal bacteria Top10.By adopting the colony PCR amplification of primer pCL1925 vec F (SEQ ID NO:64) and chnseq R1 (SEQ ID NO:59), at the product screening transformant of about 1kbp.

Finish the structure of approach carrier, digest the pCL1925-KoDD-ddr plasmid with XbaI and SacI, and the 9504bp carrier segments of gained is carried out gel-purified.To have the chnA operon (people such as Koichi of terminator from pCL1925-ter-T5chnA, both sides, (1997) Volume 272, Number 51, and pp.32034-32041) (the trpA terminator is positioned at 3 ' end of chnA encoding sequence) is the XbaI/SacI fragment of 1271bp by gel-purified.Junction fragment and be transformed among the intestinal bacteria Top10 after, PCR screens transformant by bacterium colony.In the plasmid pCL1925-KoDD-ddr::ter-T5chnA of gained, amplify the 1107bp PCR product of expection with primer chnSeq F1 (SEQ ID NO:58) and pCL1925 vec R2 (SEQ ID NO:64).

Embodiment 10

The table of 2-butanols biosynthetic pathway in crossing the intestinal bacteria of expressing the endogenous alcoholdehydrogenase Reach

The purpose of present embodiment is to express 2-butanols biosynthetic pathway in several coli strains.

The structure of the coli strain of constitutive expression yqhD:

Intestinal bacteria contain natural gene (yqhD), and this natural gene is accredited as 1, ammediol desaturase (U.S. Patent No. 6,514,733).Gene adh B (may be NADH dependent form butanols desaturase) in yqhD gene (SEQ ID NO:74) and the fusobacterium has 40% identity.Adopt λ Red technology (Datsenko and Wanner, Proc.Natl.Acad.Sci.U.S.A.97:6640 (2000)) the yqhD gene to be placed under the constitutive expression of glucose isomerase promotor 1.6GI (SEQ ID NO:67) variant of coli strain MG1655 1.6yqhD::Cm (WO 2004/033646).Similarly, (SEQ ID NO:68) replaces this natural promoter with 1.5GI promotor (WO 2003/089621), produces bacterial strain MG1655 1.5yqhD::Cm, thereby, replaced the 1.6GI promotor of MG1655 1.6yqhD::Cm with the 1.5GI promotor.1.5GI and the difference of 1.6GI promotor is the 1bp in-35 districts, changed the intensity (WO 2004/033646) of promotor thus.When replacing natural yqhD promotor with 1.5GI or with the 1.6GI promotor, the yqhC gene of the transcription regulaton factor of inferring of coding yqh operon is deleted.Adopt the method for knowing in this area to confirm the activity of butanols desaturase by the enzyme detection method.

The conversion of coli strain:

With the approach plasmid pCL1925-Kodd-ddr that describes among the embodiment 9 and pTrc99a-budABC cotransformation in coli strain MG1655, MG1655 1.6yqhD and MG1655 1.5yqhD.The two kinds of bacterial strains in back are crossed and are expressed 1, ammediol desaturase (YqhD), and this desaturase also has the butanols dehydrogenase activity.Substantially as mentioned above check whether bacterial strain produces 2-butanone and 2-butanols.Seed cells into be equipped with 50 or 150mL TM3a/ dextrose culture-medium (contain the 0.1mg/L vitamins B ₁₂, suitable microbiotic and IPTG) shake bottle (cumulative volume is approximately 175mL) to show medium oxygen and hypoxia condition respectively.Spectinomycin (50 μ g/mL) and Pyocianil (100 μ g/mL) are respectively applied for plasmid pCL1925-Kodd-ddr and pTrc99a-budABC.With initial OD ₆₀₀≤ 0.04 unit to shaking bottle, hatches colony inoculation under 34 ℃ with the 300rpm vibration.The bottle cap that shakes that fills the 50mL substratum has vent cap; The bottle that shakes that fills the 150mL substratum has airproof lid at utmost to reduce air inerchange.When time point zero, add concentration and be 0 or the IPTG of 0.04mM.The analytical results that 2-butanone and 2-butanols produce is shown in the table 7.All coli strains that comprise 2-butanols biosynthetic pathway have produced 2-butanone under hypoxemia and medium oxygen condition, and have produced the 2-butanols under hypoxia condition.

Table 7

With the large intestine bar that contains approach plasmid DCL1925-Kodd-ddr and pTrc99a-budABC Bacterium MG1655 bacterial strain produces 2-butanone and 2-butanols

Bacterial strain a，b	IPTG.mM	Culture volume, mL	2-butanone, mM	The 2-butanols, mM
MG1655 #
	1	0	50	0.08	Do not detect
MG1655 #2						0	50	0.11	Do not detect
	MG1655 #1	0.04	50	0.12	Do not detect
MG1655 #2						0.04	50	0.11	Do not detect
	MG1655 #1	0	150	0.15	0.047
MG1655 #2						0	150	0.19	0.041
	MG1655 #1	0.04	150	0.10	0.015
MG1655 #2						0.04	150	0.11	0.015
MG1655 1.5yqhD #1						0	50	0.10	Do not detect

MG1655 1.5yqhD #2	0	50	0.07	Do not detect
					MG1655 1.5yqhD #1	0.04	50	0.12	Do not detect
MG1655 1.5yqhD #2	0.04	50	0.18	Do not detect
					MG1655 1.5yqhD #1	0	150	0.16	0.030
MG1655 1.5yqhD #2	0	150	0.18	0.038
					MG1655 1.5yqhD #1	0.04	150	0.10	0.021
MG1655 1.5yqhD #2	0.04	150	0.09	0.017
MG1655 1.6yqhD #1	0	50	0.08	Do not detect
					MG1655 1.6yqhD #2	0	50	0.07	Do not detect
MG1655 1.6yqhD #1	0.04	50	0.12	Do not detect
					MG1655 1.6yqhD #2	0.04	50	0.15	Do not detect
MG1655 1.6yqhD #1	0	150	0.17	0.019
					MG1655 1.6yqhD #2	0	150	0.18	0.041
MG1655 1.6yqhD #1	0.04	150	0.11	0.026
					MG1655 1.6yqhD #2	0.04	150	0.11	0.038
					Contrast (nonvaccinated substratum)			Do not detect	Do not detect

^a#1 and #2 represent independently strain isolated.

^bMG1655 is MG1655/pCL1925-Kodd-ddr/pTrc99a-budABC

MG1655 1.6yqhD is MG1655 1.6yqhD/pCL1925-Kodd-ddr/pTrc99a-budABC

MG1655 1.6yqhD is MG1655 1.5yqhD/pCL1925-Kodd-ddr/pTrc99a-budABC.

Embodiment 11

The expression of 2-butanols biosynthetic pathway in intestinal bacteria with allos ethanol dehydrogenase

As described in example 9 above, plasmid pCL1925-KoDD-ddr::ter-T5chnA and pTrc99a-budABC are transformed in coli strain MG1655 and the MG1655 Δ yqhCD to be used to verify the generation of 2-butanols.

MG1655 Δ yqhCD carries the yqhCD of inactivation, and the yqhCD of inactivation is method (Proc.Natl.Acad.Sci.U.S.A.97 (12): 6640-6645 (the 2000)) preparation that utilizes Datsenko and Wanner.After the FRT-CmR-FRT box displacement that will distinguish with pKD3, remove the chlorampenicol resistant mark with the FLP recombinase.The sequence in disappearance zone is decided to be SEQ ID NO:66.

Substantially as stated above, check that the 2-butanone of bacterial strain MG1655/pTrc99a-budABC/pCL1925KoDD-ddr::ter-T5 chnA and MG1655 Δ yqhCD/pTrc99a-budABC/pCL1925KoDD-ddr::ter-T5 chnA and 2-butanols produce.Bacterial strain MG1655 Δ yqhCD/pCL1925 is as negative control.With cell inoculation be equipped with 50 or 150mL TM3a/ dextrose culture-medium (added the 0.1mg/L vitamins B ₁₂With suitable microbiotic) shake the bottle (cumulative volume is approximately 175mL) in to show medium oxygen and hypoxia condition respectively.Spectinomycin (50 μ g/mL) and penbritin (100 μ g/mL) are respectively applied for plasmid and the pTrc99a-budABC of screening based on pCL1925.The enzymic activity that comes from pTrc99a-budABC is to detect by enzyme assay under the situation that does not have the PTG inductor, thereby, do not add IPTG in the substratum.With initial OD ₆₀₀24h to shaking in the bottle, is hatched with the 300rpm vibration with colony inoculation in≤0.01 unit under 34 ℃.The bottle cap that shakes that fills the 50mL substratum has vent cap; The bottle cap that shakes that fills the 150mL substratum has airproof lid at utmost to reduce air inerchange.The analytical results that 2-butanone and 2-butanols produce is shown in the table 8.Two kinds of coli strains that comprise 2-butanols biosynthetic pathway all produce 2-butanone under hypoxemia and moderate oxygen condition, and produce the 2-butanols under hypoxia condition.

