CN101445804B - A plasmid mediating recipient bacteria for decreased sensibility to quinolones antibacterial drugs - Google Patents

A plasmid mediating recipient bacteria for decreased sensibility to quinolones antibacterial drugs Download PDF

Info

Publication number
CN101445804B
CN101445804B CN2007100466143A CN200710046614A CN101445804B CN 101445804 B CN101445804 B CN 101445804B CN 2007100466143 A CN2007100466143 A CN 2007100466143A CN 200710046614 A CN200710046614 A CN 200710046614A CN 101445804 B CN101445804 B CN 101445804B
Authority
CN
China
Prior art keywords
gene
quinolones
plasmid
antibacterial drugs
qnrc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2007100466143A
Other languages
Chinese (zh)
Other versions
CN101445804A (en
Inventor
王明贵
王明华
徐晓刚
张婴元
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huashan Hospital of Fudan University
Original Assignee
Huashan Hospital of Fudan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huashan Hospital of Fudan University filed Critical Huashan Hospital of Fudan University
Priority to CN2007100466143A priority Critical patent/CN101445804B/en
Publication of CN101445804A publication Critical patent/CN101445804A/en
Application granted granted Critical
Publication of CN101445804B publication Critical patent/CN101445804B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the field of microbiology, and relates to a plasmid of mediateable recipient bacteria with decreased sensibility to quinolones antibacterial drugs, the plasmid-supported mediateable gram negative bacilli to the quinolones drug resistant gene, and preparation method and use of the gene. The invention aims to the productive system of the drug resistance of the quinolones antibacterial drugs to find a new gene capable of mediating bacteria to be drug-resistant, and experiment result shows that the drug resistance of the quinolones antibacterial drugs is caused by the drug resistant gene qnrC. According to the quinolones drug resistant gene, a PCR primer to the gene is designed, and is capable of detecting other bacterial strains having the same gene. The invention can be used for the research of quinolones drug resistant system, further controlling the formation of the drug resistance and the detection of the drug resistant bacterial strains, and possibly used as the potential target acted by the antibacterial drugs.

