CN101450964B - Genetic engineering antibiotic peptides as well as preparation method and application thereof - Google Patents
Genetic engineering antibiotic peptides as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN101450964B CN101450964B CN200810157206XA CN200810157206A CN101450964B CN 101450964 B CN101450964 B CN 101450964B CN 200810157206X A CN200810157206X A CN 200810157206XA CN 200810157206 A CN200810157206 A CN 200810157206A CN 101450964 B CN101450964 B CN 101450964B
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- gene
- yeast
- primer
- genetic engineering
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a genetic-engineering antibacterial peptide, as well as a preparation method and application thereof. The preparation method comprises the following steps: according to the characteristics of the amino acid sequence of Magainin and Cecropin P and LL-37 which are antibacterial peptide, a novel antibacterial peptide gene is designed; the sequence of the gene is synthesized and transformed to be expressed in pichia to form antibacterial-peptide gene transformation pichia engineering bacteria, and to be expressed in a fermentor to achieve the effects of high-density cultivation and efficient expression. Fermentation broth is separated and purified to be an antibacterial peptide product which can be applied to feed and food additives and be used as injection. The antibacterial peptide has the advantages of good antibacterial activity to most gram-negative bacteria and gram-positive bacteria, in particular better effects of inhibiting and killing ampicillin-resistant bacteria and kanamycin-resistant bacteria.
Description
Technical field
The present invention relates to a kind of preparation of novel genetic engineering antibiotic peptides, belong to the biotechnology technical field of medicament in the modern agricultural technology.
Background technology
Antibacterial peptide is the micromolecule polypeptide of a kind of biologically active through inducing generation in the organism, and molecular weight is made up of 20～60 amino-acid residues about 2000～7000.This class active polypeptide majority has characteristics such as strong basicity, thermostability and broad-spectrum antimicrobial.First found antibacterial peptide is to be induced through injection cloaca through rod bacterium and intestinal bacteria by people such as Sweden scientist G.Boman in 1980 to cherish the polypeptide with anti-microbial activity that guppy sky silkworm chrysalis produces in the world, names to be Cecropins.After this between the several years, people find from bacterium, fungi, batrachians, insect, higher plant, Mammals and even the mankind in succession and separate the polypeptide that obtains to have anti-microbial activity.Because it is found that this class active polypeptide has the broad-spectrum high efficacy fungicidal activity to bacterium at first, thereby called after " antibactetial peptides, ABP ", Chinese is translated into antibacterial peptide, its former antibacterium peptide that means.Along with carrying out in a deep going way of people's research work, find that some antibacterium peptide all has strong lethal effect to part fungi, protozoon, virus and cancer cells etc., thereby the many scholars of the name of this class active polypeptide are tended to be referred to as " peptide antibiotics "---peptide antibiotics.But because nearly all peptide antibiotics all has antibacterial function, thereby antibacterial peptide still is widely adopted at home as a title sanctified by usage.
Antibiotic abuse has not only caused public health unmentionable diseases such as drug residue, and because the appearance of Resistant strain makes the control of bacteriosis become the human difficult problem of puzzlement once more.A kind of exploitation of brand-new antibacterials has become current microbiology man, medical scholar and veterinary work person's main attack problem.Antibacterial peptide appears clear superiority owing to the antibacterial mechanisms of its broad-spectrum high efficacy anti-microbial activity and uniqueness in the novel antibacterial drug research.Particularly,, can design more effective antibacterial peptide in medicine industry and livestock industry, cause researchist's extensive concern especially in conjunction with the modern genetic engineering technology to deepening constantly that antibacterial peptide mechanism of action and gene expression regulation mechanism thereof are thought.According to the Ministry of Agriculture regulation, there is multiple microbiotic disabled or limit the use of, traditional livestock breeding industry has been caused great impact, will be trend of the times as the use of antibiotic good alternative medicine antibacterial peptide.
At present, the exploitation antibacterial peptide is comparatively successful is that the Helix BioMedix company of the U.S. and Canadian IntraBiotics drugmaker reasonably transform genetic engineering antibiotic peptides and suddenly change, further increase its antibacterial and fungicidal activity, the relation of studying its mechanism of action and 26S Proteasome Structure and Function has directive significance to livestock industry and production of antibiotics.