Table 8

2-butanone and 2-butanols by the coli strain generation

Bacterial strain a	Volume, mL	2-butanone, mM	The 2-butanols, mM
Negative control, MG1655 Δ yqhCD/pCL1925	50	Do not detect	Do not detect
				MG1655/pTrc99a- budABC/pCL1925KoDD-ddr::T5chnA ter	50	0.33	Do not detect
MG1655Δyq hCD/pTrc99a- budABC/pCL1925KoDD-ddr::T5chnA ter #1	50	0.23	Do not detect
				MG1655 ΔyqhCD/pTrc99a- budABC/pCL1925KoDD-ddr::T5chnA #2	50	0.19	Do not detect
				Negative control, MG1655 Δ yqhCD/pCL1925	150	Do not detect	Do not detect
MG1655/pTrc99a- budABC/pCL1925KoDD-ddr::T5chnA ter	150	0.41	0.12
				MG1655 ΔyqhCD/pTrc99a- budABC/pCL1925KoDD-ddr::T5chnA #1	150	0.15	0.46
MG1655 ΔyqhCD/pTrc99a- budABC/pCL1925KoDD-ddr::T5chnA #2	150	0.44	0.14
Substratum		Do not detect	Do not detect

^a#1 and #2 represent independently strain isolated.

Embodiment 12

Amino: the clone of pyruvic acid transaminase (APT)

Amino from vibrio fluvialis JS17: pyruvic acid transaminase (APT) is identified (Appl.Microbiol Biotechnol. (2003) 61:463-471) by people such as Shin.Find the aminoacid sequence (SEQ ID NO:122) and the amino acid of this enzyme: the pyruvic acid transaminase has significant homology (Shin and Kim (J.Org.Chem.67:2848-2853 (2002)).This shows that vibrio fluvialis APT has transaminase activity to acetoin.

In order to make the APT enzyme at expression in escherichia coli, utilize preferred codon of intestinal bacteria and other consideration (for example stability of codon balance and mRNA), the APT coding region (SEQ ID NO:144) that pin design is optimized, and synthetic (synthetic by DNA2.0; RedwoodCity, CA).Coding region dna fragmentation subclone between the NcoI and HindIII site of pBAD.HisB carrier (Invitrogen), and is transformed into the plasmid (pBAD.APT1 hereinafter referred to as) of gained in the TOP10 cell.

Embodiment 13

Vibrio fluvialis APT L-Ala: the sign of acetoin transaminase activity

The fresh colony inoculation of TOP10/pBAD:APT1 cell is contained in the LB meat soup of 100 μ g/mL penbritins to 5mL.Culture is hatched about 16h at 37 ℃ vibrate down (225rpm).The aliquots containig of 300 these cultures of μ L is used to inoculate the identical substratum of 300mL, substratum is vibrated down at 37 ℃ hatch (225rpm).OD when culture ₆₀₀Reach at 0.8 o'clock, adding L-arabinose to final concentration is 0.2% (w/v).Culture is hatched 16h in addition, then results.With cell once, freezing then and preservation under-80 ℃ with 100mM potassium phosphate buffer (pH7.8) washing.

Separate enzyme, then cell granulations is thawed and be resuspended in the 8mL100mM potassium phosphate buffer (pH7), contain 0.2mM ethylenediamine tetraacetic acid (EDTA), 1mM dithiothreitol (DTT) and a slice protease inhibitor cocktail (Roche in the damping fluid; Indianapolis, IN).Make lysis by the French press under the 6.2MPa (900psi) twice, and the split product of gained is clarified by centrifugal 30min under 17000 * g.The saturation ratio that adds ammonium sulfate to 35%, and stirred solution 30min at room temperature, this moment, (30min, 17000 * g) shifted out the precipitation solid substance by centrifugal.It is saturated to add extra ammonium sulfate to 55% in supernatant liquor, at room temperature stirred solution 30min once more.(30min, 17000 * g) shift out the precipitation solid substance, are resuspended in then in the 100mM potassium phosphate buffer (pH7) that 5mL contains 10 μ M 5 '-pyridoxal phosphates and 1mM dithiothreitol (DTT) by centrifugal.This solution is carried out desalination by using buffer A (50mM bis-tris propane damping fluid (pH6) contains 10 μ M 5 '-pyridoxal phosphates and 1mM dithiothreitol (DTT)) equilibrated PD10 post.Then with sample on the extract after the desalination in the 20mL Q-Fast Flow post of crossing with the buffer A pre-equilibration.Linear gradient elution APT with 0-0.1MNaCl in the buffer A.Protein band by about 8.3E-20g (50kD) of when analyzing, existing and detect enzyme in the elutriated fraction by the characteristic absorbancy under the 418nm with polyacrylamide gel electrophoresis.The fraction that contains described enzyme is wash-out when about 0.3M NaCl.Merge the 5.45mg/mL enzyme solution that these fractions obtain cumulative volume 6mL, judge this enzyme purity by polyacrylamide gel electrophoresis 90%.

The L-Ala of APT: the acetoin transaminase activity adopts serum lactic dehydrogenase coupling assay method to measure.Reaction mixture contains 100mM bis-tris propane (pH 9.0), 10 μ M, 5 '-pyridoxal phosphate, 0-50mM acetoin, 0-5mM _L-L-Ala, 0.14 or enzyme, 200 μ M NADH and the 20U/mL serum lactic dehydrogenase (Sigma of 0.28mg/mL purifying; St.Louis, MO).After the reaction, measure the variation of 340nm place absorbancy, indicate the oxidation of NADH with this.Under these conditions, the k of acetoin _Cat/ K _mBe 10M ^-1s ^-1, the kcat/Km of L-L-Ala is 400M ^-1s ^-1

The identity of expection product 3-amino-2-butanols is by relatively coming to determine with the synthetic standard substance.With people's such as Dickey method synthetic (R, R)-and (S, S)-mixture [Amer Chem Soc74:944 (1952)] of 3-amino-2-butanols: 5g is trans-2, and the 3-butylene oxide ring stirs lentamente and adds to cold (4 ℃) NH of 150mL ₄Among the OH.Reactant slowly is warming up to room temperature, and sealing was also at room temperature stirred 10 days in addition.At this moment, under 40 ℃ vacuum condition, remove excess of ammonia and water and residual butylene oxide ring by rotary evaporation.With the clarification oily matter (2.9g) of gained be resuspended in the water to concentration be 10% (w/v).Analyze and compare to determine the generation of product by NMR with the NMR spectrum [Org.Magnetic Resonance14:214 (1980)] of people's report such as Levy.With identical method synthetic corresponding (2R, 3S)-and (2S, 3R)-isomer mixture, different is with the cis-isomeride of 2,3 butylene oxide rings as raw material.

According to Roth report be used to measure amino acid whose o-phthalaldehyde(OPA) derivatization method [Anal.Chem.43:880 (1971)] and developed the analytical procedure that detects 3-amino-2-butanols.1mM 3-amino-2-butanols (isomer mixture) aliquots containig of 200 μ L is mixed with 200 μ L 50mM borate solutions (pH9.5), add 5 μ L/mL 2 mercapto ethanols in the 10 μ L ethanol and the 10mg/mLo-o-phthalaldehyde(OPA) in the 10 μ L ethanol to it.Solution is hatched 10min under room temperature, at that time derivative is extracted in the 200 μ L hexanes.By decantation hexane is separated from the aqueous solution, and 10 μ L are injected to Chiracel OD HPLC post (Daicel Chemical Industries; FortLee, NJ).Hexane with 90:10: Virahol moving phase is annotated by chromatogram with the flow velocity of 1mL/min.Arrived the derivatize isomer of 3-amino-2-butanols by the absorbance detection at the 340nm place, retention time is about 15.7 and 16.8min[(2S, 3S) and (2R, 3R)], and 18.4 and 21.9min[(2R, 3S) and (2S, 3R)].In order to distinguish the enantiomorph in first mixture, also under the same conditions to (2R, 3R) isomer (the Bridge Organics of purifying; Vicksburg MI) carries out stratographic analysis, and finds it is the peak of 16.8min.In order to distinguish the isomer in second mixture, at first utilize L-Ala: the acetoin transaminase is carried out kinetic resolution to mixture: with enzyme and the 10mM pyruvic acid in the 1mL 100mM bis-tris propane (pH9.0) and 10mM3-amino-2-the butanols [(2R of 0.28mg purifying, 3S) and (2S, 3R) the 1:1 mixture of isomer] hatch.Behind the 24h, shift out aliquots containig and analyze as mentioned above under the room temperature.Analysis revealed, the peak of 18.4min has reduced 95%, and the peak of 21.9min surpasses 90% remain.The aliquots containig of 100 μ L residue reaction mixture and 50 μ L 20mM NADH and 10 μ L are mixed from the extract of the TOP10/pTrc99a-BudC bacterial strain described in the embodiment 9.The BudC enzyme is known to be reduced to meso-2 with (R)-acetoin, the 3-butyleneglycol, and can make (S)-acetoin be reduced to (S, S)-2,3-butyleneglycol [people such as Ui, (2004) Letters in AppliedMicrobiology39:533-537].Behind the 3h, take out sample and analyze acetoin and butyleneglycol as mentioned above from reactant.Analysis revealed, main reduzate are mesos-2, the 3-butyleneglycol, and (the R)-acetoin that illustrates that the product of transamination reaction is, therefore the 3-amino-2-butanols that consumes is (2R, 3S) isomer.Thereby retention time 18.4min can be classified as this isomer, and 21.9min can be classified as (2S, 3R) isomer.

In order to confirm the catalytic L-Ala of APT: the product of acetoin transamination reaction is 3-amino-2-butanols, with 10mM acetoin, the 10mM in pure enzyme of 0.28mg and the 1mL100mM bis-tris propane (pH9.0) _L-L-Ala, 50U serum lactic dehydrogenase and 200 μ M NADH are hatched.Reaction mixture is at room temperature hatched 20h, shift out 200 μ L aliquots containigs and derivatize as mentioned above then.The retention time of derived products is respectively 15.8min (primary product) and 18.5min (secondary product), with (2S, 3S)-and (2R, 3S)-retention time of 3-amino-2-butanols standard model conforms to.

