CN101451110A - Construction method of genetic engineering bacterial strain capable of producing low diacetyl beer - Google Patents
Construction method of genetic engineering bacterial strain capable of producing low diacetyl beer Download PDFInfo
- Publication number
- CN101451110A CN101451110A CNA2007101447347A CN200710144734A CN101451110A CN 101451110 A CN101451110 A CN 101451110A CN A2007101447347 A CNA2007101447347 A CN A2007101447347A CN 200710144734 A CN200710144734 A CN 200710144734A CN 101451110 A CN101451110 A CN 101451110A
- Authority
- CN
- China
- Prior art keywords
- aldc
- add
- minutes
- yeast
- beer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method for constructing a genetic engineering strain capable of being used for producing low-diacetyl beer. During beer brewing, diacetyl is a critical factor in influencing the quality of beer and is also an important index to determine whether the beer is mature or not, so that severe control of the yield of the diacetyl during the whole fermentation is very important. The method comprises: selecting an industrial Saccharomyces cerevisiae strain; cloning alpha-acetolactate decarboxylase ALDC and constructing pGM-ALDC recombinant plasmids; constructing a recombinant plasmid deoxyribonucleic acid DNA, namely pYC6/CT-ALDC; obtaining Saccharomyces cerevisiae containing the alpha-acetolactate decarboxylase ALDC; and converting the recombinant plasmid pYC6/CT-ALDC into Saccharomyces cerevisiae HDY-01, and storing the yeast into CCTCC with a preserving number of M 207162. Therefore, the alcohol content, the diacetyl content and the acetaldehyde content of the genic yeast strain are changed.
Description
Technical field:
The present invention relates to a kind of biological engineering method of utilizing and make up the method that can be used for producing the engineering strain that hangs down di-acetyl beer.
Background technology:
In the brewage process, di-acetyl is the key factor that influences beer quality, also is decision beer maturation whether important indicator, and therefore the generation of strict control di-acetyl is vital in whole fermentation process.Alpha-acetolactate decarboxylase (ALDC) can be decomposed into acetoin rapidly with the precursor α-acetylactis of di-acetyl in the beer production, thereby reduces the content of di-acetyl in the beer apace.Along with deepening continuously and development on Protocols in Molecular Biology to alpha-acetolactate decarboxylase research, making up the alpha-acetolactate decarboxylase enzyme lives higher, can rapidly α-acetylactis be converted into acetoin, thereby reduce diacetyl content, shorten the beer yeast gene engineering bacteria of beer maturation period and become inexorable trend.Do not contain ALDC in the yeast saccharomyces cerevisiae body, therefore, external source is introduced ALDC
Summary of the invention:
The purpose of this invention is to provide and a kind ofly introduce ALDC, make it participate in the intravital pathways metabolism of yeast saccharomyces cerevisiae, reduce the content of di-acetyl, make up the genes of brewing yeast engineering strain of low di-acetyl by gene clone technology external source in the industrial bacterial strain of yeast saccharomyces cerevisiae.
Above-mentioned purpose realizes by following technical scheme:
Can be used for producing the construction process of the engineering strain that hangs down di-acetyl beer, its composition comprises: choose industrial Wine brewing yeast strain, carry out the clone of α-acetolactate decarboxylase ALDC and pGM-ALDC construction of recombinant plasmid, recombinant plasmid thymus nucleic acid DNA pYC6/CT-ALDC structure, acquisition contains α-acetolactate decarboxylase ALDC yeast saccharomyces cerevisiae, this yeast of recombinant plasmid pYC6/CT-ALDC transformed saccharomyces cerevisiae HDY-01 is preserved in CCTCC preserving number M 207162.