LL-37 is unique a kind of Cathelicidin class antibacterial peptide that is present in human body of finding up to now, is the activated C end fragment that is discharged behind Serine protease 3 and other proteolytic ferment enzymolysis by its precursor peptide Human cathelicidin antimicrobial peptide18 (hCAP-18).Experiment in vitro card LL-37 has broad-spectrum antibacterial action, and anti-microbial activity relies on the formation of its helical conformation, by " carpet sample " machine-processed kill bacteria.LL-37 except direct germicidal action, also have antitumor, in conjunction with in and intracellular toxin, chemotactic and promote effects such as vasculogenesis.
Summary of the invention
At the deficiencies in the prior art, the invention provides a kind of novel gene engineering antibacterial peptide and preparation method thereof.
Summary of the invention
The present invention is according to existing antibacterial peptide Magainin, the characteristics of the aminoacid sequence of Cecropin P and LL-37, designed new antibacterial peptide gene, synthetic its sequence transforms in pichia spp to be expressed, form antibacterial peptide gene and transformed Pichia yeast engineering, in fermentor tank, express the effect that reaches high-density culture and efficiently express.The fermented liquid separation and purification is become antimicrobial peptide products.
Detailed Description Of The Invention
Technical scheme of the present invention is as follows:
One, genetic engineering antibiotic peptides
Genetic engineering antibiotic peptides of the present invention has following sequence:
GCTCTC 6
GAGAAAAGAG?GTATTGGTAA?GTTTTTGCAT?TCTGCTAAGA?AGTTTGGTAA?GGCTTTTGTT?66
GGTGAGATTA?TGAACTCTGA?GAAAAGATCT?TGGTTGTCTA?AAACTGCTAA?AAAATTGGAA?126
AATTCTGCTA?AAAAGCGTAT?TTCTGAAGGT?ATTGCTATTG?CTATTCAAGG?TGGTCCACGT?186
GAGAAAAGAT?TGTTGGGTGA?CTTCTTCAGA?AAGTCCAAGG?AAAAGATCGG?TAAGGAGTTC?246
AAGAGAATCG?TCCAGAGAAT?CAAGGACTTC?TTGAGGAACT?TGGTCCCAAG?AACTGAATCC?306
CAATGATCTA?GAAGT 321
Two, the preparation of genetic engineering antibiotic peptides
The preparation method of genetic engineering antibiotic peptides of the present invention, step is as follows:
1) synthetic antibacterial peptide gene
According to the aminoacid sequence of three antibacterial peptide Magainin, Cecropin P among the GenBank (gene pool) and LL-37, select pichia spp preference codon for use, design 6 primer M1, M2, C1, C2, L1 and L2.The complementary sequence that 20bp is arranged between M2 and C1, C2 and L1 primer, wherein M1 primer 5 ' end adds Xho I restriction enzyme site and zymic Kex2 enzymatic lysis site sequence, and L2 primer 5 ' end adds Xba I restriction enzyme site.Between these three antibacterial peptide sequences, add zymic Kex2 enzymatic lysis site sequence, the terminal glutamine (Gln) of introducing of gene, simultaneously, synthetic pichia spp universal primer 5 ' AOX and 3 ' AOX carry out SOE method pcr amplification as primers designed.
XhoI
M1：5’-GCT
AAAAGAGGTATTGGTAAGTTTTTGCATTCTGCTAAGAAGTTTGG-3’
M2：5’-CTCAGAGTTCATAATCTCACCAACAAAAGCCTTACCAAACTTCTTAGCAGAATG-3’
C1：5’-GAGATTATGAACTCTGAGAAAAGATCTTGGTTGTC-3’
C2：5’-ACCCAACAATCTTTTCTCACGTGGACCACCTTGAATAGC-3’
L1：5’-GAGAAAAGATTGTTGGGTGACTTCTTCAGAAAGTCC-3’
XbaI
L2：5’-ACT
TCATTGGGATTCAGTTCTTGGGACCAAGTTCCTCAAGAAGTC-3’
5’AOX：5’-GACTGGTTCCAATTGACAAGC-3’
3’AOX：5’-GCAAATGGCATTCTGACATCC-3’
2) will directly carry out Xho I, Xba I double digestion after the above-mentioned PCR product recovery, the directed insertion among Yeast expression carrier pPICZ α-A makes up the expression of recombinant yeast plasmid.Identify positive plasmid with EcoR I restriction enzyme site deletion method and PCR method, the positive plasmid called after pPICZa-mcl of evaluation also checks order.