Embodiment 14

The amino alcohol kinases and the amino alcohol O-phosphoric acid ester of the black shin subspecies of carrot soft rot Erwinia are split Separate the evaluation and the clone of enzyme

The purpose of this embodiment is to describe the sequence of how to identify and to clone from the coding amino alcohol kinases and the amino alcohol O-phosphoric acid ester lyase of bacterium carrot soft rot Erwinia.These two kinds of enzymes are in the approach 1 3-amino-2-butanols to be converted into the part of 2-butanone through intermediate product 3-amino-2-butanols phosphoric acid ester, as shown in Figure 1.

The prediction of Erwinia amino alcohol kinases and amino alcohol O-phosphoric acid ester lyase

ATP dependent form amino alcohol kinases and amino alcohol O-phosphoric acid ester lyase activity are detected in the bacterial classification of several Rhodopseudomonass and erwinia, comprise pseudomonas P6NCIB10431), pseudomonas putida NCIB 10558 (people such as Jones, (1973) Biochem.J.134:167-182), carrot soft rot Erwinia, pineapple Erwinia (Erwinia amanas), Yunnan Caulis Spatholobi Erwinia (Erwina milletiae) and potato are deceived shin Erwinia (Erwiniaatroseptica) (people such as Jones, (1973) Biochem.J.134:959-968).In these researchs, the extract of above-mentioned bacterial classification shows to have the activity that aminopropanol is converted into propionic aldehyde and thanomin is converted into acetaldehyde via thanomin O-phosphoric acid ester via aminopropanol O-phosphoric acid ester.

It is reported that the gene order that exists above-mentioned active potato to deceive shin Erwinia bacterial strain (existing called after carrot soft rot Erwinia black shin subspecies bacterial strain SCRI1043 (ATCC BAA-672)) carried out measuring (people such as Bell, Proc.Natl.Acad.Sci.USA101 (30): 11105-11110) at Sanger Institute.The kinase gene of analyzing in the black shin subspecies genome of carrot soft rot Erwinia of inferring has been found an operon sequence (SEQ ID NO:275), its coding infer albumen (ECA2059; SEQ ID NO:124) homoserine kinase with Root or stem of Littleleaf Indianmulberry root nodule bacterium (Rhizobiumloti) has 39% homology, the 3rd class pyridoxal phosphate (PLP) dependent form transaminase (ECA2060 of coding; SEQ ID NO:126) with from the transaminase of inferring of rhizobium melioti (Rhizobium meliloti) has 58% homology.Estimate that ECA2059 is a kind of amino alcohol kinases, ECA2060 is the amino alcohol O-phosphoric acid ester lyase of a kind of PLP of utilization as cofactor.

Carrot soft rot Erwinia is deceived inferring the amino alcohol kinases and inferring amino alcohol O-of shin subspecies The clone of phosphoric acid ester lyase

The genomic dna that carrot soft rot Erwinia is deceived shin subspecies (ATCC #:BAA-672D) can derive from U.S. typical case DSMZ (ATCC).The amino alcohol kinases (KA) that coding is inferred and operon called after KA-AT (the SEQID NO:275 of amino alcohol O-phosphoric acid ester lyase (AT).With Phusion archaeal dna polymerase (Finnzymes; New England Biolabs; Ipswich, MA) from erwinia genomic dna this operon sequence that increases, amplimer is OT872 (SEQ.ID:127) and OT873 (SEQID:128).React the gene fragment that obtains 2.4kb by PCR, it is corresponding to the size of KA-AT operon.With EcoRI and PstI digestion with restriction enzyme PCR product, and be cloned into pKK223-3 carrier (the Amersham Biosciences that digests with the same restrictions restriction endonuclease; Piscataway, NJ) in.This has produced plasmid pKK223.KA-AT, and it contains the erwinia amino alcohol kinases-lyase operon sequence of inferring that is under the control of tac promotor.Similarly, prepare plasmid pKK223.KA and pKK223.AT, wherein erwinia kinases of inferring and the erwinia lyase coding region of inferring have been placed independently carrier, all be in the control of tac promotor down.PCR clone for KA coding region (SEQ ID NO:123) has used primer OT872 (SEQID:127) and OT879 (SEQIDNo.129); And clone for the PCR of AT coding region (SEQID NO:125), in pcr amplification, having used primer OT873 (SEQ.ID:128) and OT880 (SEQID:130), the PCR product of generation is respectively 1.1kb and 1.3kb.Every kind of PCR product is digested with EcoRI and PstI, and connect to advance among the carrier pKK223-3 to produce pKK223.KA and pKK223.AT.

Derive from inferring the amino alcohol kinases and inferring ammonia of the black shin subspecies of carrot soft rot Erwinia The activity in vivo of the pure O-phosphoric acid ester lyase of base

Plasmid pKK223.KA-AT, pKK223.KA, pKK223.AT and pKK223-3 are converted in the intestinal bacteria MG1655 bacterial strain.Streak inoculation is to MOPS minimum medium flat board once more with transformant, and this minimum medium contains 1% glucose, 0.5% aminopropanol (as single nitrogenous source), 1mM IPTG and 100 μ g/mL penbritins.Induce KA-AT, KA and AT expression of gene with IPTG.Do not contain IPTG in the contrast flat board.Flat board was cultivated 7 days down in 37 ℃.Containing on the flat board of IPTG, MG1655/pKK223.KA-AT strain growth only, other three kinds of bacterial strains are failed growth.Grown the MG1655/pKK223.KA-AT bacterial strain in the flat board of no IPTG, but bacterium colony is significantly less than those bacterium colonies on the flat board that contains IPTG, this is lower corresponding to KA in the inducible strain cell not and AT expression level.Other three kinds of bacterial strains also fail to grow on flat board.This shows that the erwinia KA that infers and the coexpression of AT gene provide enough enzymic activitys, and this activity makes coli strain MG1655/pKK223.KA-AT can utilize aminopropanol as unique nitrogenous source.The expression of every kind of independent KA enzyme or AT enzyme is not enough to produce in vivo such enzymic activity.

Embodiment 15

The external work of amino alcohol kinases that erwinia is inferred and amino alcohol O-phosphoric acid ester lyase The property

With erwinia KA-AT operon subclone in the pBAD.HisB carrier and induce egg White matter is expressed

Adopt the SDS-PAGE analytical method, analyzed in the MG1655 cell from the KA that infers of the erwinia of pKK223.KA-AT vector expression and the protein expression level of AT enzyme.The expression level of Erwinia AT enzyme is relatively low, and detects the new protein band that correct molecular weight is 7.8E-20g (46kD) in the solvable fraction of cell extract, and does not detect the new protein band quite big or small with the KA enzyme of expecting.

In order to improve KA and the AT expression of gene that erwinia is inferred, KA-AT operon subclone is entered EcoRI and the HindIII site of carrier pBAD.HisB-EcoRI.By using primer OT909 (SEQ ID #131) and OT910 (SEQ ID #132), via QuickChange site-directed mutagenesis (Stratagene, LaJolla, CA) usefulness EcoRI replaces in the site NcoI site among the pBAD.HisB, and deriving from pBAD.HisB carrier (Invitrogen) obtains pBAD.HisB-EcoRI.In the plasmid pBAD.KA-AT that makes up, the KA-AT operon is directly placed under the control of araB promotor (not having histidine-tagged).

The pBAD.KA-AT plasmid is transformed in the intestinal bacteria TOP10 bacterial strain.With the 50mL culture of TOP10/pBAD.KA-AT strain in the LB substratum that contains 100 μ g/mL penbritins under 37 ℃ with the 250rpm shaking culture to mid-log phase (OD ₆₀₀=0.6).By adding L-arabinose, and under 37 ℃, further hatch 5h, then by centrifugal results culture to final concentration 0.1% (w/v) inducing culture thing.Cell granulations is resuspended in ice-cold 50mM Tris-HCl (among the pH8.0), and with Fischer Sonic 300 type Dismembrator (Fischer, Pittsburgh, PA) with 50% power, at ultrasonication cell on ice, each circulation was carried out supersound process 30 seconds, stopped 60 seconds between each circulation, repeated four circulations.With every kind of sample centrifugal (15,000 * g, 4 minutes, 4 ℃) through supersound process.Clarifying cell-free extract is analyzed its protein expression level and amino alcohol O-phosphoric acid ester lyase activity.

The chemosynthesis of amino butanol O-phosphoric acid ester and aminopropanol O-phosphoric acid ester

The synthetic substrate of method of the method by being used for phosphorylethanolamine based on Ferrari and Ferrari report (United States Patent (USP) 2730542[1956]) (R, R)-3-amino-2-butanols O-phosphoric acid ester: with the 10mmol H in 50% (w/v) aqueous solution ₃PO ₄With (R, R)-3-amino-2-butanols (BridgeOrganics; Vicksburg, 50% (w/v) aqueous solution MI) is stirring simultaneously on ice.Behind the mixing, solution slowly is warming up to room temperature, and under vacuum condition, stirs then and be heated to 70 ℃.Behind 70 ℃ of following 1h, temperature is increased to 185 ℃ and keep other 2h lentamente.Then, reaction is cooled to room temperature, and discharges vacuum.Surplus materials is soluble in water, and by the NMR analysis revealed, 80% feedstock conversion becomes product, 20% unreacted is still arranged.Do not observe extra product.