The described construction process that can be used for producing the engineering strain that hangs down di-acetyl beer, the clone of described α-acetolactate decarboxylase ALDC and pGM-ALDC construction of recombinant plasmid:
Subtilis ALDC gene order (L04470) according to the GenBank login, design a pair of Auele Specific Primer, hold primer to add the recognition site of restriction endonuclease EcoR I and Bam H I respectively at 5 ' end primer and 3 ', this primer is given birth to worker company limited by Shanghai and is synthesized concentration 2OD;
Upstream 5 ' ACT
GAATTCATGAAACGAGAAAGCAACATT
EcoR?I
Downstream 3 ' CAT
GGATCCTTATTCAGGGCTTCCTTCAGT
Bam?H?I
With the subtilis is that template is directly carried out bacterium colony PCR, 94 ℃ of sex change 5 minutes, 94 ℃ of sex change 30 seconds, 53 ℃ of annealing 30 seconds, 72 ℃ were extended 1 minute, 35 circulations, after being connected of PCR product and T-vector, be transformed among the competent escherichia coli cell DH5 α, extract the recon plasmid, obtain recombinant plasmid pGM-ALDC, contain the ALDC gene fragment in this plasmid.
The described construction process that can be used for producing the engineering strain of low di-acetyl beer, the structure of described recombinant plasmid dna pYC6/CT-ALDC: pGM-ALDC and pYC6/CT are connected with behind Eco R I and the Bam H I double digestion respectively again.To connect product and be transformed into intestinal bacteria DH 5 α, and, carry out the extraction of plasmid DNA, the performing PCR of going forward side by side checking the positive colony amplification.Obtain the pYC6/CT-ALDC recombinant plasmid.
The described construction process that can be used for producing the engineering strain that hangs down di-acetyl beer, contain the acquisition of ALDC yeast saccharomyces cerevisiae: pYC6/CT-ALDC transformed saccharomyces cerevisiae HDY-01:
Utilize the Lithium Acetate conversion method, with the HDY-01 bacterial strain YPD cultivate and on activate, three rides, in 10 milliliters of YPD liquid nutrient mediums, 30 ℃ of per minutes 180 change the shaking table overnight incubation, measure the OD value of bacterium liquid, OD when making it be diluted to 50 milliliters with single colony inoculation
600Reach 0.4, continue to cultivate 2-4 hour, yeast nutrient solution room temperature 1500 under aseptic condition is restrained centrifugal 5 minutes, abandon supernatant, add 40 milliliters of 1 * TE solution and will precipitate the washing that suspends, 1500 grams were abandoned supernatant in centrifugal 5 minutes, add 2 milliliters of 1 * LiAc/0.5 * TE solution, the suspension post precipitation, room temperature was placed 10 minutes, in an aseptic centrifuge tube, add the treated yeast suspension of 100 μ L respectively, 100 μ g sex change salmon sperm DNAs, 1 μ g pYC-ALDC DNA, 700 μ l, 1 * LiAc/40%PEG-4000/1 * TE mixes, and gets another aseptic centrifuge tube simultaneously, adds the treated yeast suspension of 100 μ L respectively, 100 μ g sex change salmon sperm DNAs, 700 μ l, 1 * LiAc/40%PEG-4000/1 * TE mixes, and in contrast, 30 ℃ were reacted 30 minutes, add 8 μ LDMSO stostes, mix, 40 ℃ of water-baths 7 minutes left the heart 10 seconds at per minute 13000, abandon supernatant, twice of 1 * TE washing precipitation (add the 1mLTE washing, the centrifugal 10s of 14000rpm draws supernatant), add 0-100 μ L1 * TE, coat the dull and stereotyped last 30 ℃ of cultivations 2 days that contain Blasticidin after the dilution.
This technical scheme has following beneficial effect:
By the present invention, the low di-acetyl that has successfully made up yeast saccharomyces cerevisiae produces bacterium 1-27.Continuous 15 days fermenting experiments of 1-27 processes prove that its diacetyl content and acetaldehyde all decrease than starting strain.
The checking of express recombinant
When being coated on the bacterial strain that transforms on the Blasticidin YPD flat board that contains 50 μ g/mL, unconverted bacterial strain also is coated on the Blasticidin YPD flat board of same concentrations as negative contrast, original strain is owing to not containing the Blasticidin resistant gene and to the Blasticidin sensitivity, can not grow containing on the flat board of Blasticidin, can grow containing on the flat board of Blasticidin and transform bacterial strain owing to contain the Blasticidin resistant gene.Then can in the bacterium colony that grows, go down to posterity five times by the picking positive colony, to guarantee its inheritance stability.