3) competence Pichia yeast X-3380uL mixes mutually with the linearizing recombinant expression vector 10uL of Sac I, transfer in the quartzy electric revolving cup of 0.2cm of precooling, to the competence yeast X-33 conversion of shocking by electricity, conversion product.Getting the 0.1mL conversion product evenly coats and contains 100 μ g/mL Zeocin
TMPlain YPDS (Yeast Extract Peptone Dextrose sorbitoMediuml, Pichia yeast collective media) selects on the flat board, and 30 ℃ have been cultured to high copy recombinant bacterial strain and have got single bacterium colony appearance.
Adopt round pcr detection mcl gene and the genomic integration of pichia spp, screening positive clone.Get positive recombinant, be antibacterial peptide yeast HC/X-33.
4) positive recombinant that step 3) is screened is inoculated in 5mL and contains 100 μ g/ml Zeocin
TMThe YPDS liquid nutrient medium in, 28-30 ℃ of 220-300r/min overnight incubation, transfer in 100mL BMGY substratum in the ratio of 1:50 next day, and 28-30 ℃ of 220-300r/min is cultured to A600 and reaches 3～6, centrifugal collection thalline is resuspended in 500mL BMMY substratum, carries out abduction delivering.28-30 ℃, 220-300r/min cultivates 48-72h.Behind the 48-72h, the centrifugal 10min of 8000-12000r/min collects culture supernatant, carries out bacteriostatic activity and measures.
The antibacterial peptide that obtains of step 4) is to be transformed by the saccharomycetes to make fermentation after the gene recombination to obtain herein, and purpose is to detect the abduction delivering situation of recombination yeast, is to be testing goal.
In order to prepare the goods of antibacterial peptide, need carry out following fermentative production step:
5) fermentation
The activated back of positive recombinant (being antibacterial peptide yeast HC/X-33) that step 3) screens is inserted in the triangular flask according to the 1%-5% inoculum size, 28-30 ℃, inoculum size with 7%-20% behind the 220-250r/min shaking table cultivation 16-18h inserts fermentor tank, at 28-30 ℃, 450-500r/min, tank pressure is 0.05-0.07Pa, ventilation is 60-80NL/min, pH5.5-6.0, dissolved oxygen is not less than under 40% the condition and ferments, stream adds the methyl alcohol of 0.5-1% when cultivating 18-24h, and whole fermentation continues 48-72h.Above-described per-cent is volume percent.
Feed 100 ℃ of steam 10-15min then, sterilization, blowing, 4 ℃-10 ℃ centrifugal removal thalline of fermented liquid make work in-process after micro-filtration and ultrafiltration, 60 ℃ of concentrating under reduced pressure 10-50 doubly add the modified starch auxiliary material, and spraying drying obtains the goods of novel gene engineering antibacterial peptide.
Three, the application of novel gene engineering antibacterial peptide
With above-mentioned steps 5) goods that obtain novel gene engineering antibacterial peptide are as the additive of feed or food.
The present invention utilizes original pichia spp preference codon transformation development, and the antibacterial peptide inhibitory potency that obtains is good, and the expression amount height has higher ph stability and thermostability, can be applicable in feed and the foodstuff additive and as injection; Most Gram-negative bacterias and gram-positive microorganism all have bacteriostatic activity preferably, particularly the bacterium of amicillin resistance and the bacterium of kalamycin resistance are pressed down better effects if extremely.
Description of drawings
Fig. 1 is gene fragment splicing (2%wt agarose) electrophoresis photo, swimming lane M::DL2000; Swimming lane 1:cecropinP fragment; Swimming lane 2:LL-37 fragment; Swimming lane 3:magainin fragment; Swimming lane 4:magainin and cecropin P splicing back fragment; Swimming lane 5:magainin, cecropin P and LL-37 splicing back fragment.
Fig. 2 is that PCR identifies and EcoR I restriction enzyme site disappearance evaluation (1%agarose) electrophoresis photo, swimming lane M::DL2000; Swimming lane 1:PCR identifies; Swimming lane 2: positive plasmid EcoR I enzyme is cut; Swimming lane 3:pPICZ α-A plasmid EcoR I enzyme is cut.
Fig. 3 is: the PCR of composite antibiosis peptide restructuring yeast strains X-33/pPICZ α-mcl identifies (1%agarose) swimming lane M::DL2000; Swimming lane 1,2: with mcl gene self primer pcr amplification result; Swimming lane 2: with yeast universal primer PCR amplification.
Fig. 4 is the bacteriostatic activity of MCL antibacterial peptide to streptococcus aureus, and wherein, 11～14 is different positive colony bacterial strains, A
+Be the Amp positive control.
Embodiment
Below in conjunction with embodiment the present invention is described in further details, but is not limited thereto.