Description

A kind of plasmid that mediates recipient bacterium to the decline of carbostyril family antibacterial drugs susceptibility
Technical field
The invention belongs to the microbiology field, relate to a kind of plasmid that recipient bacterium descends to carbostyril family antibacterial drugs susceptibility that mediates, the mediated gram negative bacilli that this plasmid carries is to the drug resistant gene of quinolones, and the preparation method and the purposes of this gene.
Background technology
Carbostyril family antibacterial drugs is widely used in treatment urinary tract infections, respiratory tract infection, abdominal cavity infection etc., but along with the increasing of clinical application, bacterium rises rapidly to the resistance of quinolones.In China, escherichia coli rises rapidly to the resistance of quinolones, and resistant rate occupies first of the whole world at present, is much higher than other countries.According to domestic bacterial drug resistance monitoring materials, when quinolones began to use at home in 1988, escherichia coli is almost all responsive to it, resistant rate only is 0～3%, but (1992-1993) promptly increases sharply to 41%～54% after the several years, and each metropolitan report resistant rate of the 1999-2004 whole nation all is higher than 50%, and the part report is higher than 70%.Has the statistics of closing, at present other countries' escherichia coli shows the resistant rate of quinolones: Spain community infect be 12%, hospital infection 20%, Latin America hospital infection 13%, West Europe hospital infection 8%, Britain and Canadian hospital infection 3%～3.7%, United States Hospital and community infect and all are about 5%.Domestic other gram negative bacillis are also quite high to the resistance of quinolones simultaneously, and the clinical separation Pseudomonas aeruginosa in area, Shanghai in 2003, klebsiella spp, enterobacter and acinetobacter bacterium reach 19%～42% to the resistant rate of Ciprofloxacin.
Discover that bacterium is mainly target position (DNA gyrase and topoisomerase I V) to the resistance mechanism of quinolones and changes and initiatively efflux, both are the karyomit(e) mediation.The DNA gyrase is made up of GyrA and GyrB2 subunit, topoisomerase I V is made up of ParC and ParE accordingly, catastrophe point position pilosity is born in the quinolone resistance determining area (quinolone-resistance-determiningregion of GyrA and ParC, QRDR), the common mutations site of GyrA is 83 and 87, and the most common site of PareC is 80 and 84.Compare with GryA and ParC, the mutation rate of GyrB and ParE is relatively low.As for the mechanism of effluxing, the effect that effluxes of escherichia coli is relevant with AcrAB-TolC, EmrAB and the outer heat-extraction system of MdfA, has the minimizing of membranin OmpF simultaneously; Pseudomonas aeruginosa relates to 4 MexAB-OprM of efflux pump system, MexCD-OprJ, MexEF-OprN and MexXY-OprM.
Above-mentioned chemical sproof formation is by due to the chromosome mutation, but Jacoby experiment group obtained 1 R-plasmid in 1 strain Klebsiella Pneumoniae clinical isolates in 1998, when this plasmid is transferred to other bacteriums, bacterium rises 4～16 times to the minimum inhibitory concentration of quinolones, has confirmed to exist in the gram negative bacilli plasmid-mediated quinolones resistance first.Drug resistant gene is cloned out subsequently, and its length is 657 Nucleotide, 218 the amino acid whose albumen of encoding.The initial called after qnr of this gene is owing to find the similar gene qnrB of more qnr, qnrS afterwards again, existing called after qnrA.Get QnrA albumen at external purifying and can protect DNA gyrase and topoisomerase, bacterium is reduced quinolones susceptibility.Follow-up qnrS and the qnrB of in Shigella flexneri and kerekou pneumonia bacterium, finding, similar with the effect of qnrA.These genes have been found the hypotype that some homologies are higher, after said gene, add Arabic numerals by the priority of finding and name, as: qnrA1, qnrB1, qnrS1 etc.These are discovered and show, the extensive existence of plasmid-mediated quinolones resistance in various gram negative bacilli clinical strains.
Summary of the invention
The objective of the invention is for solving the chemical sproof problem of clinical application, especially solve the chemical sproof problem of quinolones and be research and development novel carbostyril antibacterials, a kind of plasmid that recipient bacterium descends to carbostyril family antibacterial drugs susceptibility that mediates is provided.
The present invention also provides mediated gram negative bacilli that this plasmid the carries drug resistant gene to quinolones, and the preparation method of this gene,
The present invention further provides the method that detects above-mentioned drug resistant gene.
