CN101443050A - Complement binding aptamers and anti-C5 agents useful in the treatment of ocular disorders - Google Patents

Abstract

Methods of treating complement-mediated ocular disorders by administering agents that inhibit a subject's complement component in an amount sufficient to treat the ocular disorder wherein, in a selected embodiment, said agent is an anti-complement aptamer that, in a preferred embodiment, is an anti-C5 aptamer.

Description

The complement that uses in the treatment ocular disorders is in conjunction with fit and anti--C5 medicine

Related application

Present patent application requires the priority of No. 60/848274, U.S. Provisional Patent Application series number that No. 60/780905, the U.S. Provisional Patent Application series number submitted on March 8th, 2006 and JIUYUE in 2006 submitted on the 29th, and above-mentioned patent is all incorporated this paper into by being cited in this.

Invention field

The present invention relates generally to the nucleic acid field, more particularly be can the conjugated complement system proteinic fit, be used for complement-relevant eye, the heart, inflammation, asthma, and Autoimmune Disorders, the disease that the complement activity of ischemical reperfusion injury and/or other C5 mediation is relevant or the treatment and the diagnosis of imbalance.In the preferred embodiment, the more specific method and the material for the treatment of and diagnosing the eye imbalance that relate to of the present invention, including, but not limited to, the imbalance of treatment and diagnosis C5 mediation such as the eye imbalance of C5 mediation.The invention further relates to that use can be in conjunction with the fit material and the method that comprise the proteic complement system protein of C5.

Background of invention

The fit of definition is a kind of isolated nucleic acid molecule, its reciprocal action by being different from the Watson-Crick base pair with high specific and affinity in conjunction with some targets, as a kind of protein.Though fit is nucleic acid molecules, between fit and other nucleic acid molecules such as gene and mRNA, still have basic difference.Among the latter, nucleic acid structure is by its linear base sequence encoding information, and this sequence is important for information storage function.In contrast, fit function, its based on the particular combination of target molecule, do not rely on conservative linear base sequence, and more pay close attention to specific secondary/and tertiary structure.Fit right and wrong-coded sequence.Fit any potential code capacity is coincidence fully, and is adiaphorous in the combining of fit and its homology target.Like this, in conjunction with same target, even the same loci on the target is fit, can have identical base sequence, is different under the more susceptible condition.

Fit also different with spontaneous nucleotide sequence in conjunction with specified protein.These latter's sequences are the abiogenous sequences that are incorporated in the organism genome, its with relate to transcribing of nature nucleic acid, the proteinic specific subunit combination of translation and transhipment, for example, nucleic acid binding protein.On the other hand, fit is short and small, isolating, non-spontaneous nucleic acid molecules.Though the fit protein bound feature that has with bind nucleic acid, under many situations these fit have less or not with can be by the sequence that natural nucleic acid binding protein is discerned consistent sequence.Prior, fitly in fact can and comprise micromolecule in conjunction with any protein (being not only nucleic acid binding protein), carbohydrate, polypeptide etc. any at target.For most of targets, even protein, there is not its bonded spontaneous nucleotide sequence; Have the target of this sequence for those, for example, nucleic acid binding protein, these sequences are compared with high-affinity is fit with fit different, and its binding affinity in naturalness is relatively low.

Fit, show with phage or polypeptide that antibody produced similar, can specific bond selected target is also adjusted targeted activity or adhesion, for example, by in conjunction with the fit ability that can prevent its objective function.When antibody existed, the functional characteristic of particular combination target was a kind of inherent character.When antibody existed, though the technical staff can not know a kind of fit precision architecture characteristic for a target, the technical staff knew under the situation of disappearance precision architecture definition how to identify, prepared and used these molecules.

Fit also similar with the micromolecule therapeutic agent, the change of its single structure, as if very small, also can greatly influence (several ranks or magnitude) fit combination and/or other activity.On the other hand, some structural changes are with rare or do not have an effect.These results come from secondary/threes' grade of fit structure importance.In other words, fit is a kind of three dimensional structure with fixture construction, provide with its to the bonded chemical bond power that sets the goal.Therefore: (1) some zones or particular sequence be for the specified point of (a) combining target, and/or (b) the bonded sequence of localized molecules and target is essential; (2) some zones or particular sequence have range of variation, and for example, nucleoside X must be a pyrimidine, or nucleoside Y must be purine, or nucleoside X and Y must be complementary; (3) some zones or particular sequence can be arbitrarily, and it can be sufficient space elements, for example, its can make any given length nucleotide chain or even non-nucleoside at interval, as the PEG molecule.

Arbitrarily the external selection test of oligonucleotide sequence set is found, generation fit at surpassing 130 kinds of protein comprises somatomedin, transcription factor, enzyme, immunoglobulin, and receptor.Typical fit be 10-15kDa size (20-45 nucleoside), with little mM extremely Asia-little mM affinity in conjunction with its target, and the target that is closely related of differentiation (for example, fit can be typically not with protein bound from same gene family).A series of structural research has shown the fit affinity and the specificity that can use identical set interactive (for example, hydrogen bond, static complementation, hydrophobic interaction, size exclusion) to drive antibody-antigenic compound.

The fit characteristic that is used for the treatment of and diagnoses with many expectations comprises high specific and affinity, biological effect and good pharmacokinetic properties.In addition, it provides the specific competitive advantage that is better than antibody and other protein biology preparations, for example:

1) speed and control.Fitly can carry out the quick preparation of lead, comprise the treatment lead fully by in vitro method preparation.External selection makes that fit specificity and affinity are the also preparation guiding of high degree of controlled, comprise the guiding at toxin and non--immunogen target.

2) toxicity and immunogenicity.Fit as one type, have significant treatment and can accept toxicity and lack immunogenicity.Yet the effect of many monoclonal antibodies can be by the immunoreation of its antibody self restriction, is unusual difficulty and excite fit antibody, main can not be because fit by MHC by the T-cellular expression, and immunne response is domesticated for usually nucleic acid fragment is not had identification.

3) administration.Many Antybody therapy agent that provide at present are by intravenous infusion administration (usually above 2-4 hour), and fit can pass through the subcutaneous injection administration (fit bioavailability by subcutaneous administration is in the monkey experimental study〉80% (Tucker etc., J.Chromatography B.732:203-212,1999)).Thereby this difference is bigger mainly due to the volume that the quite low solubility of therapeutic mAbs needs.Have good solubility (〉 150mg/mL) (fit: 10-50kDa with relative lower molecular weight; Antibody: 150kDa), fit all using dosages can be with the volume injection delivery less than 0.5mL.In addition, another is fit-treatment or the prevention advantage on basis be, fit smaller size smaller can make it infiltrate through to tighten the conception zone, and antibody or antibody fragment can't infiltrate through.

4) metrizability and price.Treating fit is therefore can easily measuring according to the production demand of chemosynthesis.And the metric difficulty of producing has been limited the practicality of some biological preparation, and the expense that height-flux protein prepares equipment also is huge, and the output of a high-flux oligonucleotide synthesis system is at least 100kg/, and only needs the initial outlay of appropriateness relatively.At present the fit synthetic expense of kilogram levels is estimated as 500 dollars/gram, has comparability with the antibody of height optimization.Continuous progress in the research process can be estimated in 5 years that expense will be reduced to and be lower than 100 dollars/gram.

5) stability.Therapeutic is fit to be that chemistry is sane.It can keep active inherently when being exposed to the various factors as heat and denaturant, and at room temperature can preserve 1 year long duration (〉 with freeze-dried powder).On the contrary, antibody must stored frozen.

Complement system.Complement system comprises that one group is at least 20-30 kytoplasm and memebrane protein, its in modulated cascade system combined effect with the pathogen form outside the attack cells (for example, antibacterial).Complement system comprises three different enzymatic activity cascades, classics, and agglutinin and selectivity path (Fig. 1), it has been gathered the active of C5 and has produced the non--enzymatic pathway that is known as film attack approach.

First kind of enzymatic activity cascade, it is known as classical pathway, comprises several compositions, C1, C4, C2, C3 and C5 (with the sequence arrangement in the approach).Along with first kind of complement component (C1) by immunity and non--immunocompetence factor and combination and activation, the classical pathway of complement system begin generation.C1 comprises a Clq, the calcium of Clr and Cls-dependence complex, and by activating in conjunction with the Clq composition.Clq comprises six identical subunits, and each subunit comprises three chains (A, B and C chain).Each chain has a ball head that connects collagen-analog afterbody.Antigen-antibody complex is for the combination of Clq and activate the head zone that occurs in Clq.A large amount of non--antibody Clq activated materials comprises protein, and lipid and nucleic acid are by the combination of unique site and the activation Clq of collagen-similar neck area.The molecular recognition of the complement activation agent by Clq has caused conformational change, and thorn prokinase Clr self activates, and it promotes the Proteolytic enzyme of Cls conversely.Cs is the activity of catalysis complement component C4 and C2 subsequently, forms the C4bC2a complex of tool C3 convertase function.

Second is known as the cascade of lectin pathway enzyme activation, except the MBL/MASP-2 complex replaces C1, all similar with first.The polysaccharide that contains mannose of mannan-binding lectin (MBL) Direct Recognition bacterium surface, and on 26S Proteasome Structure and Function with the composition Clq homology of C1.MBL and combining of activator have guided the activity of MBL-associated protein enzyme 2 (MASP-2).MASP-2 activates C4 and C2 in the homologous mode of Cls function conversely, the formation of guiding C3 convertase.

The third enzymatic activity cascade is known as the selectivity approach, is fast a kind of, and antibody-ind complement system activates and method and approach.The selectivity approach comprises several compositions, C3, factor B, and factor D (with the sequence arrangement in the approach).The activation of selectivity approach betides C3b, and the hydrolytic rupture form of a kind of C3 is during with the combining of active surface such as antibacterial.Factor B combines with C3b subsequently, and is formed C3 convertase C3bBb by the factor D cutting.The active amplification of C3 convertase takes place when producing and depositing extra C3b.The positive combination of regulating albumen properdin (P) further promotes to amplify reaction, and the stability to degradation that it improves the activation invertase makes the half-life extend to 18 minutes from 1-2 minute.

Like this, all three approach all produce the C3 convertase that factor lytic C3 is C3a and C3b.At this moment, C3 convertase (classics/agglutinin and selectivity) further is assembled into C5 convertase (C4b2a3b and C3b3bBb).These complex cracking complement component C5 subsequently are two kinds of compositions: C5a polypeptide (9kDa) and C5b polypeptide (170kDa).The C5a polypeptide is heavily striden film G-protein binding receptor in conjunction with 7, and it is initial relevant with leukocyte, and present knownly express in multiple tissue, comprises hepatocyte and neurocyte.The C5a molecule is the initial chemotactic composition of people's complement system, and can cause multiple biological response, comprises leucocyte chemotaxis, smooth muscle contraction, the activation of signal transduction path in the cell, neutrophil cell-endotheliocyte adheres to, and cytokine and lipid adjustment release and oxidant form.

Bigger C5b fragment then with subsequently complement cascade, C6, C7, C8 and C9 are in conjunction with forming C5b-9 membrane attack complex (" MAC ").C5b-9MAC is the cracking erythrocyte directly, and to a greater extent, its dialogue lysis and damaging tissue, as muscle, epithelium and endotheliocyte.In the inferior molten broken dosage, MAC can stimulate the rise molecular adhesion, the release of intracellular Ca2+ and the release of cytokine.In addition, C5b-9MAC can stimulating endothelial cell and platelet cell and do not cause lysis.Non--cracking effect of C5a and C5b-9MAC is closely similar sometimes.

Though complement system has important effect in keeping health, its also have cause or diseases induced potential may.For example, complement system is performed the operation at bypass operation of coronary artery (" CABG "), numerous kidneys, and rheumatism, nerve, dermatosis, hematopathy, tremulous pulse/lung, allergy infects, and shows its side effect in biocompatibility/shock disease and/or the situation.Complement system is not unique factor that causes of disease, but it may be one of several factors that cause disease.

At present, data show also comprises complement in ophthalmic.In addition, have treatment and the diagnosis that new complement system inhibitor helps complement-associated eye conditions.

Description of drawings

Fig. 1 describes the classics of complement system and the sketch map of selectivity approach.

Fig. 2 describes from the set of oligonucleotide random sequence to carry out external fit selection (SELEX ^TM) sketch map of method.

Fig. 3 A describes anti--nucleotide sequence and secondary structure (serial number: sketch map 1) that C5 is fit, wherein the residue of leukorrhagia line be 2 '-H pyrimidine residue or 2 '-fluorine pyrimidine residue, the residue that adds frame is 2 '-fluorine pyrimidine residue or 2 '-OMe pyrimidine residue, with the residue of arrow (→) expression represent to contain 2 '-residue that fluorine is modified.

Fig. 3 B be describe ARC330 anti--nucleotide sequence and secondary structure (serial number: sketch map 2) that C5 is fit, wherein the residue of zone circle be 2 '-the H residue, the pyrimidine residue is 2 '-fluorine replaces, main purine residue is 2 '-OMe replaces, except three 2 of highlighting '-OH purine residue.

Fig. 3 C be describe ARC186 anti--nucleotide sequence and secondary structure (serial number: sketch map 4) that C5 is fit, wherein all 21 pyrimidine residues have 2 '-fluorine modifies, main purine (14 residues) has 2 '-OMe modifies, except three 2 of highlighting '-OH purine residue.

Fig. 4 be the PEG of 40kD branch (1, the sketch map of 3-two (mPEG-[20kDa])-propyl group-2-(4 '-butamide).

Fig. 5 be contact fit 5 ' the terminal PEG of 40kD branch (1, the sketch map of 3-two (mPEG-[20kDa])-propyl group-2-(4 '-butamide).

Fig. 6 describes the method sketch map of various synthetic high polymer amount PEG-nucleic acid conjugates.

Fig. 7 A be PEGization anti--C5 is fit (ARC657 (serial number: 61), 62), and ARC187 (serial number: 5)) ARC658 (serial number:, resist-C5 is fit (the dose-dependent hemolysis inhibition of ARC186 (serial number: 4)) with respect to non--PEGization; Fig. 7 B is the fit IC that uses in hemolytic test that describes among Fig. 7 A ₅₀The value table; Fig. 7 C be comparison PEGization anti--the fit ARC187 of C5 (serial number: 5), ARC1537 (serial number: 65), 66), and ARC1905 (serial number: dose-dependent hemolysis inhibition 67) ARC1730 (serial number:; Fig. 7 D is the fit IC that uses in hemolytic test that describes among Fig. 7 A ₅₀The value table.

Fig. 8 be the serum of macaque complement with respect to anti-in the human SC-C5 is fit, (serial number: haemolysis 62) suppresses the percentage rate sketch map to ARC658.

Fig. 9 is 37 degree and room temperature (23 the degree) (serial number: 4) in conjunction with the proteic sketch map of purification C5 of ARC186 when hatching 15 minutes.

Figure 10 is 37 degree and room temperature (23 the degree) (serial number: 4) in conjunction with the proteic sketch map of purification C5 of ARC186 when hatching 4 hours.

Figure 11 is the resolving time process sketch map of C5-ARC186 complex when 23 spend.

Figure 12 is the equilibration time process sketch map that the C5-ARC186 complex forms when 23 spend.

Figure 13 be C5 albumen with respect to the upstream and downstream protein ingredient in the complement cascade and ARC186 (serial number: 4) combine sketch map.

Figure 14 be exist unmarked competition thing ARC186 (serial number: 4), ARC657 (serial number: 61), ARC658 (serial number: 62) or ARC187 (serial number: in the time of 5), radiolabeled ARC186 (serial number: 4) in conjunction with the percentage rate sketch map of C5.

Figure 15 describes ARC186 with variable concentrations (serial number: 4) fit, 25 degree and 37 is spent and hatched the generation quantity sketch map of C5b complement protein in the blood sample 5 hours.

Figure 16 describes undiluted human serum, and in citric acid treatment people's whole blood and the serum of macaque, (serial number: complement 5) suppresses percentage rate to ARC187 when having zymosan.

Figure 17 shows the (serial number: 62) for the inhibition fully of complement activity (C5a) of ARC658 in the embodiment 1D tubulose winding model.

Figure 18 describes the 10th to take turns the dissociation constant sketch map that C5 selects set.By bringing numeral into equation: isolated fragment combination=amplification * K _d/ (K _d+ [C5]), assessment dissociation constant (K _DS)." ARC520 " (serial number: 70) refer to natural unselected dRmY set, "+" refers to exist competition thing (0.1mg/ml tRNA, 0.1mg/ml salmon sperm DNA).

Figure 19 is a sketch map of describing C5 clone and separate constant curve.By bringing numeral into equation: fragment RNA combination=amplification * K _d/ (K _d+ [C5]), assessment dissociation constant (K _DS).

Figure 20 is the fit clone of the anti-C5 ARC913 that describes a variable concentrations (serial number: 75) in contrast to ARC186 (serial number: 4) for the depression effect IC of hemolytic activity ₅₀Curve.

Figure 21 is an ARC187 (serial number: structural representation 5).

Figure 22 is an ARC1905 (serial number: structural representation 67).

Figure 23 is an EXPERIMENTAL DESIGN outline table of describing first isolation perfusion cardiac studies.

Figure 24 is that the pressure trajectories of describing isolating cardiac left atrium (LV) the atrial pressure power that is exposed to human plasma (A) compares sketch map with the LVP pressure trajectories that is exposed to the fit solution of contrast (B).

Figure 25 is that isolating cardiac such as is exposed at mole, 10 * and 50 * fit/C5 solution when (normal, the estimated concentration of C5 is about 500nm in the undiluted human plasma), left atrium (LV) intraventricular pressure track is sketch map relatively.

Figure 26 separates per minute heart beating (bpm) rhythm of the heart that mouse heart is exposed to human plasma and different blood plasma/fit solution to change relatively sketch map.

Figure 27 separates mouse heart to be exposed to and to contain 0-1 * molar ratio ARC186 (serial number: 4) (inefficacy heart), or the cardiac weight before and after 10-50 * molar ratio (C5 is fit protection heart) changes relatively sketch map.

Figure 28 is that perfusion separates in the mouse heart, and the relevant C5a that contains the fit human plasma of variable concentrations produces relatively sketch map.Relevant C5a concentration is with absorbance units (Abs) note, and there is higher levels of C5a in wherein higher readings signify.

Figure 29 is that perfusion separates in the mouse heart, and the relevant solubility C5b-9 that contains the fit human plasma of variable concentrations produces relatively sketch map.

Figure 30 is the (serial number: 4) for the sketch map of C3 cracking effect of ARC186 in the mouse heart effluent.

Figure 31 is an immunohistochemical staining signal table as a result in the isolation perfusion cardiac studies.

Figure 32 shows in human serum and the primates serum that the protection heart is not subjected to the required ARC658 (serial number: molar ratio icon 62) of C5b-mediation infringement.

Figure 33 shows to remain the logarithm-linear graph of percent as the total length ARC186 of incubation time function in rat and the macaque blood plasma.

Figure 34 be show describe among the embodiment 5 lead the pharmacokinetic EXPERIMENTAL DESIGN sketch map of representing with Sprague-Dawley.

Figure 35 be ARC657 (serial number: 61), ARC658 (serial number: 62) or ARC187 (serial number: 5) lead with respect to Sprague-Dawley in the mean plasma concentration sketch map of time.

Figure 36 be rat after intravenous administration is fit, the ARC657 of each time (serial number: 61), 62) or ARC187 (serial number: 5) mean plasma concentration sketch map ARC658 (serial number:.

Figure 37 shows the non-compartment analysis sketch map of the concentration of Figure 35 and Figure 36 description with respect to time data.

5) and ARC1905 (serial number: pharmacokinetic design drawing 67) Figure 38 A describes the (serial number: of ARC187 in the mice.5) and ARC1905 (serial number: pharmacokinetic design drawing 67) Figure 38 B describes the (serial number: of ARC187 in the CD-1 mice; Figure 38 C is the non-compartment analysis table of the concentration of displayed map 38B description with respect to time data.

Figure 39 shows behind the intravenous administration listed fit measurement result table in the mouse heart tissue.

Figure 40 is the EXPERIMENTAL DESIGN table that shows the zooscopy of describing among the embodiment 5E 1.

Figure 41 shows the macaque intravenous push is used the fit plasma concentration table of fit back with respect to the time.

Figure 42 be in the research 1 to ARC657 behind the macaque intravenous administration (serial number: 61), 62) and ARC187 (serial number: pharmacokinetic parameter table 5) ARC658 (serial number:.

Figure 43 (a) and 43 (c) be describe the macaque intravenous use the fit ARC657 of anti--C5 (serial number: 61), 62) and ARC187 (serial number: 5) the back plasma concentration sketch map of each time sC5b-9 and C5a ARC658 (serial number:; Figure 43 (b) and 43 (d) be the plasma concentration of describing sC5b-9 and C5a with respect to anti--fit ARC657 of C5 (serial number: 61), 62) and ARC187 (serial number: the 5) sketch map of concentration ARC658 (serial number:.

Figure 44 shows the research 2 EXPERIMENTAL DESIGN tables of describing among the embodiment 5F.

62) or ARC187 (serial number: 5) the average fit plasma concentration sketch map of back different time points Figure 45 describes the macaque intravenous to use ARC658 (serial number:.

Figure 46 shows to inject in your posterior vein to use two the compartment analysis tables of fit back concentration with respect to the time.

5) and ARC658 (serial number: the 62) sketch map of concentration Figure 47 describes when having zymosan in the macaque blood plasma C5b-9 concentration with respect to ARC187 (serial number:.

5) and ARC658 (serial number: the 62) sketch map of concentration Figure 48 describes when having zymosan in the macaque blood plasma C5a concentration with respect to ARC187 (serial number:.

Figure 49 be when describing the administration of macaque intravenous push and afterwards ARC187 (serial number: PK-PD research 5) is shown.

Figure 50 is an ARC187 (serial number: pharmacokinetic parameter table 5) after the administration of description macaque intravenous push.

Figure 51 is an ARC187 (serial number: the pharmacokinetic parameter sketch map of calculating 5) and practical measurement after the administration of description macaque intravenous push.

Figure 52 is a residual activity ARC187 (serial number: the horizontal sketch map of plasma concentration 5) after the administration of description macaque intravenous push.

Figure 53 is that the anti--fit human of C5 of prediction in the CABG operation needs dose form.