Embodiment 1:
1) antibacterial peptide MCL gene design and SOE splicing
According to several antibacterial peptide Magainin among the GenBank, the aminoacid sequence of Cecropin P and LL-37, select pichia spp preference codon for use, according to existing Cecropin P in company laboratory and LL-37 plasmid, 6 primer: the M1 that utilized DNAStar, primerpremier5.0 software design, M2, C1, C2, L1 and L2, M2 and C1 have the complementary sequence of 20bp between C2 and L1 primer, wherein M1 primer 5 ' end adds Xho I restriction enzyme site and zymic Kex2 enzymatic lysis site sequence, and L2 primer 5 ' end adds Xba I restriction enzyme site.Add zymic Kex2 enzymatic lysis site sequence between 3 antibacterial peptide sequences, the terminal glutamine (Gln) of introducing of gene, glutamine in theory then can strengthen the anti-microbial activity of antibacterial peptide.The primer relation meets the requirement of geneSOEing (gene splicing by overlap extension).Synthetic simultaneously pichia spp universal primer 5 ' AOX and 3 ' AOX by pcr amplification and SOE splicing, have obtained the fragment of about 310bp as primers designed, and be consistent with expection mcl gene fragment size, sees Fig. 1.
Xho?I
M1：5’-GCT
AAAAGAGGTATTGGTAAGTTTTTGCATTCTGCTAAGAAG
TTTGG-3’
M2：
5’-CTCAGAGTTCATAATCTCACCAACAAAAGCCTTACCAAACTTCTTAGCAGAA
TG-3’
C1：5’-GAGATTATGAACTCTGAGAAAAGATCTTGGTTGTC-3’
C2：5’-ACCCAACAATCTTTTCTCACGTGGACCACCTTGAATAGC-3’
L1：5’-GAGAAAAGATTGTTGGGTGACTTCTTCAGAAAGTCC-3’
XbaI
L2
5’-ACT
TCATTGGGATTCAGTTCTTGGGACCAAGTTCCTCAAGAAGT
C-3’
5’AOX：5’-GACTGGTTCCAATTGACAAGC-3’
3’AOX：5’-GCAAATGGCATTCTGACATCC-3’
2) structure of antibacterial peptide restructured Pichia pastoris in expression carrier and sequencing
Pcr amplification and the spliced product of SOE are directly carried out Xho I, Xba I double digestion, and directed the insertion among the Yeast expression carrier pPICZa-A makes up the expression of recombinant yeast plasmid.Owing to do not have proper restriction site in the MCL gene fragment, so identify positive plasmid with EcoR I restriction enzyme site deletion method and PCR method, the positive plasmid called after pPICZa-mcl that identifies also checks order, verify that 100% is correct, and correctly inserted the downstream of the Kex2 protease cracking site of carrier, read the consistent (see figure 2) of frame with α-factor.
Below be the codon aminoacid sequence of MCL gene nucleotide series correspondence,
*What represent is terminator codon.
GCTCTC
7 GAGAAAAGAGGTATTGGTAAGTTTTTGCATTCTGCTAAGAAGTTTGGTAAGGCTTTTGTT
1 E K R G I G K F L H S A K K F G K A F V
67 GGTGAGATTATGAACTCTGAGAAAAGATCTTGGTTGTCTAAAACTGCTAAAAAATTGGAA
21 G E I M N S E K R S W L S K T A K K L E
127?AATTCTGCTAAAAAGCGTATTTCTGAAGGTATTGCTATTGCTATTCAAGGTGGTCCACGT
41 N S A K K R I S E G I A I A I Q G G P R
187?GAGAAAAGATTGTTGGGTGACTTCTTCAGAAAGTCCAAGGAAAAGATCGGTAAGGAGTTC
61 E K R L L G D F F R K S K E K I G K E F
247?AAGAGAATCGTCCAGAGAATCAAGGACTTCTTGAGGAACTTGGTCCCAAGAACTGAATCC
81 K R I V Q R I K D F L R N L V P R T E S
307?CAATGATCTAGAAGT
101 Q *
3) antibacterial peptide is to the conversion and the phenotypic evaluation of yeast cell
Competence Pichia yeast X-3380uL mixes mutually with the linearizing recombinant expression vector 10uL of Sac I, transfer in the quartzy electric revolving cup of 0.2cm of precooling, after ice was put 5 minutes, quartzy electricity transformed cup and used for 70% ethanol cleaning and dipping half an hour in advance, and rearmounted purple is turned off the light down and shone half an hour.Dry the moisture on the quartzy electricity conversion cup outer wall, the groove of putting into BioRad GenePulse electricity conversion instrument is with 1.5kV, and 25 μ F shock by electricity under the condition of 200 Ω, after the end, add the D-sorbyl alcohol of 1mL1mol/L immediately, mixing.Inclusion transferred in the 5mL sterilization centrifuge tube place 30 ℃ of incubators to leave standstill 1.5～2h.