Clinical practice shows that the greatest problem of quinolones clinical application at present is the bacterial drug resistance height, influences clinical efficacy.The present invention sets about from the mechanism that the quinolones resistance produces, and searching can mediate the new gene of bacterial resistance, with the research and development of chemical sproof formation of further control and promotion novel carbostyril antibacterials.
The present invention is the donor bacterium with clinical isolating gram negative bacilli strain, with E.coli J53Az R(provide by the David C.Hooper of the total institute in masschusetts, u.s.a, contact method and strain characteristic are seen Antimicrob.Agents Chemother.2003,47:2242-2248.) be recipient bacterium, by joint experiment well known in the art, acquisition can mediate recipient bacterium E.coli-J53Az RPlasmid to the decline of carbostyril family antibacterial drugs susceptibility.
Described donor bacterium is clinical separation Proteus mirabilis, be numbered 06-489, according to the regulation of budapest treaty, this donor bacterium is stored in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC, BeiJing, China) on September 26th, 2007; Preserving number: CGMCC2189.
The described plasmid called after pHS10 that carbostyril family antibacterial drugs susceptibility is descended, the base pair population size of this plasmid is 100-120kb, the quinolones Ciprofloxacin is 0.125 μ g/ml to containing the zygosporic minimum inhibitory concentration of this plasmid (MIC).
The pHS10 that the present invention adopts the HindIII restriction enzyme that zygote is extracted carries out enzyme and cuts.Enzyme is cut behind the product purification and carrier pUC18 (Takara, Dalian, China) connect, connect product and be converted into competent cell DH5 α (Tiangen Biotech, Beijing, China), use contains tryptone soy agar (TSA, Oxoid, the Britain) plate screening of Ciprofloxacin, Ampicillin Trihydrate, success obtains transformant, and Ciprofloxacin also is 0.125 μ g/ml to the MIC of this transformant.
The invention provides the polynucleotide that come from gram negative bacilli:
Extract the plasmid of this above-mentioned transformant, obtain the nucleotide sequence of a 4409bp by the walking method order-checking.Use the DNAStar sequence analysis software sequence is carried out bioinformatic analysis, find to comprise in it 3 opening code-reading frames (ORF) (see figure 1), by NCBI BLAST (http://www.ncbi.nlm.nih.gov/BLAST/)Online sequence alignment, find that one of them length is that the coded proteic aminoacid sequence of ORF sequence (base 1846 to 2382 of Seq.ID.NO..1) of 537 Nucleotide is Seq.ID.NO..2, with known QnrA1, QnrS1, QnrB1 has homology, be respectively 67.6%, 63.1% and 48.0%, naming this gene order is qnrC, and its encoded protein is the QnrC (see figure 2).Two ORF of its upstream and downstream are respectively intergrase sample gene and Ntn hydrolase sample gene (see figure 1) through the BLAST compare of analysis, and length is respectively 627 (intergrase sample genes) and the individual Nucleotide of 1224 (Ntn hydrolase sample genes).
For further clear and definite quinolones resistance is by the qnrC gene mediated, get rid of the influence of qnrC upstream and downstream gene, described qnrC is cloned again, the complete sequence that only comprises qnrC is cloned into pMD19 (Takara, Dalian, Chinese), and be converted into DH5 α, the transformant of acquisition, adopt Etest test strip (AB BioDisk, Sweden) MIC of mensuration transformant Ciprofloxacin, result show that the transformant that contains recombinant plasmid rises to the resistance of Ciprofloxacin equally.And to the clone of two other ORF (upstream and downstream), do not screen transformant with above-mentioned Ciprofloxacin, Ampicillin Trihydrate screening flat board, the coded product that shows them can not mediate the quinolones resistance, and this experimental result has verified that further the resistance of quinolones is caused by qnrC.
The present invention further provides the PCR detection method that detects this gene.
The present invention is according to the new gene qnrC of the quinolones resistance nucleotide sequence that obtains, and design can detect other bacterial strain that carries identical new gene at the PCR primer of this gene.
The present invention can be used for the research of quinolones resistance mechanism and the detection of Resistant strain, and might be as the potential target position of antibacterials effect.
Description of drawings
Fig. 1: the structure iron of plasmid qnrC-pUC18.
(QnrA1, QnrS1, aminoacid sequence QnrB1) are relatively for Fig. 2: QnrC and other 3 Qnr albumen.
Fig. 3: remove qncC front and back plasmid structure iron.
Fig. 4: the electrophorogram of PCR detection method qnrC
Wherein, employed abbreviation and name have following meaning:
The Ampicillin Trihydrate resistant gene that the ampR:pUC18 plasmid carries;
The proteic encoding gene of qnrC:QnrC, the base 1846 to 2382 of Seq.ID.NO..1;
Integrase like: intergrase sample gene;
Amidase like: Ntn hydrolase sample gene;
HindIII: restriction enzyme HindIII restriction enzyme site;
ApaI: restriction enzyme A paI restriction enzyme site;
Primer1: sequence is the primer of GCGGCGTGATTCATCACAGT, is positioned at the base 1298 to 1317 of Seq.ID.NO..1;
Primer2: sequence is the primer of TATGCAGACCTACGAGATGCT, is positioned at the base 1897 to 1917 of Seq.ID.NO..1;
Primer3: sequence is the primer of CCGTTGCTATATGGTTCTATC, is positioned at the base 2502 to 2522 of Seq.ID.NO..1;
Primer4: sequence is TGT GGGCCCThe primer of TACGATTTTAATCACTCAAATTTGCG, italicized item are the base 1820 to 1845 that distinguished sequence is positioned at Seq.ID.NO..1, and underscore partly is the ApaI restriction enzyme site;
Primer5: sequence is TGT GGGCCCThe primer of TGACCTACGATTTTAATCACTCA, italicized item are the base 2380 to 2402 that distinguished sequence is positioned at Seq.ID.NO..1, and underscore partly is the ApaI restriction enzyme site;
The QnrA1:qnrA1 encoded protein;
The QnrB1:qnrB1 encoded protein;
QnrC:qnrC encoded protein, aminoacid sequence are Seq.ID.NO..2;
The QnrS1:qnrS1 encoded protein;
M：DL2000 DNA Marker；
489: reference numeral is the qnrC gene masculine clinical separation strain of 06-489;
T1～T4: be 4 strain qnrC gene masculine zygotes of the clinical separation strain that should be numbered 06-489.
Embodiment
Embodiment 1
Clone, screening quinolones drug resistant gene from clinical separation gram negative bacilli
Step 1 contains the screening of plasmid-mediated unknown quinolones drug resistant gene clinical strain
The gram negative bacilli clinical separation strain that collection descends to quinolones susceptibility adopts PCR method to detect known drug resistant gene qnrA, qnrB, qnrS, and the bacterial strain of leaving and taking known drug resistant gene feminine gender is used for follow-up study;
Step 2 contains obtaining of unknown quinolones drug resistant gene plasmid
The negative gram negative bacilli clinical separation strain of known drug resistant gene that obtains with step 1 is the donor bacterium, with E.coliJ53Az RFor recipient bacterium engage experiment (concrete grammar reference literature Antimicrob.Agents Chemother.2003,47:2242-2248.).(be stored in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC, BeiJing, China) on September 26th, 2007 by engaging experiment by the clinical separation Proteus mirabilis that is numbered 06-489; Preserving number: acquisition can mediate recipient bacterium E.coli J53Az CGMCC2189) RTo the plasmid pHS10 that carbostyril family antibacterial drugs susceptibility descends, the base pair population size of this plasmid is 100-120kb, and the quinolones Ciprofloxacin is 0.125 μ g/ml to containing the zygosporic MIC of this plasmid.
Step 3 clone drug resistant gene
Adopt pHS10 that HindIII restriction enzyme (Takara, Dalian, China) extracts above-mentioned zygote and carry out enzyme as the pUC18 of carrier and cut, concrete enzyme blanking method and step are with reference to product description; Enzyme cut product adopt DNA purification kit (Tiangen Biotech, Beijing, China) to specifications step carry out purifying; PHS10 enzyme behind the purifying is cut product and is adopted T4DNA ligase enzyme (Takara, Dalian, Chinese) and cut through enzyme equally, the carrier pUC18 of purifying carries out ligation, operation steps is finished by the reagent specification sheets, connect product and be converted into competent cell DH5 α, use contains Ciprofloxacin (0.06 μ g/ml), the TSA plate screening of Ampicillin Trihydrate (50 μ g/ml), success obtains transformant, adopt the Etest test strip according to (the Clinical andLaboratory Standards Institute of research on standard institute of clinical labororatory, CLSI) the method mensuration Ciprofloxacin of recommending also is 0.125 μ g/ml to the MIC of this transformant, confirms to contain unknown drug resistant gene in the endonuclease bamhi.
Step 4 contains the sequential analysis of the endonuclease bamhi of drug resistant gene
Extract the plasmid of this transformant, obtain the nucleotide sequence of a 4409bp by the walking method order-checking.Use DNAStar sequence analysis software (DNAStar Inc, the U.S.) sequence carried out bioinformatic analysis, find to comprise in it 3 ORF (see figure 1)s, by NCBI BLAST website with (http://www.ncbi.nlm.nih.gov/BLAST/) online sequence alignment, find that wherein the length of sequence 1 is the ORF sequence (base 1846 to 2382) of 537 Nucleotide, coded proteic aminoacid sequence is a sequence 2, with known QnrA1, QnrS1, QnrB1 has homology, is respectively 67.6%, 63.1% and 48.0%, said gene called after qnrC of the present invention, its encoded protein is QnrC (Fig. 2).Two ORF of its upstream and downstream, length is respectively 627 and 1224 Nucleotide, and BLAST is respectively intergrase sample gene and Ntn hydrolase sample gene (Fig. 1).