Figure 54 is the demonstration ARC187 that measures with clotting time (PT) and activated partial thromboplastin time (APTT) (serial number: 5) do not have the sketch map of external relative blood coagulation effect.

Figure 55 shows ARC187 (serial number: 5) resisting-blood coagulation activity and the active vitro effect table of protamine coagulant collection for heparin.

Figure 56 shows ARC187 (serial number: 5) do not influence anticoagulant sketch map in the heparin body.

Figure 57 suppresses to measure with the zymosan complement activity, and (serial number: 5) anti--complement function does not have the sketch map of effect for ARC187 for heparin and protamine.

Figure 58 be show when having human serum as anti--fit ARC1905 of C5 (serial number: 67) or ARC672 (serial number: the sheep red blood cell (SRBC) haemolysis of function 63) suppresses the sketch map of percent.

There is the people in Figure 59 A, and (serial number: haemolysis 67) suppresses the percent sketch map to ARC1905 when macaque and rat blood serum; There is the people in Figure 59 B, when macaque and rat blood serum, ARC1905, a kind of anti--C5 is fit, or ARC127, does not a kind ofly suppress IC in conjunction with the complement activity of C5 irrelevant fit (negative control) ₅₀The value table.

Figure 60 be competition in conjunction with test in, 67) or ARC672 (serial number: the 63) function of (trunnion axis) concentration, radio-labeled ARC186 (serial number: 4) the inhibition IC of (longitudinal axis) as unlabelled competition thing ARC1905 (serial number: ₅₀The value sketch map.

Figure 61 is that competition is in conjunction with in the test, when 37 degree and 25 are spent, as unlabelled competition thing ARC1905 (serial number: the 67) function of (trunnion axis) concentration, radio-labeled ARC186 (serial number: 4) the inhibition IC of (longitudinal axis) ₅₀The value sketch map.

Figure 62 is a standard curve sketch map of describing people C5a (hC5a) and macaque C5a (hC5a eq).

Figure 63 is what to describe with the complement activity test determination of zymosan-mediation, (the serial number: 67) the active inhibition of C5 IC of ARC1905 in people and the serum of macaque ₅₀, IC ₉₀, and IC ₉₉The value table.

Figure 64 is what to describe with the complement activity test determination of zymosan-mediation, as (the serial number: 67) the inhibition percentage rate of the C5a of function generation of ARC1905 in people and the serum of macaque.

Figure 65 is what to describe with the complement activity test determination of zymosan-mediation, (the serial number: 67) to the effect sketch map of C3a generation of ARC1905 in people and the serum of macaque.

Figure 66 is with complement activity winding model determination, derive from 5 not in volunteer's the human serum ARC1905 (serial number: 67) complement activity suppresses average IC ₅₀, IC ₉₀, and IC ₉₉The value table.

Figure 67 is in the complement activity winding model, as ARC1905, a kind of anti--C5 is fit, or ARC127, and is a kind of not in conjunction with the function of irrelevant fit (negative control) concentration of C5, the inhibition percentage rate sketch map that C5a and C3a produce.

Summary of the invention

The invention provides treatment, the material and the method for the ocular disease of prevention and/or stable complement-relevant (referring to the eye imbalance here).

In embodiments more of the present invention, the function of anti--aptamer regulated complement component of complement or its variant.In the particular preferred embodiment, a kind of anti--fit inhibition of complement or weaken complement component or the function of its variant, preferably, in vivo, particularly in the vertebrates, particularly in the mammal, more suitably in human body.In embodiments more of the present invention, for example, work as C2, C3, C4, C5 and/or factor B are the complement targets, fit function adjustment for suppressing, is finished by protein cleavage preferablyly.In embodiments more of the present invention, for example, work as C2b, C5b, C5, C7, C8, C9 is when factor B and/or properdin are the complement target, the adjustment of fit function for suppressing, is the gathering by active complement component preferablyly, finishes as invertase or membrane attack complex.In embodiments more of the present invention, for example, work as C3b, factor D, C1 (comprising C1r and/or C1s) and/or mannose are correlated with serine protease (" MASP ") when being the complement target, fit function adjustment, preferably is to suppress, and is to pass through enzymatic activity.In embodiments more of the present invention, for example work as C3a, C5a, when C3a receptor or C5a receptor are the complement target, fit function adjustment, preferably is to suppress, and is by the ligand/receptor combination.

In the embodiment, provide stable, treated and/or prevented C5a, the method for the eye imbalance of C5a and/or C5b-9 mediation, this method comprises the administered of needs stable, treats and/or prevents the anti--C5 medicine step of effective quantity of eye imbalance.In some embodiments, stable, the eye imbalance that treats and/or prevents is that the eye neovascularity generates imbalance.In some embodiments, stable, the eye imbalance that treats and/or prevents is diabetic renal papillary necrosis or degeneration of macula, particularly age-related macular degeneration (＂ AMD ＂).In some embodiments, stable, the AMD that treats and/or prevents is an exudative AMD.In some embodiments, stable, the AMD that treats and/or prevents is non-exudative AMD.

In some embodiments, provide stable, treat and/or prevent complement-mediated the method for eye imbalance, this method comprises the anti--fit step of C5 complement to the effective quantity of administered of needs.In some embodiments, anti--effective quantity of treatment that complement is fit is stable, treats and/or prevents effective quantity of eye imbalance.In embodiments more of the present invention, main body is a kind of vertebrates, is a kind of mammal in some embodiments, is human in some embodiments.In some embodiments, stable, the eye imbalance of the complement-mediation that treats and/or prevents is the eye imbalance of deformity or chronic inflammatory disease and/or area mediation.In some embodiments, stable, the eye imbalance of the complement-mediation that treats and/or prevents is selected from following group: the inflammation conjunctivitis, comprise giant papillary conjunctivitis, macular edema, uveitis, endophthalmitis, scleritis, corneal ulcer, xerophthalmia, glaucoma, the atrophic retinopathy, corneal graft rejection, intraocular surgery related complication such as intra-ocular lens are transplanted and the cataract operation related inflammation, Bchcet ' s disease, the Stargardt disease, immunity meets vasculitis, Fuch ' s disease, Vogt-Koyanagi-Harada disease, fibrosis under the retina, keratitis, vitreous-body-retina inflammation, eye parasitic infection/transfer, retinitis pigmentosa, cytomegaloviral retinitis and choroiditis.In some embodiments, stable, the eye imbalance that treats and/or prevents is a degeneration of macula, particularly age-related macular degeneration (" AMD ").In some embodiments, stable, eye imbalance right and wrong-exudative (" drying " and/or " atrophy ") the type AMD that treats and/or prevents.In some embodiments, stablize, the imbalance of the eye that treats and/or prevents is a kind of eye new vessels imbalance, as diabetic renal papillary necrosis or exudative (" wetting ") type AMD.

In some embodiments, stable C5 is provided, the method of the eye new vessels imbalance of C5a and/or C5b-9 mediation, particularly exudative AMD or diabetes retinitis, comprise the administered of needs is stablized C5, the anti--C5 medicine of effective quantity of the eye new vessels imbalance of C5a and/or C5b-9 mediation.In some embodiments, use anti--C5 medicine of effective quantity, the vision precision of main body is compared with the vision precision level of main body in anti--C5 Drug therapy process, be maintained until the level together of looking younger.In some embodiments, use the anti--C5 medicine of effective quantity, the retinal vessel density of main body is compared with the main body in the therapeutic process, keep approximately identical level.

In some embodiments, the method of the eye new vessels imbalance of stable complement-mediation is provided, particularly exudative AMD or diabetes retinitis, comprise to the administered of needs stablize complement-mediation the imbalance of eye new vessels effective quantity anti--complement is fit.In some embodiments, use effective quantity anti--complement is fit, and the vision precision of main body is compared with the vision precision level of main body in anti--complement aptamer therapeutics process, be maintained until look younger with level.In some embodiments, use effective quantity anti--complement is fit, and the retinal vessel density of main body is compared with the main body in the aptamer therapeutics process, keeps approximately identical level.In some embodiments, use effective quantity anti--complement is fit, make hemorrhage with new vessels in the main body-relevant, flow liquid is assembled, retina separate and/or the level of cicatrization with resist-complement aptamer therapeutics process in new vessels-relevant hemorrhage of main body, flow liquid is assembled, and the level of retina separation and/or cicatrization is compared and kept stablizing or keeping.

In some embodiments, treatment C5 is provided, the method of the eye new vessels imbalance of C5a and/or C5b-9 mediation, particularly exudative AMD or diabetes retinitis, comprise that the administered to needs reduces C5, the anti--C5 medicine of effective quantity of the eye new vessels diagonosis of disorder of C5a and/or C5b-9 mediation.In some embodiments, use anti--C5 medicine of effective quantity, the vision precision of main body is compared with the vision precision level of main body in anti--C5 Drug therapy process increased.In some embodiments, use anti--C5 medicine of effective quantity, make the retinal vessel density of main body compare minimizing to some extent with the main body in the therapeutic process.

In some embodiments, the method of the eye new vessels imbalance of treatment complement-mediation is provided, particularly exudative AMD or diabetes retinitis comprise that administered to needs reduces that the resisting of effective quantity of the eye new vessels diagonosis of disorder of complement-mediation-complement is fit.In some embodiments, use effective quantity anti--complement is fit, the vision precision of main body is compared with the vision precision level of main body in anti--complement aptamer therapeutics process is increased.In some embodiments, use effective quantity anti--complement is fit, the retinal vessel density of main body is compared with the main body in the therapeutic process is to some extent reduced.In some embodiments, use effective quantity anti--complement is fit, make hemorrhage with new vessels in the main body-relevant, flow liquid is assembled, retina separate and/or the level of cicatrization with resist-complement aptamer therapeutics process in new vessels-relevant hemorrhage of main body, flow liquid is assembled, and retina separates and/or the level of cicatrization is compared minimizing to some extent.

In some embodiments, improved the method for the eye new vessels imbalance that prevents clinical complement-mediation, particularly exudative AMD or diabetes retinitis comprise that administered to needs reduces that the resisting of effective quantity of the eye new vessels imbalance clinical symptoms of complement-mediation-complement is fit.In some embodiments, use effective quantity anti--complement is fit with the clinical infringement of vision precision of prevention main body.In some embodiments, use effective quantity anti--complement is fit with the relevant retinal vessel level of density of clinical eye new vessels imbalance in the prevention main body.In some embodiments, the danger of main body tool generation eye new vessels imbalance.In some embodiments, method further be included in use anti--complement fit before, diagnose having complement-dangerous main body of relevant eye new vessels imbalance.In some embodiments, diagnosis algorithm comprises that measuring main body drusen and/or retinal pigment change and mensuration vision precision does not have clinical weakening.In some embodiments, diagnosis algorithm comprises measures the variant factor H relevant with wild type factor H in the main body.Ripoche etc. (1998) have reported the aminoacid sequence of wild type factor H, the full amino acid sequence of people's complement factor H, Biochem.j.249,593-602.In some embodiments,, treat and/or prevent the new vessels eye imbalance of the complement-mediation of main body when providing stable, particularly during the method for diabetic retinopathy, resist-route of administration that complement is fit is eye or administration near the eyes.

In some embodiments, provide comprise to administered anti--the clinical C5 of C5 chemoprophylaxis main body, the eye new vessels imbalance of C5a and/or C5b-9 mediation, the method of exudative type AMD or diabetic retinopathy particularly, this method has comprised the anti--C5 medicine step to the effective quantity of administered, with prevention C5, the eye new vessels imbalance clinical symptoms of C5a and/or C5b-9 mediation.In some embodiments, use of the clinical loss of the anti--C5 medicine of effective quantity with prevention main body vision precision.In some embodiments, anti--C5 medicine of using effective quantity is with the relevant retinal vessel level of density of clinical eye neovascular disease in the prevention main body.In some embodiments, main body is in the danger that the imbalance of eye neovascularization takes place.In some embodiments, C5 takes place to tool before further being included in and using anti--C5 medicine in this method, and the main body of the eye new vessels imbalance of C5a and/or C5b-9 mediation is identified.In some embodiments, authentication step comprises the existence of measuring drusen in the main body and measures the vision precision and do not have clinical loss.In some embodiments, authentication step comprises the variant of measuring complement factor H in the main body.

In some embodiments of said method, method additionally comprises the step to administered anti-VEGF medicine, the VEGF medicine of particularly selecting from the group that comprises following material: nucleic acid molecules, fit, antisense molecule, RNAi molecule, protein, polypeptide, cyclic peptide, antibody or antibody fragment, sugar, polymer, micromolecule.

In some embodiments of said method, method additionally comprise to administered anti--step of PDGF medicine, the PDGF medicine of particularly from the group that comprises following material, selecting: nucleic acid molecules, fit, antisense molecule, RNAi molecule, protein, polypeptide, cyclic peptide, antibody or antibody fragment, sugar, polymer, micromolecule.

In some embodiments of said method, method additionally comprise to administered anti--step of blood vessel drug eluting.In some embodiments, anti--blood vessel drug eluting is the porphyrin derivatives.In some embodiments of porphyrin derivatives, be the verteporfin (Visud that is used to inject , the Novartis pharmaceutical companies, East Hanover, NJ).In some embodiments, this method further comprises the method with laser active porphyrin derivatives.

In the embodiment, provide stable, treated and/or prevented C5, the method for the non--exudative AMD of C5a and/or C5b-9 mediation comprises anti--C5 medicine to the effective quantity of administered of needs with stable, treatment and/non--exudative AMD of prevention.In the embodiment, when non--when exudative AMD is stabilized, use anti--C5 medicine of effective quantity, with keep with use anti--C5 medicine process in the drusen level of main body compare approximately identical drusen level.In the embodiment, when non--when exudative AMD is stabilized, use anti--C5 medicine of effective quantity, with keep with use anti--C5 medicine process in the vision precision level of main body compare approximately identical vision precision level.In the embodiment, when treatment non--during exudative AMD, use anti--C5 medicine of effective quantity, the drusen level of main body is compared to some extent and is reduced in making its drusen level and using anti--C5 medicine process.In the embodiment, when treatment non--during exudative AMD, use anti--C5 medicine of effective quantity, the vision precision level of main body is compared to some extent and is increased in making its vision precision level and using anti--C5 medicine process.In the embodiment, when prevention non--during exudative AMD, method comprises anti--C5 medicine to the effective quantity of administered of needs with prevention C5, the clinical symptoms of the non--exudative AMD of C5a and/or C5b-9 mediation.In some embodiments, use of the clinical loss of the anti--C5 medicine of effective quantity with vision precision in the prevention main body.In some embodiments, use the anti--C5 medicine of effective quantity and assemble with the clinical level of prevention drusen.In some embodiments, the danger of non--exudative AMD takes place in the main body tool.In some embodiments, C5 takes place to tool before further being included in and using anti--C5 medicine in method, and the main body of the non--exudative AMD danger of C5a and/or C5b-9 mediation is identified.In some embodiments, authentication step comprises the existence of measuring drusen in the main body and measures the vision precision and do not have clinical loss.In some embodiments, authentication step comprises the variant of measuring complement factor H in the main body.

In some embodiments of said method, anti-C5-medicine is to select from the group that comprises following material: nucleic acid molecules, and fit, antisense molecule, RNAi molecule, protein, polypeptide, cyclic peptide, antibody or antibody fragment, sugar, polymer, micromolecule.In the particular, anti-C5-medicine is that a kind of C5 specificity is fit, and more particularly from comprising serial number 1-67, the C5 that selects in the group of 75-81 and 88-98 is special fit.In the preferred embodiment, the C5 that uses in the said method special fit be from comprising ARC

5) and ARCD1905 (serial number: select in the group 67) 187 (serial numbers:.

In some embodiments of said method, anti--C5 medicine is carried by dosing eyes, especially by the glass vivo medicine-feeding.In some embodiments of said method, the anti-VEGF medicine, anti--PDGF medicine and/or anti--angiogenesis drug are carried by dosing eyes.In some embodiments of said method, anti--C5 medicine of using, the anti-VEGF medicine, anti--PDGF medicine and/or anti--angiogenesis drug is a kind of prodrug.In some embodiments of said method, main body is human.

The term that uses in the said method " in anti--C5 medicament administration process " comprises the preceding time of the symptom of suspecting being carried out Clinical detection of anti--C5 medicament administration.

In the embodiment, provide stable, treated and/or prevented the method for the non--exudative AMD of complement-mediated, comprise to the administered of needs treat effective quantity anti--complement is fit.Stablize in the embodiment of non--exudative AMD, use effective quantity anti--complement is fit, make its drusen level (for example, size, quantity, area and/or form) keep with resist-drusen level in administration process that complement is fit is identical.In the embodiment that non--exudative AMD is stabilized, use effective quantity anti--complement is fit, development with rational atrophy stably, comprise retinal pigment epithelium, the atrophy capillaceous of photosensitive receptor and/or venation is to keep the ground rational atrophy level identical with main body level in anti--fit application of complement.Stablize in the embodiment of non--exudative AMD, use effective quantity anti--complement is fit, make its main body vision precision level keep with resist-the fit application of complement in the vision precision level of main body identical.

Treat in the embodiment of non--exudative AMD, use effective quantity anti--complement is fit so that the level of drusen is particularly big, softish drusen is anti-than using-process that complement is fit in main body drusen level reduce to some extent.Treat in the embodiment of non--exudative AMD, use effective quantity anti--complement is fit, so that the vision precision of main body is compared and increased in the vision precision of the main body process fit with using anti--complement.

In the embodiment, provide the method for preventing non--exudative AMD, comprise to the effective quantity of administered of needs anti--complement is fit with the non--exudative AMD clinical symptoms of prevention complement-mediation.In the embodiment, use effective quantity anti--complement is fit, with the clinical loss of vision precision of prevention main body.In some embodiments, use effective quantity anti--complement is fit, assembles with the drusen that prevents clinical level, and is particularly big, soft drusen.In some embodiments, use effective quantity anti--complement is fit, with the rational atrophy in the ground of prevention clinical level.In some embodiments, the effective quantity of administered of-exudative AMD non-to having anti--complement is fit, to prevent the development of exudative AMD in the main body.Dimly in the embodiment, to main body with age-related macular degeneration (with existing of drusen, retinal pigment changes and/or the atrophy of zonule is a feature) use effective quantity anti--complement is fit, with the development of the exudative AMD that prevents main body or the rational atrophy in ground of clinical level.

In some embodiments, main body has the danger that non--exudative AMD takes place.In some embodiments, method further is included in to be used anti--complement and the main body of the non--exudative AMD of tool generation complement-mediation is identified before fit.In some embodiments, authentication step comprises the existence of measuring drusen in the main body, and is particularly big, soft drusen, and retinal pigment change and/or ischemic area and mensuration do not have the clinical loss of vision precision.In some embodiments, authentication step comprises the variant of measuring wild type complement factor H in the main body.

In some embodiments of said method, anti--complement target that the fit inhibition of complement is selected from following group: CCP composition, selectivity complement pathway composition and blood clotting pathway components.In some embodiments, anti--complement is fit to suppress the complement target with film attack approach.In some embodiments, anti--complement target that the fit inhibition of complement is selected from following group: C1, C1q, C1r, C1s, C2, C3, C3a, C3a receptor, C4, C5, C5a, C5a receptor, C5b, C6, C7, C8, C9, factor B, factor D, properdin, mannose be in conjunction with hemagglutinin (being " MBL " here), the MBL relevant serine protease 2 with MBL of serine protease 1 (" MASP1 ") (" MASP2 ") of being correlated with.In some embodiments, anti--complement is fit be not a kind of from following group, select the complement target is had high-affinity and specific fit: C3a, C3a receptor, C5a, and C5a receptor.In some embodiments, anti--complement is fit be not a kind of from following group, select the complement target is had high-affinity and specific fit: factor B and factor D.

In some embodiments of said method, by eye drops, particularly by in the crystalline lens or eye-all administrations carry anti--complement is fit.In some embodiments, to administered anti--complement is fit to be included in the file layout.

Term used herein " in anti--administration process that complement is fit " comprises the time of the symptom of being suspected being carried out clinical assays or assessment, wherein measure or time of assessment before anti--fit administration of complement to anti--during the fit administration of complement and in the short time afterwards, for example, after the administration 12 hours, after 24 hours, or after 48 hours.

In some embodiments, provide comprise the effective quantity of treatment anti--ophthalmic pharmaceutical compositions that complement is fit, for example, can stablize, treat and/or prevent effective quantity that the eye of complement-mediation is lacked of proper care.Pharmaceutical composition of the present invention can comprise a kind of drug acceptable carrier or diluent.This aspect the invention provides and suppresses function in the eye complement objective body, and particularly the people is intravital, comprises the fit pharmaceutical composition of the effective quantity of treatment, or its salt and a kind of drug acceptable carrier or diluent.In some embodiments, the ocular drug composition comprises a kind of storage form.

In a kind of embodiment, use in the said method anti--complement is fit to be C5 fit in the C5, particularly human body in a kind of inhibition body.In the particular, provide use in the said method with the bonded ARC186 of PEG aglucon (serial number: 4) anti--C5 is fit or comprise nucleotide sequence ARC186 (serial number: 4) fit.In the particular, ARC186 is fit/PEG covalency thing with comprise serial number: 4 sequences but disappearance PEG aglucon fit has substantially the same C5 complement protein binding affinity.Substantially the same binding affinity used herein refers to be no more than 2 to 10 times of differences with the dissociation constant of Dot blot assay determination, follows suitably for being no more than 2 to 5 times of differences.The competition Dot blot assay determination of dissociation constant to describe among the following embodiment 1A in some embodiments.In some embodiments, the Polyethylene Glycol aglucon comprise molecular weight greater than 10kDa, particularly greater than the molecular weight of 20kDa, more particularly greater than the molecular weight of 30kDa with greater than the molecular weight of 40kDa.In some embodiments, PEG aglucon and ARC186 (serial number: 5 ' the terminal combination 4).In some embodiments, with the half-life in the primates of the fit/PEG covalency thing of the two Room model determinations described among the embodiment 5E, being the terminal half-life suitably, being at least 15 hours, is 24 hours suitably, more suitably is at least 48 hours.In some embodiments, the two Room model half-life of fit/PEG covalency thing, in rat, be at least 10 hours, more suitably be 15 hours.In some embodiments, (serial number: 4) 5 ' terminal PEG is a kind of 40kDa PEG in conjunction with ARC186.40kDa PEG is a kind of PEG of branch in the specific embodiment.The 40kDa PEG of this branch is 1 in some embodiments, 3-pair (mPEG-[20kDa])-propyl group-2-(4 '-butamide).The 40kDa PEG of branch is 2 in other embodiments, 3-pair (mPEG-[20kDa])-propyl group-1-carbamyl.