Getting 0.1mL evenly coats and contains 100 μ g/mL Zeocin
TMPlain YPDS selects on the flat board, and 30 ℃ have been cultured to high copy recombinant bacterial strain and have got single bacterium colony appearance.
Half of the height that screens copy recombinant bacterial strain being got single bacterium colony is put in the Eppendof pipe, add 50 μ LTE (pH8.0), employing boils-freezes-and cooking method prepares the pichia spp genomic dna, utilize general primers designed 5 ' AOX and 3 ' AOX to carry out PCR and identify, get 5 μ LPCR products after electrophoresis finishes with 1% agarose gel electrophoresis observations.
Get the above-mentioned institute genome of carrying as template, carry out PCR with sequencing primer 5 ' AOX and 3 ' AOX and gene self primer M1, L2.Result (Fig. 3) shows, has obtained the positive colony bacterial strain, and the mcl gene has been incorporated into pichia spp X-33 genome.
The PCR reaction system is: 10 * PCR Buffer2.5 μ L, 25mM Mg
2+1.5 μ L, 2.5mmol/L dNTP1 μ L, primer 10.25 μ L, primer 2 0.25 μ L, pastoris genomic dna 2.5 μ L, rTaq enzyme 0.25 μ L, ddH
2O16.75 μ L, total system 25 μ L.
PCR response procedures: 94 ℃ of 5min; 94 ℃ of 1.0min; 55 ℃ of 1.0min; 72 ℃ of 1.0min so carry out 30 circulations; 72 ℃ of 10min.
4) abduction delivering of yeast recon
The positive recombinant HC/X-33 that screens is inoculated in 5mL contains 100 μ g/ml Zeocin
TMThe YPDS liquid nutrient medium in, 28-30 ℃ of 220-300r/min overnight incubation, transfer in 100mL BMGY (2%peptone-Y in the ratio of 1:50 next day, 1%yeast extract, 1.34%YNB, 0.4mg/L vitamin H, 1% glycerine, the 100mmol/L phosphate buffered saline buffer) substratum, 28-30 ℃ of 220-300r/min is cultured to A600 and reaches 3～6, centrifugal collection thalline is resuspended in 500mL BMMY (2%peptone-Y, 1%yeast extract, 1.34%YNB, 0.4mg/L vitamin H, 0.5% methyl alcohol, the 100mmol/L phosphate buffered saline buffer) substratum carries out abduction delivering.28-30 ℃, 220-300r/min cultivates 48-72h.Behind the 48-72h, the centrifugal 10min of 8000-12000r/min collects culture supernatant, carries out bacteriostatic activity and measures.
5) the preliminary bacteriostatic activity of antibacterial peptide is measured
Employing standard agar hole diffusion process is a test strain with streptococcus aureus Cowan I, will be for examination bacterium suspension (D
600=0.2-0.3) pave plate behind the LB solid medium 25mL mixing of 200 μ L and 55 ℃ and treat that it solidifies after, punch tool (diameter 5mm) punching with the bacterium of going out, drip 20 μ L expression supernatant to be measured in the hole, cultivate 8-12h for 37 ℃, with the positive contrast of Amp, measured bacteriostatic diameter on the 2nd day, and can obtain MCL antibacterial peptide bacteriostatic activity height, can good fungistatic effect be arranged thalline by Fig. 4.
Embodiment 2: the goods of engineering antibacterial peptide
Yeast HC/X-33 after the gene recombination that embodiment 1 step 3) is obtained inserts in the triangular flask according to 3% inoculum size activated back, 28-30 ℃, inoculum size with 15% behind the 220-250r/min shaking table cultivation 17h inserts fermentor tank, at 28-30 ℃, 450-500r/min, tank pressure are 0.05-0.07Pa, ventilation is 60-80NL/min, the pH5.5-6.0 dissolved oxygen is not less than under 40% the condition and ferments, and stream adds 0.8% methyl alcohol when cultivating 20h, and whole fermentation continues 48-72h.Above-described per-cent is volume percent.