The performance that contains ALDC yeast saccharomyces cerevisiae recon 1-27 of the present invention:
The mensuration that recon ALDC enzyme is lived:
Under alkaline condition, can generate red material according to acetoin with the mixture reaction of creatine and naphthyl alcohol, the principle that the light absorption value of the red material that generates in certain scope and the content of acetoin are directly proportional, the activity of mensuration alpha-acetolactate decarboxylase.A unit enzyme (1U) alive is defined as at 30 ℃, under the reaction conditions of pH6.0, and the enzyme amount that made α-acetylactis decarboxylation form 1 μ mol acetoin in 1 minute.Recon is induced behind 30 ℃, 160r/min, cultivation 24h through 10mL beta galactose inducing culture, enlarged culturing in the 100mLYPD substratum is gone in switching, centrifugal collection thalline, 0.85%NaCl suspends after washing 2 times, ultrasonic disruption (ice bath, omnidistance 5min effect 10s be 30s power 600w at interval), the centrifugal bacterial chip of removing is got supernatant, 200 μ L enzyme samples and 200 μ L substrates are blended in 30 ℃ of water-bath 20min, add 4.6mL developer room temperature and place 50min, and 522nm measures light absorption value down.
Have four recons to express the ALDC enzyme and live, be respectively 1-27 (0.0081 ± 0.00018U/mL), 1-34 (0.0072 ± 0.00027U/mL), 3-4 (0.0054 ± 0.00024U/mL), 3-12 (0.0049 ± 0.00047U/mL).
The optimization of recon 1-27 condition of enzyme production:
Utilize single factor (time 12,24,36,48,60,72h; Temperature 25,28,30,33 ℃; Inoculum size 2%, 4%, 6%, 8%, 10%; The substratum wort YPD) and orthogonal experimental design, is optimized the best condition of enzyme production of recon 1-27.Inoculum size and temperature are to influence the key factor that ALDC produces enzyme, are incubation time secondly.Incubation time is 36h, and culture temperature is 30 ℃, and inoculum size is 10% for the suitableeest condition of enzyme production of ALDC.This optimum condition verified show that at 36h, 30 ℃, under the condition of 10% inoculum size, enzyme work reaches 0.0087U/mL.
Starting strain, 1-27 fermentation test:
Bacterial strain 1-27 and starting strain are 36h at incubation time, culture temperature is 30 ℃, inoculum size is through after the enlarged culturing under 10% the condition, transfer in the 700mL malt extract medium with 3% inoculum size, seal, guarantee anaerobic condition with sealing film, 13 ℃ of static cultivations, survey each fermentation parameter every sampling in 1 day, comprise di-acetyl, acetaldehyde etc.
The result shows, in whole fermentation process from initial to finally, the diacetyl content that transforms in bacterial strain 1-27 fermented liquids is all low than original strain, transforming the bacterial strain maximum value is 0.04806ppm, minimum value is 0.01872ppm.The original strain maximum value is 0.05578ppm, and minimum value is 0.01826ppm.The diacetyl content that transformed bacterial strain in fermentation on the 8th day reaches 0.02494ppm, and final diacetyl content reaches 0.01788ppm.
Original strain does not have obvious difference with conversion bacterial strain 1-27 acetaldehyde in the fermented liquid in whole fermentation process, and content is all less than 10ppm.
This shows, transform the intravital ALDC of bacterial strain and brought into play effect that it makes the content that transforms the bacterial strain di-acetyl that time general arranged, simultaneously, the content of acetaldehyde does not exceed threshold value yet, and the low di-acetyl yeast success that we make up is described.
The specific embodiment of the present invention:
Embodiment 1:
Be used to produce the construction process of the engineering strain that hangs down di-acetyl beer, its composition comprises: choose industrial Wine brewing yeast strain, carry out the clone of α-acetolactate decarboxylase ALDC and pGM-ALDC construction of recombinant plasmid, recombinant plasmid thymus nucleic acid DNA pYC6/CT-ALDC structure, obtain to contain α-acetolactate decarboxylase ALDC yeast saccharomyces cerevisiae, recombinant plasmid pYC6/CT-ALDC transformed saccharomyces cerevisiae HDY-01.
The patent bacterial classification:
Yeast saccharomyces cerevisiae 1-27 (Saccharomycescerevisiae) CCTCC M 207162 preservation dates on October 16th, 2007.