Embodiment 2
Sequential analysis obtains the affirmation of the new gene qnrC of resistance
Step 1 is by the qnrC gene mediated for clear and definite quinolones resistance, get rid of the influence of qnrC upstream and downstream gene, qnrC is carried out time cloning again, the fragment cloning of complete sequence that only comprises qnrC with primer Primer1 and Pimer3 amplification is to pMD19 (Takara, Dalian, China), and be converted into DH5 α, obtain transformant with above-mentioned Ampicillin Trihydrate screening plate screening, the transformant that contains recombinant plasmid rises to the resistance of Ciprofloxacin equally.And the fragment cloning that does not contain the qnrC complete sequence that obtains with primer Primer2 and Primer3 amplification is to pMD19, screen the transformant that plate screening arrives with the Ampicillin Trihydrate, though have recombinant plasmid, but the resistance to Ciprofloxacin does not rise, and has verified that further the resistance of quinolones is caused by qnrC.
Step 2 is for further confirming the effect of qnrC gene in the quinolones resistance forms, adopt band ApaI restriction enzyme site primer primer4 and primer5, carry out pcr amplification, PCR reagent is Takara LA Taq (Takara, Dalian, China), the PCR reaction system is pressed the product description preparation, the PCR reaction conditions be 98 ℃ 10 seconds, 68 ℃ 10 seconds, 35 circulations, the PCR product is through ethanol sedimentation, the ApaI enzyme is cut the purifying of tapping rubber after 2 hours, and purified product adopts T4 dna ligase (Takara, Dalian, China) connection is spent the night, be converted into DH5 α, acquire transformant with Ampicillin Trihydrate screening plate screening, the extracting plasmid confirms that through order-checking the qnrC sequence has been removed (see figure 3).Adopting the Etest method to measure Ciprofloxacin MIC is 0.008 μ g/ml, and plasmid-free DH5 α is identical, shows that the qnrC gene can cause that the quinolones resistance forms.
Embodiment 3
Sequence is set up the PCR method that detects the qnrC gene according to the present invention
Step 1. design of primers
Nucleotide sequence input oligo software of the present invention is carried out design of primers, select primer from the primer sequence that software screens, expection product size is 395bp, and primer sequence is as follows:
qnrC AF 5’-GGGTTGTACATTTATTGAATC-3’
qnrC AR 5’-CCTGAATTCTGCATTGCTC-3’
Step 2 is optimized the pcr amplification condition
Adopt Takara Taq reagent preparation PCR reaction system, on increasing instrument, the TP600 type TakaraPCR Thermal cycler dice with gradient heating and cooling function carries out annealing temperature optimization, final determine 94 ℃ after 5 minutes 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ of 30 circulations in 30 seconds, 72 ℃ of the bests of expanding effect when extending 5 minutes.
The sequential analysis of step 3qnrC gene masculine bacterial strain
Adopt the method after step 2 is optimized to detect the bacterial strain that the qnrC gene carries, comprise clinical strain 06-489, and 4 strains carry the zygote of qnrC gene, above-mentioned bacterial strains all manifests the positive PCR product band of expection after testing, conforms to fully with known array through order-checking.Obtain a qnrC gene masculine plasmid in clinical strains, carry out sequential analysis by the step 2 of embodiment 1 to step 4, the fragment sequence that the endonuclease bamhi of acquisition and embodiment 1 obtain is identical.
SEQUENCE LISTING
＜110〉Huashan Hospital Affiliated To Fudan Univ
＜120〉a kind of plasmid that mediates recipient bacterium to the decline of carbostyril family antibacterial drugs susceptibility
<130>11
<160>2
<170>PatentIn version 3.1
<210>1
<211>4409
<212>DNA
＜213〉bacterium
<400>1
aagctttatg gatattcaag acaagccata tatgcacata taaacaaagg aaatttatct 60
aaaggatctg atggattaat tgacttttca gaggccctaa gagtttttgg ggaaccacaa 120
aaaaaagagg atacagtcaa tcaaagtcaa tcaattaaca gtcaaaactt gacagaagtt 180
gacttactaa aacgtcaagt tgacatactg ggcctcattc tgcgtgaaaa ttttttctag 240
tttgccggat aggttgatcg catttctctt gtatttaagg ggctgttagg tgccttattt 300
tggctatttt tgtggtgtgt aactatttgt ttttatgtgg gtttattttg ttgtcaatat 360
gaatcgcccc gggtttgtcg gaggctaact ttcttgagag aattagccta tgaaaaagag 420
acctggatat tcccccgaaa cgcgtgaacg agcagtaagg cttgtgctca ccaccgaaca 480
agatcacagc tcacgttggg cggccataat atctgttgcc agcaagattg gctgtacgcc 540
tgaaacactc cgcgcatgga taaaccgaac tgaatccaat agcgccgctc ccgacaccgt 600
aaacgttacc gaatccgagc gaattaaagc cttagagcgc gagaatcgcg aactcaaacg 660
tgcgaatgaa atcctgcgtc tagcctcggc tttttttgcc caggcggagc tcgaccgcaa 720