Sequence table
＜110〉Shandong Sinostar Bioscience and Technology Co., Ltd.
＜120〉a kind of genetic engineering antibiotic peptides and preparation method thereof and application
<160>1
<210>1
<211>321
<212>DNA
<400>1
Claims (4)
1. a genetic engineering antibiotic peptides is characterized in that, by following nucleotide sequence coded:
GCTCTC 6
GAGAAAAGAG?GTATTGGTAA?GTTTTTGCAT?TCTGCTAAGA?AGTTTGGTAA?GGCTTTTGTT 66
GGTGAGATTA?TGAACTCTGA?GAAAAGATCT?TGGTTGTCTA?AAACTGCTAA?AAAATTGGAA 126
AATTCTGCTA?AAAAGCGTAT?TTCTGAAGGT?ATTGCTATTG?CTATTCAAGG?TGGTCCACGT 186
GAGAAAAGAT?TGTTGGGTGA?CTTCTTCAGA?AAGTCCAAGG?AAAAGATCGG?TAAGGAGTTC 246
AAGAGAATCG?TCCAGAGAAT?CAAGGACTTC?TTGAGGAACT?TGGTCCCAAG?AACTGAATCC 306
CAATGATCTA?GAAGT 321。
2. the preparation method of the genetic engineering antibiotic peptides of claim 1, step is as follows:
1) synthetic antibacterial peptide gene
According to the aminoacid sequence of three antibacterial peptide Magainin, Cecropin P among the GenBank and LL-37, select pichia spp preference codon for use, design 6 primer M1, M2, C1, C2, L1 and L2; The complementary sequence that 20bp is arranged between M2 and C1, C2 and L1 primer, wherein M1 primer 5 ' end adds Xho I restriction enzyme site and zymic Kex2 enzymatic lysis site sequence, and L2 primer 5 ' end adds Xba I restriction enzyme site; Between these three antibacterial peptide sequences, add zymic Kex2 enzymatic lysis site sequence, the terminal glutamine of introducing of gene, simultaneously, synthetic pichia spp universal primer 5 ' AOX and 3 ' AOX carry out SOE method pcr amplification as primers designed;
XhoI
M1：5’-GCT?
AAAAGAGGTATTGGTAAGTTTTTGCATTCTGCTAAGAAGTTTGG-3’
M2：5’-CTCAGAGTTCATAATCTCACCAACAAAAGCCTTACCAAACTTCTTAGCAGAATG-3’
C1：5’-GAGATTATGAACTCTGAGAAAAGATCTTGGTTGTC-3’
C2：5’-ACCCAACAATCTTTTCTCACGTGGACCACCTTGAATAGC-3’
L1：5’-GAGAAAAGATTGTTGGGTGACTTCTTCAGAAAGTCC-3’
XbaI
L2：5’-ACT?
TCATTGGGATTCAGTTCTTGGGACCAAGTTCCTCAAGAAGTC-3’
5’AOX：5’-GACTGGTTCCAATTGACAAGC-3’
3’AOX：5’-GCAAATGGCATTCTGACATCC-3’
2) will directly carry out Xho I, Xba I double digestion after the above-mentioned PCR product recovery, the directed insertion among Yeast expression carrier pPICZ α-A makes up the expression of recombinant yeast plasmid; Identify positive plasmid with EcoR I restriction enzyme site deletion method and PCR method, the positive plasmid called after pPICZa-mcl of evaluation also checks order;
3) competence Pichia yeast X-33 80uL mixes mutually with the linearizing recombinant expression vector 10uL of Sac I, transfer in the quartzy electric revolving cup of 0.2cm of precooling, to the competence yeast X-33 conversion of shocking by electricity, conversion product; Getting the 0.1mL conversion product evenly coats and contains 100 μ g/mL Zeocin
TMPlain YPDS selects on the flat board, and 30 ℃ have been cultured to high copy recombinant bacterial strain and have got single bacterium colony appearance;
Adopt round pcr detection mcl gene and the genomic integration of pichia spp, screening positive clone; Get positive recombinant, be the antibacterial peptide yeast;
4) positive recombinant that step 3) is screened is inoculated in 5mL and contains 100 μ g/m1Zeocin
TMThe YPDS liquid nutrient medium in, 28-30 ℃ of 220-300r/min overnight incubation, transfer in 100mLBMGY substratum in 1: 50 ratio next day, and 28-30 ℃ of 220-300r/min is cultured to A600 and reaches 3～6, centrifugal collection thalline is resuspended in 500mL BMMY substratum, carries out abduction delivering; 28-30 ℃, 220-300r/min cultivates 48-72h; Behind the 48-72h, the centrifugal 10min of 8000-12000r/min collects culture supernatant, carries out bacteriostatic activity and measures.