By same method, with (2R, 3S)-3-amino-2-butanols and (2S, 3R)-the 1:1 mixture of 3-amino-2-butanols (as synthetic as described in the embodiment 13) is as raw material, synthetic other substrate (2R, 3S)-3-amino-2-butanols O-phosphoric acid ester and (2S, 3R)-3-amino-2-butanols O-phosphoric acid ester.After the same method, with DL-1-amino-2-propyl alcohol, (R)-2-amino-1-propyl alcohol or (S)-2-amino-1-propyl alcohol is as raw material, synthetic DL-1-amino-2-propyl alcohol O-phosphoric acid ester, (S)-2-amino-1-propyl alcohol O-phosphoric acid ester and (R)-2-amino-1-propyl alcohol O-phosphoric acid ester.

Aminopropanol O-phosphoric acid ester lyase by the erwinia KA-AT operon coding of inferring Active analysis

Aminopropanol O-phosphoric acid ester lyase assay method according to people such as Jones (1973, Biochem.J.134:167-182) and described the carrying out of people (1995, Chromatographia 40:336) such as G.Gori.Measure by colorimetric analysis with MBTH (it makes that can detect aldehyde forms) form propionic aldehyde from aminopropanol O-phosphoric acid ester.This reaction is following to be carried out.In the 1mL reactant, the cell-free extract of 100 μ g intestinal bacteria TOP10/pBAD.KA-AT is added in 10mM DL-1-amino-2-propyl alcohol O-phosphoric acid ester among the 100mMTris-HCl (pH7.8), have 0.1mM PLP among this Tris-HCl.Reactant was hatched under 37 ℃ 10 minutes and 30 minutes, shift out 100 μ L reaction mixture aliquots containigs, and it is mixed with 6mg/mL MBTH among 100 μ L 375mM glycine-HCl (pH 2.7) at each time point.This mixture was hatched 3 minutes at 100 ℃, at cooled on ice 15-30s, and the 3.3mg/mL FeCl of adding 1mL ₃6H ₂O (in 10mM HCl) was at room temperature hatched 30 minutes then.Measure the absorbancy of the reaction mixture that contains aldehyde-MBTH affixture at the 670nm place.The result of this mensuration is shown in the table 9.When having aminopropanol phosphoric acid ester substrate, PLP and cell-free extract, detect the generation of aldehyde, aldehyde generates uses Abs ₆₇₀Indication, its comparison reaches 0.3 according to background is high.When not having substrate or cell-free extract, all do not detect aldehyde.When not adding PLP, detect more a spot of aldehyde, supposition is owing to there is the cause of PLP in the cell-free extract.Without the cell-free extract of inductive TOP10/pBAD.KA-AT-culture in reaction, do not generate any can detected aldehyde.These results show that the erwinia amino alcohol O-phosphoric acid ester lyase of inferring catalysis aminopropanol O-phosphoric acid ester really transforms the generation propionic aldehyde.

Table 9

Aminopropanol O-phosphoric acid ester lyase is measured.Sample 1 is without the inductive intestinal bacteria The cell-free extract of the contrast of TOP10/pBAD.KA-AT.Sample 2-5 contains through inducing The cell-free extract of culture intestinal bacteria TOP10/pBAD.KA-AT

Sample number	Induce by 0.1% pectinose	Aminopropanol O-phosphoric acid ester	PLP	Enzyme extract (100 μ g/mL)	OD 670，10min	OD 670，30min
							1	Do not induce	(+)	(+)	(+)	0.262	0.255
2	Through inducing	(+)	(+)	(+)	1.229	2264
							3	Through inducing	(-)	(+)	(+)	0.303	0.223
4	Through inducing	(+)	(-)	(+)	0.855	1.454
							5	Through inducing	(+)	(+)	(-)	0.156	0.065

Erwinia amino alcohol O-phosphoric acid ester lyase is to the work of amino butanol O-phosphoric acid ester substrate The property analysis

Under condition same as described above, research amino alcohol O-phosphoric acid ester lyase is to the activity of amino butanol O-phosphoric acid ester substrate.This is reflected in the 1mL reactant to spend the night in 37 ℃ and carries out, this reactant contains cell-free extract, 10mM amino butanol O-the phosphoric acid ester ((R of 100 μ g intestinal bacteria TOP10/pBAD.KA-AT among the 100mM Tris-HCl (pH7.8), R)+(S, S) mixture or (R, S)+(S, R) mixture of isomers, as described in example 15 above), this Tris-HCl is added with 0.1mM PLP.Shift out 100 μ L reaction mixtures, and with " general method " and described in the MBTH derivatization method detect the 2-butanone product.Observe two peaks representing deutero-2-butanone isomer.So erwinia amino alcohol O-phosphoric acid ester lyase is except being the aminopropanol phosphoric acid ester phosphoroclastic cleavage enzyme, or amino butanol phosphoric acid ester phosphoroclastic cleavage enzyme.

Erwinia amino alcohol O-phosphoric acid ester lyase is to aminopropanol O-phosphoric acid ester and ammonia butanols The activation analysis of the steric isomer of O-phosphoric acid ester

Under condition same as described above, research erwinia amino alcohol O-phosphoric acid ester lyase is to the activity of the multiple steric isomer of aminopropanol O-phosphoric acid ester and ammonia butanols O-phosphoric acid ester.Under the situation that has erwinia amino alcohol O-phosphoric acid ester lyase, (R) become acetone by this enzymatic conversion with (S)-2-amino-1-propyl alcohol O-phosphoric acid ester, still the productive rate of (S) isomer is much higher.This enzyme also all generates butanone from two kinds of mixtures of 3-amino-2-butanols O-phosphoric acid ester isomer, contain (R, S) and (S, R) productive rate is higher in the reactant of substrate isomer.Acetone and butanone product all carry out derivatize by MBTH, and by as " general method " and described in HPLC detect.

The gene expression dose of erwinia amino alcohol kinases and amino alcohol O-phosphoric acid ester lyase Optimization

In order to improve erwinia amino alcohol kinases and the expression level of amino alcohol O-phosphoric acid ester lyase gene in intestinal bacteria, by DNA2.0 (Redwood City, CA) the codon optimized coding region of synthetic two kinds of enzymes (called after EKA:SEQ ID NO:155 and EAT:SEQ ID NO:156 respectively).Synthesize and comprise restriction enzyme site each coding region: EKA at 5 ' and 3 ' end and have 5 ' BbsI and 3 ' EcoRI, HindIII site to be used to clone; EAT has 5 ' EcoRI and 3 ' HindIII site.DNA2.0 provides EKA and EAT coding region with the form of plasmid pEKA and pEAT, and these two plasmids are in the pJ51 of DNA2.0 carrier.By connecting the pEKA fragment through BbsI and HindIII digestion, the coding region subclone that EKA is optimized is between the NcoI and HindIII site of pBAD.HisB carrier, with generation plasmid pBAD.EKA.In the plasmid of gained, the coding region, is reacted the terminal His of the N-that the amino alcohol kinases of structure and erwinia merges so use primer SEQ ID NO:157 and SEQ ID NO:158 at 5 ' end of histidine mark by carrying out the QuickChange site-directed mutagenesis ₆The coding region of mark is to produce carrier pBAD.His-EKA.

PBAD.His-EKA is transformed into coli strain BL21AI (F ^-OmpThsdSB (rB-mB-) gal dcm araB::T7RNAP-tetA; Invitrogen) in to produce bacterial strain BL21AI/pBAD.HisA-EKA.The 50mLBL21AI/pBAD.HisA-EKA culture is cultured to mid-log phase (OD ₆₀₀=0.6), induce with 0.1% pectinose, and further 30 ℃ of following overnight incubation.Prepare cell-free extract by supersound process.Under non-sex change purification condition,, use ProBond according to manufacturer's specification sheets ^TMPurification system (Invitrogen) purifying His ₆The erwinia amino alcohol kinases fusion rotein of-mark.

Prophesy property result

According to manufacturer's specification sheets, (DiscoveRx, Fremont CA) analyze His with ADP Quest Assay ₆The kinase whose activity of erwinia amino alcohol of mark.This is the biochemical assay of the accumulation of a kind of ADP of mensuration, and ADP utilizes aminopropanol or the amino butanol product as the amino alcohol kinase reaction of substrate.In the reactant of 0.2mL, with substrate and the His of 10mM ₆The erwinia amino alcohol kinases of mark is at 100mM Tris-HCl (pH7.8), 10mMMgCl ₂, mix among 2mM KCl, the 0.1mM ATP, and at 37 ℃ of reaction 1h down.Add ADP reagent A (100 μ L) and ADP reagent B (200 μ L), and mixture is at room temperature hatched 30min.Measure the activity that fluorescent signal is indicated with the excitation wavelength of 530nm and the emission wavelength of 590nm.