accgaaactc tagtccattt tgtggaagcc cataaaaatg attttggtgt cgagccaatt 780
tgtcagcagt tacagattgc accatcgacg tattatcgac acaagcaatt ggagaaaaag 840
ccggagctga gagcgcggcg aattcagcag gatgagtgtt tagccgttga aatccagcgt 900
atttggcttg aaagtgatcg taattatggt gcacggaaaa tctggaaaca gctgcgcaga 960
gagggggttg atgtggcacg gtgtaccgtt gagcggctaa tgcgtcaatt gggtgttgaa 1020
ggtgtgcgtc gcggcaaaaa atgtaaaaca acaatccctg acaacaaagc acattgcccg 1080
caagatctgg ttaaccgtca ctttaaagcg gagaagccaa atcaactctg ggttgccgac 1140
attacttatg tttccacctg gtcaggtttt gtctatgtcg cctttgtaat cgatgtattt 1200
tcgcgtcgcc ttgttggctg gcgagcgatg aagactatgc agacggattt aattctggac 1260
gcactggagc aggcattgtg ggcaagagga aaaccgcgcg gcgtgattca tcacagtgac 1320
aggggtagtc aatatttatc catcagctac accgaacgcc ttgctgaggc aggatttaat 1380
gcgtcggttg ggagcgtggg ggattcctac gataacgcct tagctgaaac gattaacggg 1440
ctttacaaaa ctgaggttat tcataaaggc gcaccttgga aaaatcttga atctgtagag 1500
ctggcgacgc ttgcatgggt cgaatggttt aacaaccgtc ggctgcatag tgcactgggg 1560
tatgtaccac cgaaggagtt cgaagaaaat ttttatcaac aaactgagtt ggctcatgta 1620
gcatgactca aattaaaccg cctccgaaaa agtcggggcg attcaatatg gctgtagatg 1680
ttagtcttaa tttaaattaa tcaagaggtt ataacattga attattccca taaaacgtac 1740
gatcaaattg atttttccgg ccaagatttg agctctcatc acttttctca ctgtaaattt 1800
tttggttgta attttaatcg agtgaattta cgtgatgcta aattcatggg ttgtacattt 1860
attgaatcga atgattttga aggatgtaat tttatctatg cagacctacg agatgcttca 1920
tttatgaatt gcatgctttc aatggcgaat ttccaagggg caaactgttt tggccttgaa 1980
ttgagagaat gcgatttaaa aggtgctaat ttctcacagg caaactttgt taatcatgtt 2040
tctaacaaaa tgtatttttg ctctgcttac attacgggtt gtaatttgtc ttatgctaat 2100
ttcgataagc aatgccttga aaagtgtgat ttatttgaaa ataaatgggt aggtgcaagc 2160
ctgcaagggg cctcttttaa agagtcagac ttaagtaggg gatcattttc tgatgacttt 2220
tgggagcaat gcagaattca ggggtgtgat ctcactcatt cagaattaaa tggcttagaa 2280
cctcgtaaag tggatttaac tggcgtgaaa atttgttcat ggcaacaaga gcagcttttg 2340
gagcagttgg gggtgattgt tattccagac aaagtgtttt gacctacgat tttaatcact 2400
caaatttata aagcgaatca tcttcaaggc cttacaatta taaagatagg aactcctatg 2460
tataactttt tatcctctgg cgcatttgtt gaaaccttca cgatagaacc atatagcaac 2520
gggtcactta atgggcttac atttgccgtt aaagacaata ttgatattgc tcagtataaa 2580
acctcttatg ggagcccatc ttggcaacat aaacataagg ctgccattta taacgctttg 2640
tgtgtcgatc agctattagg cgctggggca acctgtttag ggaagacagt atcagatgaa 2700
tttacttata gtttagatgg cgaaaatttc ttttttggaa cgcctatcaa ccccaaagtg 2760
ccagatagaa taccgggagg ctcatcgagt ggttcggctt ctgctgttgc gtgcggttta 2820
gttgattttg ccattggaac cgattcagca ggttcaatcc gagtacctgc aagtttgtgt 2880
ggcgtttatg ccatgcgacc aactatgcat cgaatatcgg aggcaggtgt cttacctttc 2940
gtccctagca cgagtacggt tggggctttt gccaatgata tagatgtatt gggcgatgtt 3000
atgcacacac tattaaaaag tgaaagcgtg gtatcacaaa aaatagagac gatttacctg 3060
cttgaagatg cctttaatac ctctgatgct gaggtatcag ctctgataaa agatagcatt 3120
aacaatttat tggttaatat tgatgctgat gtggtctcta ttacactgag cgatattctt 3180
ggcgaggaag caacacttga tatgcttaat gttaatgcat taagaccatt acaaactttt 3240
gagttcttaa acactgtcgg taactggatt gaacatgaat ctccagaact tagcccattt 3300
tttgctatga aatatgaaac tgtacgaaag tttgaacgca agttggttag cgattctctc 3360
cggctttgtg agcgatattt tcgtcggatg tcctcgtttc taaaaaaggg cgatttggtt 3420
ttgttcccca cagtacccac ggttgcacca ttaaaacatt cgcttgagga tatggaaaca 3480
gcgctagatt tttatgaccg aacaatgtcg atcacttcat tttctggtat tggtcgttta 3540
cctgaaatat cgataccaat agcaaatata gataacgcac ctgttggact gtctgttgca 3600
gcaggcttct atcaagatga atttttaatc tccagtgtaa agcagttatt ttgtgaggtg 3660
atgatgccac ctcaaactaa gtgactaaat tcactatgcc actgcaatgt ggctagattg 3720
ccctaactca tttctgtccg tgcgacctga agtcgtatga agcgttgttc atcgctttat 3780
gaatgaaccg tctgtatcac cagatgaacc tacgagcctg aataaagcag cggctcggac 3840
aatgtaacga agagcaattt caaattgctc gggatcgaaa tcgtgagagg cagatcctcc 3900
tgataaccac atgaatcggg taagtgctag gtagtcagta tgatgaacgt aagtgaatcc 3960
atgaaaggtg cgttatgtga tgaaacagcg gaagtggtta atacgctgta gccaaaaggc 4020
aatgagagtc ggaaagaggt tggacagtac tctttcgtga tcgtagtgct ctccgcacta 4080
tagtgggcat ctaagctgat attttacgtg acatacggaa cagggtaagc ctgtattact 4140
cccactggga aagtctctgc gaccgatagt gatgcaggta taggaggtcg gaaaaagcga 4200
aagctacatt gtaatgatgt agatacaggt tctgcctgat cacgaaagtg agcccacttc 4260
cgacgggtct cccattgcga gagaatttga agaactttat tcaaggagaa aagcaaatga 4320
tggtctcgaa agagattagt gcatcttctg acggtgctca gtggcagtct atcgactgga 4380
aatccgctga agcacacgta ttaaagctt 4409
<400>2
MetGlyCysThrPheIleGluSerAsnAspPheGluGlyCysAsnPheIleTyrAlaAspLeuArgAsp
AlaSerPheMetAsnCysMetLeuSerMetAlaAsnPheGlnGlyAlaAsnCysPheGlyLeuGluLeuArgGl
uCysAspLeuLysGlyAlaAsnPheSerGlnAlaAsnPheValAsnHisValSerAsnLysMetTyrPheCysS
erAlaTyrIleThrGlyCysAsnLeuSerTyrAlaAsnPheAspLysGlnCysLeuGluLysCysAspLeuPhe
GluAsnLysTrpValGlyAlaSerLeuGlnGlyAlaSerPheLysGluSerAspLeuSerArgGlySerPheSe
rAspAspPheTrpGluGlnCysArgIleGlnGlyCysAspLeuThrHisSerGluLeuAsnGlyLeuGluProA
rgLysValAspLeuThrGlyValLysIleCysSerTrpGlnGlnGluGlnLeuLeuGluGlnLeuGlyValIle
ValIleProAspLysValPhe