30 ℃ of cultivations are in the YPD substratum, and its composition is 1% yeast extract, 2% peptone, 2% glucose, 2% agar powder, 121 ℃ of sterilization 30min;
1, the clone of ALDC and pGM-ALDC construction of recombinant plasmid
Subtilis ALDC gene order (L04470) according to the GenBank login designs a pair of Auele Specific Primer, holds primer to add the recognition site of EcoR I and Bam H I respectively at 5 ' end primer and 3 '.This primer is given birth to worker company limited by Shanghai and is synthesized concentration 2OD.
Upstream 5 ' ACT
GAATTCATGAAACGAGAAAGCAACATT
EcoR?I
Downstream 3 ' CAT
GGATCCTTATTCAGGGCTTCCTTCAGT
Bam?H?I
With the subtilis is that template is directly carried out bacterium colony PCR, 94 ℃ of sex change 5min, and 94 ℃ of sex change 30s, 53 ℃ of annealing 30s, 72 ℃ are extended 1min, 35 circulations.After being connected of PCR product and T-vector, be transformed among the competent escherichia coli cell DH5 α, extract the recon plasmid, obtain recombinant plasmid pGM-ALDC.Contain the ALDC gene fragment in this plasmid.
2, the structure of recombinant plasmid dna pYC6/CT-ALDC
PGM-ALDC and pYC6/CT are connected with behind Eco R I and the Bam H I double digestion respectively again.To connect product and be transformed into bacillus coli DH 5 alpha, and, carry out the extraction of plasmid DNA, the performing PCR of going forward side by side checking the positive colony amplification.Obtain the pYC6/CT-ALDC recombinant plasmid.
3, contain the acquisition of ALDC yeast saccharomyces cerevisiae: pYC6/CT-ALDC transformed saccharomyces cerevisiae HDY-01
Utilize the Lithium Acetate conversion method.With the HDY-01 bacterial strain YPD cultivate and on activate, three rides, with single colony inoculation in the 10mLYPD liquid nutrient medium, 30 ℃ of 180rpm shaking table overnight incubation.Measure the OD value of bacterium liquid, OD when making it be diluted to 50mL
600Reach 0.4, continue to cultivate 2-4h.The centrifugal 5min of room temperature 1500g under aseptic condition abandons supernatant with the yeast nutrient solution, adds 40mL1 * TE solution and will precipitate the washing that suspends, and 1500g is centrifugal, and 5min abandons supernatant, adds 2ml1 * LiAc/0.5 * TE solution, the suspension post precipitation, and room temperature is placed 10min.In an aseptic centrifuge tube, add the treated yeast suspension of 100 microlitres respectively, 100 microgram sex change salmon sperm DNAs, 1 μ g pYC-ALDC DNA, 700 μ l1 * LiAc/40%PEG-4000/1 * TE mixes.Get another aseptic centrifuge tube simultaneously, add the treated yeast suspension of 100 μ L respectively, 100 μ g sex change salmon sperm DNAs, 700 μ l1 * LiAc/40%PEG-4000/1 * TE mixes, in contrast.30 ℃ of reaction 30min, add 8 μ LDMSO stostes, mix, 40 ℃ of water-bath 7min, 13000rpm is centrifugal, and 10s abandons supernatant, and 1 * TE washing precipitation (adds the 1mLTE washing twice, the centrifugal 10s of 14000rpm, draw supernatant), add 0-100 μ L1 * TE, coat the dull and stereotyped last 30 ℃ of cultivation 2d that contain Blasticidin after the dilution.
Claims (5)
1. construction process that can be used for producing the engineering strain of low di-acetyl beer, its composition comprises: choose industrial Wine brewing yeast strain, it is characterized in that: the structure that carries out the clone of α-acetolactate decarboxylase ALDC and pGM-ALDC construction of recombinant plasmid, recombinant plasmid thymus nucleic acid DNA pYC6/CT-ALDC, acquisition contains α-acetolactate decarboxylase ALDC yeast saccharomyces cerevisiae, recombinant plasmid pYC6/CT-ALDC transformed saccharomyces cerevisiae HDY-01, this yeast is preserved in CCTCC preserving number M207162.