Embodiment 16

The expression of whole approach 3

The structure of carrier pCLBudAB-ter-T5chnA

With EcoRI digested vector pTrc99a::BudABC (as described in example 9 above), and handle to produce flat terminal with the Klenow archaeal dna polymerase this DNA.Subsequently, digest this flat endization carrier contains budA and budB gene with generation 2.5kb fragment with SpeI.With HindIII digested vector pCL1925-ter-T5chnA (as described in example 9 above), and handle to produce flat terminal with the Klenow archaeal dna polymerase this DNA.Digest this flat endization carrier to produce the fragment of 4.6kb with XbaI subsequently, then this fragment is connected to budAB fragment from pTrc99a::BudABC.The plasmid (called after pCLBudAB-ter-T5chnA) of gained is used for transformed into escherichia coli Top10 cell, and the mono-clonal bacterium colony that utilizes primer pCL1925vecF (SEQ ID NO:62) and N84seqR3 (SEQ ID NO:159) to have the correct plasmid structure by the PCR screening.From produce the mono-clonal bacterium colony of expection size, prepare plasmid for the PCR product of 1.4kb.

The structure of carrier pKK223.KA-AT-APT

Utilize primer APTfor (SEQ ID NO:162; 5 ' end contains RBS and SmaI site) and APTrev (SEQ ID NO:163; 3 ' end has added the SmaI site), by PCR from carrier pBAD.APT (as described in example 12 above) amplification APT gene.The product that will have the expection size of 1.7kb carries out gel-purified and flat terminal to produce with SmaI digestion.With PstI digested vector pKK223.KA-AT (as described in example 14 above), and handle to produce flat terminal with the KlenowDNA polysaccharase DNA.The dna fragmentation of the gained PCR product with SmaI digestion is connected, and will connects product and be used for transformed into escherichia coli Top10 cell.Utilize primer OT872 (SEQ ID NO:127) and APTrev (SEQ ID NO:163), screen one amicillin resistance bacterium colony by PCR.Estimate that size shows for the existence of the PCR product of 4.1kbp, the gene of coding APT exists and the direction orientation identical with the gene of encoded K A and AT.Use the sequence of primer APTseqRev (SEQ ID NO:160) and APTseqFor (SEQ ID NO:161) check inset.With this plasmid called after pKK223.KA-AT-APT.By with the culture of 5ml Top10/pKK223.KA-AT-APT in the LB substratum that contains 100 μ g/mL penbritins in 37 ℃ of shaking culture, thereby check whole three kinds of genes whether correctly to express.Work as OD ₆₀₀Reach at about 0.8 o'clock, induce expression of gene on the plasmid by adding IPTG to 0.4mM.Assess expression by SDS PAGE and above-mentioned activation measurement.

The structure of 2-production of butanol bacterial strain and the generation of 2-butanols and 2-butanone

With pKK223.KA-AT-APT and pCLBudAB-ter-T5chnA transformed into escherichia coli bacterial strain MG1655, and screen transformant, the existence of penbritin and spectinomycin resistance indication plasmid with penbritin and spectinomycin resistance.Seed cells into fill 50 or 150ml TM3a/ dextrose culture-medium (containing suitable microbiotic) shake the bottle (cumulative volume is approximately 175ml) in to show medium oxygen and hypoxia condition respectively.Add IPTG to 0.4mM to induce the genetic expression of pKK223.KA-AT-APT.As negative control, the MG1655 cell is cultivated in lacking antibiotic same medium.With initial OD ₆₀₀≤ 0.01 the inoculation shake bottle, under 34 ℃ with 300rpm shaking culture 24h.The bottle cap that shakes that fills the 50mL substratum has vent cap; The bottle that shakes that fills the 150mL substratum has airproof lid at utmost to reduce air inerchange.The MG1655/pKK223.KA-AT-APT/pCLBudAB-ter-T5chnA bacterial strain that comprises 2-butanols route of synthesis has produced 2-butanone and 2-butanols under low grade and medium oxygen condition, but and the negative control bacterial strain does not produce the 2-butanols or the 2-butanone of detection level.

Embodiment 17

Glycerol dehydratase and the active sign of butyleneglycol dehydratase

Glycerol dehydratase (E.C.4.2.1.30) with dioldehydrase (E.C.4.2.1.28) though structurally relevant, distinguish based on multiple difference (comprising substrate specificity) usually in this area.Present embodiment has proved glycerol dehydratase with meso-2, and the 3-butyleneglycol is converted into 2-butanone.At US 6,514, among 733 (people such as Emptage) and the WO 2003089621 (incorporating these two pieces of documents into this paper by reference) recombinant escherichia coli strain KLP23/pSYCO12 has been described, it comprises the Klebsiella Pneumoniae gene, a plurality of subunits of this genes encoding glycerol dehydratase (α: SEQID NO:145 (coding region) and 146 (protein); β: SEQ ID NO:147 (coding region) and 148 (protein); And γ: SEQ ID NO:149 (coding region) and 150 (protein)), and it also comprises the Klebsiella Pneumoniae gene, this genes encoding glycerol dehydratase is a plurality of subunits of activating enzyme (big subunit, SEQ ID NO:151 (coding region) and 152 (protein) again; And small subunit, SEQ ID NO:153 (coding region) and 154 (protein)).Prepare the acellular crude extract of KLP23/pSYCO12 by method known to those skilled in the art.Carry out enzyme assay in 37 ℃ of following 80mM HEPES damping fluids (pH8.2) under no optical condition, this damping fluid has 12 μ M coenzyme B ₁₂With 10mM meso-2, the 3-butyleneglycol.By HPLC (the SH-G guard column that uses Shodex SH-1011 post and have RI-detector; 0.01MH ₂SO ₄As moving phase, flow velocity is 0.5mL/min, and column temperature is 50 ℃; 2-butanone retention time=40.2min) the generation of monitoring 2-butanone.The formation speed of the 2-butanone by glycerol dehydratase preparation is the 0.4nmol/min/mg crude protein.

Embodiment 18

By producing and checking the profile HMM of the glycol/glycerol dehydratase that the experiment proved that right Glycol/glycerol dehydratase carries out structural analysis

Dioldehydrase and glycerol dehydratase distribute and belong to enzyme type 4.2.1.28 and 4.2.1.30.Every kind of mixture that is three subunits of this enzyme of two types: big subunit (being also referred to as the α subunit), medium subunit (being also referred to as the β subunit) and small subunit (being also referred to as the γ subunit).In some glycerol dehydratases, find that big subunit and medium subunit merge.

By the Sequence Identification family member

With Klebsiella oxytoca butyleneglycol dehydratase as prototype enzyme to be used to identify two pure and mild glycerol dehydratase families.Aminoacid sequence (GenBank No:BAA08099 with the α subunit; SEQID NO:8), the aminoacid sequence of β subunit (GenBank No:BAA08100; SEQ IDNO:10) and the aminoacid sequence of γ subunit (GenBank No:BAA08101; SEQ ID NO:12) each adopts default parameters to carry out the BLASTp search all as search sequence to GenBank nonredundancy Protein Data Bank.The serial correlation that extraction has a relevant matches is by about mating the details that comprises in proteinic E value score value, protein definition, the GenBank report, and about the literature review of theme.For big subunit, BLAST output result shows that it is 1.5 that the E value increases to the E value suddenly from e-20.Have 1.5 or the full sequence coupling of bigger E value all be defined as and do not belong to dehydratase.Many RNA polymerase β subunits of being demarcated to the DNA guiding in these sequences.Some matching E value is about e-20, and it is a partial sequence.If the E value is lower than 1.5, then will there be the sequence of note to be included.

Utilize Klebsiella oxytoca butyleneglycol dehydratase α subunit as search sequence, 50 kinds of homologues are accredited as the member of this protein families.This group comprises some sequences that are not full length protein.The full length sequence that is accredited as glycol/glycerol dehydratase α subunit family is prototype SEQ ID NO:8 and SEQ ID NO:93,99,105,135,138,141,146,164,167,170,173,176,179,182,185,188,191,194,197,200,203,206,209,212,215,218,221,224,227,130,243,254,255,256,257,258 and 259.SEQ ID NO:233,235,237,239,241,246,247 comprises α subunit and β subunit, and these two subunits merge in these sequences.

Utilize Klebsiella oxytoca butyleneglycol dehydratase β-subunit as search sequence, 51 kinds of homologues are accredited as the member of this protein families.This group membership comprises some sequences that are not full length protein.The full length sequence that is accredited as glycol/glycerol dehydratase β subunit family is prototype SEQ IDNO:10 and SEQ ID NO:95,101,107,136,139,142,148,165,168,171,174,177,180,183,186,189,192,195,198,201,204,207,210,213,216,219,222,225,228,231,244,250,252,260,261,262,263,364,265,266 and 167.

Utilize Klebsiella oxytoca butyleneglycol dehydratase γ subunit as search sequence, 48 kinds of homologues are accredited as the member of this protein families.This group membership comprises some sequences that are not full length protein.The full length sequence that is accredited as glycol/glycerol dehydratase γ subunit family is prototype SEQ IDNO:12 and SEQ ID NO:97,103,109,137,140,143,150,166,169,172,175,178,181,184,187,190,193,196,199,202,205,208,211,214,217,220,223,226,229,232,234,236,238,240,242,245,248,249,251,253,268,270,271,272,273 and 274.

Evaluation has the family member through the function of experimental evaluation

For every sequence by above-mentioned Analysis and Identification, the experimental evidence of its biochemical function of search in BRENDA, UniProt and NCBIEntrez database.BRENDA is the database of a manual maintenance, it contains the details of extracting from the experiment document about enzyme kinetics, physics and biochemical property, and has link (the Cologne UniversityBioInformatics Center) with Relational database.UniProt Knowledgebase constitutes by manual maintenance part Swiss-Prot database with by the additional TrEMBL database of machine note.The Swiss-Prot database of manual maintenance (Swiss Institute of Bioinformatics) provide high-caliber protein note, comprises structural domain structure, posttranslational modification and sequence variants.NCBI Entrez is positioned at NCBI (National Center for Biotechnology Information, Bethesda is MD) about integrated, the text based search and the retrieval system of major database (comprising PubMed, Nucleotide and Protein Sequences, Protein Structures, Complete Genomes and Taxonomy).