Claims (1)

1. a mediation recipient bacterium is characterized in that to the drug-fast gene of carbostyril family antibacterial drugs Ciprofloxacin the nucleotides sequence of described gene classifies the nucleotide sequence of the 1298th bit base to the 2522 bit bases in the sequence 1 as, and length is 1225bp.
CN2007100466143A 2007-09-27 2007-09-27 A plasmid mediating recipient bacteria for decreased sensibility to quinolones antibacterial drugs Expired - Fee Related CN101445804B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2007100466143A CN101445804B (en) 2007-09-27 2007-09-27 A plasmid mediating recipient bacteria for decreased sensibility to quinolones antibacterial drugs

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2007100466143A CN101445804B (en) 2007-09-27 2007-09-27 A plasmid mediating recipient bacteria for decreased sensibility to quinolones antibacterial drugs

Publications (2)

Publication Number Publication Date
CN101445804A CN101445804A (en) 2009-06-03
CN101445804B true CN101445804B (en) 2011-08-17

Family

ID=40741680

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2007100466143A Expired - Fee Related CN101445804B (en) 2007-09-27 2007-09-27 A plasmid mediating recipient bacteria for decreased sensibility to quinolones antibacterial drugs

Country Status (1)

Country Link
CN (1) CN101445804B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110129246B (en) * 2019-04-29 2021-02-19 华南农业大学 Donor bacterium, construction method and application thereof, and plasmid inhibitor screening method
CN110591962B (en) * 2019-09-28 2020-11-06 华中农业大学 Proteus mirabilis BSFLG-CIP5 derived from stratiomyiid intestinal tract and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1837811A (en) * 2006-04-24 2006-09-27 王勇 Method for controlling shigella molecule spread and epidemic

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1837811A (en) * 2006-04-24 2006-09-27 王勇 Method for controlling shigella molecule spread and epidemic