40kDa PEG is 1 in branch, in the embodiment of 3-two (mPEG-[20kDa])-propyl group-2-(4 '-butamide), provides to have the fit of following structural formula:

Wherein,

～～～～～～a kind of junctional complex represented

Fit=fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfU fUfUAfCfCfUmGfCmG-3T (serial number: 4),

FC and fU=2 '-fluorine nucleoside wherein, mG and mA=2 '-OME nucleoside, other nucleoside be 2 '-OH, 3T represents reverse thymidine.

40kDa PEG is 2 in branch, in the embodiment of 3-two (mPEG-[20kDa])-propyl group-1-carbamyl, provides to have the fit of following structural formula:

Wherein

～～～～～～a kind of junctional complex represented

Fit=fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfU fUfUAfCfCfUmGfCmG-3T (serial number: 4),

FC and fU=2 '-fluorine nucleoside wherein, mG and mA=2 '-OME nucleoside, other nucleoside be 2 '-OH, 3T represents reverse thymidine.

Junctional complex is a kind of alkyl junctional complex in embodiments more of the present invention.In the particular, the alkyl junctional complex comprises 2 to 18 continuous CH ₂Group.In the suitable embodiment, the alkyl junctional complex comprises 2 to 12 continuous CH ₂Group.The alkyl junctional complex comprises 3 to 6 continuous CH in the specially suitable embodiment ₂Group.

In the special embodiment, fit ARC187 (serial number: 5) have following structural formula:

Wherein fit=fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfU fUfUAfCfCfUmGfCmG-3T (serial number: 4),

FC and fU=2 '-fluorine nucleoside wherein, mG and mA=2 '-OME nucleoside, other nucleoside be 2 '-OH, 3T represents reverse thymidine.

In another fit embodiment, ARC1905 (serial number: 67) have following structural formula:

Wherein fit=fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfU fUfUAfCfCfUmGfCmG-3T (serial number: 4)

FC and fU=2 '-fluorine nucleoside wherein, mG and mA=2 '-OME nucleoside, other nucleoside be 2 '-OH, 3T represents reverse thymidine.

In the embodiment, the ARC186 that comprises effective quantity is provided (serial number: 4), ARC187 (serial number: 5) or ARC1905 67) or the ophthalmic pharmaceutical compositions of its esters (serial number:, to treat in main body, eye stable and/or prevention complement-mediation is lacked of proper care.Pharmaceutical composition of the present invention can comprise a kind of drug acceptable carrier or diluent.This aspect, invention provide a kind of fit pharmaceutical composition or its esters and drug acceptable carrier or diluent of the effective quantity of treatment that comprise, suppress cracking in the C5 complement protein body.This aspect of the present invention provides interior therapeutic, and the ARC186 of stable and/or prevention ocular disease (serial number: 4), 5) or ARC1905 (serial number: 67) pharmaceutical composition ARC187 (serial number:.This aspect of the present invention also provides to be used to prepare interior therapeutic, and the ARC186 of stable and/or prevention ocular disease pharmaceutical composition (serial number: 4), 5) or ARC1905 (serial number: 67) ARC187 (serial number:.

In another embodiment, provide comprise the effective quantity of treatment anti--ophthalmic pharmaceutical compositions that C5 is fit, it comprises the nucleotide sequence of selecting from following group: serial number: 1 to 69,75,76,81,91,95 and 96, be used to prepare the pharmaceutical composition that complement-mediation therapeutic scheme uses.This aspect the invention provides and suppresses cracked fit pharmaceutical composition or its esters and drug acceptable carrier or the diluent of the effective quantity of treatment that comprise in the C5 complement protein body.

In another embodiment, the invention provides pharmaceutical composition.5) or ARC1905 (serial number: 67) or the pharmaceutical composition of its esters in the embodiment, provide to comprise the ARC187 that treats effective quantity (serial number:.Pharmaceutical composition of the present invention can comprise drug acceptable carrier or diluent.This aspect, invention provide and have comprised and suppress cracked comprised drug regimen that the effective quantity of treatment is fit thing or its esters and drug acceptable carrier or diluent in the C5 complement protein body.5) or ARC1905 (serial number: 67) pharmaceutical composition this aspect of invention is provided for treatment, prevents or improve the ARC187 (serial number: of disease in the body.5) or ARC1905 (serial number: 67) this aspect of invention also provides the ARC187 that is used for pharmaceutical compositions (serial number:.

Invention provides the method for treatment on the other hand.In the embodiment, method of the present invention provides treatment, 5) or ARC1905 (serial number: pharmaceutical composition 67) prevention or improve the C5 complement protein, and/or the disease of its derivatives C5a and C5b-9 mediation, this method comprise vertebrates used and comprise ARC187 (serial number:.In some embodiments, this method comprises administration pharmaceutical composition of the present invention.In some embodiments, mammal is human.

In some embodiments, by the C5 complement protein, the disease of C5a and C5b-9 mediation is acute atrophy disease (myocardial infarction, apoplexy, atrophic/reperfusion injury); The acute inflammation disease (catches septicemia, apoplexy, acute/as to cross acute transplant rejection), chronic inflammatory disease and/or immunity-disease mediated, comprise diabetic retinopathy, degeneration of macula, comprise exudative and non--exudative AMD, and also comprise allergy, asthma, rheumatic arthritis, with other rheumatism, multiple sclerosis and other sacred diseases, psoriasis and other dermatosis diseases, myasthenia gravis, systemic lupus erythematosus (sle) (SLE)); With subacute/chronic inflammatory disease, and/or immunity-disease mediated (comprising transplant rejection, glomerulonephritis and other kidney diseases and ocular disease).In some embodiments, the C5 complement protein, the disease of C5a and C5b-9 mediation comprises the complement activation of raid or circular correlation, wherein blood is through synthetic pipe and/or allosome material.In some embodiments, the C5 complement protein, the disease of C5a and C5b-9 mediation comprises the relevant myocardial damage of CABG operation, the myocardial damage myocardial damage relevant with restenosis that the sacculus angioplasty is relevant.In some embodiments, the C5 complement protein, the imbalance of C5a and C5b-9 mediation comprises the relevant myocardial damage of CABG operation, the myocardial damage myocardial damage relevant with restenosis that the sacculus angioplasty is relevant, the complication of the complement protein mediation that the CABG operation is relevant, the complication of the complement protein mediation that percutaneous coronary intervention (pci) is relevant, paroxysmal hematuria at night card, acute grafing repels, and crosses acute transplant rejection, subacute transplant rejection, and chronic transplanting rejection.The disease of C5 complement protein C5a that is treated in some embodiments and/or C5b-9 mediation is the relevant complication of CABG operation.In the particular, the disease of treatment is the relevant myocardial damage of CABG operation.In the special embodiment of Therapeutic Method of the present invention, its symptom is weakened, and disease stable and/or prevention is a kind of eye imbalance, and particularly diabetes retinitis is exudative and/or non--exudative AMD.

In some embodiments, method of the present invention comprise use ARC187 (serial number: 5) or ARC1905 (serial number: pharmaceutical composition 67) is to obtain the fit plasma concentration higher 5 to 10 times than endogenous C5 complement protein.In some embodiments, drug administration ARC187 (serial number: 5) or ARC1905 (serial number: 67) fit compositions is to obtain than endogenous C5 complement protein high 0.75 to about 5 times, 0.75 to 3 times, with 1.5 times to about 2 times to the fit plasma concentration of endogenous C5 complement protein, and use the plasma concentration of fit compositions in other embodiments to obtain to equate with the endogenous complement protein.In some embodiments, use comprise ARC187 (serial number: 5) or ARC1905 (serial number: pharmaceutical composition 67) is to obtain about 5 μ M, about 4 μ M, about 3 μ M, about 2 μ M, about 1.5 μ M, the fit plasma concentration of about 1 μ M or about 500nM.

The approach of any administration, process and speed can be used, with effective acquisition fit plasma concentration of the present invention.In some embodiments, pharmaceutical composition passes through intravenous administration.In some embodiments, pharmaceutical composition is by injecting and/or by the continous pouring administration.

Treatment, prevention and/or improve the relevant complication of CABG operation, particularly in the special embodiment of the myocardial damage that the CABG operation is relevant, drug administration compositions and successive administration were at least 24 hours before method was included in and performs the operation, in some embodiments be 48 hours or, be 72 hours in some embodiments.In the special embodiment of the present invention, before venous perfusion is fit than low dosage, simultaneously or afterwards by intravenous push about 0.75 to 1.25, be the fit of fit every patient kg of 1mg suitably, to obtain to double approximately the fit concentration of blood plasma of endogenous complement protein concentration, wherein mg dosage does not comprise the weight of covalency PEG.In some embodiments, will be than low dosage with 0.001 to 0.005mg/kg/min speed perfusion, wherein mg dosage does not comprise covalency PEG weight.In the special embodiment, will be than low dosage with the speed perfusion of 0.0013mg/kg/min.In other embodiments of aspect of the present invention, wherein fit/covalency thing comprises the half-life of abundant length, and fit pharmaceutical composition can pass through intravenous push administration once or twice every day.

Another aspect of the present invention provides diagnostic method.5) or ARC1905 (serial number: 67) comprise that the compositions of C5 complement protein or its variant contact with suspecting, and the existence or the disappearance of mensuration C5 complement protein or its variant in the embodiment, diagnostic method comprises the (serial number: with ARC187.Complement protein or variant are to belong to vertebrate in some embodiments, and particularly mammal is more especially human.5) or ARC1905 (serial number: 67) compositions the invention provides the ARC187 that is used for external or in-vivo diagnostic (serial number:.

Another aspect of the present invention provides to comprise from following group and to select the fit of nucleotide sequences: ARC330 (serial number; 2), ARC188-189, ARC250, ARC296-297, ARC331-334, ARC411-440, ARC457-459, ARC473, ARC522-525, ARC532, ARC543-544, ARC550-554, ARC657-658, ARC672, ARC706, ARC1537, and ARC1730 (serial number: 6 to serial number: 66).In another embodiment, provide the ARC330 that is used for pharmaceutical compositions (serial number; 2), ARC188-189, ARC250, ARC296-297, ARC331-334, ARC411-440, ARC457-459, ARC473, ARC522-525, ARC532, ARC543-544, ARC550-554, ARC657-658, ARC672, ARC706, ARC1537, and ARC1730 (serial number: 6 to serial number: any 66).In this regard, the invention provides fit or its esters and a kind of drug acceptable carrier or the diluent that comprises the effective quantity of cracked treatment in the inhibition C5 complement protein body.

In the special embodiment, provide to comprise serial number: 1 nucleotide sequences fit.In the special embodiment, provide from serial number: 61, serial number: 62, serial number: 64 to serial number: select the fit of nucleotide sequences in 66.In some embodiments, comprise from serial number when fit: 61, serial number: 62, serial number: 64 to serial number: during the nucleotide sequences selected in 66, this is fit to the binding affinity of C5 complement protein with comprise serial number: 4 but lack the fit fully identical of PEG aglucon.

In the special embodiment, comprise from serial number when fit: 61, serial number: 62, serial number: 64 to serial number: during the nucleotide sequences selected in 66, with the half-life of two Room model determinations among the embodiment 5E, particularly terminal half-life, being at least 16 in primates, is 30 hours suitably.In some embodiments, comprise from serial number when fit: 61, serial number: 62, serial number: 64 to serial number: during the nucleotide sequences selected in 66, with the half-life of two Room model determinations among the embodiment 5E, particularly the terminal half-life, in rat, be at least 1 and a half hours, be suitably at least 7 hours.

In some embodiments of this aspect of the present invention, comprise from serial number when fit: 61, serial number: 62, serial number: 64 to serial number: during the nucleotide sequences selected in 66, fit following synthetic to have 5 ' junctional complex form: H ₂N～～～5 ' fit 3 ', wherein～～～the expression junctional complex.This junctional complex is the alkyl junctional complex in some embodiments: H2N-(CH ₂) n-5 ' is fit 3 ', wherein n=2 to 18, n=2-12, more suitably n=3 to 6 suitably, more suitably n=6, and fit fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfU fUfUAfCfCfUmGfCmG-3T (serial number: 4)

FC and fU=2 '-fluorine nucleoside wherein, mG and mA=2 '-OME nucleoside, other nucleoside be 2 '-OH, 3T represents reverse thymidine.Last amino-modification is fit can with from comprising 10kDa PEG, 20kDa PEG, the PEG aglucon combination of selecting in the group of the linear PEG of 30kDaPEG and 40kDa PEG.In some embodiments, the pharmaceutical composition for the treatment of the fit or its esters of effective quantity is provided, it comprises from serial number: 1, serial number: 2 and serial number 6 to serial number: the nucleotide sequences of selecting in 66 the group, particularly from serial number: 61, serial number: 62, serial number: 64 to serial number: the nucleotide sequences of selecting in 66.Pharmaceutical composition of the present invention can comprise drug acceptable carrier or diluent.This aspect of the present invention, provide and be used for the treatment of, prevent or improve the pharmaceutical composition of disease in the body, it comprises from serial number: 2 and serial number 6 to serial number: select the fit of nucleotide sequences 66, particularly from serial number: 61, serial number: 62, serial number: 64 to serial number: select in 66.

In another embodiment, treatment is provided, prevent or improve the method for the disease of C5 complement protein mediation, comprise vertebrates is used the pharmaceutical composition that comprises a kind of fit or its esters, wherein fit comprising from serial number 2 and serial number: 6 to serial number: the nucleotide sequence selected 66 the group, serial number particularly: 61, serial number: 62, and serial number: 64 to 66.In embodiments more of the present invention, method comprises mammal, is human administration pharmaceutical composition of the present invention suitably.

In some embodiments, the C5 complement protein of treatment, the disease of C5a and/or C5b-9-mediation is acute atrophy disease (myocardial infarction, apoplexy, atrophic/reperfusion injury); The acute inflammation disease (catches septicemia, apoplexy, acute/as to cross acute transplant rejection), chronic inflammatory disease and/or immunity-disease mediated, comprise diabetic retinopathy, degeneration of macula, comprise exudative and non--exudative AMD, and also comprise allergy, asthma, rheumatic arthritis, with other rheumatism, multiple sclerosis and other sacred diseases, psoriasis and other dermatosis diseases, myasthenia gravis, systemic lupus erythematosus (sle) (SLE)); With subacute/chronic inflammatory disease, and/or immunity-disease mediated (comprises transplant rejection, glomerulonephritis and other kidney diseases and ocular disease.In some embodiments, the C5 complement protein, the disease of C5a and C5b-9 mediation comprises the complement activation of raid or circular correlation, wherein blood is through synthetic pipe and/or allosome material.In some embodiments, the C5 complement protein, the disease of C5a and C5b-9 mediation comprises the relevant myocardial damage of CABG operation, the myocardial damage myocardial damage relevant with restenosis that the sacculus angioplasty is relevant.In some embodiments, the C5 complement protein, the imbalance of C5a and C5b-9 mediation comprises the relevant myocardial damage of CABG operation, the myocardial damage myocardial damage relevant with restenosis that the sacculus angioplasty is relevant, the complication of the complement protein mediation that the CABG operation is relevant, the complication of the complement protein mediation that percutaneous coronary intervention (pci) is relevant, paroxysmal hematuria at night card, acute grafing repels, and crosses acute transplant rejection, subacute transplant rejection, and chronic transplanting rejection.The disease of C5 complement protein C5a that is treated in some embodiments and/or C5b-9 mediation is the relevant complication of CABG operation.In the particular, the disease of treatment is the relevant myocardial damage of CABG operation.In the special embodiment of Therapeutic Method of the present invention, its symptom is weakened, and disease stable and/or prevention is a kind of eye imbalance, and particularly diabetes retinitis is exudative and/or non--exudative AMD.

In some embodiments, method of the present invention comprises administered is comprised a kind of fit pharmaceutical composition that it comprises from serial number: 2, and serial number: 6 to serial number: 6

The nucleotide sequence, particularly serial number selected in 6: 61, serial number: 62, and serial number: 64 to serial number: 66, the fit plasma concentration that makes main body is 0.5 to 10 times of endogenous C5 complement protein concentration.In some embodiments, the fit compositions of drug administration is to obtain than endogenous C5 complement protein high 0.75 to about 5 times, 0.75 to 3 times, with 1.5 times to about 2 times to the fit plasma concentration of endogenous C5 complement protein, and use the plasma concentration of fit compositions in other embodiments to obtain to equate with the endogenous complement protein.In some embodiments, use pharmaceutical composition of the present invention to obtain about 5 μ M, about 4 μ M, about 3 μ M, about 2 μ M, about 1.5 μ M, the fit plasma concentration of about 1 μ M or about 500nM.

Can use the route of administration of the fit concentration of any effective acquisition the present invention, process, and speed.In some embodiments, pharmaceutical composition passes through intravenous administration.In some embodiments, pharmaceutical composition is by injecting and/or the continous pouring administration.

In treatment, prevention and/improve the CABG relevant complication of performing the operation, particularly in the special embodiment of the myocardial damage that the CABG operation is relevant, present invention resides in before the operation and made pharmaceutical composition continuously at least 24 hours afterwards, be 48 hours in some embodiments or be 72 hours in some embodiments.In the particular of the present invention, desired fit plasma concentration, for example, be the twice of endogenous complement protein concentration in some embodiments, be in the venous patient of being treated the perfusion low dosage fit before, simultaneously, or afterwards, obtain by the intravenous push administration.In another embodiment of the present invention, when fit/when the covalency thing comprised the half-life of abundant length, fit pharmaceutical composition can be by intravenous push administration every day 1 to 2 time.

Provide diagnostic method in another embodiment of the present invention.In the embodiment, diagnostic method comprises compositions and a kind of fit contact, it comprises serial number: 2 and serial number: 6 nucleotide sequences to serial number 66, serial number particularly: 61, serial number: 62, and serial number: 64 to serial number: 66, and measure the existence or the disappearance of C5 complement protein in the compositions or its variant.In some embodiments, complement protein or variant are vertebrate, and be particularly mammiferous, more especially human.Fit compositions provided by the invention has and comprises from serial number: 2 and the nucleotide sequence selected to the serial number 66 of serial number 6 fit, be used for external or in-vivo diagnostic.In the present invention, provide to comprise from serial number: 2 and the nucleotide sequence selected to the serial number 66 of serial number 6 fit, be used for pharmaceutical compositions.

Another aspect of the present invention provides to comprise the fit of a kind of nucleotide sequence, itself and serial number: 75 to 81, serial number: 83 and serial number 88 to 98 in the sequence selected have 80% concordance.In some embodiments, provide to comprise the fit of a kind of nucleotide sequence itself and serial number: 75 to 81, serial number: 83 and serial number 88 to 9

Unique zone of the arbitrary sequence of selecting in 8 has 80% concordance.In another embodiment, provide to comprise the fit of a kind of nucleotide sequence itself and serial number: 75 to 81, serial number: 83 and serial number 88 to 98 in the sequence selected have 90% concordance.In a kind of special embodiment, provide to comprise the fit of a kind of nucleotide sequence itself and serial number: 75 to 81, serial number: 83 and serial number 88 to 98 in unique zone of the arbitrary sequence selected have 90% concordance.And in another embodiment, provide to comprise the fit of a kind of nucleotide sequence 40 continuous nucleoside wherein and serial number: 75 to 81, serial number: 83, consistent with 40 continuous nucleoside in the optional sequence in the serial number 88 to 98.In another embodiment, provide to comprise the fit of a kind of nucleotide sequence 30 continuous nucleoside wherein and serial number: 75 to 81, serial number: 83, consistent with 30 continuous nucleoside in the optional sequence in the serial number 88 to 98.And in another embodiment, the fit of the specific bond C5 complement protein that comprises a kind of nucleotide sequence is provided, 10 continuous nucleoside wherein and serial number: 75 to 81, serial number: 83, consistent with 10 continuous nucleoside in the optional sequence in the serial number 88 to 98.In a kind of suitable embodiment, provide to comprise the fit of a nucleotide sequences itself and serial number: 75 to 81, serial number: 83, consistent with optional sequence in the serial number 88 to 98.

In some embodiments, the above-mentioned of the present invention fit chemical modification of selecting in following group that may further include: the chemistry of glycosyl position is replaced; The chemistry of phosphoric acid position is replaced; Drawing in full amount of the base position of nucleotide sequence replaced.In some embodiments, modification is selected from following group: the integration of modified nucleoside; 3 ' add medicated cap, with high molecular non--covalent bond of immunogen compound; The covalent bond of lipophilic compound; The modification of phosphoric acid skeleton.

In the special embodiment of the present invention, the function of fit adjustment C5 complement protein or its variant.In the specially suitable embodiment, the function of fit inhibition C5 complement protein or its variant, particularly in vivo, more especially in human body.In one embodiment of the invention, fit function adjustment for suppressing, is the cracking to the C5 complement protein suitably.

In some embodiments on the other hand, the invention provides and suppress cracked pharmaceutical composition and a kind of drug acceptable carrier or the diluent that comprises the fit or its esters of the effective quantity of treatment in the C5 complement protein body.

In some embodiments, provide a kind of pharmaceutical composition or its esters for the treatment of effective quantity that comprise, itself and serial number: 75 to 81, serial number: 83 and serial number 88 to 98 in the sequence selected have 80%, be 90% concordance suitably.In some embodiments, provide a kind of pharmaceutical composition or its esters for the treatment of effective quantity that comprise, itself and serial number: 75 to 81, serial number: 83, having 80% with unique zone of the arbitrary sequence of selecting in the serial number 88 to 98, is 90% concordance suitably.In other embodiments, provide to comprise a kind of fit pharmaceutical composition of effective quantity for the treatment of, wherein 40,30 or 10 continuous nucleoside and serial number: 75 to 81, serial number: 83 and serial number 88 to 98 in 40,30 or 10 continuous nucleoside unanimities of the nucleotide sequences selected.The bright pharmaceutical composition that bursts out also can comprise a kind of drug acceptable carrier or diluent.This aspect of the present invention provides and has been used for the treatment of, prevent or improve the pharmaceutical composition of disease in the body, wherein the fit or its esters that comprises of this pharmaceutical composition has from serial number: 3 to 4, and serial number: 75 to 81, serial number: 83 and serial number: the nucleotide sequences of selecting in 88 to 98.This aspect provides to be used for the having from serial number of pharmaceutical compositions: 3 to 4, and serial number: 75 to 81, serial number: 83 and serial number: the nucleotide sequences of selecting in 88 to 98 fit.This aspect the invention provides and comprises a kind of pharmaceutical composition for the treatment of the fit or its esters of effective quantity, and it can suppress cracking in the body of C5 complement protein, and a kind of drug acceptable carrier or diluent.