By information and the reference identified from these databases are analyzed, eight kinds of glycol/glycerol dehydratases that have glycol or glycerol dehydratase function through experimental verification have been identified.These eight kinds of enzymes are shown in the table 10.

Table 10.

Has glycol/glycerol dehydratase through the function of experimental verification

To compare by carry out the multisequencing comparison with the ClustalW that adopts default parameters from one group 8 aminoacid sequences (in table 10, listing) of every kind of subunit with the glycol/glycerol dehydratase of testing the function of determining.The identity percentage range of big subunit is 97.6% to 58.4%.The identity percentage range of medium subunit is 89.5% to 41.7%.The identity percentage range of small subunit is 83.3% to 36.4%.Thereby the sequence identity degree between some subunit sequences lower (for example 36.4%, 41.7%) is the known component that can carry out the enzyme of identical function of data by experiment although known these subunits.The sequence identity per-cent of low degree makes and utilizes these standards that are used for structure/functional dependency to become unrealistic.

Close through the glycol/glycerol dehydratase of experimental verification and the sequence of other glycol/glycerol dehydratase System

Analyze in order to carry out these, will greater than the sequence of the high redundancy of 95% identity removes from the sequence sets of big subunit, medium subunit or small subunit, only keeps all function sequences through experimental verification.Protein sequence brachymemma or part also is removed.Utilize the ClustalW that adopts default parameters that remaining sequence is carried out the multisequencing comparison.The scope of the identity per-cent of big subunit is that 97.6% (the highest per-cent is from many sequences through experimental verification) are to 42.8%.The scope of the identity per-cent of medium subunit is 91.9% to 26.4%.The scope of the identity per-cent of small subunit is 85.2% to 20.5%.These identity percentage range are similar to the identity percentage range through the sequence of experimental verification.

Based on multisequencing comparison, utilize in abutting connection with algorithm (neighbor-joining algorithm) constructing system tree (as realizing in the MEGA software package 3.1 editions; People such as Kumar, 2004 Briefings in Bioinformatics5:150-163.)。Genealogical tree is shown in Fig. 2 (big subunit), Fig. 3 (medium subunit) and Fig. 4 (small subunit), and wherein for each figure, the identity of the sequence of mapping (mapped sequence) is listed in key.From being labeled as position through the function sequence of experimental verification (dioldehydrase and glycerol dehydratase are respectively black and light grey garden circle) as can be seen, the take a walk major part of this genealogical tree of these sequences.Yet each genealogical tree comprises having the branch that does not have through the member of experimental verification really, but these members seem to belong to glycol/dehydrating glycerin enzyme family.

Make up the profile of glycol/glycerine-dehydratase family based on the sequence sets of eight subunit sequences Hidden Markov model (HMM)

A kind of alternate to the structure of the subunit collection of the glycol/dehydrating glycerin enzyme family of enzyme/function characterize be with the HMMER software package (theory of profile HMM institute foundation is described in following reference: R.Durbin, S.Eddy, A.Krogh and G.Mitchison, Biological Sequence analysis:probabilistic models of proteins and nucleic acids, Cambridge University Press, 1998; People such as Krogh, 1994; J.Mol.Biol.235:1501-1531), (users' guidebook VA) carries out for Janelia Farm Research Campus, Ashburn according to deriving from HMMER.

To analyze individually with the HMMER software program through the sequence sets of each 8 sequence (as shown in table 10) of big subunit, medium subunit and the small subunit of the glycol/glycerol dehydratase of Function Identification.The HMMER software program is output as profile hidden Markov model (HMM), and it has characterized list entries.Described in users' guidebook, profile HMM is the statistical model of multisequencing comparison.These profiles HMM has captured the conservative property degree about every row comparison, and the location specific information which kind of amino acid most probable occurs on each position.Thereby HMM has form probability basis (formal probabilistic basis).The profile HMM of amounts of protein family can in the PFAM database, obtain (Janelia Farm ResearchCampus, Ashburn, VA).

The following structure of each profile HMM:

Step 1. makes up sequence alignment

With the Clustal W that adopts default parameters eight sequences (SEQ ID NO:8,99,105,135,138,141,146 and 164) through the big subunit of the glycol/glycerol dehydratase of functional verification are compared.The sequence sets (SEQ ID Ns:10,101,107,136,139,142,148 and 165) of medium subunit sequence and the sequence sets (SEQ ID NO:12,103,109,137,140,143,150 and 166) of small subunit sequence are compared with the Clustal W that adopts default parameters equally.

Step 2. makes up profile HMM

Adopt default parameters, each aligned sequences collection is carried out the hmmbuild program.Hmmbuild reads multisequencing comparison file, makes up new profile HMM, and this profile HMM is saved to file.Utilize this program, from the unregulated profile HMM of multisequencing comparison generation of above-mentioned each subunit sequence sets.

Following information based on HMMER software users guide has provided some descriptions to the mode of hmmbuild program construction profile HMM.Profile HMM can simulate the room comparison, as comprises insertion and disappearance, and this makes this software can describe complete conserved domain (rather than only describing the motif that does not have the room).Insert and lack and simulate with (I) state of insertion and disappearance (D) state.Contain more than all row of the idle character of a certain mark x and will be composed to inserting row.When default, x is set at 0.5.Every kind of matching status has associated I state and D state.The one group three kinds states (M/D/I) of HMMER identical total position in will comparing are called " node (node) ".These states are interconnected with the arrow that is called state transition probability (state transition probability).M and I state are radiator (emitter), and the D state is reticent.These transfers (transition) are arranged so that at each node, have perhaps used M state (and compare and give a mark residue), perhaps used the D state (do not carry out the residue comparison, cause disappearance-idle character '-').Insertion appears between the node, and the I state has from shifting (self-transition), allows one or more insertion residues to appear between the total row.

The score value of the residue of matching status (being matching status emission score value), or the score value of the residue of the state of insertion (i.e. insertion state emission score value) is proportional with Log_2 (p_x)/(null_x).Wherein, p_x is according to the probability of the amino-acid residue of specific location in profile HMM, the comparison, and null_x is the probability according to the Null model.The Null model is a kind of probability model of a single state, has in precalculated 20 seed amino acids every kind emission probability collection, and this probability comes from the distribution of amino acid in SWISSPROT release 24.

The state transitions score value also is calculated as stratagem ensuring success logarithm (log odds) parameter and proportional with Log_2 (t_x).Wherein t_x is transferred to emission state or non-emitting shape probability of state.

Step 3. calibration distribution type HMM

Read each profile HMM with hmmcalibrate, hmmcalibrate gives a mark to a large amount of synthetic stochastic sequences with this profile HMM, and (the acquiescence number of used composition sequence is 5,000), with the histogram-fitting of The extreme value distribution (EVD) with these score values, and preserve the HMM file again, this document has comprised the EVD parameter now.With this profile HMM search protein sequence database the time, these EVD parameters (μ and λ) are used to calculate the E value of scale-of-two score value (bit score).Hmmcalibrate writes the HMM file with two parameters on the row that is designated as " EVD ": μ (position) that these two parameters are The extreme value distribution (EVD) and λ (yardstick) parameter, this The extreme value distribution is mated the histogram of the score value that the sequence that produces is at random calculated most, and wherein this sequence that produces at random has approximately identical with SWISS-PROT length and residue composition.Each profile HMM is carried out this calibration.

The profile HMM of the calibration of big subunit, medium subunit and small subunit sequence sets provides in appendix, is α profile HMM, β profile HMM and γ profile HMM Excel chart.Each profile HMM provides in chart, and chart has provided every seed amino acid probability that each position occurs in aminoacid sequence.For each position, highlighted the highest probability.Table 11 has shown several row of the profile HMM that makes up for the big subunit that has through the glycol/glycerol dehydratase of the function of experimental verification.

Table 11

The part of big subunit profile HMM

Amino acid is by the single-letter representation

First row of each position has been reported coupling emission score value: each amino acid is in the probability (having highlighted the highest score value) of this state.Second row has been reported and has been inserted the emission score value, and the third line has been reported state transitions score value: M → M, M → I, M → D; I → M, I → I; D → M, D → D; B → M; M → E.

Table 11 shows, for big subunit, methionine(Met) has 4141 probability and is in first position, and this is a maximum probability, and highlighted.Second position, Methionin has the highest probability, and probability is 1954.The 3rd position, arginine has maximum probability, and probability is 3077.

Specificity and the susceptibility of the profile HMM that step 4. check makes up

Utilize hmmsearch to estimate each profile HMM, hmmsearch reads profile HMM and sequential file is searched for significantly similar sequences match from hmmfile.The sequential file of search is a GenBank nonredundancy Protein Data Bank.The size of database (Z parameter) is set at 1,000,000,000.This size set(ting)value is guaranteed will in a foreseeable future keep significance to the remarkable E value of current database.E value cutoff value is set at 10.

The specificity that has through the profile HMM of big subunit, medium subunit and the small subunit of the glycol/glycerol dehydratase of the function of experimental verification is, only glycol/dehydrating glycerin enzyme subunit is recovered, this note by matching sequence shows, even and susceptibility is that the partial sequence of glycol/dehydrating glycerin enzyme subunit is also recovered.The E value that every sequence of recovery sequence has is 0.01 or littler.