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Jiunn-Jong Wu.Prevalence of Plasmid-Mediated Quinolone Resistance Determinants QnrA, QnrB, and QnrS among Clinical Isolates of Enterobacter cloacae in a Taiwanese Hospital.《ANTIMICROBIAL AGENTS AND CHEMOTHERAPY》.2007,第51卷(第4期),全文. *
Mariana Castanheira等.First Report of Plasmid-Mediated qnrA1 in a Ciprofloxacin-Resistant Escherichia coli Strain in Latin America.《ANTIMICROBIAL AGENTS AND CHEMOTHERAPY》.2007,第51卷(第4期),全文. *

Also Published As

Publication number Publication date
CN101445804A (en) 2009-06-03

Similar Documents

Publication Publication Date Title
Aviv et al. Horizontal transfer of the Salmonella enterica serovar Infantis resistance and virulence plasmid pESI to the gut microbiota of warm-blooded hosts
Belland et al. Neisseria gonorrhoeae acquires mutations in analogous regions of gyrA and parC in fluoroquinolone‐resistant isolates
Hu et al. Stenotrophomonas maltophilia resistance to trimethoprim/sulfamethoxazole mediated by acquisition of sul and dfrA genes in a plasmid-mediated class 1 integron
Burton et al. Improved understanding of the bacterial vaginal microbiota of women before and after probiotic instillation
Wong et al. Evolution and dissemination of OqxAB-like efflux pumps, an emerging quinolone resistance determinant among members of Enterobacteriaceae
Ceccarelli et al. New cluster of plasmid-located class 1 integrons in Vibrio cholerae O1 and a dfrA15 cassette-containing integron in Vibrio parahaemolyticus isolated in Angola
Yeung et al. Comparative phenotypic, molecular, and virulence characterization of Vibrio parahaemolyticus O3: K6 isolates
Benacer et al. Characterization of drug-resistant Salmonella enterica serotype Typhimurium by antibiograms, plasmids, integrons, resistance genes, and PFGE
Klein et al. Genes similar to the Vibrio parahaemolyticus virulence-related genes tdh, tlh, and vscC2 occur in other Vibrionaceae species isolated from a pristine estuary
Heaton et al. Potent antipneumococcal activity of gemifloxacin is associated with dual targeting of gyrase and topoisomerase IV, an in vivo target preference for gyrase, and enhanced stabilization of cleavable complexes in vitro
Goñi-Urriza et al. Type II topoisomerase quinolone resistance-determining regions of Aeromonas caviae, A. hydrophila, and A. sobria complexes and mutations associated with quinolone resistance
Japoni et al. Assay for integrons and pattern of antibiotic resistance in clinical Escherichia coli strains by PCR-RFLP in Southern Iran
Chowdhury et al. Transferable plasmid-mediated quinolone resistance in association with extended-spectrum β-lactamases and fluoroquinolone-acetylating aminoglycoside-6′-N-acetyltransferase in clinical isolates of Vibrio fluvialis
Yamamoto et al. The presence of the virulence island containing the usp gene in uropathogenic Escherichia coli is associated with urinary tract infection in an experimental mouse model
Tan et al. Distribution of Helicobacter pylori cagA, cagE and vacA in different ethnic groups in Kuala Lumpur, Malaysia
Lau et al. Catabacter hongkongensis gen. nov., sp. nov., isolated from blood cultures of patients from Hong Kong and Canada
EP2671953B1 (en) Composition and kit for detection and analysis of strains of clostridium difficile and method of detecting strains of clostridium difficile by using the same
Jeong et al. Epidemiology of nalidixic acid resistance and TEM-1-and TEM-52-mediated ampicillin resistance of Shigella sonnei isolates obtained in Korea between 1980 and 2000
Flannery et al. Self-Transmissibility of the integrative and conjugative element ICE Pm1 between clinical isolates requires a functional integrase, relaxase, and Type IV secretion system
Spagnoletti et al. Rapid detection by multiplex PCR of Genomic Islands, prophages and Integrative Conjugative Elements in V. cholerae 7th pandemic variants
Al-Benwan et al. Cystitis caused by Aeromonas caviae
CN101445804B (en) A plasmid mediating recipient bacteria for decreased sensibility to quinolones antibacterial drugs
Guerin et al. Fluoroquinolone resistance associated with target mutations and active efflux in oropharyngeal colonizing isolates of viridans group streptococci
Spigaglia et al. Molecular analysis of the gyrA and gyrB quinolone resistance-determining regions of fluoroquinolone-resistant Clostridium difficile mutants selected in vitro
Lee et al. Increased risk of severe gastric symptoms by virulence factors vacAs1c, alpA, babA2, and hopZ in Helicobacter pylori infection

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20110817

Termination date: 20200927

CF01 Termination of patent right due to non-payment of annual fee