3. the goods of the described antibacterial peptide of claim 1, the activated back of positive recombinant that claim 2 step 3) screens is inserted in the triangular flask according to the 1%-5% inoculum size, 28-30 ℃, inoculum size with 7%-20% behind the 220-250r/min shaking table cultivation 16-18h inserts fermentor tank, at 28-30 ℃, 450-500r/min, tank pressure is 0.05-0.07Pa, ventilation is 60-80NL/min, pH5.5-6.0, dissolved oxygen is not less than under 40% the condition and ferments, and stream adds the methyl alcohol of 0.5-1% when cultivating 18-24h, and whole fermentation continues 48-72h;
Feed 100 ℃ of steam 10-15min then, sterilization, blowing, 4 ℃-10 ℃ centrifugal removal thalline of fermented liquid make work in-process after micro-filtration and ultrafiltration, and 60 ℃ of concentrating under reduced pressure 10-50 doubly add the modified starch auxiliary material, and spraying drying obtains the goods of genetic engineering antibiotic peptides.
4. the goods of the described genetic engineering antibiotic peptides of claim 3 are as the Application of Additives of feed or food.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810157206XA CN101450964B (en) | 2008-09-25 | 2008-09-25 | Genetic engineering antibiotic peptides as well as preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810157206XA CN101450964B (en) | 2008-09-25 | 2008-09-25 | Genetic engineering antibiotic peptides as well as preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101450964A CN101450964A (en) | 2009-06-10 |
| CN101450964B true CN101450964B (en) | 2011-08-10 |
Family
ID=40733465
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810157206XA Active CN101450964B (en) | 2008-09-25 | 2008-09-25 | Genetic engineering antibiotic peptides as well as preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101450964B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816770A (en) * | 2012-08-30 | 2012-12-12 | 浙江大学 | Cotesia plutellae antimicrobial peptide defensin gene, antimicrobial peptide and application |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101979649B (en) * | 2010-10-13 | 2013-01-02 | 山东华辰生物科技有限公司 | Method for controlling Pichia pastoris to ferment to produce antibacterial peptide by utilizing dissolved oxygen parameters |
| CN102174623B (en) * | 2011-01-18 | 2013-11-13 | 深圳市圣西马生物技术有限公司 | Fermentation method and application of yeast engineering bacteria |
| CN102907583B (en) * | 2012-10-27 | 2018-06-15 | 北京大北农科技集团股份有限公司 | 2 spray powder of pig beta-defensin, feed addictive, premix and batch |
| CN102965390A (en) * | 2012-12-11 | 2013-03-13 | 河南省康星药业股份有限公司 | Fermentation production method for antibacterial peptide LP gene transformed yeasts |
| CN105017390B (en) * | 2015-06-29 | 2018-02-23 | 广东海纳川生物科技股份有限公司 | Antibacterial peptide His6K and its application |
| CN105968214A (en) * | 2016-06-21 | 2016-09-28 | 中国农业大学 | Antibacterial and antiviral hybrid peptide as well as preparation method and application thereof |
| CN107267537B (en) * | 2017-07-13 | 2020-07-28 | 陕西科技大学 | Preparation method of hybrid antibacterial peptide M L H |
| CN109924571B (en) * | 2019-04-24 | 2020-11-06 | 浙江红雨医药用品有限公司 | Antibacterial mask |
| CN110305890A (en) * | 2019-07-02 | 2019-10-08 | 河南城建学院 | The novel 5 kinds of antibacterial peptides expressing in series recombination engineering construction method of one kind and its application |
| CN114540405A (en) * | 2022-03-04 | 2022-05-27 | 成都大学 | Method for improving yield of pichia pastoris antibacterial peptide LL-37 and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1896107A (en) * | 2006-06-13 | 2007-01-17 | 南京农业大学 | Cecropin A-magainin hybrid gene engineering bactericidal peptide |
-
2008
- 2008-09-25 CN CN200810157206XA patent/CN101450964B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1896107A (en) * | 2006-06-13 | 2007-01-17 | 南京农业大学 | Cecropin A-magainin hybrid gene engineering bactericidal peptide |
Non-Patent Citations (3)
| Title |
|---|
| A. J. Moore等.Antimicrobial activity of cecropins.《Journal of Antimicrobial Chemotherapy》.1996,第37卷1077-1089. * |
| M. ZASLOFF.Magainins, a class of antimicrobial peptides from Xenopus skin: Isolation, characterization of two active forms, and partial cDNA sequence of a precursor.《Proc. Natl. Acad. Sci.》.1987,第84卷5449-5453. * |