All sequences on the genealogical tree among Fig. 2, Fig. 3 and Fig. 4 is all recovered in profile HMM coupling.Do not contain and have that all sequences all mates in the genealogical tree branch of the sequence of the function of experimental verification.Thereby, by with the profile HMM coupling that has through big subunit, medium subunit or the small subunit of 8 kind of two pure and mild glycerol dehydratase of the function of experimental verification, whole two pure and mild glycerol dehydratases are all related with these 8 kinds of enzymes.The total length two pure and mild glycerol dehydratases that mate described profile HMM have following SEQ ID NO:

(α) subunit greatly: 8,93,99,105,135,138,141,146,164,167,170,173,176,179,182,185,188,191,194,197,200,203,206,209,212,215,218,221,224,227,130,243,254,255,256,257,258 and 259.

Big subunit that merges and medium subunit (big subunit and medium subunit part are mated big subunit profile HMM and medium subunit profile HMM respectively): 233,235,237,239,241,246 and 247.

Medium (β) subunit: 10,95,101,107,136,139,142,148,165,168,171,174,177,180,183,186,189,192,195,198,201,204,207,210,213,216,219,222,225,228,231,244,250,252,260,261,262,263,364,265,266 and 167.

Little (γ) subunit: 12,97,103,109,137,140,143,150,166,169,172,175,178,181,184,187,190,193,196,199,202,205,208,211,214,217,220,223,226,229,232,234,236,238,240,242,245,248,249,251,253,268,270,271,272,273 and 274.

These analyze demonstration, and the usefulness of every kind of subunit has the profile HMM through the sequence construct of the function of experimental verification, and the structure with the function association of glycol/glycerol dehydratase is provided.The coupling of all above-mentioned sequences and this profile HMM provides the structure/function association of these sequences then again.

Claims (43)

1. a recombinant microorganism host cell comprises the dna molecular of at least a coding catalytic substrate to the polypeptide of product conversion, and described substrate to the conversion of product is selected from the group of being made up of following conversion:

I) pyruvic acid is converted into α-acetylactis;

Ii) α-acetylactis is converted into acetoin;

Iii) acetoin is converted into 2, the 3-butyleneglycol;

Iv) 2, the 3-butyleneglycol is converted into 2-butanone; And

V) 2-butanone is converted into the 2-butanols;

Wherein said at least a dna molecular and described microbial host cell are allogenic, and wherein said microbial host cell produces the 2-butanols.

2. a recombinant microorganism host cell comprises the dna molecular of at least a coding catalytic substrate to the polypeptide of product conversion, and described substrate to the conversion of product is selected from the group of being made up of following conversion:

I) pyruvic acid is converted into α-acetylactis;

Ii) α-acetylactis is converted into acetoin;

Iii) acetoin is converted into 2, the 3-butyleneglycol; And

Iv) 2, the 3-butyleneglycol is converted into 2-butanone;

Wherein said at least a dna molecular and described microbial host cell are allogenic, and wherein said microbial host cell produces 2-butanone.

3. host cell according to claim 1 and 2, wherein catalytic substrate pyruvic acid to the polypeptide that product α-acetylactis transforms is an acetolactate synthase.

4. host cell according to claim 1 and 2, wherein said catalytic substrate α-acetylactis to the polypeptide that the product acetoin transforms is an acetolactate decarboxylase.

5. host cell according to claim 1 and 2, wherein said catalytic substrate acetoin are to product 2, and the polypeptide that the 3-butyleneglycol transforms is the butanediol dehydrogenation enzyme.

6. host cell according to claim 1 and 2, wherein said catalytic substrate 2,3-butyleneglycol to the polypeptide that the product 2-butanone transforms is dioldehydrase or glycerol dehydratase.

7. host cell according to claim 1, wherein said catalytic substrate 2-butanone to the polypeptide that product 2-butanols transforms is the butanols desaturase.

8. host cell according to claim 1 and 2, wherein said cell is selected from the group of being made up of following cell: bacterium, cyanobacteria, filamentous fungus and yeast.

9. host cell according to claim 8, wherein said cell are the members who is selected from by the genus of the group of forming with the subordinate: fusobacterium, zymomonas, Escherichia, salmonella, Rhod, Rhodopseudomonas, bacillus, lactobacillus, enterococcus spp, Pediococcus, Alkaligenes, klebsiella spp, class Bacillus, genus arthrobacter, corynebacterium, brevibacterium sp, Pichia, mycocandida, Hansenula and yeast belong.

10. host cell according to claim 3, wherein based on using default parameters to be gap penalty=10, room length point penalty=0.1 and protein weight matrix Clustal W comparison method as Gonnet 250 series, described acetolactate synthase has the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:4, SEQ ID NO:77 and SEQ ID NO:79.

11. host cell according to claim 4, wherein based on using default parameters to be gap penalty=10, room length point penalty=0.1 and the protein weight matrix Clustal W comparison method as Gonnet 250 series, described acetolactate decarboxylase has the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ IDNO:2, SEQ ID NO:81 and SEQ ID NO:83.

12. host cell according to claim 5, wherein based on using default parameters to be gap penalty=10, room length point penalty=0.1 and the protein weight matrix Clustal W comparison method as Gonnet 250 series, described butanediol dehydrogenation enzyme has the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:6, SEQ ID NO:85, SEQ ID NO:87 and SEQ ID NO:89.

13. host cell according to claim 6, wherein said dioldehydrase or glycerol dehydratase comprise the big subunit of total length, medium subunit and small subunit, when with the inquiry of profile hidden Markov model, the E-value parameter that described every kind of subunit provides is 0.01 or littler, and wherein said profile hidden Markov model is to produce with following subunit: SEQ ID NO:8,99,105,135,138,141,146 and 164 big subunit; SEQ ID NO:10,101,107,136,139,142,148 and 165 medium subunit; With SEQ ID NO:12,103,109,137,140,143,150 and 166 small subunit; Each inquiry is to be that 1,000,000,000 hmmsearch algorithm carries out with Z parameter setting wherein.

14. host cell according to claim 6, wherein said dioldehydrase or described glycerol dehydratase are identified by the method that comprises the steps:

A) comparison from the aminoacid sequence of the big subunit of the described two pure and mild glycerol dehydratases of correspondence, medium subunit and small subunit produces the profile hidden Markov model; Wherein

I) described big subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:8,99,105,135,138,141,146 and 164;

Ii) described medium subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:10,101,107,136,139,142,148 and 165; And

Iii) described small subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:12,103,109,137,140,143,150 and 166;

B) utilize wherein the Z parameter setting be 1,000,000,000 and the E value parameter be set at 0.01 hmmsearch algorithm, inquire about at least one disclosed protein sequence database that contains two pure and mild glycerol dehydratase sequences with the profile hidden Markov model of (a), to identify first data set of two pure and mild glycerol dehydratase aminoacid sequences; And

C) first data set from (b) removes any part sequence to produce second data set of two pure and mild glycerol dehydratase aminoacid sequences, and wherein dioldehydrase and glycerol dehydratase are identified.

15. host cell according to claim 6, wherein said dioldehydrase or glycerol dehydratase comprise big subunit, based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, and described big subunit comprises the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:8,93,99,105,135,138,141,146,164,167,170,173,176,179,182,185,188,191,194,197,200,203,206,209,212,215,218,221,224,227,130,243,254,255,256,257,258 and 259.

16. host cell according to claim 6, wherein said dioldehydrase or glycerol dehydratase comprise medium subunit, based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, and described medium subunit comprises the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:10,95,101,107,136,139,142,148,165,168,171,174,177,180,183,186,189,192,195,198,201,204,207,210,213,216,219,222,225,228,231,244,250,252,260,261,262,263,364,265,266 and 167.

17. host cell according to claim 6, wherein said dioldehydrase or glycerol dehydratase comprise small subunit, based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, and described small subunit comprises the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:12,97,103,109,137,140,143,150,166,169,172,175,178,181,184,187,190,193,196,199,202,205,208,211,214,217,220,223,226,229,232,234,236,238,240,242,245,248,249,251,253,268,270,271,272,273 and 274.

18. host cell 6 according to claim 6, wherein said dioldehydrase or glycerol dehydratase comprise the big subunit of fusion, medium subunit and small subunit, based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, the big subunit of described fusion, medium subunit and small subunit comprise the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:233,235,237,239,241,246 and 247.

19. host cell according to claim 6, wherein said dioldehydrase or glycerol dehydratase comprise the big subunit of fusion, medium subunit and small subunit, and have at least 95% identity with the aminoacid sequence of whole three aminoacid sequences that comprise encode big subunit, medium subunit and small subunit, wherein said three aminoacid sequences are selected from the group of being made up of following sequence:

A) SEQ ID NO:8, SEQ ID NO:10 and SEQ ID NO:12;

B) SEQ ID NO:93, SEQ ID NO:95 and SEQ ID NO:97;

C) SEQ ID NO:99, SEQ ID NO:101 and SEQ ID NO:103;

D) SEQ ID NO:105, SEQ ID NO:107 and SEQ ID NO:109;

E) SEQ ID NO:135, SEQ ID NO:136 and SEQ ID NO:137;

F) SEQ ID NO:138, SEQ ID NO:139 and SEQ ID NO:140;

G) SEQ ID NO:146, SEQ ID NO:148 and SEQ ID NO:150;

H) SEQ ID NO:141, SEQ ID NO:142 and SEQ ID NO:143; With

I) SEQ ID NO:164, SEQ ID NO:165 and SEQ ID NO:166;

Wherein said sequence identity is based on uses default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series.