In some embodiments, the C5 complement protein of treatment, the disease of C5a and/or C5b-9-mediation is acute atrophy disease (myocardial infarction, apoplexy, atrophic/reperfusion injury); The acute inflammation disease (catches septicemia, apoplexy, acute/as to cross acute transplant rejection), chronic inflammatory disease and/or immunity-disease mediated, comprise diabetic retinopathy, degeneration of macula, comprise exudative and non--exudative AMD, and also comprise allergy, asthma, rheumatic arthritis, with other rheumatism, multiple sclerosis and other sacred diseases, psoriasis and other dermatosis diseases, myasthenia gravis, systemic lupus erythematosus (sle) (SLE)); With subacute/chronic inflammatory disease, and/or immunity-disease mediated (comprises transplant rejection, glomerulonephritis and other kidney diseases and ocular disease.In some embodiments, the C5 complement protein, the disease of C5a and C5b-9 mediation comprises the complement activation of raid or circular correlation, wherein blood is through synthetic pipe and/or allosome material.In some embodiments, the C5 complement protein, the disease of C5a and C5b-9 mediation comprises the relevant myocardial damage of CABG operation, the myocardial damage myocardial damage relevant with restenosis that the sacculus angioplasty is relevant.In some embodiments, the C5 complement protein, the imbalance of C5a and C5b-9 mediation comprises the relevant myocardial damage of CABG operation, the myocardial damage myocardial damage relevant with restenosis that the sacculus angioplasty is relevant, the complication of the complement protein mediation that the CABG operation is relevant, the complication of the complement protein mediation that percutaneous coronary intervention (pci) is relevant, paroxysmal hematuria at night card, acute grafing repels, and crosses acute transplant rejection, subacute transplant rejection, and chronic transplanting rejection.The disease of C5 complement protein C5a that is treated in some embodiments and/or C5b-9 mediation is the relevant complication of CABG operation.In the particular, the disease of treatment is the relevant myocardial damage of CABG operation.In the special embodiment of Therapeutic Method of the present invention, its symptom is weakened, and disease stable and/or prevention is a kind of eye imbalance, and particularly diabetes retinitis is exudative and/or non--exudative AMD.

In some embodiments, method of the present invention comprises administered is comprised a kind of fit pharmaceutical composition, it comprises from serial number: 3 to 4, serial number: 75 to 81, serial number: 83 and serial number: the nucleotide sequence, particularly serial number selected in 88 to 98: 61, serial number: 62, and serial number: 64 to serial number: 66, and the fit plasma concentration that makes main body is 0.5 to 10 times of endogenous C5 complement protein concentration.In some embodiments, the fit compositions of drug administration is to obtain than endogenous C5 complement protein high 0.75 to about 5 times, 0.75 to 3 times, with 1.5 times to about 2 times to the fit plasma concentration of endogenous C5 complement protein, and use the plasma concentration of fit compositions in other embodiments to obtain to equate with the endogenous complement protein.In some embodiments, use pharmaceutical composition of the present invention to obtain about 5 μ M, about 4 μ M, about 3 μ M, about 2 μ M, about 1.5 μ M, the fit plasma concentration of about 1 μ M or about 500nM.

Can use the route of administration of the fit concentration of any effective acquisition the present invention, process, and speed.In some embodiments, pharmaceutical composition passes through intravenous administration.In some embodiments, pharmaceutical composition is by injecting and/or the continous pouring administration.

In treatment, prevention and/improve the CABG relevant complication of performing the operation, particularly in the special embodiment of the myocardial damage that the CABG operation is relevant, present invention resides in before the operation and made pharmaceutical composition continuously at least 24 hours afterwards, be 48 hours in some embodiments or be 72 hours in some embodiments.In the particular of the present invention, desired fit plasma concentration, for example, be the twice of endogenous complement protein concentration in some embodiments, be in the venous patient of being treated the perfusion low dosage fit before, simultaneously, or afterwards, obtain by the intravenous push administration.In another embodiment of the present invention, when fit/when the covalency thing comprised the half-life of abundant length, fit pharmaceutical composition can be by intravenous push administration every day 1 to 2 time.

Provide diagnostic method in another embodiment of the present invention.In the embodiment, diagnostic method comprises and will suspect the compositions and a kind of fit contact of sudden and violent button C5 complement protein or its variant, it comprises serial number: 75 to 81, serial number: 83 and the nucleotide sequence of serial number 88 to 98, and measure the existence or the disappearance of C5 complement protein in the compositions or its variant.In some embodiments, complement protein or variant are vertebrate, and be particularly mammiferous, more especially human.Fit compositions provided by the invention has and comprises from serial number: 75 to 81, serial number: 83 and serial number 88 to 98 in the nucleotide sequence selected fit, be used for external or in-vivo diagnostic.

In some embodiments, provide to comprise the fit of a kind of nucleotide sequences, it is in essence by from serial number: the nucleotide sequences of selecting 68 and 69 is formed.In some embodiments, provide to comprise the fit of a kind of nucleotide sequences, it is by from serial number: the nucleotide sequences of selecting 68 and 69 is formed.In embodiments more of the present invention, fitly can be used for diagnostic method.

In the embodiment, a kind of method of the present invention is directly treated, the eye imbalance of stable and/or prevention complement-mediation, and this method comprises uses the step that the resisting of the effective quantity of treatment-complement is fit to the main body of needs.In the embodiment, the eye imbalance of being treated is a degeneration of macula.In the embodiment, the eye imbalance of being treated is that a kind of eye neovascularity generates imbalance.

The specific embodiment

Details describes in the following description in one or the multiple embodiments of the present invention.Though any with describe method and material similar or that equate here and can be used for practice of the present invention or test, more suitably method and material just are described.Other features of the present invention are conspicuous in the description here of object and advantage.In explanation, singulative also can comprise plural number, unless clearly regulation is arranged in the context in addition.Unless otherwise defined, all technology used herein and scientific terminology have by the same meaning of the institute of the those of ordinary skill in the field under the present invention common sense.If any conflict, this explanation is with controlled.

Anti--C5 medicine and eye imbalance

Present data show age related macular degeneration (AMD) is still a kind of inflammation mediated disease of complement activity participation effect.Age-related macular degeneration (" AMD ") is a kind of chronic and process oculopathy, and it is the U.S., and Europe and Japan cause the guided bone reason of the visual impairment that can't retrieve.AMD is with the process deterioration of foveal region of retina zone macula lutea.The appearance that the most tangible index thing of process AMD is a drusen has Huang-Bai deposit under retina, it is the speckle that derives from the retina cell metabolic waste.The appearance of drusen is two kinds of form AMD: the important composition of exudative (" wetting ") and non--exudative (" doing ").Wet type AMD when growing under retina and infect retina by the membrane structure that is known as Bruch ' s film, neovascularity takes place.This abnormal vascular growth is often referred to angiogenesis or (choroid) neovascularity generates.These neovascularity break easily and often hemorrhage and liquid body exudate to macula lutea, the result causes suddenly and serious visual impairment usually sometimes.Though new treatment (for example, Lucentis ^TM) can stop the gathering of angiogenesis and reverse fluid, even in a few patients, recover vision, yet the infringement of angiogenesis often causes scabbing of retina cell and/or damages and cause nonvolatil vision loss.The development of drusen is ahead of wet type AMD usually, and it compiles and comprise complement protein, comprises complement factor H (CFH).A large amount of, medium relevant with disease after-stage development great risk to big drusen, it is generated as feature with rational atrophy in ground and/or neovascularity.It is diagnosed out the back several months at affected eyes serious vision loss taking place in two years, though vision loss also can take place in a few hours or a couple of days to most of wet type AMD in disease.Dry type AMD is normally slower, and in macula lutea light-sensitive cells slow atrophy takes place, and it is slowly fuzzy that affected eye center vision is taken place.The formation of drusen and gathering are amphiblestroid deterioration sometimes, cause the acceleration of vision loss, though do not follow unusual angiogenesis and hemorrhage.

Cause having complement component and other inflammatory mediators (Haines etc. (2005) Science 308:419-421) in the observed drusen and inflammatory cell in the damage of the relevant vision loss of AMD-.AMD and genetic defect relevant strongly (Haines etc., 2005) in the complement adjusting approach.The variant of coding complement factor H (CFH) gene passes through it to the drusen Influence and Development, the precursor vision loss relevant that neovascularity generates with AMD, as if greatly or fully cause increasing the danger (Edwards etc., (2005) Science 308:421-424) of AMD.The Elementary Function of CFH be by in conjunction with and inactivation C3b or stimulating factor Bb separate the activity of downward modulation selectivity cascade invertase from C3b.(Hageman etc. (2005) PNAS 102 (2): 7227-7232).The probability that present gene data demonstration wet type-AMD drusen patient has 50-70% just has CFH allele, causes intensive complement is interfered and AMD treats related (Klein etc. (2005) Science 308:385-389).A kind of inhibition its active anti--C5 is fit, also can in the patient who has the relevant defective CFH gene of AMD, work.Similarly, a kind of inhibition selectivity cascade target, as factor B, factor D, and properdin, regular grade is unified into branch, and particularly C3 and membrane attack complex composition is fit, can suppress active, even patient has the relevant defective CFH gene of AMD.The haplocype of some complement factor Hs (CFH) gene is after measured for to develop the danger of degeneration of macula relevant with patient.Particularly, the tyrosine of complement factor H (CFH) 402 amino acids-histidine change causes and the strong relevant CFH genetic mutation result of disease-susceptible humans on chromosome 1.The change of sequence is positioned in conjunction with heparin and C-reactive protein CFH zone.AMD takes place in the congenital people Geng Yi that has this CFH genetic mutation.The CFH genetic mutation may cause half in the U.S.'s 15000000 degeneration of macula cases.If have the CFH genetic mutation, its probability that degeneration of macula takes place will increase by 2.5 to 5.5 times among the old people.

The CFH gene works in regulating pathways of inflammation (selectivity complement pathway).This surperficial inflammation also has important function in degeneration of macula.The blood levels of markers of inflammation thing C-reactive protein (CRP) has been found that the development that can promote degeneration of macula.(Science.2005 April 15; 308 (5720): 419-21, Science.2005 April 15; 308 (5720): 421-4, Science.2005 April 15; 308 (5720): 385-9).Based on its position location at the CRP calmodulin binding domain CaM of heparin and factor H, the Y402H variant can destroy the convening of the host cell surface H factor of Dan Baijutang and CRP mediation, has got rid of the downward modulation ability of factor H to the C3b that piles up cell.Because C5a and the not controlled release of C5b-9, the untamed expansion of complement pathway in host tissue cause the inflammation in the retina to take place and angiogenesis.CFH stops not controlled complement activity and inflammation; Therefore the sudden change among the CFH is with exacerbate inflammation and its consequence.By reducing too much complement (pathways of inflammation) activity in the degeneration of macula, perhaps we can slow down the process of disease.In addition, relatively with at present, the mensuration to genetic mutation can be used for the joint imaging technology more early to identify the individuality that produces high-risk AMD in the future.(JAMA.2005 April 20; 293 (15): 18410)

Complement activity has related to other ocular disease, as diabetic retinopathy, and may compound or initial vascular lesion (Zhang etc., (2002) Diabetes 51:3499).Appreciation diabetic renal papillary necrosis (PDR) is a kind of diabetic complication that causes that changed by retinal vessel.When the evil of the vascular injury in the retina, its possibility oozing of blood also becomes fragile, and brush sample branch and scar tissue occur.Stain or distortion appear in this image that will make retina transfer to brain.25% type i diabetes people will stand diabetic renal papillary necrosis according to estimates, and rise to 60% after 5 years, be 80% behind the 10-15.This disease is with hyperglycemia, basement membrane thickened, peripheral cells is lost, new vessels turns to feature before blood capillary aneurysm and the retina, itself since disengaging hemorrhage and that retina involves cause losing one's sight.The diabetic retina of non-dispersive and with microangioma in the retina, hemorrhage, new-fiber-layer blocks, rigid oozing out and the blood capillary deformity.Macular edema is the main mechanism of visual impairment.This is the result of macula lutea (foveal region of retina zone) capillary tube microangioma venous leakage.Seepage can be aggravated macula lutea and be thickened, and it oozes out or the capsule sample changes relevantly with rigid, and causes central vision in various degree to lose.The appreciation diabetic renal papillary necrosis turns to feature with retinal neovascularization.It is according to the existence of retinal neovascularization, the position, and seriousness is carried out classification with relevant hemorrhagic activity.It is relevant with serious vision loss.The cause of disease of diabetic retinopathy can ascribe following disease stage to.Circulatory problems causes retinal area ischemia or atrophy.Neovascularization causes neovascularity to begin to grow to keep suitable oxygen level in vitreous body.The oozing of blood of new capillary vessel and the formation of scar tissue produce amphiblestroid traction and cause gap to form.Shed tears and subsequently under layer of retina or between and flow liquid and disengaging appear.Because hemorrhage, edema and cicatrix produce, patient's vision occurs fuzzy, drift, flash of light and blind suddenly.

Low-level constant complement activity usually occurs in the non-diabetic human eye, its in the big rathole of non-diabetic with MAC exist with Complement Regulatory Protein be feature, the imbalance that shows complement occurs in (Sohe etc., (2000) IOVS 41:3492) among the diabetes patient.In addition, in diabetes patient volunteer's retinal vessel, be measured to the deposition of C5b-9, in the non-diabetic people, then do not have (Zhang etc.), in diabetic retina, find the expression decreased (Zhang etc.) of CD55 and CD59, and in the diabetes Urina Hominis, find to exist glycosylation CD59 (Acosta etc., (2002) PNAS 97,5450-5455).In addition, known complement and vascular system are activated in the type i diabetes.See, for example, Hansen, T.K. etc., diabetes, 53:1570-1576 (2004).C5a activates endotheliocyte by immunity and complement system.See, for example, Albrecht, E.A. etc., Am J Pathology, 164:849-859 (2004).Vascular system is activated in comprising the ocular disease of diabetic retinopathy.See, for example, Gert, V.B. etc., Invest Opthalmol Vis Sci, 43:1104-1108 (2002).Complement system also is activated in diabetic retinopathy.See, for example, Gert, V.B. etc., Invest Opthalmol Vis Sci, 43:1104-1108 (2002) and Badouin, C etc., Am J Opthalmol, 105:383-388 (1988).

Uveitis is represented Uveal inflammation, and pigment vascular lamina (or film) is positioned between sclera (fibrous membrane) and the retina (visual light sensitive layer), with iris, and ciliary body and choroid (nourishing amphiblestroid blood vessel and conjunctive tissue layer).Because Uveal dissection complexity, uveitis is divided many types, and because uvea and other structures of eye () anatomy relationship for example, retina, uvea common related with the inflammation of its hetero-organization (for example, retinitis).Uveitis is divided into anterior uveitis usually (mainly influences iris and relevant ciliary body, cup between iris and the cornea and the flow liquid that comprises), intermediate uveitis (influence orbiculus ciliaris behind the ciliary body and retina before " edge "), or posterior uveitis (influence chamber, retro-iridian back, it is full of transparent gel-form nature of glass liquid and directly links to each other with retina).Anterior uveitis is a modal form and relevant with autoimmune disease such as rheumatic arthritis usually.Be inferior common form intermediate uveitis.Posterior uveitis is least common form, may cause by system's infection (for example, viral, bacillary, fungoid, or toxin) or relevant with autoimmune disease.The uveitic generation of autoimmune also can not comprise systematic influence.Uveitis also can be caused (for example, injured, operation etc.) or unknown cause (" congenital ") by wound.Do not consider nosetiology, the uveal inflammation of any influence all will cause uveitis.

Part tissue of eye and liquid contain multiple complement component usually, as factor B in the tunica uvea tissue and C2, and C4, C3, C5, C6, and C7 (Brawman-Mintzer O, Invest Ophthalmol Vis Sci.1989 October; 30 (10): 2240-4), the C1 in the aqueous humor, C4, C3 and C5 (Mondino BJ, Arch Ophthalmol.March nineteen eighty-three; 101 (3): 465-8) and the C1 in the cornea, C4, C2, C3, C5, C6 and C7 (Mondino BJ, Arch Ophthalmol.1981 August; 99 (8): 1430-3).These complement components have been considered to important normal immanoprotection action with relevant Complement Regulatory Protein in part tissue of eye.

The important function of complement activity in the uveitis nosetiology is indicated by the following fact: with respect to retinal vasculitis patient (contrast), the special-shaped incidence rate of anterior uveitis patient's C4 (C4B2) raises (Wakefield D, Hum Immuno1.1988 March; 21 (4): 233-7); The plasma concentration of the immune complex of congenital uveitis and philtrum C3d and comprise-complement raises (Vergani S, Br J Ophthalmol.1986 January; 70 (1): 60-3); The hemolytic activity of system inflammation disease and concurrent uveitis patient's lachrymal gland flow liquid (tear) complement-mediation and the rising of C3 and C4 level; (Drozdova EA, the Vestn Oftalmol.2004 7-8 month; 120 (4): 24-6); With the tunica uvea zone immune complex of the initial incident of conduct in uveitis and deposition (O ' Connor GR, Trnas Ophthalmol SocU K, in JIUYUE, 1981 of complement; 101 (Pt3) (3): 297-300). complement activity has been included in many inflammation and/or autoimmune diseases that have uveitis eye diseases, comprises Behcet ' s disease (Cuchacovich M, the Clin Exp Rheumatol.2005 7-8 month; 23 (4 Suppl 38): S27-34, Bardak Y, Ocul Immunol Inflamm.2004 March; 12 (1): 53-8), Fuch ' s heterochromic iridocyclitis (La Hey E, Am J Ophthalmol.1992 January 15; 113 (1): 75-80), Vogt-Koyanagi-Harada disease (Sakamoto T, Ophthalmol.In JIUYUE, 1991; 109 (9): 1270-4) and Asian TV Station's postretinal fiberization and chronic uveitis (Palestine AG, Ophthalmology.1985 June; 92 (6): 939-44).

A large amount of test-initiation uveitis animal models have shown that complement activity is (Jha P, the Invest Ophthalmol Vis Sci.2006 March of important pathogenic factor in the uveitis; 47 (3): 1030-8, Kasp E, Clin Exp Immunol.1992 May; 88 (2): 307-12), and this complement activity is closely regulated (Bardenstein DS, Immunology.2001 December by Complement Regulatory Protein; 104 (4): 423-30, Sohn JH, Invest Ophthalmol Vis Sci.2000 October; 41 (11): 3492-502).In these complements-mediation uveitis model, the loss of complement as handling with cobra-venom factor (CVF) or as the key factor of the hereditary loss of complement activity approach (C3), can prevent or significantly reduces inductive uveitic seriousness.

Jointly, data show complement component and adjusting albumen are part tissue of eye and uveal important normal composition, and complement activity is the uveitic origin cause of formation in the autoimmune uveitis test model, and complement activity is relevant with uveitis in human body.Like this, in some embodiments, in the method for the present invention, activate and produce C5a and C5b-9 (MAC) before, use to stop the fit of selectivity and classical complement activity approach, continue incident and/or seriousness to reduce uveitic generation at C5.

Glaucoma refers to because a class disease of the vision loss that optic nerve and retinal damage cause is relevant with intraocular pressure rising (" IOP ") usually.Open angle glaucoma is modal form, increases IOP because fluid passage (for example, trabecular reticulum) long-term narrow or inaccessible causes the formation of aqueous humor.Glaucoma is divided into two types, angle of release and angle-closure.Slowly also painless during open angle glaucoma development originally, follow the numbness vision loss in the several years usually.Secondary open angle glaucoma causes (for example, uveitis or other inflammation diseases, diabetes, tumor, cataract), management of blunt injuries or certain drug such as steroid by other diseases.Angle closure glaucoma (also referring to narrow angle type glaucoma or lopsided glaucoma) is because the variation at iris place causes the unexpected obstruction of flow of liquid, causes the unexpected increase of IOP to cause.The symptom of angle closure glaucoma is to comprise ocular pain and the vision loss of feeling sick.The increase of IOP is not followed in the nerve injury that takes place in some individualities; The glaucoma of this type is normal pressure (normal pressure or low-pressure) glaucoma.Damage reason neural in this type glaucoma is also unknown.

The effect of complement in the glaucoma cause of disease is shown: 1) in the rat glaucoma model, IOP follows complement component (C1q, C1r when raising, C1s, C3) retina of mRNAs is expressed (Ahmed, F, Brown, KM, Stephan, DA, Morrison, JC, Johnson, EC, Tomarev, SI (2004) IOVS 45,1247-54); 2) complement component in the macaque glaucoma model (C4, B, C1q, C3) expression of mRNAs in retina increase (Miyahara, T, Kikuchi, T, Akimoto, M, Kurokawa, T, Shibuki, H.Yoshimura, N (2003) IOVS 44,4347-56); 3) the increase of interior C1q mRNA of retinal gliocytes and protein expression in mice and the macaque glaucoma model (Stasi, K, Nagel, D, Yang, X, Wang, R, Ren, L, Podos, SM, Mittag, T, Danias, J (2006) IOVS 47,1024-29); 4) immunohistochemical staining of C1q cell (Stasi etc., 2006) in the human collagen cell.The expression of C1Q. in tentative glaucoma mice show with IOP continue to increase and to foveal region of retina cells injury process relevant (Stasi etc., 2006).Anti--treatment that complement is fit, for example, a kind of anti--C5 is fit, can be to the neural degeneration tool protective effect in high or low-pressure glaucoma.

Correspondingly, embodiments more of the present invention provide the anti--C5 medicine of the ocular disease of treatment complement-mediated.In some embodiments, use separately of the present invention anti--the C5 medicine, and in other embodiments its with anti-VEGF and/or resist=the medication combined use of PDGF.

Other embodiments of the present invention provide treatment, and the resisting of the eye imbalance of stable and/or prevention complement-mediation-complement is fit.Anti--complement is fit can be according to SELEX ^TMThe method preparation.In the special embodiment, the present invention includes use a kind of anti--complement is fit, for example, in a kind of method to a kind of minimizing of administered, at least a symptom, particularly diabetes retinitis in the stable and/or prevention eye imbalance, the symptom of exudative and/or non--exudative AMD anti--C5 is fit.