2. require the 1 described construction process that can be used for producing the engineering strain that hangs down di-acetyl beer according to power, it is characterized in that: the clone of described α-acetolactate decarboxylase ALDC and pGM-ALDC construction of recombinant plasmid process comprise:
Subtilis ALDC gene order (L04470) according to the GenBank login, design a pair of Auele Specific Primer, hold primer to add the recognition site of restriction endonuclease EcoR I and Bam H I respectively at 5 ' end primer and 3 ', this primer is given birth to worker company limited by Shanghai and is synthesized concentration 2 OD;
Upstream 5 ' ACT
GAATTCATGAAACGAGAAAGCAACATT
EcoR?I
Downstream 3 ' CAT
GGATCCTTATTCAGGGCTTCCTTCAGT
Bam?H?I
With the subtilis is that template is directly carried out bacterium colony PCR, 94 ℃ of sex change 5 minutes, 94 ℃ of sex change 30 seconds, 53 ℃ of annealing 30 seconds, 72 ℃ were extended 1 minute, 35 circulations, after being connected of PCR product and T-vector, be transformed among the competent escherichia coli cell DH5 α, extract the recon plasmid, obtain recombinant plasmid pGM-ALDC, contain the ALDC gene fragment in this plasmid.
3. require the 1 or 2 described construction processs that can be used for producing the engineering strain that hangs down di-acetyl beer according to power, it is characterized in that: the construction process of described recombinant plasmid dna pYC6/CT-ALDC: pGM-ALDC and pYC6/CT are connected with behind Eco R I and the Bam H I double digestion respectively again, to connect product and be transformed into bacillus coli DH 5 alpha, and positive colony increased, carry out the extraction of plasmid DNA, the performing PCR of going forward side by side checking obtains the pYC6/CT-ALDC recombinant plasmid.
4. the construction process that can be used for producing the engineering strain of low di-acetyl beer according to claim 1 and 2 is characterized in that: contain the preparation method of ALDC yeast saccharomyces cerevisiae, with pYC6/CT-ALDC transformed saccharomyces cerevisiae HDY-01:
Utilize the Lithium Acetate conversion method, with the HDY-01 bacterial strain YPD cultivate and on activate, three rides, in 10 milliliters of YPD liquid nutrient mediums, 30 ℃ of per minutes 180 change the shaking table overnight incubation, measure the OD value of bacterium liquid, OD when making it be diluted to 50 milliliters with single colony inoculation
600Reach 0.4, continue to cultivate 2-4 hour, yeast nutrient solution room temperature 1500 under aseptic condition is restrained centrifugal 5 minutes, abandon supernatant, add 40 milliliters of 1 * TE solution and will precipitate the washing that suspends, 1500 grams were abandoned supernatant in centrifugal 5 minutes, add 2 milliliters of 1 * LiAc/0.5 * TE solution, the suspension post precipitation, room temperature was placed 10 minutes, in an aseptic centrifuge tube, add the treated yeast suspension of 100 μ L respectively, 100 μ g sex change salmon sperm DNAs, 1 μ g pYC-ALDC DNA, 700 μ l1 * LiAc/40%PEG-4000/1 * TE mixes, and gets another aseptic centrifuge tube simultaneously, adds the treated yeast suspension of 100 μ L respectively, 100 μ g sex change salmon sperm DNAs, 700 μ l1 * LiAc/40%PEG-4000/1 * TE mixes, and in contrast, 30 ℃ were reacted 30 minutes, add 8 μ LDMSO stostes, mix, 40 ℃ of water-baths 7 minutes left the heart 10 seconds at per minute 13000, abandon supernatant, 1 * TE washing precipitation adds the 1mLTE washing for twice, and the centrifugal 10s of 14000rpm draws supernatant, add 0-100 μ L1 * TE, coat the dull and stereotyped last 30 ℃ of cultivations 2 days that contain Blasticidin after the dilution.