| Z. Oren等.Structure and organization of the human antimicrobial peptide LL-37 in phospholipid membranes: relevance to the molecular basis for its non-cell-selective activity.《Biochem. J.》.1999,第341卷501-513. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816770A (en) * | 2012-08-30 | 2012-12-12 | 浙江大学 | Cotesia plutellae antimicrobial peptide defensin gene, antimicrobial peptide and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101450964A (en) | 2009-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101450964B (en) | Genetic engineering antibiotic peptides as well as preparation method and application thereof | |
| CN102199581B (en) | Zearalenone toxin degradation enzyme and coding gene and application thereof | |
| Druzhinina et al. | Familiar stranger: ecological genomics of the model saprotroph and industrial enzyme producer Trichoderma reesei breaks the stereotypes | |
| CN101173260B (en) | Representation of high disinfection vitality T4 lysozyme in yeast and producing method thereof | |
| CN102676477A (en) | Transformation of acidic beta-mannase gene and construction of engineering bacteria of acidic beta-mannase gene | |
| CN102181469A (en) | Recombinant spore for displaying human serum albumin on surface of bacillus subtilis and preparation method thereof | |
| CN104974974A (en) | Saccharopolyspora spinosa high-pleocidin-yield engineering strain and application thereof | |
| CN102304484A (en) | New strain of pseudoalteromonas flavipulchra and use thereof | |
| CN102443560A (en) | Gene engineering bacterium for high efficiency conversion of echinocandin B and preparation method thereof | |
| CN108103036A (en) | A kind of novel laccase enzyme and its gene, engineering bacteria, preparation and application | |
| CN115873733B (en) | Pichia pastoris strain for high yield of lysozyme and application thereof | |
| CN102061303B (en) | Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product | |
| CN107475222A (en) | The heat-resisting human lysozyme of genetic engineering transformation | |
| Mojsov | New and future developments in microbial biotechnology and bioengineering | |
| CN101314762A (en) | Yeast engineering bacterium for expression recombination of rainbow trout antimicrobial peptide Oncorhyncin II and preparation method thereof | |
| CN101165172B (en) | Recombination methyl nourishment bacillus and application thereof | |
| CN102093998A (en) | Preparation method of antibacterial peptide cecropin feed additive | |
| CN102080079B (en) | Preparation method and application of novel antimicrobial peptide Misgurin mutant | |
| CN106434394B (en) | Aureobasidium pullulans alb1 gene knockout mutant strain and its application | |
| CN105753958B (en) | A kind of Novel fish derived antimicrobial peptide mutant and its preparation method and application | |
| CN104164441A (en) | Three glufosinate-resistant rice cytoplasm type glutamine synthetase mutants | |
| CN108948160A (en) | A kind of Lactococcus lactis antibacterial peptide, preparation method and application | |
| CN105062906B (en) | A kind of production method optimizing organophosphor hydrolytic enzyme Yeast engineering bacteria and its enzyme | |
| CN103045629A (en) | Lactase glucose depression knockout vector pMD19/HPT | |
| CN107022534B (en) | Preparation of oyster cell wall hydrolase recombinant protein and application of recombinant protein obtained by preparation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Jiang Zhengjun Inventor after: Liu Shaojie Inventor after: Liu Lulu Inventor after: Chen Buyan Inventor after: Liu Gang Inventor after: Kuang Baoxiao Inventor after: Wang Shaojuan Inventor after: Xu Zhenlong Inventor after: Su Xiaoming Inventor after: Cui Liping Inventor after: Wang Maochao Inventor before: Jiang Zhengjun Inventor before: Chen Buyan Inventor before: Liu Gang Inventor before: Xu Zhenlong Inventor before: Su Xiaoming Inventor before: Cui Liping Inventor before: Wang Maochao Inventor before: Liu Shaojie Inventor before: Liu Lulu |
|
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 261061 Weifang high tech Zone, Shandong Chang Shun Street, No. 207 Patentee after: Shandong Huachen Pharmaceutical Co., Ltd. Address before: 262610 Weifang high tech Zone, Jin Road, No. 516, No. Patentee before: Shandong Sinostar Bioscience and Technology Co., Ltd. |