Special fit of C5

Be used for the treatment of prevention and/or reduce that the C5 of eye diagonosis of disorder of complement-mediation is special fitly can to pass through SELEX ^TMThe method preparation.In the particular, present invention resides in a kind of method few to administered, at least a symptom, particularly diabetes retinitis in the stable and/or prevention eye imbalance, anti--fit medicine of C5 of the symptom of exudative and/or non--exudative AMD.

Fit is a kind of nucleic acid molecules, and the particular combination affinity of itself and molecule is the reciprocal action that is different from the Watson-Crick base pair.

Fit, be similar to by phage and show or the polypeptide of monoclonal antibody (" mAbs ") preparation, target of can particular combination selecting and the activity of regulating target, for example, by with the fit function that can stop its target that combines.

That carries out external selection preparation from the random sequence oligonucleotides library fitly surpasses 100 kinds of protein, comprises somatomedin, transcription factor, enzyme, immunoglobulin, and receptor.Typical fit be 10-15kDa size (30-45 nucleoside), with Asia-mole affinity in conjunction with its target, and differentiation tight to target (for example, fit typically not with other protein binding that derive from related gene family).A series of structural researches have shown fitly can use identical combination (for example, hydrogen bond, classical complementary, hydrophobic force, size exclusion), produces the affinity and the specificity of antibody-antigenic compound.

The fit feature that is used for the treatment of and diagnoses with many expectations comprises high specific and affinity, biological effect and good pharmacokinetic properties.

SELEX ^TM Method

Preparing a kind of fit prefered method, describe in Fig. 2 usually, is with " the aglucon phylogeny of Exponential growth " (" SELEX ^TM").SELEX ^TMProcess, a kind of external method of compiling the nucleic acid molecules of high specific bond target molecule is described in, for example, U.S. the patent application series number 07/536,428, June 11 nineteen ninety, filing was discarded at present, U.S. number of patent application 5475096, be entitled as " nucleic acid aglucon, " and U.S. number of patent application 5270163 (also seeing WO 91/19813), be entitled as " nucleic acid aglucon." by carrying out multiple selection and amplification cycles, SELEX ^TMCan be used for obtaining fit, also refer to have " the nucleic acid aglucon of any desired target binding affinity level at this.”

SELEX ^TMProcess is based on unique observation, and promptly nucleic acid has and forms two-and the ability of three-Wei structural variant, and has as any chemical compound, no matter is the sufficient monomer chemistry versatility (for example, form particular combination to) of monomer or polymeric aglucon.The molecule of any size or composition all can be used as target.

SELEX ^TMProcess is based on the ability of combining target.Pass through SELEX ^TMThe fit of process acquisition will have the target amount of money and characteristic.Yet, SELEX ^TMThe process different choice is fit or other characteristics of target, therefore can not expect SELEX ^TMThe fit of process preparation having except any other characteristic in conjunction with expectation target, though can expect to obtain fitly will have other characteristics.Like this, though expect a kind of fit ability that will have the specific bond target, except combining target, a kind of given fitly can not have, and maybe can have multiple effect.For example, when target is a kind of and the protein effect of many cells surface receptor, a kind of fit combination that can stop or strengthen protein and one or more this receptors, or it can not have effect to any reciprocal action.Among another embodiment, target can be a kind of haptoreaction class material, and the fit effect that can suppress or strengthen the haptoreaction function, or the contact response function is not had effect.Yet before suitable method test, the technical staff can not predict a kind of given fit characteristic that has.In fact, simple target combination does not provide information for functional effect, and it can expose under fit bonded effect.

The change of target molecule characteristic needs the specific site of fit combining target, produces effect with the change to target property.In theory, SELEX ^TMProcess can be identified fit in a large number, wherein the different loci of each fit combining target.In the practice, fit-target combination usually occurs in one or a small amount of target binding site that is fit to, and it provides for interactive stable and readily accessible structure influence.In addition, when the physiology target molecule is used SELEX ^TMDuring process, the technical staff can not control fit location for target usually.Therefore, fit binding site on target can be positioned at, and maybe cannot be positioned at, or approach, and can cause one of potential binding site of expectation effect, maybe can target molecule not had any effect.

Even when a kind of fit, because the ability of its combining target, be found and have a kind of effect, and the enzyme method predicted the existence of this effect, or know the type of this effect in advance.Carry out SELEX ^TMDuring test, the technical staff can only know a kind of fit, and is a kind of fit at impact point, will have the target binding characteristic.Can carry out SELEX ^TMTest expect some certified fit effects that can have except combining target, but this is uncertain.

SELEX ^TMMethod is initial as single stranded oligonucleotide library that comprises random sequence or set.Oligonucleotide can be DNA that modify or unmodified, RNA, or DNA/RNA hybridization.Among some embodiment, set comprises 100% at random or the part random oligonucleotide.Among other embodiment, set comprise at random or the part random oligonucleotide comprise fixed sequence program and/or the conserved sequence that at least a and random sequence are integrated.Among other embodiment, set comprise at random or the part random oligonucleotide comprise at least a 5 ' and/or 3 ' end fixed sequence program and/or conserved sequence, it can comprise the sequence that all molecules are shared in the oligonucleotide set.Fixed sequence program is the common sequences of oligonucleotide in the set, and it is comprised CpG die body as described below for preselected purpose, the hybridization site of PCR primer, the sub-site of rna polymerase promoter (for example, T3, T4, T7, and SP6), restriction site, or the homopolymerization sequence, as poly-A or poly-T zone, catalytic core, selection helps the clone and/or the order-checking of the oligonucleotide expected in conjunction with the site of affinity column and other.Conserved sequence is to be different from aforesaid fixed sequence program, by multiple fit share and in conjunction with the sequence of same target.

The oligonucleotide set comprises the random sequence part and the fixed sequence program of effective amplification needs suitably.Typically, that the initial set of oligonucleotide comprises is fixed 5 ' and 3 ' end sequence, it has 30-50 the insertion zone of nucleoside at random in the side.Nucleoside can be prepared by several different methods at random, comprises synthetic and from carrying out size selection the cracked nucleus at random with blood.Can introduce or increase the sequence variants in the test nucleic acid before the selection/amplification cycles or in the process by suddenling change.

The random sequence part of oligonucleotide can and can comprise ribonucleotide and/or deoxyribonucleotide for any length, and can comprise modification or non--natural nucleoside or nucleoside analog.See, for example, U.S. Patent number 5958691; U.S. Patent number 5660985; U.S. Patent number 5958691; U.S. Patent number 5698687; U.S. Patent number 5817635; The open WO 92/07065 of U.S. Patent number 5672695 and PCT.Random oligonucleotide can be synthetic with di-phosphate ester-crosslinked nucleoside by the solid phase oligonucleotide synthetic technology that suppresses in this area.See, for example, Froehler etc., Nucl.Acid Res.14:5399-5467 (1986) and Froehler etc., Tet.Lett.27:5575-5578 (1986).Random oligonucleotide can use liquid phase process synthetic, as three ester synthetic methods.See, for example, Sood etc., Nucl.Acid Res.4:2557 (1977) and Hirose etc., Tet.Lett, 28:2449 (1987).Typical synthesizing is to carry out on automatic dna synthesizer, produces for most of SELEX ^TMTest enough 10 ¹⁴-10 ¹⁶Independent molecule.In sequential design, fully on a large scale random sequence has increased the probability that each synthetic molecules is represented a unique sequence.

The initial library of oligonucleotide can be by dna synthesizer by the synthetic preparation of robotics.Be synthetic random sequence, each nucleoside increases step and adds all four kinds of nucleoside in building-up process, makes the nucleoside random integration.As mentioned above, in the embodiment, random oligonucleotide comprises that auspicious fully is sequence; Yet in other embodiments, random sequence can comprise one section nonrandom or part random sequence.The part random sequence can add four kinds of nucleoside with the different mol ratio example by increase step at each nucleoside.

The initial library of oligonucleotide can be RNA, DNA, the RNA of replacement or DNA or its combination.When using the RNA library as initial library, it through suitable pcr amplification, uses the t7 rna polymerase in vitro transcription DNA library of t7 rna polymerase or modification typically by synthetic DNA library under this situation, and the purification library of transcribing and preparing.Nucleic acid library is separated also amplification being suitable for progressively returning repetition with the target mixing and to combining under the bonded condition, uses identical conventional selection scheme, to obtain the set affinity and the selectivity characteristic of any reality.More particularly, begin SELEX with the mixture that comprises the initial set of nucleic acid ^TMMethod may further comprise the steps: (a) under suitable bonded condition mixture is contacted with target; (b) unconjugated nucleic acid is separated from the nucleic acid of specific bond target molecule; (c) nucleic acid-target complex that dissociates; (d) nucleic acid under separating from nucleic acid-target complex is increased be rich in the mixtures of nucleic acids of aglucon with preparation; And (e) repeat combination by crisscross circulation, separate, dissociate and amplification step with preparation for the target molecule high specific, the nucleic acid aglucon of high-affinity.Under these situations, when RNA fit when selected, SELEX ^TMMethod further may further comprise the steps: (i) will carry out reverse transcription by dissociated nucleic acid from nucleic acid-target complex before amplification step (d) is carried out; And (ii) the nucleic acid to the amplification that derives from step (d) is transcribed before the restart procedure.

In the mixtures of nucleic acids that comprises possible in a large number sequence and structure, has large-scale binding affinity for a given target.These more tend to combining target for the nucleic acid that target has high-affinity (lower dissociation constant).Separate, after dissociating and increasing, produced second kind of mixtures of nucleic acids with higher binding affinity material standed for.Extra selection circulation helps to obtain best aglucon, mainly contains one or more sequences until last mixtures of nucleic acids and constitutes.It can be cloned, and order-checking is also separately as aglucon or fit mensuration 1) the target binding affinity; With 2) influence the ability of objective function.

Repeat to select and the result of amplification cycles until the acquisition expectation.In most cases, continue to select/increasing, the adhesion signal no longer strengthens when repetitive cycling.This method typically gets used to adopting 10 ¹⁴Different nucleic acid, but the 1018 kinds of different nucleic acid of as many as of also can taking a sample.Usually, the aptamer molecule is selected through 15 to 20 cyclic processes.In the embodiment, heterogeneous composition only adds in the beginning choice phase, and does not occur in repetitive process.

SELEX ^TMIn the embodiment of method, selection course is efficiently for brute force in conjunction with the nucleic acid of selected target, only needs a step to select and amplification cycles.These effective choice can betide, for example, chromatograph-type procedure, the mutual relation of its amplifying nucleic acid and post combining target carries out in one way, and wherein pillar can separate the nucleic acid aglucon of high-affinity efficiently.

Under many situations, do not need to carry out multiple SELEX ^TMStep is to identify single nucleic acid aglucon.Target-special nucleic acid aglucon solution can comprise nucleic acid structure or die body family, its have a large amount of conserved sequences and in a large number through replace or increase after not appreciable impact nucleic acid aglucon to the sequence of the affinity of target.Before finishing, stop SELEX ^TMStep can be measured many nucleic acid aglucon family members' sequence.

Known existence a large amount of nucleic acid one-level, secondary and tertiary structure.These generally include in the die body structure of non--Watson-Crick type effect and refer to hairpin loop, symmetrical or asymmetric projection, pseudo-knot and multiple repetition.Almost all known case of these die bodys show that it can form the nucleotide sequence that is no more than 30 nucleoside.For this reason, more preferably have the SELEX of the adjacent random fragment that comprises 20 to 50 nucleoside usually ^TMProcess in some embodiments, is 30 to 40 nucleoside.Among the embodiment, 5 '-fixing: at random: 3 ' fixed sequence program has comprised about 30 random sequences to about 50 nucleoside.

Core SELEX ^TMMethod has been adjusted to obtain many specific targets.For example, U.S. Patent number 5707796 has been described the associating gel electrophoresis and has been used SELEX ^TMMethod is selected the nucleic acid molecules of special architectural feature, as bent DNA.U.S. Patent number 4763177 has been described based on SELEX ^TMMethod selects to comprise the nucleic acid aglucon of phosphorus reaction group, can in conjunction with and/or phosphorus-crosslinked and/or phosphorus inactivation target molecule.U.S. Patent number 5567588 and U.S. Patent number 5861254 have been described based on SELEX ^TMThe method high efficiency separation has the oligonucleotide of high-affinity and low-affinity to target molecule.U.S. Patent number 5496938 has been described and has been carried out SELEX ^TMThe method of the nucleic acid aglucon that is improved after the method.U.S. Patent number 5705337 has been described the method for its target of aglucon covalent cross-linking.

SELEX ^TMMethod also can be used to obtain the nucleic acid aglucon that combination surpasses a kind of target molecule site, and acquisition comprises the nucleic acid aglucon of the combining target specific site of non--nucleic acid substances.SELEX ^TMMethod provides the nucleic acid aglucon in conjunction with any anticipation target, comprises big and little biomolecule, as nucleic acid-conjugated protein with do not know the part of its function, and the protein of bind nucleic acid whether, and cofactor and other micromolecule.For example, U.S. Patent number 5580737 has been described and has been passed through SELEX ^TMThe nucleotide sequence that method is identified, its can high-affinity in conjunction with caffeine and analog, theophylline.

Oppositely-SELEX ^TMMethod is a kind of crosslinked-reaction by assessment nucleic acid aglucon sequence and one or more non--target molecules, improves the specific method of nucleic acid aglucon to target molecule.Oppositely-SELEX ^TMMethod may further comprise the steps: (a) preparation nucleic acid mixing material standed for; (b) candidate's mixture is contacted with target, wherein can from candidate's mixture, separate the nucleic acid that target has high-affinity with respect to candidate's mixture; (c) from remaining candidate's mixture, separate the nucleic acid that increases affinity; (d) dissociate from target and increase the nucleic acid of affinity; (e) will increase the nucleic acid of affinity non-with one or more-target molecule contacts, and makes the nucleic acid aglucon that has an affinity with non--target molecule be removed; (f) nucleic acid that will be only target molecule be had a specific affinity increases, the mixtures of nucleic acids of the capacity that can check order with preparation, and it has higher affinity and particular combination target molecule relatively.As above SELEX ^TMMethod is described, repeats selection and amplification cycles as required until obtaining desired destination.

Use nucleic acid as treatment, the potential problems of diagnostic medicine and vaccine are, the oligonucleotide of di-phosphate ester form will be in body fluid before the effect of its expectation occurs by born of the same parents in and exoenzyme, degrade fast as Cobra venom endonuclease and exonuclease.SELEX ^TMMethod comprises the high affinity nucleic acid aglucon of identifying the nucleoside that comprises modification, and the characteristic that it provides aglucon to improve is as improving the body internal stability or improving the submission feature.The embodiment of these modifications comprises the chemistry replacement of sugar and/or phosphorus and/or base position.SELEX ^TMThe modified nucleoside that the nucleic acid aglucon of method-evaluation comprises is described in, for example, U.S. Patent number 5660985, it has been described in ribose 2 ' site, 5 sites of pyrimidine, with 8 sites of purine by the oligonucleotide of chemical modification, U.S. Patent number 5756703 described comprise different 2 '-modify the oligonucleotide of pyrimidine, U.S. Patent number 5580737 described comprise one or more 2 '-ammonia (2 '-NH ₂), 2 '-fluorine (2 '-F), and/or 2 '-the O-methyl (2 '-the high affinity nucleic acid aglucon of the modified nucleoside OMe) replaced.

The modification of the nucleic acid aglucon of expecting among the present invention includes, but are not limited to, and other chemical groups are provided, and it is that nucleic acid aglucon base or nucleic acid aglucon are integrated additional charge, polarizability, hydrophobicity, water key, electrostatic force and three-dimensional changeableness.It is interior crosslinked that the modification of the conventional oligonucleotide of nuclease-resistant comprises that one or more replace nucleoside, and sugar changes, sequence change, or its combination.These modifications include, but are not limited to, 2 '-site is sugar-modified, and 5-site pyrimidine is modified, and 8-site purine is modified, the modification of the outer amine of ring, 4-thiouracil nucleoside nucleoside, 5-bromine or 5-iodo-uracil; Backbone modification, phosphorothionate or alkyl phosphorus are modified, and methylate and uncommon base-right associating, as different base, iso-cytosine and isoguanine.Modify also can comprise 3 ' and 5 ' modify, as add medicated cap, for example, increase by 3 '-3 ' dT medicated cap with increase the exonuclease resistance (see, for example, U.S. Patent number 5674685; 5668264; 6207816; With 6229002, wherein each all is incorporated in this paper by citation at this).

In the embodiment, its P of the oligonucleotide that provides (O) O group is by P (O) S (" sulfo-"), P (S) S (" dithio "), P (O) NR ₂(" amidatioon "), P (O) R, P (O) OR, ' CO or CH ₂(" formacetal ") or 3 '-amine (NH-CH ₂-CH ₂-), wherein each R or R ' they are independently H or replacement or non-replacement alkyl.Crosslinked group can pass through-O-,-N-, or-S-is crosslinked and adjacent, and nucleoside is connected.All connections in the oligonucleotide do not require all identical.

In the extra embodiment, oligonucleotide comprises the glycosyl of modification, and for example, one or more hydroxyls are by halogen, and aliphatic group is replaced, or as the function of ester or amine.In the embodiment, 2 of furan residue '-site is by the O-methyl, O-alkyl, the rare propyl group of O-, S-alkyl, the rare propyl group of S-, or halogenation group.Synthetic 2 '-modify sugared method to be described in, for example, Sproat, etc., Nucl.Acid Res.19:733-738 (1991); Cotten, etc., Nucl.Acid Res.19:2629-2635 (1991); And Hobbs, etc., Biochemistry 12:5138-5145 (1973).Other modifications are that those skilled in the art are known.These modifications can be preceding-SELEX ^TMProcess is modified or back-SELEX ^TMProcess is modified (the unmodified aglucon to previous evaluation is modified) or is integrated into SELEX ^TMProcess.

Before-SELEX ^TMProcess is modified or those are by being integrated into SELEX ^TMThe nucleic acid aglucon of process preparation has for SELEX ^TMThe specificity of target and the stability of raising, for example, the body internal stability.Back-SELEX to the nucleic acid aglucon ^TMProcess is modified and can be improved stability, for example, and body internal stability and do not influence the binding ability of nucleic acid aglucon on the contrary.

SELEX ^TMMethod comprises that the oligonucleotide that will select unites with oligonucleotide and non--oligonucleotide functional unit of other selections, described in U.S. Patent number 5637459 and U.S. Patent number 5683867.SELEX ^TMMethod comprises that further the oligonucleotide aglucon that will select and lipotropy or non--immunogenicity high-molecular weight compounds are in diagnosis or treat in the complex and unite, be described in U.S. Patent number 6011020, U.S. Patent number 6051698 and PCT publication number WO 98/18480.The associating of a large amount of form He other characteristics has been described in these patents and application, and it has, and oligonucleotide effectively increases and the desired character of copy feature and other molecules.

Pass through SELEX ^TMMethod is to little, and the nucleic acid aglucon of pliability polypeptide is also identified.Little polypeptide has pliability and exists in solution with multiple uniform balance usually, so it is considered at first and can limits binding affinity by cause the conformational entropy loss in conjunction with the pliability polypeptide.Yet, feasibility existing description in U.S. Patent number 5648214 of identifying the nucleic acid aglucon of the medium and small polypeptide of solution.In this patent, identified a kind of high affine RNA nucleic acid aglucon of 11 amino acid polypeptides for Substance P.

Said, the present invention passes through SELEX ^TMMethod selects to have the fit of specificity and binding affinity for the complement target.In addition, selection course can be integrated modified nucleoside to increase the stability of fit molecule for vivo degradation.

2 ' modification SELEX ^TM

Fitly be suitable for treatment or diagnosis is used for making, safety in vivo, stably synthetic is suitable and skew.Wild type rna and DNA are fit because its degraded sensitivity for nuclease is unstable in vivo.Can by be integrated into 2 '-group that the site is modified increases the resistance to nuclease degradation.

2 '-fluorine and 2 '-amine groups successfully has been integrated into and selected fit oligonucleotide set.Yet, these are modified has greatly increased synthetic final fit expense, and may be under certain conditions, because the degraded by modified oligonucleotide and then use these nucleoside, cause safety problem and make the nucleoside circulation of modification enter host DNA as the synthetic material of DNA.

Comprise 2 '-O-methyl (" 2 '-OMe ") nucleoside fit, as previously mentioned, overcome many these shortcomings.Comprise 2 '-oligonucleotide of OMe nucleoside is anti--nuclease and synthetic more cheap.Though 2 '-the OMe nucleoside is ubiquitous in biosystem, under the physiological condition polymerase of nature do not accept 2 '-OMe NTPs is as substrate, so just do not have 2 '-the OMe nucleoside enters the safety problem of host DNA.Preparation 2 '-fit SELEX modified ^TMMethod is seen and is described in, for example, U.S. Provisional Patent Application series number 60/430761, in December, 2002 filing, U.S. Provisional Patent Application series number 60/487474, filing on July 15th, 2003, U.S. Provisional Patent Application series number 60/417039, filing on November 4th, 2003, Application No. 10/729581, December in 2003 filing on the 3rd, filing in Application No. on June 21st, 10/873856,2004, exercise question be " external selection 2 '-method of O-methyl replacement nucleic acid; " U.S. Provisional Patent Application series number 60/696292, on June 30th, 2005 filing, exercise question was filed on June 30th, 11/480188,2006 for " prepare whole 2 '-the improvement material and the method for the transcribed nucleic acid modified " and Application No., exercise question for " prepare whole 2 '-material and the method for the transcribed nucleic acid modified, " its each all integrate with this paper at this by quoting from.