5. the construction process that can be used for producing the engineering strain that hangs down di-acetyl beer according to claim 3 is characterized in that: contain the acquisition of ALDC yeast saccharomyces cerevisiae: pYC6/CT-ALDC transformed saccharomyces cerevisiae HDY-01
Utilize the Lithium Acetate conversion method, with the HDY-01 bacterial strain YPD cultivate and on activate, three rides, in 10 milliliters of YPD liquid nutrient mediums, 30 ℃ of per minutes 180 change the shaking table overnight incubation, measure the OD value of bacterium liquid, OD when making it be diluted to 50 milliliters with single colony inoculation
600Reach 0.4, continue to cultivate 2-4 hour, yeast nutrient solution room temperature 1500 under aseptic condition is restrained centrifugal 5 minutes, abandon supernatant, add 40 milliliters of 1 * TE solution and will precipitate the washing that suspends, 1500 grams were abandoned supernatant in centrifugal 5 minutes, add 2 milliliters of 1 * LiAc/0.5 * TE solution, the suspension post precipitation, room temperature was placed 10 minutes, in an aseptic centrifuge tube, add the treated yeast suspension of 100 μ L respectively, 100 μ g sex change salmon sperm DNAs, 1 μ g pYC-ALDC DNA, 700 μ l1 * LiAc/40%PEG-4000/1 * TE mixes, and gets another aseptic centrifuge tube simultaneously, add the treated yeast suspension of 100 μ L respectively, 100 μ g sex change salmon sperm DNAs, 700 μ l1 * LiAc/40%PEG-4000/1 * TE mixes, in contrast, 30 ℃ were reacted 30 minutes, add 8 μ LDMSO stostes, mix, 40 ℃ of water-baths 7 minutes, left the heart 10 seconds at per minute 13000, abandon supernatant, 1 * TE washing precipitation twice adds the 1mLTE washing, the centrifugal 10s of 14000rpm, draw supernatant, add 0-100 μ L1 * TE, coat the dull and stereotyped last 30 ℃ of cultivations 2 days that contain Blasticidin after the dilution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101447347A CN101451110A (en) | 2007-12-04 | 2007-12-04 | Construction method of genetic engineering bacterial strain capable of producing low diacetyl beer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2007101447347A CN101451110A (en) | 2007-12-04 | 2007-12-04 | Construction method of genetic engineering bacterial strain capable of producing low diacetyl beer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101451110A true CN101451110A (en) | 2009-06-10 |
Family
ID=40733598
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2007101447347A Pending CN101451110A (en) | 2007-12-04 | 2007-12-04 | Construction method of genetic engineering bacterial strain capable of producing low diacetyl beer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101451110A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101861895A (en) * | 2010-04-06 | 2010-10-20 | 扬州大学 | Method for preparing novel fermented soybean milk products |
| CN102816787A (en) * | 2012-06-20 | 2012-12-12 | 江南大学 | Highly expressed Staphyloccocus aureus alpha-acetolacetate decearboxylase by utilization of recombinant escherichia coli |
| CN102876704A (en) * | 2012-09-20 | 2013-01-16 | 江南大学 | Method for expressing staphyloccocus aureus alpha-acetolactate decarboxylase by utilizing recombinant bacillus subtilis efficiently |
| CZ307083B6 (en) * | 2016-10-12 | 2018-01-03 | Výzkumný ústav pivovarský a sladařský, a.s. | Yeast strain of Saccharomyces cerevisiae CCM 8714 and its use in beer production |
| CZ307085B6 (en) * | 2016-12-13 | 2018-01-03 | Výzkumný ústav pivovarský a sladařský, a.s. | Yeast strain of Saccharomyces cerevisiae CCM 8715 and its use in beer production |
| CZ307574B6 (en) * | 2017-12-21 | 2018-12-19 | Výzkumný ústav pivovarský a sladařský, a.s. | The yeast strain of Saccharomyces cerevisiae CCM 8822 and its use in beer production |
| CZ307575B6 (en) * | 2017-12-21 | 2018-12-19 | Výzkumný ústav pivovarský a sladařský, a.s. | The yeast strain of Saccharomyces cerevisiae CCM 8823 and its use in beer production |
-
2007
- 2007-12-04 CN CNA2007101447347A patent/CN101451110A/en active Pending
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101861895A (en) * | 2010-04-06 | 2010-10-20 | 扬州大学 | Method for preparing novel fermented soybean milk products |
| CN101861895B (en) * | 2010-04-06 | 2012-05-30 | 扬州大学 | Method for preparing novel fermented soybean milk products |