20. host cell according to claim 8, wherein based on using default parameters to be gap penalty=10, room length point penalty=0.1 and the protein weight matrix Clustal W comparison method as Gonnet 250 series, described butanols desaturase has the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:14, SEQ ID NO:72, SEQ ID NO:75 and SEQ ID NO:91.

21. a method of producing the 2-butanols comprises:

1) provide the recombinant microorganism host cell, it comprises the dna molecular of at least a coding catalytic substrate to the polypeptide of product conversion, and described substrate to the conversion of product is selected from the group of being made up of following conversion:

I) pyruvic acid is converted into α-acetylactis;

Ii) α-acetylactis is converted into acetoin;

Iii) acetoin is converted into 2, the 3-butyleneglycol;

Iv) 2, the 3-butyleneglycol is converted into 2-butanone; And

V) 2-butanone is converted into the 2-butanols;

Wherein said at least a dna molecular and described microbial host cell are allogenic; With

Host cell in (1) is contacted in fermention medium with the carbon substrate that can ferment under the condition that can produce the 2-butanols.

22. a method of producing 2-butanone comprises:

1) provide the recombinant microorganism host cell, it comprises the dna molecular of at least a coding catalytic substrate to the polypeptide of product conversion, and described substrate to the conversion of product is selected from the group of being made up of following conversion:

I) pyruvic acid is converted into α-acetylactis;

Ii) α-acetylactis is converted into acetoin;

Iii) acetoin is converted into 2, the 3-butyleneglycol; And

Iv) 2, the 3-butyleneglycol is converted into 2-butanone;

Wherein said at least a dna molecular and described microbial host cell are allogenic; With

Host cell in (1) is contacted in fermention medium with the carbon substrate that can ferment under the condition that can produce 2-butanone.

23. according to claim 21 or 22 described methods, the wherein said carbon substrate that ferments is selected from the group of being made up of monose, oligosaccharides and polysaccharide.

24. according to claim 21 or 22 described methods, wherein catalytic substrate pyruvic acid to the described polypeptide that product α-acetylactis transforms is an acetolactate synthase.

25. according to claim 21 or 22 described methods, wherein catalytic substrate α-acetylactis to the described polypeptide that the product acetoin transforms is an acetolactate decarboxylase.

26. according to claim 21 or 22 described methods, wherein the catalytic substrate acetoin is to product 2, the described polypeptide that the 3-butyleneglycol transforms is the butanediol dehydrogenation enzyme.

27. according to claim 21 or 22 described methods, wherein catalytic substrate 2,3-butyleneglycol to the described polypeptide that the product 2-butanone transforms is dioldehydrase or glycerol dehydratase.

28. method according to claim 21, wherein catalytic substrate 2-butanone to the described polypeptide that product 2-butanols transforms is the butanols desaturase.

29. according to claim 21 or 22 described methods, wherein said cell is selected from the group that following cell is formed: bacterium, cyanobacteria, filamentous fungus and yeast.

30. method according to claim 29, wherein said cell are the members who is selected from by the genus of the group of forming with the subordinate: fusobacterium, zymomonas, Escherichia, Salmonellas, Rhod, Rhodopseudomonas, bacillus, lactobacillus, enterococcus spp, Pediococcus, Alkaligenes, klebsiella spp, class Bacillus, genus arthrobacter, corynebacterium, brevibacterium sp, Pichia, mycocandida, Hansenula and yeast belong.

31. method according to claim 24, wherein based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, and described acetolactate synthase has the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:4, SEQ ID NO:77 and SEQ ID NO:79.

32. method according to claim 25, wherein based on using default parameters to be gap penalty=10, room length point penalty=0.1 and the protein weight matrix Clustal W comparison method as Gonnet 250 series, described acetolactate decarboxylase has the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:2, SEQ ID NO:81 and SEQ ID NO:83.

33. method according to claim 26, wherein based on using default parameters to be gap penalty=10, room length point penalty=0.1 and the protein weight matrix Clustal W comparison method as Gonnet 250 series, described butanediol dehydrogenation enzyme has the aminoacid sequence that has at least 95% identity with the sequence that is selected from the group of being made up of following sequence: SEQ ID NO:6, SEQID NO:85, SEQ ID NO:87 and SEQ ID NO:89.

34. method according to claim 27, wherein said dioldehydrase or glycerol dehydratase comprise the big subunit of total length, medium subunit and small subunit, when with the inquiry of profile hidden Markov model, the E-value parameter that described every kind of subunit provides is 0.01 or littler, and wherein said profile hidden Markov model is to produce with following subunit: SEQ ID NO:8,99,105,135,138,141,146 and 164 big subunit; SEQ ID NO:10,101,107,136,139,142,148 and 165 medium subunit; And SEQ ID NO:12,103,109,137,140,143,150 and 166 small subunit; Each inquiry is to be that 1,000,000,000 hmmsearch algorithm carries out with Z parameter setting wherein.

35. method according to claim 27, wherein said dioldehydrase or described glycerol dehydratase are identified by the method that may further comprise the steps:

A) comparison from the aminoacid sequence of the big subunit of the described two pure and mild glycerol dehydratases of correspondence, medium subunit and small subunit produces the profile hidden Markov model;

I) described big subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:8,99,105,135,138,141,146 and 164;

Ii) described medium subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:10,101,107,136,139,142,148 and 165; And

Iii) described small subunit comprises the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:12,103,109,137,140,143,150 and 166;

B) utilize wherein the Z parameter setting be 1,000,000,000 and the E value parameter be set at 0.01 hmmsearch algorithm, inquire about at least one disclosed protein sequence database that contains two pure and mild glycerol dehydratase sequences with the profile hidden Markov model of (a), to identify first data set of two pure and mild glycerol dehydratase aminoacid sequences; And

C) first data set from (b) removes any part sequence to produce second data set of two pure and mild glycerol dehydratase aminoacid sequences, and wherein dioldehydrase and glycerol dehydratase are identified.

36. method according to claim 27, wherein said dioldehydrase or glycerol dehydratase comprise big subunit, based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, and described big subunit comprises the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: 8,93,99,105,135,138,141,146,164,167,170,173,176,179,182,185,188,191,194,197,200,203,206,209,212,215,218,221,224,227,130,243,254,255,256,257,258 and 259.

37. method according to claim 27, wherein said dioldehydrase or glycerol dehydratase comprise medium subunit, based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, and described medium subunit comprises the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:10,95,101,107,136,139,142,148,165,168,171,174,177,180,183,186,189,192,195,198,201,204,207,210,213,216,219,222,225,228,231,244,250,252,260,261,262,263,364,265,266 and 167.

38. method according to claim 27, wherein said dioldehydrase or glycerol dehydratase comprise small subunit, based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, and described small subunit comprises the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:12,97,103,109,137,140,143,150,166,169,172,175,178,181,184,187,190,193,196,199,202,205,208,211,214,217,220,223,226,229,232,234,236,238,240,242,245,248,249,251,253,268,270,271,272,273 and 274.

39. method according to claim 27, wherein said dioldehydrase or glycerol dehydratase comprise the big subunit of fusion, medium subunit and small subunit, based on using default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series, the big subunit of described fusion, medium subunit and small subunit comprise the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:233,235,237,239,241,246 and 247.

40. method according to claim 27, wherein said dioldehydrase or glycerol dehydratase comprise the big subunit of fusion, medium subunit and small subunit, and have at least 95% identity with the aminoacid sequence of whole three aminoacid sequences that comprise encode big subunit, medium subunit and small subunit, wherein said three aminoacid sequences are selected from the group of being made up of following sequence:

A) SEQ ID NO:8, SEQ ID NO:10 and SEQ ID NO:12;

B) SEQ ID NO:93, SEQ ID NO:95 and SEQ ID NO:97;

C) SEQ ID NO:99, SEQ ID NO:101 and SEQ ID NO:103;

D) SEQ ID NO:105, SEQ ID NO:107 and SEQ ID NO:109;

E) SEQ ID NO:135, SEQ ID NO:136 and SEQ ID NO:137;

F) SEQ ID NO:138, SEQ ID NO:139 and SEQ ID NO:140;

G) SEQ ID NO:146, SEQ ID NO:148 and SEQ ID NO:150;

H) SEQ ID NO:141, SEQ ID NO:142 and SEQ ID NO:143; With

I) SEQ ID NO:164, SEQ ID NO:165 and SEQ ID NO:166;

Wherein said sequence identity is based on uses default parameters to be gap penalty=10, room length point penalty=0.1, and the protein weight matrix is the Clustal W comparison method of Gonnet 250 series.

41. method according to claim 28, wherein based on using default parameters to be gap penalty=10, room length point penalty=0.1 and the protein weight matrix Clustal W comparison method as Gonnet 250 series, described butanols desaturase has the aminoacid sequence that at least 95% identity is arranged with the aminoacid sequence that is selected from the group of being made up of following sequence: SEQ ID NO:14, SEQ ID NO:72, SEQ ID NO:75 and SEQ ID NO:91.

42. a tunning substratum that contains the 2-butanols, described tunning substratum is produced by method according to claim 21.

43. a tunning substratum that contains 2-butanone, described tunning substratum is produced by the described method of claim 22.

Images