The present invention includes in conjunction with and regulate the fit of complement objective function, it comprises that the nucleoside (for example, 2 '-nucleoside that the site is modified) of modification makes oligonucleotide more stable for enzyme and chemical degradation and heat and unable degraded than the oligonucleotide of unmodified.In the preferred embodiment, described complement marlinspike is complement protein C5.Have in the document severally to comprise 2 '-the fit embodiment of OMe (see, for example, Green etc., Current Biology2,683-695,1995), transcript library preparation that it is modified by external selection, wherein C and U residue be 2 '-fluorine (2 '-F) replace and A and G residue are 2 '-OH.In case the function sequence identified, test each A and G residue for 2 '-toleration that OMe replaces, all A and G residue all have 2 '-fit quilt that OMe replaces toleration synthesizes again.Great majority with the fit A of this two-step method preparation and G residue for 2 '-OMe replaces has toleration, though, on average have 20% to there is no this characteristic.Therefore, this method preparation fit trend towards comprising from 2 to 42 '-the OH residue, and obtain the stability and the synthetic expense of trading off at last.Prepare the stable oligonucleotide that uses in the oligonucleotide set by in responsive transcription, integrating modified nucleoside, pass through SELEX ^TMMethod (and/or any its change and improvement, comprise described here) selection and enrichment are fit, and method of the present invention has been assessed the needs (for example, by the synthetic again fit oligonucleotide of modified nucleoside) of the fit oligonucleotide of stable selection.

In the embodiment, the invention provides comprise 2 '-OH, 2 '-F, 2 '-deoxidation and 2 '-ATP that OMe modifies, GTP, CTP, TTP and UTP nucleoside combination fit.In other embodiments, the invention provides comprise 2 '-OH, 2 '-F, 2 '-deoxidation and 2 '-OMe, 2 '-NH ₂With 2 '-ATP that methoxy ethyl is modified, GTP, CTP, TTP and UTP nucleoside combination fit.In another embodiment, the invention provides comprise 2 '-OH, 2 '-F, 2 '-deoxidation and 2 '-OMe, 2 '-NH ₂With 2 '-ATP, GTP, CTP, TTP and UTP nucleoside 5 that methoxy ethyl is modified ⁶Combination fit.In the preferred embodiment, the invention provides comprise all or fully all 2 '-ATP that OMe modifies, GTP, CTP, TTP, and/or the UTP nucleoside is fit.

Of the present invention 2 '-modify fit can the use to modify polymerase and select, for example, the T7 polymerase of modification, its integration speed to a large amount of modified nucleosides of replacing in furanose 2 ' site is higher than the wild type polymerase.For example, mutation T 7 polymerases that the tyrosine residue in 639 sites is changed into phenylalanine (Y639F) can utilize (integration) 2 ' deoxidation, 2 ' ammonia-and 2 ' fluoro-nucleoside triphosphate (NTPs), but not high capacity 2 ' replacement, as 2 '-OMe or 2 '-nitrine (2 '-N ₃) NTPs that replaces.Be to integrate high capacity 2 ' replacements, except Y639F suddenlys change, mutation T 7 polymerases (Y639F/H784A) that the histidine in 784 sites becomes alanine residue have been used to integrate the pyrimidine NTPs of modification under the limited conditions.See Padilla, R. and Sousa, R, Nucleic Acids Res, 2002,30 (24): 138.The tyrosine residue in 639 sites is changed into phenylalanine, the histidine in 784 sites becomes alanine residue, the lysine in 378 sites is changed into purine and the pyrimidine NTPs that arginic mutation T 7RNA polymerase (Y639F/H784A/K378R) has been used to integrate modification under the limited conditions, for example, 2 '-OMeNTPs, but need 2 '-OH GTP is used to transcribe.See Burmeister etc., (2005) Chemistry and Biology, 12:25-33.Though do not expect to be subject to theory, K378R sudden change keeps clear of the avtive spot of polymerase, thereby is considered to silent mutation, for 2 '-integration that OMe modifies NTPs do not have effect.Mutation T 7 polymerases that the histidine in site 784 is changed into alanine (H784A) are described.Padilla etc., Nucleic Acid Research, 2002,30:138.In Y639F/H784A sudden change and H784A mutation T 7 polymerases, change into the integration that p1 amino acid residue such as alanine can impel a large amount of nucleic acid primers, for example, 2 '-OMe replaces nucleoside.See Chelliserry, K. and Ellington, A.D., (2004) Nature Biotech, 9:1155-60.More the t7 rna polymerase that has a sudden change at its avtive spot is described, its be easier to integrate a large amount of 2 '-modify substrate, for example, 639 site tyrosine are changed into the T7 RNA polymerase of leucine (Y639L).

Usually, have been found that under the condition of here describing, Y693F sudden change can be used to integrate except GTP all 2 '-NTPs that OMe replaces, and Y639F/H784A, Y639F/H784A/K378R, Y639L/H784A, Y639L/H784A/K378R, Y639L, Y639L/K378R, use under the condition that the t7 rna polymerase of P266L/Y639L/H784A or P266L/Y639L/H784A/K378R sudden change can here be described with integration comprise 2 '-OMe GTP all 2 '-OMEe replaces NTPs.

2 '-oligonucleotide modified can be fully by the nucleoside of modifying, or the nucleoside subgroup of modifying is synthesized.Modification can be identical or different.Some or all of nucleoside can be modified, and those adornedly can comprise identical modification.Some or all of nucleoside can be modified, and those adornedly can comprise different modifications.For example, comprise that all nucleoside of identical base can have one type modification, and comprise that the nucleoside of other bases can have dissimilar modifications.All purine nucleosides can have one type modification (or not modifying), and all pyrimidine nucleosides have another kind of dissimilar modification (or not modifying).In this case, use the combined preparation transcript of any modification, or the set of transcript, comprise, for example, ribonucleotide (2 '-OH), deoxyribonucleotide (2 '-deoxidation), 2 '-aminonucleoside (2 '-NH ₂), 2 '-the fluorine nucleoside (2 '-F) and 2 '-the O-methyl (2 '-OMe) nucleoside.Comprise 2 '-OH A and G and 2 '-FC and U transcribe mixture be called " rRfY ＂ mixture, and select thus fit be that " rRfY ＂ is fit.Comprise 2 '-mixture of transcribing of OMe C and U and 2 '-OH A and G is called " rRmY " mixture, and fit being called of selecting thus " rRmY ", is fit.Comprise deoxidation A and G and 2 '-mixture of transcribing of OMe U and C is called " dRmY " mixture, fit being called " dRmY " of Xuan Zeing, is fit thus.Comprise 2 '-OMeA, C, and the mixture of transcribing of U and 2 '-OH G is called " rGmH " mixture, fit being called " rGmH " of Xuan Zeing, is fit thus.Optionally comprise 2 '-OMe A, C, U and G and 2 '-OMe A, U and C and 2 '-F G to transcribe the fit finger " selectivity mixture " that mixture is called " selectivity mixes, " to be selected thus fit.Comprise 2 '-OMe A, U, C, and G, wherein G ' s of 10% is that the mixture of transcribing of ribonucleotide is called " r/mGmH " mixture, fit being called " r/mGmH " of Xuan Zeing, is fit thus.Comprise 2 '-OMe A, U, and the mixture of transcribing of C and 2 '-F G is called that " fGmH ＂ mixture, " fGmH ＂ is fit fit being called of Xuan Zeing thus.Comprise 2 '-OMe A, U, and the mixture of transcribing of C and deoxidation G is called " dGmH " mixture, fit being called " dGmH " of Xuan Zeing, is fit thus.Comprise deoxidation A, with 2 '-OMeC, the mixture of transcribing of G and U is called " dAmB " mixture, fit being called " dAmB " of Xuan Zeing, is fit thus, comprise all 2 '-mixture of transcribing of OH nucleoside is called " rN " mixture, fit being called " rN, " " rRrY " or " RNA " of Xuan Zeing is fit thus.Comprise 2 '-mixture of transcribing of OH adenosine triphosphate and GTP (guanosine triphosphate) and deoxidation triphosphoric acid cytosine and triphosphoric acid thymus pyrimidine is called the rRdY mixture, and " rRdY ＂ is fit fit being called of Xuan Zeing thus.It is fit that " mRmY " is also referred to as " MNA ", its except initial nucleoside be 2 '-OH guanosine or any wild type guanosine, only comprise 2 '-the O-methyl nucleoside, and can pass through back-SELEX ^TMWith 2 '-OH Gs replaces with 2 '-OMe Gs, derive from the r/mGmH oligonucleotide.Optionally, mRmY is fit can pass through mRmY SELEX ^TMIdentify.

That a kind of preferred embodiment comprises is any 2 '-OH, 2 '-deoxidation and 2 '-associating of OMe nucleoside.That preferred embodiment comprises is any 2 '-deoxidation and 2 '-associating of OMe nucleoside.Even preferred embodiment be any 2 '-deoxidation and 2 '-associating of OMe nucleoside, wherein pyrimidine be 2 '-OMe (as dRmY, mRmY or dGmH).

(in advance) is integrated into fit (for example, preceding-SELEX of the present invention with modified nucleoside before selection course ^TMProcess is modified).Alternatively, the present invention is by preceding-SELEX ^TMThe process modification has been integrated the fit of modified nucleoside and also can further have been passed through back-SELEX ^TMProcess is modified (for example, SELEX ^TMBack-SELEX afterwards ^TMProcess is modified).Before-SELEX ^TMProcess is modified and is produced SELEX ^TMThe modification of nucleic acids aglucon that target is special also improves the body internal stability.Back-SELEX ^TMProcess is modified, and for example, modifies (for example, to having through preceding-SELEX ^TMProcess is modified integration nucleic acid, and before the aglucon of identifying cut off, and deletion is replaced or the increase nucleoside) can further improve the body internal stability, and not obvious influence has preceding-SELEX ^TMProcess is modified the binding ability of the nucleic acid aglucon of integrating nucleoside.

For accept 2 at polymerase '-prepare 2 under the condition of the NTPs that modifies '-modify (for example, 2 '-OMe) rna transcription thing, can use Y693F, Y693F/K378R, Y693F/H784A, Y693F/H784A/K378R, Y639L, Y639L/K378R, the t7 rna polymerase of P266L/Y639L/H784A and P266L/Y639L/H784A/K378R sudden change.Other t7 rna polymerases, particularly show to a large amount of 2 '-replace the polymerase of height endurability, also can be used for the present invention.When using the polymerization of template-control under the condition of describing here, Y693F/H784A, Y693F/H784A/K378R, the t7 rna polymerase of P266L/Y639L/H784A or P266L/Y639L/H784A/K378R sudden change can be used to integrate all 2 '-OMe NTPs, comprise 2 '-OMe GTP, and obtain than using Y693F, Y693F/K378R, Y693F/H784A, Y693F/H784A/K378R, Y639L, the t7 rna polymerase of Y639L/K378R sudden change is better transcribed output.Y693F/H784A, Y693F/H784A/K378R, the t7 rna polymerase of P266L/Y639L/H784A or P266L/Y639L/H784A/K378R sudden change can be with 2 '-OH GTP uses jointly, but it is optional, with obtain 2 of high yield '-modify, for example, comprise 2 '-oligonucleotide of OMe.

Other polymerases, particularly those shown for a large amount of 2 '-replace and to have height endurability, also can be used for the present invention.Transcribing under the condition of here describing screened these polymerases by testing its ability of integrating modified nucleoside.

It is important that many factors have been determined for the condition of using in the method described herein of transcribing.For example, it is important for increasing the output of modifying transcription product that DNA transcribes the homing sequence of integrating on template 5 ' terminal fixed sequence program, wherein the T7RNA polymer of Y693F/K378R or Y693F/H784A/K378R sudden change is used to transcribe, for example, transcribe under the condition at dRmY described below or r/mGmH.In addition, homing sequence can be used to help to increase the output of modifying transcription product, but optional, wherein uses Y693F/H784A or Y693F/H784A/K378R mutation T 7RNA polymerase to be used to transcribe, and for example, transcribes under the condition at mRmY described below.Homing sequence typically is 6-15 nucleoside length, and can comprise all purine, or the mixture of purine and pyrimidine nucleoside.

The key factor that the transcription product of modified nucleoside has been integrated in another acquisition is 2 '-existence of OH guanosine or concentration (for example, GMP, GTP, or other are non--2 '-OMe is non--triphosphate).Transcription product can be divided into two stages: first kind of stage is initialization, during NTP add 3 of GTP '-C-terminal (or GMP, or other are non--2 '-OMe is non--triphosphate) with the preparation dinucleotide, expand to about 10-12 nucleoside subsequently; Second stage is to extend, during on initial 10-12 nucleoside, carry out transcription.Have been found that to add in a small amount 2 '-OH GTP (or GMP, or other are non--2 '-OMe is non--triphosphate) superfluous 2 to containing '-OME GTP transcribe mixture can effectively strengthen polymerase and use 2 '-OH GTP (or GMP, guanosine, or other are non--2 '-OMe is non--triphosphate) initial transcriptional capability.Like this, for example, a kind of dRmY transcribes the extra GMP in a small amount that adds of mixture (comprising deoxidation purine and 2 ' OMe pyrimidine) needs to strengthen initially transcribing of polymerase, and transcribe in the mixture (comprise 10%2 '-OH GTP) at r/mGmH, GMP in a small amount can be added to and transcribe in the mixture, but because 2 '-OH GTP gene is present in and transcribes in the mixture, so it is not to strengthen polymerase initially to transcribe necessary.Enter the extension stage in case transcribe, 2 '-OMe and 2 '-OH GTP between the minimizing of difference, and 2 '-OMe GTP more than 2 '-OH GTP, make integrate be mainly 2 '-OMe GTP.

As mentioned above, initial have 2 '-the transcribing of OH guanosine (for example, GMP, GTP or other are non--2 '-OMe is non--triphosphate) and be important.This result is influenced for the specificity of initial nucleoside by polymerase.As a result of, 5 of any transcription product of any the method preparation '-terminal nucleoside may be for 2 '-OH G.The preferred concentration of GMP is 0.5mM, more preferably is 1mM.Have been found that to comprise PEG in the responsive transcription, be preferably PEG-8000, can make the integration maximization of modified nucleoside.

Integrate 2 '-to replace another key factor that nucleoside enters transcription product be to use bivalence magnesium and manganese in transcribing mixture to OMe.The magnesium chloride of variable concentrations and the combination of manganese chloride have been found that can influence 2 '-the methylate output of transcription product of O-, the optium concentration of magnesium chloride and manganese chloride depends on the concentration of the NTPs of compound bivalent metal ion in the responsive transcription mixture.For obtain all 2 '-O-methylate transcription product (for example, all 2 '-OMe A, C and U and about 90%G nucleoside) maximum production, the optium concentration of magnesium chloride and manganese chloride is about 5mM and 1.5mM when every kind of NTP concentration is 0.5mM.When the concentration of every kind of NTP was 1.0mM, the suitable concn of magnesium chloride and manganese chloride was 6.5mM and 2.0mM.When the concentration of every kind of NTP was 2.0mM, the suitable concn of magnesium chloride and manganese chloride was 9.6mM and 2.9mM.In any case, double strength departs from the modification transcription product that still can obtain remarkable quantity.

In some embodiments, use GMP or guanosine in being adapted at initially transcribing.This result is influenced for the specificity of initial nucleoside by polymerase.As a result of, 5 of any transcription product of any the method preparation '-terminal nucleoside may be for 2 '-OH G.The preferred concentration of GMP is 0.5mM, more preferably is 1mM.Have been found that to comprise PEG in the responsive transcription, be preferably PEG-8000, can make the integration maximization of modified nucleoside.

For make 2 '-OMe ATP (100%), UTP (100%), the integration maximization of CTP (100%) and GTP (～90%) (" r/mgmH); following condition is suitable: HEPES buffer 200mM; DTT40mM, spermidine 2mM, PEG-8000 10% (w/v); Triton X-1000.01% (w/v), MgCl ₂5mM (when every kind 2 '-it was 6.5mM when OMe NTP concentration was 1.0mM), MnCl 1.5mM (when every kind 2 '-it was 2.0mM when OMe NTP concentration was 1.0mM), 2 '-OMe NTP (every kind) 500 μ M (more suitably being 1.0mM), 2 '-OHGTP 30 μ M, 2 '-OH GMP 500 μ M, pH7.5, Y639F/H784A t7 rna polymerase 15 units/ml, inorganic pyrophosphate esterase 5 units/ml and a kind of Allopurinol homing sequence that is at least 8 nucleoside length.Used herein, Y639F/H784A mutation T 7 RNA polymerases of a unit (or any other mutation T 7RNA polymer) are defined under the r/mGmH condition, integrate 1nmole 2 '-OMe NTPs and go into the needed enzyme quantity of transcription product.Used herein, the inorganic pyrophosphate esterase of a unit is defined as under pH7.2 and 25 degree, and per minute discharges the required enzyme quantity of 1.0mole inorganic orthophosphate.

For make 2 '-OH GTP and 2 '-OMe ATP, UTP and CTP (" rGmH ") the integration maximization (100%) in transcription product, following condition is preferred: HEPES buffer 200mM, DTT40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl ₂5mM (it is 9.6mM when every kind of NTP concentration is 2.0mM), MnCl ₂(1.5mM it is 2.9mM when every kind of NTP concentration is 2.0mM), NTP (every kind) 500 μ M (more suitably being 2.0mM), 2 '-OH GMP 1mM, pH7.5, Y639F/K378RT7RNA polymerase 200nM, inorganic pyrophosphate esterase 5 units/ml and a kind of Allopurinol homing sequence that is at least 8 nucleoside length.

For make 2 '-OMe ATP (100%), 2 '-OMe UTP (100%), 2 '-the integration maximization of OMe CTP (100%) and 2 '-OMe GTP (100%) (" mRmY " or " MNA ＂) in transcription product, following condition is preferred: HEPES buffer 200mM; DTT 40mM; spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v); MgCl 28mM, MnCl ₂2.5mM, 2 '-OMe NTP (every kind) 1.5mM, 2 '-OH GMP 1mM, pH7.5, Y639F/H784A/K378R T7 RNA polymerase 200nM, inorganic pyrophosphate esterase 5 units/ml and a kind of optional homing sequence of transcribing output that under the condition of transcribing, increases.In some embodiments, optional homing sequence is an Allopurinol homing sequence.In another embodiment, optional homing sequence is the mixing of purine and pyrimidine.

For make 2 '-OH ATP and GTP, with 2 '-OMe UTP and the integration maximization (100%) of CTP (" rRmY ") in transcription product, following condition is preferred: HEPES buffer 200mM, DTT 40mM, spermidine 2mM, PEG-800010% (w/v), Triton X-100 0.01% (w/v), MgCl ₂5mM (it is 9.6mM when every kind of NTP concentration is 2.0mM), MnCl ₂(1.5mM it is 2.9mM when every kind of NTP concentration is 2.0mM), NTP (every kind) 500 μ M (more suitably being 2.0mM), 2 '-OH GMP1mM, pH7.5, Y639F/H784A/K378R T7 RNA polymerase 200nM, inorganic pyrophosphate esterase 5 units/ml and a kind of Allopurinol homing sequence that is at least 8 nucleoside length.

For make 2 '-OMe ATP, UTP and CTP (" rGmH ") the integration maximization (100%) in transcription product, following condition is preferred: HEPES buffer 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl ₂5mM (it is 9.6mM when every kind of NTP concentration is 2.0mM), MnCl ₂(1.5mM it is 2.9mM when every kind of NTP concentration is 2.0mM), NTP (every kind) 500 μ M (more suitably being 2.0mM), 2 '-OH GMP1mM, pH7.5, Y639F T7 RNA polymerase 1.5 units/ml, inorganic pyrophosphate esterase 5 units/ml and a kind of Allopurinol homing sequence that is at least 8 nucleoside length.

For make 2 '-OMe UTP and the integration maximization (100%) of CTP (" rRmY ") in transcription product, following condition is preferred: HEPES buffer 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl ₂5mM (it is 9.6mM when every kind of NTP concentration is 2.0mM), MnCl ₂(1.5mM it is 2.9mM when every kind of NTP concentration is 2.0mM), NTP (every kind) 500 μ M (more suitably being 2.0mM), 2 '-OH GMP1mM, pH7.5, Y639F/H784A t7 rna polymerase 1.5 units/ml, inorganic pyrophosphate esterase 5 units/ml and a kind of Allopurinol homing sequence that is at least 8 nucleoside length.

For make deoxidation ATP and GTP and 2 '-OMe UTP and CTP (" dRmY ") the integration maximization (100%) in transcription product, following condition is preferred: HEPES buffer 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl ₂9.6mM, MnCl ₂2.9mM, NTP (every kind) 2.0mM, 2 '-OH GMP 1mM, pH7.5, Y639F/K378R t7 rna polymerase 200nM/ml, inorganic pyrophosphate esterase 5 units/ml and a kind of Allopurinol homing sequence that is at least 8 nucleoside length.

For make 2 '-OMe ATP, UTP and CTP and 2 '-F GTP and (" fRmH ") integration maximization (100%) in transcription product, following condition is preferred: HEPES buffer 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl ₂9.6mM, MnCl ₂2.9mM, 2 '-OMe NTP (every kind) 2.0mM, 2 '-OH GMP 1mM, pH7.5, Y639F/K378R T7 RNA polymerase 200nM/ml, inorganic pyrophosphate esterase 5 units/ml and a kind of Allopurinol homing sequence that is at least 8 nucleoside length.

For making deoxidation ATP and 2 '-OMe UTP, GTP and CTP (" dAmB ") the integration maximization (100%) in transcription product, following condition is preferred: HEPES buffer 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl 29.6mM, MnCl ₂2.9mM, NTP (every kind) 2.0mM, 2 '-OH GMP 1mM, pH7.5, Y639F/K378R T7 RNA polymerase 200nM/ml, inorganic pyrophosphate esterase 5 units/ml and a kind of Allopurinol homing sequence that is at least 8 nucleoside length.

Each above-mentioned transcription is preferably carried out at (a) about 20 degree to 50 degree, preferably spend to 45 degree 30, more preferably be 37 degree, at least 2 hours, (b) use the 50-300nM double-stranded DNA to transcribe template (using 200nM template (dRmY uses the 300nM template in transcribing) in the circulation 1), use about 50nM subsequently in the circulation, the best PCR reactant liquor of 1/10 dilution uses condition described herein).Preferred DNA described below transcribe template (wherein ARC254 and ARC256 all 2 '-transcribe under the OMe condition, and ARC255 transcribes under the rRmY condition).