| CN102816787A (en) * | 2012-06-20 | 2012-12-12 | 江南大学 | Highly expressed Staphyloccocus aureus alpha-acetolacetate decearboxylase by utilization of recombinant escherichia coli |
| CN102816787B (en) * | 2012-06-20 | 2015-05-06 | 江南大学 | Highly expressed Staphyloccocus aureus alpha-acetolacetate decearboxylase by utilization of recombinant escherichia coli |
| CN102876704A (en) * | 2012-09-20 | 2013-01-16 | 江南大学 | Method for expressing staphyloccocus aureus alpha-acetolactate decarboxylase by utilizing recombinant bacillus subtilis efficiently |
| CZ307083B6 (en) * | 2016-10-12 | 2018-01-03 | Výzkumný ústav pivovarský a sladařský, a.s. | Yeast strain of Saccharomyces cerevisiae CCM 8714 and its use in beer production |
| CZ307085B6 (en) * | 2016-12-13 | 2018-01-03 | Výzkumný ústav pivovarský a sladařský, a.s. | Yeast strain of Saccharomyces cerevisiae CCM 8715 and its use in beer production |
| CZ307574B6 (en) * | 2017-12-21 | 2018-12-19 | Výzkumný ústav pivovarský a sladařský, a.s. | The yeast strain of Saccharomyces cerevisiae CCM 8822 and its use in beer production |
| CZ307575B6 (en) * | 2017-12-21 | 2018-12-19 | Výzkumný ústav pivovarský a sladařský, a.s. | The yeast strain of Saccharomyces cerevisiae CCM 8823 and its use in beer production |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101451110A (en) | Construction method of genetic engineering bacterial strain capable of producing low diacetyl beer | |
| CN101497865A (en) | Yeast strain for producing low diacetyl beer | |
| CN105420252A (en) | Glucose oxidase gene GOD, protein coded by GOD, pichia pastoris transformed by GOD and preparation method of pichia pastoris | |
| CN105368766A (en) | Genetically engineered bacterium for producing pentamethylene diamine and method for preparing pentamethylene diamine | |
| CN102703339A (en) | High-yield arginine deiminase bacterial strain and method for producing L-citrulline by same | |
| CN106282274A (en) | A kind of Pichia sp. fermentation process in high density of insulin precursor protein | |
| CN104630166A (en) | Method for producing low-temperature glucose oxidase by virtue of microbial fermentation | |
| CN102559802B (en) | Method for preparing high-yield Tremella polysaccharide by adopting culture medium for fermenting | |
| CN101475914B (en) | Method for producing oligo-galactose by cyclic utilization of recombinant Saccharomyces cerevisiae | |
| CN102604904B (en) | Production method of glucose dehydrogenase | |
| CN110564580B (en) | Method for producing vinegar containing pyrroloquinoline quinone through microbial co-culture fermentation | |
| CN104630167A (en) | Method for producing low-temperature glucose oxidase by fermentation of marine microorganisms | |
| CN113913309B (en) | Alkali-resistant yeast and application thereof in producing single cell protein by utilizing biogas slurry | |
| CN101497866B (en) | Saccharomyces cerevisiae for producing low alcohol beer | |
| CN107227284A (en) | A kind of restructuring streptococcus zooepidemicus for the micromolecule hyaluronic acid that ferments | |
| CN102146415A (en) | Gene knockout bacterium of gluconobacter oxydans and preparation method thereof | |
| CN104263744B (en) | A kind of engineered glucose oxidase gene and its Expression and Application | |
| CN103146726B (en) | Aspergillus niger alpha-glucosidase gene and high-efficiency expression method thereof | |
| CN110628653B (en) | Proliferation medium of kluyveromyces marxianus and preparation method thereof | |
| CN102061295A (en) | Vitreoscilla hemoglobin gene expression box and method for improving yield of saccharifying enzyme produced by aspergillus niger | |
| CN104263749B (en) | A kind of expression of scorpion derived antimicrobial peptide IsCT in Pichia pastoris and its clinically application for the treatment of infectious trauma | |
| CN101407768B (en) | Saccharomyces cerevisiae mutant bacterial strain and use thereof in glutathion production by fermentation | |
| CN114410523A (en) | Strain combination for efficiently preparing black tea fungus and application thereof | |
| CN101463370A (en) | Method for preparing L-lactic acid by fermenting potato starch by Rhizopus oryzae | |
| CN105018410A (en) | Method for inducing Blakeslea trispora aging strain to rapidly produce a large number of spores |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090610 |