ARC254 series number: 99

5’-CATCGATGCTAGTCGTAACGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGAACGTTCTCTCCTCTCCCTATAGTG

AGTCGTATTA-3’

ARC255 series number: 100

5’-CATGCATCGCGACTGACTAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGAACGTTCTCTCCTCTCCCTATAGTG

AGTCGTATTA-3’

ARC256 series number: 101

5’-CATCGATCGATCGATCGACAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGAACGTTCTCTCCTCTCCCTATAGTG

AGTCGTATTA-3’

Under rN transcribes condition, transcribe mixture comprise 2 '-OH adenosine triphosphate (ATP), 2 '-OH GTP (guanosine triphosphate) (GTP), 2 '-OH cytidine (CTP) and 2 '-OH uridine triphosphate (UTP).The modified oligonucleotide of transcribing mixture preparation with rN of the present invention comprise fully all 2 '-the OH adenosine, 2 '-the OH guanosine, 2 '-the OH cytidine, 2 '-the OH uridnine.Preferred rN transcribes in the embodiment, in the sequence that last oligonucleotide comprises at least 80% adenosine be 2 '-the OH adenosine, at least 80% guanosine is 2 '-the OH guanosine, at least 80% cytidine is 2 '-the OH cytidine, at least 80% uridnine is 2 '-the OH uridnine.Preferred rN transcribes in the embodiment, in the sequence that last oligonucleotide comprises at least 90% adenosine be 2 '-the OH adenosine, at least 90% guanosine is 2 '-the OH guanosine, at least 90% cytidine is 2 '-the OH cytidine, at least 90% uridnine is 2 '-the OH uridnine.Most preferred rN transcribes in the embodiment, in the sequence that last oligonucleotide comprises at least 100% adenosine be 2 '-the OH adenosine, at least 100% guanosine is 2 '-the OH guanosine, at least 100% cytidine is 2 '-the OH cytidine, at least 100% uridnine is 2 '-the OH uridnine.

RRmY transcribes under the condition, and the responsive transcription mixture comprises 2 '-the OH adenosine triphosphate, 2 '-the OH GTP (guanosine triphosphate), 2 '-OMe cytidine and 2 '-the OMe uridine triphosphate.The modified oligonucleotide of transcribing mixture preparation with rRmY of the present invention comprise fully all 2 '-the OH adenosine, 2 '-the OH guanosine, 2 '-the OMe cytidine, 2 '-the OMe uridnine.In the embodiment preferred, in the sequence that last oligonucleotide comprises at least 80% adenosine be 2 '-the OH adenosine, at least 80% guanosine is 2 '-the OH guanosine, at least 80% cytidine is 2 '-the OMe cytidine, at least 80% uridnine is 2 '-the OMe uridnine.In the preferred embodiment, in the sequence that last oligonucleotide comprises at least 90% adenosine be 2 '-the OH adenosine, at least 90% guanosine is 2 '-the OH guanosine, at least 90% cytidine is 2 '-the OMe cytidine, at least 90% uridnine is 2 '-the OMe uridnine.In the most preferred embodiment, in the sequence that last oligonucleotide comprises at least 100% adenosine be 2 '-the OH adenosine, at least 100% guanosine is 2 '-the OH guanosine, at least 100% cytidine is 2 '-the OMe cytidine, at least 100% uridnine is 2 '-the OMe uridnine.

DRmY transcribes under the condition, and the responsive transcription mixture comprises 2 '-the deoxidation adenosine triphosphate, 2 '-the deoxidation GTP (guanosine triphosphate), 2 '-O-methyl cytidine and 2 '-O-methyl uridine triphosphate.The modified oligonucleotide of transcribing mixture preparation with dRmY of the present invention comprise fully all 2 '-deoxyadenosine, 2 '-deoxyguanosine, 2 '-the O-methylcytidine, 2 '-the O-methyluridine.In the embodiment preferred, in the sequence that last oligonucleotide comprises at least 80% adenosine be 2 '-deoxyadenosine, at least 80% guanosine is 2 '-deoxyguanosine, at least 80% cytidine is 2 '-the O-methylcytidine, at least 80% uridnine is 2 '-the O-methyluridine.In the preferred embodiment, in the sequence that last oligonucleotide comprises at least 90% adenosine be 2 '-deoxyadenosine, at least 90% guanosine is 2 '-deoxyguanosine, at least 90% cytidine is 2 '-the O-methylcytidine, at least 90% uridnine is 2 '-the O-methyluridine.In the most preferred embodiment, in the sequence that last oligonucleotide comprises at least 100% adenosine be 2 '-deoxyadenosine, at least 100% guanosine is 2 '-deoxyguanosine, at least 100% cytidine is 2 '-the O-methylcytidine, at least 100% uridnine is 2 '-the O-methyluridine.

RGmY transcribes under the condition, and the responsive transcription mixture comprises 2 '-the OH GTP (guanosine triphosphate), 2 '-the OMe cytidine, 2 '-OMe uridine triphosphate and 2 '-the OMe adenosine triphosphate.The modified oligonucleotide of transcribing mixture preparation with rGmY of the present invention comprise fully all 2 '-the OH guanosine, 2 '-the OMe cytidine, 2 '-OMe uridnine and 2 '-the OMe adenosine.In the embodiment preferred, in the sequence that last oligonucleotide comprises at least 80% guanosine be 2 '-the OH guanosine, at least 80% cytidine is 2 '-the OMe cytidine, at least 80% uridnine is 2 '-the OMe uridnine, at least 80% adenosine is 2 '-the OMe adenosine.In the preferred embodiment, in the sequence that last oligonucleotide comprises at least 90% guanosine be 2 '-the OH guanosine, at least 90% cytidine is 2 '-the OMe cytidine, at least 90% uridnine is 2 '-the OMe uridnine, at least 90% adenosine is 2 '-the OMe adenosine.In the most preferred embodiment, in the sequence that last oligonucleotide comprises at least 100% guanosine be 2 '-the OH guanosine, at least 100% cytidine is 2 '-the OMe cytidine, at least 100% uridnine is 2 '-the OMe uridnine, at least 100% adenosine is 2 '-the O-methyladenosine.

R/mGmH transcribes under the condition, and the responsive transcription mixture comprises 2 '-O-methyl adenosine triphosphate, 2 '-O-methyl cytidine, 2 '-O-methyl GTP (guanosine triphosphate), 2 '-O-methyl uridine triphosphate and 2 '-the OH GTP (guanosine triphosphate).The modified oligonucleotide of transcribing mixture preparation with r/mGmH of the present invention comprise fully all 2 '-the O-methyladenosine, 2 '-the O-methylcytidine, 2 '-the O-methylguanosine, 2 '-the O-methyluridine, wherein in the guanosine 2 '-OH guanosine quantity is 10% to the maximum.In the preferred embodiment, in the sequence that result's r/mGmH modified oligonucleotide comprises among the present invention at least 80% adenosine be 2 '-the O-methyladenosine, at least 80% cytidine is 2 '-the O-methylcytidine, at least 80% guanosine is 2 '-the O-methylguanosine, at least 80% uridnine is 2 '-the O-methyluridine, and be no more than 10% guanosine and be 2 '-the OH guanosine.In the preferred embodiment, as a result in the sequence that comprises of modified oligonucleotide at least 90% adenosine be 2 '-the O-methyladenosine, at least 90% cytidine is 2 '-the O-methylcytidine, at least 90% guanosine is 2 '-the O-methylguanosine, at least 90% uridnine is 2 '-the O-methyluridine, and be no more than 10% guanosine and be 2 '-the OH guanosine.In the most preferred embodiment, as a result in the sequence that comprises of modified oligonucleotide at least 100% adenosine be 2 '-the O-methyladenosine, at least 100% cytidine is 2 '-the O-methylcytidine, at least 90% guanosine is 2 '-the O-methylguanosine, at least 100% uridnine is 2 '-the O-methyluridine, and be no more than 10% guanosine and be 2 '-the OH guanosine.

MRmY transcribes under the condition and (also refers to MNA here), transcribe mixture include only 2 '-O-methyl adenosine triphosphate, 2 '-O-methyl cytidine, 2 '-O-methyl GTP (guanosine triphosphate), 2 '-O-methyl uridine triphosphate.In the sequence that the modified oligonucleotide as a result that uses mRmY of the present invention to transcribe mixture preparation comprises 100% adenosine be 2 '-the O-methyladenosine, 100% cytidine is 2 '-the O-methylcytidine, 100% guanosine is 2 '-O-methylguanosine (except first guanosine of oligonucleotide), 100% uridnine is 2 '-the O-methyluridine.

FGmH transcribes under the condition, and the responsive transcription mixture comprises 2 '-O-methyl adenosine triphosphate, 2 '-O-methyl uridine triphosphate, 2 '-O-methyl cytidine, 2 '-the F GTP (guanosine triphosphate).The modified oligonucleotide of transcribing mixture preparation with fGmH of the present invention comprise fully all 2 '-the O-methyladenosine, 2 '-the O-methyluridine, 2 '-the O-methylcytidine, 2 '-the F guanosine.In the preferred embodiment, in the sequence that result's modified oligonucleotide comprises among the present invention at least 80% adenosine be 2 '-the O-methyladenosine, at least 80% uridnine is 2 '-the O-methyluridine, at least 80% cytidine is 2 '-the O-methylcytidine, at least 80% guanosine is 2 '-the F guanosine.In the preferred embodiment, in the sequence that result's modified oligonucleotide comprises among the present invention at least 90% adenosine be 2 '-the O-methyladenosine, at least 90% uridnine is 2 '-the O-methyluridine, at least 90% cytidine is 2 '-the O-methylcytidine, at least 90% guanosine is 2 '-the F guanosine.In the most preferred embodiment, in the sequence that result's modified oligonucleotide comprises among the present invention at least 100% adenosine be 2 '-the O-methyladenosine, at least 100% uridnine is 2 '-the O-methyluridine, at least 100% cytidine is 2 '-the O-methylcytidine, at least 100% guanosine is 2 '-the F guanosine.

DAmB transcribes under the condition, phosphate, 2 '-O-methyl cytidine, 2 '-O-methyl GTP (guanosine triphosphate), 2 '-O-methyl uridine triphosphate.The modified oligonucleotide that uses dAmB of the present invention to transcribe mixture preparation comprise fully all 2 '-deoxyadenosine, 2 '-the O-methylcytidine, 2 '-O-methylguanosine and 2 '-the O-methyluridine.In the preferred embodiment, in the sequence that result's modified oligonucleotide comprises at least 80% adenosine be 2 '-deoxyadenosine, at least 80% cytidine is 2 '-the O-methylcytidine, at least 80% guanosine is 2 '-the O-methylguanosine, at least 80% uridnine is 2 '-the O-methyluridine.In the more preferred, in the sequence that result's modified oligonucleotide comprises at least 90% adenosine be 2 '-deoxyadenosine, at least 90% cytidine is 2 '-the O-methylcytidine, at least 90% guanosine is 2 '-the O-methylguanosine, at least 90% uridnine is 2 '-the O-methyluridine.In the most preferred embodiment, in the sequence that result's modified oligonucleotide comprises at least 100% adenosine be 2 '-deoxyadenosine, at least 100% cytidine is 2 '-the O-methylcytidine, at least 100% guanosine is 2 '-the O-methylguanosine, at least 100% uridnine is 2 '-the O-methyluridine.

Under every kind of situation, transcription product can be used as SELEX ^TMLibrary in the process is identified fit and/or is measured the conserved sequence that has in the sequence to the binding specificity that sets the goal.Sequence has been stable as a result, eliminates this step to obtain stable fit sequence and as a result of from process, gives more stable fit.2 '-OMe SELEX ^TMAnother advantage of process be as a result sequence have still less sequence required 2 '-the OH nucleoside, may not comprise yet.Residue 2 ' OH nucleoside can be modified by back-SELEX and remove.

As described below, the transcription product of lower still effective fully integrated 2 ' replacement nucleoside can obtain under the condition except above-mentioned optimal conditions.For example, the variation of above-mentioned patent condition comprises:

The HEPES buffer concentration can be for 0 to 1M.The present invention's buffer of other pKa values between 5 and 10 also on probation, for example, Tris (methylol) aminomethane.

The DTT concentration range can be for 0 to 400mM.Method of the present invention also provides on probation other to go back original reagent, for example, and mercaptoethanol.

Spermidine and/or spermine concentration range can be for 0 to 20mM.

The PEG-8000 concentration range can be 0 to 50% (w/v).Method of the present invention also provides uses other hydrophilic polymers, comprise, for example, the PEG of other molecular weight or other Polyethylene Glycol.

Triton X-100 concentration range can be 0 to 0.1% (w/v).Method of the present invention also provides uses other non--ion detergents, comprises that for example, other detergents comprise other Triton-X detergents.

MgCl ₂Concentration range can be 0.5mM to 50mM.MnCl ₂Concentration range can be 0.15mM to 15mM.MgCl ₂And MnCl ₂Concentration must be in described scope, MgCl in the preferred embodiment ₂: MnCl ₂Be 10 to 3, preferably, be 3-5:1, more preferably, ratio is about 3-4:1.

2 '-concentration (the every kind of NTP) scope of OMe NTP is 5 μ M to 5mM.

2 '-OH GTP concentration range can 0 μ M to 300mM.In some embodiments, transcribe can disappearance 2 '-OH GTP (0 μ M) time carries out.

2 '-OH GMP, guanosine or other except 2 of 2 ' glycosyl site '-concentration range that OH G replaces can be for 0 to 5mM, wherein, in some embodiments, 2 '-OH GTP is not included in the reaction, 2 '-OH GMP be need and its scope be 5 μ M to 5mM.

The dna profiling concentration range is 5nM to 5 μ M.

Sudden change polymerase concentration scope is 2nM to 20 μ M.

The inorganic pyrophosphatase scope is 0 to 100 units/ml.

The pH scope is pH6 to pH9.Method of the present invention can be implemented in the active pH scope of most polymerases integration modified nucleosides.

The responsive transcription time can for 1 hour to several weeks, be preferably 1 to 24 hour.

The biological method described in following examples shows, what have high-affinity and a binding specificity selected fitly is suitable for treating the relevant treatment of diseases of C5 complement protein.

Aptamer medicinal chemistry

In case identified in conjunction with the fit of expectation target, can be carried out combination and/or functional character that several technology further strengthen the fit sequence of being identified.Pass through SELEX ^TMProcess (comprise 2 '-SELEX modified ^TM) identify in conjunction with fit Horizon endization arbitrarily of expectation target with acquisition have expect combination and/or functional character minimize fit sequence (also referring to " minimizing structure " here).Use method for folding and sequence analysis (for example, the cloned sequence result who derives from selection being calibrated to seek conserved die bodies and/or covariant) to know the design that minimizes structure.The biochemical probe time also can be measured 5 of fit sequence ' and 3 ' border, to know the design that minimizes structure.Minimize structure can by chemosynthesis and measure its than origin non--minimize the combination and the functional character of sequence.Comprise a series of 5 ', 3 ' and/or the variant of the fit sequence of inner deletion also can be directly by chemosynthesis and test its than its origin non--minimize the combination and/or the functional character of sequence.

In addition, the doping gravity treatment can be used to study the fit sequence of single-activity and (for example, passes through SELEX ^TMFit in conjunction with expectation target that process is identified, (comprise 2 '-SELEX modified ^TM), or a kind of single fit sequence that minimizes) the sequence needs.Use synthetic, based on the degeneracy set of the unique sequence design of the expectation gravity treatment of mixing.The degeneracy level is generally 70% to 85% variation of wild type nucleoside, for example, and the unique sequence of expectation.Usually, identify the sequence that has neutral sudden change, but sequence changes the result that can obtain to strengthen affinity under the certain situation by the doping reuse adoption process.Deriving from the composition sequence information of using the doping gravity treatment to identify the clone can be used to identify minimum knot matched moulds body and help to obtain optimal effectiveness.

Use SELEX ^TMFit sequence that process is identified (comprise 2 '-modify SELEX and doping gravity treatment) and/or minimized fit sequence also can be at SELEX ^TMUse Aptamer Medicinal Chemistry to carry out optimal treatment afterwards, carry out at random or direct sequence sudden change increasing binding affinity and/or functional character, or measure in the sequence for combination activity and/or the necessary site of functional character.

Aptamer medicinal chemistry is a kind of fit improving technology, wherein respectively organizes variant data by chemosynthesis.These variants are typically fit different with parent, and it has introduced single replacement, and owing to replace the different differences mutually in site.Between these variants and and parent between compare mutually.Improvement on the feature can be far-reaching, and it single replacement that comprises can be that acquisition particular treatment standard is necessary.

Alternatively, the information that obtains from single variant group can be used to design the variant group of increase, wherein surpasses a kind of replacement and is introduced at the same time.In a kind of layout strategy, all single replacement variants are classified, select preceding 4 kinds, and this in 4 all possible two (6) of single replacement variant, three (4) and four (1) heavily unite and are synthesized and analyze.In second kind of layout strategy, best single replacement variant is used as new female parent, comprises that all possible two variants of replacing of the single replacement variant of the highest-rank are synthesized and analyze.Other strategies also can be used, and these strategies can reuse the quantity of make replacing and increase gradually, identify the variant of increase-improvement continuously.

The replacement that aptamer medicinal chemistry can specifically be introduced the part as a kind of method, and non-integral is studied.Because fit is to select in by the library of transcribing preparation, at SELEX ^TMThe replacement of introducing in the process must be whole the introducing.For example, to introduce thiophosphate crosslinked if be desirably between nucleoside, and it can only introduce (the whole replacement) in each A (or each G, C, T, U etc.).In some A (or some G, C, T, U etc.), need thiophosphate (the local replacement) and in other A the fit of no toleration can not find by the method.

The replacement type that the aptamer medicinal chemistry method is used only is subjected to the solid phase synthesis reagent preparation and guides it to enter the restriction of the ability of polymer synthetic schemes.Method is not subject to nucleoside separately.The replacement that the aptamer medicinal chemistry method comprises can be introduced space, hydrophobicity, hydrophilic, lipotropy, lipophobia, cation, in the shadow, neutral ion, amphion, polarizability, nuclease-resistance, conformation hardness, conformation pliability, albumen-binding characteristic, quality etc.The aptamer medicinal chemistry method can be introduced base-modification, and glycosyl-modification or di-phosphate ester be crosslinked-modify.

When the type of considering can help treating fit replacement, then the replacement with following one or both characteristics is introduced in expectation.

(1) replacement that in health, has existed, for example, 2 '-deoxidation, 2 '-ribose, 2 '-O-methyl purine or pyrimidine or 5-methylcytidine.

(2) be the replacement of the part of the therapeutic agent that provided, for example, thiophosphate-crosslinked oligonucleotide.

(3) hydrolysis or a kind of replacement of degraded to above-mentioned two specific characters, for example, methyl phosphorodithioate-crosslinked oligonucleotide.

Fit the fit of described thus aptamer medicinal chemistry method preparation that comprise of the present invention.

Fit target binding affinity of the present invention can be by the association reaction between a series of fit and targets (for example, a kind of protein) and is measured, wherein ³²The serial dilution target that the fit and buffer of P-labelling is heavy is hatched altogether, and uses the vacuum filtration collecting tubule by the nitrocellulose filter filter analysis.Here the speckle marking method of indication uses three layers (from top to bottom) by celluloid, the film medium that nylon membrane and gel speckle paper are formed.Bonded RNA is caught by the cellulose filter membrane with target, but not-target is hunted down on the nylon filter membrane in conjunction with RNA.Gel speckle paper is as the supporting dielectric of other filter membranes.Along with filtration is carried out, filter course is separated, and drying also is exposed to fluorescent screen and uses the fluorescent display system alignment to carry out quantitatively.Quantized result can be used to generate fit binding curve, wherein can calculate dissociation constant (K _D).In the preferred embodiment, the buffer solution medium that is used to carry out association reaction is to be added with 1 of 0.1mg/ml BSA ^*Dulbecco ' s PBS (has Ca ⁺⁺And Mg ⁺⁺).

Usually, the active ability of aptamer regulated objective function, for example, fit function can use external and the analysis of body inner model, and its biological function according to target changes.In some embodiments, the fit known organism that can suppress target of the present invention is learned function, and in other embodiments, and fit known organism that can stimulation target of the present invention is learned function.Fit functional activity of the present invention can use the external and body inner model of measuring complement component target known function to analyze.

Fit any technology of using according to those skilled in the art of the present invention can be applicable to diagnostic purpose routinely.Diagnostic application can comprise in the body or in-vitro diagnosis is used.Diagnostic reagent only needs to be used for identifying that specific region or concentration are to the existence that sets the goal.Simply, combine the positive signal that right ability can effectively cause diagnostic purpose with target formation.Those of skill in the art also can introduce a markup tags to locate existing of these aglucons by methods known in the art to fit transformation.These labels can use in multiple diagnostic method.

The pharmacokinetics of aptamer therapeutics agent and bio distribution are regulated

Comprise fit all medicines based on-oligonucleotide, its pharmacokinetic properties and medicinal application design fully coupling are very important.Yet directly do not tolerate and carry relevant difficulty (as antisense with based on the treatment situation of-RNAi) in the cell at extracellular target fit, these are fit must can be distributed in Target organ and tissue, and conform to the desired amount scheme, in vivo one time of the section of keeping (no change).

Like this, the invention provides the material and the method for the pharmacokinetics of impression font set compound, and, particularly, change the ability of fit pharmacokinetics.The transformation ability of fit pharmacokinetics (for example, regulating power) is to combine and/or introduce modified nucleoside (for example, 2 '-fluorine or 2 '-O-methyl) and reach with the chemical composition of transformation nucleic acid with fit by modifying aglucon (for example, PEG polymer).The ability that changes fit pharmacokinetics is applied to improveing existing treatment and uses, or alternatively, develops new treatment and use.For example, during some treatments are used, for example, and the quick removing or the inefficacy of expectation medicine in Anti-tumor or the acute treatment, then expectation reduces the fit residence time in circulation.Alternatively, during other treatment is used, for example, when the systemic circulation of treatment is kept in expectation in keeping treatment, can expect to increase the fit residence time in circulation.

In addition, the transformation ability of fit pharmacokinetics is applied to modifying the bio distribution of the aptamer therapeutics agent in the main body.For example, some treatments in the application that is positioned particular tissue type or certain organs (or one group of organ), can expect to change the bio distribution of aptamer therapeutics agent in using.In these were used, aptamer therapeutics preferentially stimulated specific tissue or organ.During other treatment is used, the symptom of desired target tissue showed cell labelling or a kind of given disease association, primary cellular defect or other improper pathology, thus make aptamer therapeutics preferred accumulation in affected tissue.For example, as be described in U.S. Provisional Application serial number 60/550790, filing on March 5th, 2004, exercise question is " pharmacokinetics of aptamer therapeutics and chorologic controlled adjustment; " with the U.S. non--provisional application series number 11/075648, filing on March 7th, 2005, exercise question is " pharmacokinetics of aptamer therapeutics and chorologic controlled adjustment; " the PEGization of aptamer therapeutics (for example, the PEGization of 20kDaPEG polymer) is used to locate the inflammation tissue, thereby the agent of PEGization aptamer therapeutics is preferentially assembled in the inflammation tissue.

For measuring the pharmacokinetics and the bio distribution characteristic of aptamer therapeutics agent (for example, fit covalency thing or have and change the fit of chemical is as the nucleoside of modifying), need the various parameters of monitoring.These parameters comprise, for example, and half-life (t _1/2), plasma clearance (C1), distribution body machine (Vss), the area under the concentration-time curve (AUC), maximum serum or plasma concentration (C _Max) and average residence time (MRT) of fit compositions.The plasma concentration that term used herein " AUC " refers to the aptamer therapeutics agent with respect to aptamer therapeutics after the area under a curve of time.The AUC value is used to assess the full scale clearance rate (C1) (for example, aptamer therapeutics agent speed clearly from circulation) of bioavailability (for example, the percentage rate of the aptamer therapeutics agent in circulation after the fit administration) and/or given aptamer therapeutics agent.Fitly in the plasma concentration of volume of distribution and reagent therapeutic agent and the health exist quantity relevant.Vss is big more, outer fit many more (for example, exosmose) found of blood plasma more.

The invention provides by combining with the adjusting aglucon fit, as a kind of micromolecule, polypeptide, or polymerization end group, or, in controlled mode, regulate the body giving drugs into nose of stable fit compositions for kinetics and chorologic material and method by in fit, introducing modified nucleoside.Said, with modify aglucon combine and/or the change of nucleoside Chemical composition that can change the basic sides of fit circulation residence time and tissue distribution.

Except the scavenging action of nuclease, the nucleoside therapeutic agent also is subject to kidney and filters the eliminating function.Therefore, in the body of the oligonucleotide of the anti--nuclease by intravenous administration the half-life less than 10 minutes, unless filtering function can be suppressed.Can enter the quick distribution speed of tissue or increase the fit molecular weight of oligonucleotide from blood flow by promoting, make its surpass glomerule by size and finish.Combine (PEGization) of little therapeutic agent and PEG polymer, as described below, can increase the fit residence time in circulation significantly, thereby reduce administration frequency and strengthen effectiveness at the blood vessel target.

Further, the fit filtration of part tissue of eye also can be adjusted, and particularly is suppressed, and increases fit apparent molecular weight of the present invention by combining with the PEG polymer.

Fit can the combination with various modification aglucons, as heavy polymer, for example, PEG; Polypeptide, for example, Tat (proteic 13 the amino acid fragment (Vives of HIV Tat, Deng (1997), J.Biol.Chem.272 (25): 16010-7)), Ant (derives from the 16-aminoacid sequence (Pietersz waits (2001), Vaccine 19 (11-12): 1397-405)) and the Arg of fruit bat feeler homologous protein triple helical ₇(a kind of weak point, positive charge cell-infiltration polypeptide (Arg that the polymerization arginine is formed ₇) (Rothbard waits (2000), Nat.Med.6 (11): 1253-7; Rothbard, J etc. (2002), J.Med.Chem.45 (17): 3612-8)); And micromolecule, for example, lipophilic compound such as cholesterol.In the various combinations described here, influence fit body internal characteristic the most significantly with combining of PEG group.For example, above-mentioned non--provisional application (U.S. serial, 11/075648, filing on March 7th, 2005, exercise question is " aptamer therapeutics agent pharmacokinetics and a chorologic controlled adjustment "), the kidney filtration that fit and combining of 20kDa PEG polymer prevented also promotes fit distribution in healthy and inflammation tissue.In addition, 20kDa PEG-polypeptide polymer and 40dDa PEG polymer filter fit kidney and prevent effect similar.Though a kind of effect of PEGization is fit removing, the system of the prolongation that the 20kDa aglucon provides helps fit distribution in tissue open-assembly time, particularly those highly dabbling organ and inflammation parts.Fit-20kDa PEG polymerization conjugate makes the fit inflammation part that directly is positioned, and makes that PEGization is fit preferentially to assemble in the inflammation tissue.In the certain situation, the fit conjugate of 20kDa PEGization can be near cell interior, for example, and nephrocyte.

In sum, the low-molecular-weight aglucon comprises that cholesterol and Premeabilisation of cells polypeptide are significantly less than PEGization to fit pharmacokinetics and the influence of making up distribution or nucleoside is modified the influence that (for example, the change of chemical constituent) causes.Yet, do not expect to be subject to theory, tool show cholesterol-mediation with the combining of plasma lipoprotein, suppose that it occurs under the antisense bonding state, be excluded not fit-cholesterol the spy in conjunction with foldable structure outside, and/or relevant with the lipotropy of cholesterol group.With cholesterol seemingly, high-caliber conjugate in the kidney during with respect to 48 hours, Tat polypeptide label promote fit removing from blood flow.The mediation macromole of having reported herein is at external other polypeptide (for example, Ant, Arg by cell membrane ₇), do not promote fit removing in circulation.Yet fit with respect to other similar in appearance to Tat, the Ant conjugate is assembled in kidney significantly.Yet, do not expect to be subject to theory, Ant and Arg ₇Peptide modified aglucon may have a negative impact to three dimensional fold in the fit body, weakens the ability that these polypeptide influence fit transport features.

Modified nucleoside also can be used to adjust fit plasma clearance.For example, uncombined fit with for example, 2 '-fluorine, 2 '-OMe, and/or the integration of stablizing the thiophosphate of its chemical has typicality in the external and nucleic acid in vivo enzyme stability of its demonstration high level in preparation at present fit, compare with non-modification is suitable, shown the quick distribution in quick removing in the blood plasma (for example, quick plasma clearance) and the tissue, mainly be distributed in the kidney.

The nucleic acid that PAG-derives from

As mentioned above, the nucleic acid derivatives of high molecular non-immunogenic has the potentiality that change nucleic acid pharmacokinetics and pharmacodynamic profiles, makes it be called more effective medicine.Active strong change can comprise the resistance of increase to nucleic acid, reduces kidney and filters, and reduces immune exposure, and changes the distribution of therapeutic agent in health.

Fit compositions of the present invention can be derived from by ployalkylene glycol (＂ PAG ") aglucon.The embodiment of the nucleic acid that PAG-derives from sees U.S. Patent Application Serial filing on November 21st, 10/718833,2003, and it is by all merging and this paper in this citation.The typical polymer that uses among the present invention comprises poly-(ethylene glycol) (＂ PEG: ＂), gather (ethylene oxide,1,2-epoxyethane) (" PEO ") and POLYPROPYLENE GLYCOL (comprising PIA).In addition, different olefinic oxides (for example, ethylene oxide and propylene oxide) can use in many application.The form that it is the most frequently used, Polyethylene Glycol as PEG, is a kind ofly to have oh group at each end: HO-CH ₂CH ₂O-(CH ₂CH ₂O) _n-CH ₂CH ₂The linear polymer of-OH.This polymer, alha-, the omega-dihydroxy gathers (ethylene glycol), also can be represented by HO-PEG-OH, and it is understood that-the following construction unit of PEG-symbolic representation :-CH ₂CH ₂O-(CH ₂CH ₂O) _n-CH ₂CH ₂-, wherein the typical scope of n is 4 to 10000.

The PAG polymer that is suitable for treating typically have in water and many organic solvents in solubility, avirulence there is no immunogenic feature.The PAG that we use is polymer and water-insoluble molecule covalent bond, makes PAG-molecule " conjugate " tool solubility.For example, tool shows the water-insoluble medicine paclitaxel, and when combining with PEG, becoming has water solublity.Greenwald, etc., J.Org.Chem., 60:331-336 (1995).The PAG conjugate not only is used to strengthen solubility and stability usually, also can prolong the blood circulation half-life of molecule.

The PAG derivatives, for example, the PAG conjugate, the chorologic ability that changes therapeutic agent is relevant with many factors, comprises the apparent size (for example, measuring with hydraulic radius) of conjugate.Known bigger conjugate (〉 10kDa) more effectively suppresses kidney and filter, thereby and increase the serum half-life of little macromolecule (for example, polypeptide, antisense oligonucleotide).Tool shows, the PEG conjugate suppress filtering ability will increase with the size of PEG to 50kDa increase (since the half-life will be by the metabolism of macrophage-mediation but not kidney filter and be defined, make that further increase has very little effect.)

The chemical compound size that PAG of the present invention derives from typically is between 5 to 80kDa, however any size can be used, this selection depends on fit and its application.The chemical compound size that other PAG of the present invention derive from is between 10 to 80kDa.And the chemical compound size that other he PAG of the present invention derive from is between 10 to 60kDa.The PAG aglucon magnitude range of compositions of the present invention is 10,20,30,40,50,60, or 80kDa.In the following embodiment, PEG is linear PEG, and in other embodiments, PEG is the PEG of branch.PEG is the PEG of 40kDa branch that describes among Fig. 4 in other embodiments.In some embodiments, as shown in Figure 5, PEG of 40kDa branch and 5 fit ' terminal the connection.

The invention provides synthetic high polymer PEG-nucleic acid (preferably, fit) conjugate, comprise the economic means of multiple PEGization nucleic acid.The present invention also comprises many bodies oligonucleotide that PEG-connects, and for example, dimerization is fit.In biology-expressed proteins therapeutic agent, the exonuclease treatment agent is typically from the chemosynthesis of activated monomer nucleoside.PEG-nucleic acid conjugate can prepare by using the synthetic PEG of integration of identical repeated monomer.For example, can be integrated into the solid phase oligonucleotide synthetic by changing the activated PEG of phosphoramidite form into.Alternatively, can finish the synthetic of oligonucleotide by the site-special PEG of being integrated into association reaction site.

Active PEG

High-molecular weight PEG (〉 10kDa) preparation may be difficult, poor efficiency, and expensive.In the process of synthetic high polymer amount PEG-nucleic acid conjugate, the high-molecular weight active PEG of preparation is paid close attention in previous work.Self-closing these ramose methods comprise the linear active PEG of preparation, or the active PEG of branch, and wherein two or more PEG combine with the center that has active group.The ramose end portion of these high molecular weight PEGs, for example, relevant non--(OH) group can be activated the reaction hydroxyl, or changes functional group into, so that one or more PEG are connected by reaction site with other chemical compounds.Ramose active PEG will have two ends of surpassing, and under the situation that two or more ends are activated, these living polymer amounts PEG branch is called multiple-active PEG at this.In the certain situation, not all end all is activated in the PEG of the branch molecule.In the situation that any two ends of the PEG of branch molecule are activated, this PEG molecule refers to two-active PEG.In the situation that any two ends of the PEG of branch molecule are activated, this PEG molecule refers to two-active PEG.In the situation that an end of the PEG of branch molecule is activated, this PEG molecule refers to list-activity.As an embodiment of this approach, described by two mono methoxy PEG are connected the method (Harris etc., Nature, vol.2:214-221,2003) for preparing active PEG with the lysine center that is activated subsequently.

As shown in Figure 6, linear PEG molecule is two-function, and is sometimes referred to as " PEG glycol." end portion of PEG molecule is relative non--reaction oh group ,-OH group, it can be activated, or changes functional group into, and PEG is connected by reaction site with other chemical compounds.These active PEG glycol refer to two-active PEG at this.For example, it will be non-relatively can passing through-the reaction oh group,-OH replaces with the butanimide active ester group that derives from N-hydroxy-succinamide, the terminal aglucon of PEG glycol is become have with amino group to carry out the activated carbon acid esters of selective response and functionalization.Alternatively, the PEG glycol can be activated by many groups, includes, but are not limited to alpha-halogen acetic acid, epihalohydrines, and maleic acid, tartaric acid and carbonic acid, it can prepare bonded active carbonyl group or analog after suitable operation.Other methods that activate PEG are described in Roberts etc., and (2002) Advanced Drug Deliver Reviews 54:549-476 is by all being incorporated in this paper in this citation.Use a kind of preceding method to activate outside the PEG, the terminal ethanol functional group of one or two of PEG molecule can be modified with in conjunction with dissimilar nucleic acid.For example, change terminal ethanol functional group into amino, or mercaptan, can be in conjunction with carbamide and sulfo-urethane.

In many application, be contemplated for one of the PEG molecule terminal with fully non--reactive group sealing, make the PEG molecule be called list-function (or single-active).Usually showing in the protein therapeutic agent of multiple active PEG avtive spot that two-functional activity PEG causes extra crosslinked, produces low activity and assembles.For preparing list-active PEG, a hydroxyl of PEG glycol molecules end typically replaces with non--active methoxyl group end group ,-OCH ₃-.And the PEG molecular end of another non--sealing typically changes the reaction end group into, and it can be activated, and with a kind of surface or molecule, connects as proteinic reaction site.

Connect the fit of one or more PEG

The most common ground, by 5 '-terminal free primary amine (use modify phosphoramidite and integrate at the last coupling step of solid phase synthesis) the synthetic high polymer amount PAG-nucleic acid conjugate that increases.Use this method, reaction PEG (for example, its be activated with amino reaction and form crosslinked) combine with the oligonucleotide of purification and in solution, carry out cross-linking reaction.

In addition, high molecular PAG-nucleic acid-PAG conjugate can be by preparing single functional activity PEG with comprising the nucleic acid reaction that surpasses a reaction site.In the embodiment, nucleic acid is two-reactivity, and comprise two reaction site: synthetic and with 3 by conventional phosphoramidite '-amino solid phase is supported initial, with 5 '-amino group and 3 '-amino group is integrated into oligonucleotide, for example: describe among Fig. 63 '-5 '-two-PEGization.Optionally in the embodiment, the reflection site can be introduced in inner site, uses the 5-site of pyrimidine, the 8-site of purine, or ribose 2 '-site is as the site that connects primary amine.In this embodiment, nucleic acid can have several activity or reaction site and be multiple active.

Be preparation nucleic acid-PEG-nucleic acid conjugate, nucleic acid is at first synthesized, thus its have single avtive spot (for example, its be single-active).In the preferred embodiment, reaction site is by increase modifying phosphoramidite in oligonucleotide solid phase synthesis final step, 5 '-a amino group that end is integrated into.In another preferred embodiment, use 3 '-amido modified thing, add 5 '-the terminal amino of introducing is finished syntheticly, produce 3 ', 5 '-the bis-amino oligonucleotide.By oligonucleotide Deproteinization and the purification to modifying, it with high concentration regeneration, minimizes the natural hydrolysis of active PEG in solution.In the preferred embodiment, the concentration of oligonucleotide is 1mM, and actified solution comprises 200 ' mM NaHCO ₃-buffer, pH8.3.The synthetic of junctional complex is by slowly, and it is initial to increase highly purified active PEG step by step.In the preferred embodiment, PEG is activated as p-nitrobenzophenone carbonate.Along with reaction is carried out, PEG-nucleic acid conjugate by gel electrophoresis or liquid chromatograph purification with separate completely-, partly-and non--bound substances.

Multiple fit in conjunction with a PEG

The present invention also comprises the fit compositions of high molecular, at least one ployalkylene glycol group of wherein two or more nucleic acid aglucon covalent bond.The ployalkylene glycol group is as a kind of stable group.Stable group is a kind of molecule, or the part of molecule, and it can improve the pharmacokinetics and the pharmacodynamic profiles of the fit compositions of high molecular of the present invention.In the certain situation, stable group is the part of a kind of molecule or molecule, and it can make two or more fit, or fit zone is approaching, or the unitary rotation degree of freedom of the minimizing of the fit compositions of high molecular of the present invention is provided.Stable group can be a ployalkylene glycol, and as Polyethylene Glycol, it can be linear or ramose, single polymers or heteropolymer.Other stable groups comprise polypeptide-nucleic acid polymer such as (PNA).Oligonucleotide also can be a kind of stable group; These oligonucleotide can comprise modified nucleoside, and/or modify connection; As thiophosphate.

Stable group can be the interior section of fit compositions, for example, and itself and fit covalent bond.In the compositions of the fit arbitrary end of a kind of ployalkylene glycol covalent bond, be connected jointly in the molecule as ployalkylene glycol and nucleic acid group, this ployalkylene glycol is called linking group.In these compositionss, the original structure that connects molecule comprises linearly aligned nucleic acid-PAG-nucleic acid.In a kind of embodiment of compositions, wherein PEG stablizes the connection of group as fit separation different piece, be the compositions that a kind of PEG is connected with single fit sequence, thereby the linear arrangement of the fit compositions of high molecular is, for example, nucleic acid-PEG-nucleic acid (PEG-nucleic acid) _n, wherein n is more than or equal to 1.

Be preparation nucleic acid-PEG-nucleic acid conjugate, thus nucleic acid by initial synthetic its have a single reaction site (for example, its be single-active).In the preferred embodiment, reaction site is a kind of by introducing extra modification thiophosphate in the solid phase synthesis final step of oligonucleotide, 5 '-a terminal amino group of introducing.Behind modified nucleoside Deproteinization and purification, it with high concentration regeneration, minimizes the natural hydrolysis of active PEG in solution.In the preferred embodiment, the concentration of oligonucleotide is 1mM, and actified solution comprises 200mM NaHCO ₃-buffer, pH8.3.The synthetic of junctional complex is by slowly, increase step by step highly purified two-function PEG is initial.In the preferred embodiment, be the nitre benzol carbonate by deriving, two ends of PEG glycol all be activated (two-activity).Carry out with reaction, PEG-nucleic acid conjugate by gel electrophoresis or liquid chromatograph purification with separate completely-, part-and non--bonded material.Multiple PAG molecule connects (for example, at random or module polymer) or littler PAG chain can be connected to obtain different length (or molecular weight).Non--PAG connects and can use between the PAG of different length chain.

Join domain can have one or more coupled ployalkylene glycol groups.These PAG can be different lengths and be used in combination to obtain the desired molecular weight of compositions with suitable.

The effect of specific junctional complex can be subjected to its chemical composition and effect length.Oversize, or too short, or form unsuitable steric junctional complex and/or and the ion reciprocal action of complement component target will influence the formation of complex between fit and complement component target.A kind of junctional complex, it is required that it is longer than between nucleic acid span, will weaken combination stability by reducing the effective concentration that connects.Like this, be necessary often connecting that compositions and its length are optimized so that fit affinity to target reaches maximum.

Complement system protein C5 had the fit of binding affinity

In some embodiments, material of the present invention and method comprise a series of specific bond complement protein C5 and the aptamer of 15 to 60 nucleoside length that its function is regulated, for example, prevent the activity of the chemical examination on complement protein C5 activity in vivo and/or cell-basis.

In embodiments more of the present invention, having described can specific bond and regulate the fit of complement protein C5.These are fit to provide low-toxicity, and safety and treat effective form improves and/or prevent various complements-relevant disease or imbalance, for example, and complement-relevant heart imbalance (for example, myocardial damage; The complement complication such as the postoperative hemorrhage of the C5 mediation that bypass operation of coronary artery (CABG) is relevant, system neutrophil(e) cell and leukocyte activity increase myocardial infarction danger, and increase the cognitive function disorder; Restenosis; The complement complication of the C5 mediation relevant), ischemical reperfusion injury (for example, myocardium inflammation with percutaneous coronary intervention (pci), apoplexy, cold injury), inflammation imbalance (for example, the asthma that complement is relevant, arthritis, repel after pyemia and the organ transplantation), with the Autoimmune Disorders of complement-relevant (for example, myasthenia gravis, systemic lupus erythematosus (sle) (SLE)).The C5 of other expectations suppresses symptom and comprises, for example, pneumonia (Mulligan etc., (1998) J.Clin.Invest.98:503), external complement activity (Rinder etc., (1995) J.Clin.Invest.96:1564), antibody-mediated complement activity (Biesecker etc., (1989) glomerulonephritis and other nephropathy, the part tissue of eye damage of eye symptom such as C5 mediation J.Immunol.142:2654),, for example, diabetic retinopathy, exudative and/or non--exudative age related macular degeneration (AMD), paroxysmal nocturnal hemoglobinuria.These are fit also can be used for diagnosis.

In some embodiments, hypotoxicity of the present invention, safety, can in the method for invention, be used for the treatment of with the fit of effective adjusting, stable and/or prevent different complements-relevant ocular disease or imbalance, comprise, for example, eye acute or chronic inflammatory disease and/or immunity-mediation is lacked of proper care struvite conjunctivitis, comprise the anaphylaxis macropapillary conjunctivitis, macular edema, uveitis, endophthalmitis, cornea festers, xerophthalmia, glaucoma, diabetic retinopathy, corneal graft rejection, the complication that operated eye is relevant, the inflammation relevant with cataract operation as the intraocular lens implants, Behcet ' s disease, immune compound vasculitis, Fuch ' s disease, the Xiao Liu Harada disease, Asian TV Station's postretinal fiberization, keratitis, vitreous body-retinitis, eye parasitic infection/transfer, the degeneration of color retinal pigment, cytomegalovirus retinitis (" AMD "), non--exudative (" dryness ") AMD, or the imbalance of eye neovascularization, comprise diabetes retinitis or exudative (" wetting ") AMD.These are fit also can to use in eye diagnosis.

These are fit also can to comprise modification described herein, for example, (for example, PEG) connects, integrates the medicated cap group, integrate modified nucleoside, and the phosphoric acid skeleton is modified with lipotropy or high-molecular weight compounds.

In one embodiment of the invention, provide isolating, non--abiogenous fit in conjunction with the C5 complement protein.In another embodiment, provide in the method for the invention and to have used, with treatment, that eye stable and/or prevention complement-mediation is lacked of proper care is isolating, non--abiogenous fit in conjunction with the C5 complement protein.In some embodiments, the dissociation constant (" Kd ") of isolating, non--abiogenous fit and C5 complement protein is less than 100 μ M, less than 1 μ M, less than 500nM, less than 100nM, less than 50nM, less than 1nM, less than 500pM, less than 100pM, less than 50pM.In embodiments more of the present invention, dissociation constant is to measure with the burl dyeing titration method of describing in the following example 1.

In another embodiment, the function of the aptamer regulated C5 complement protein that uses among the present invention particularly suppresses C5 complement protein function and/or C5 complement protein variant function.C5 complement protein variant used herein comprises the variant of carrying out with the abundant similar functions of C5 complement protein.C5 complement protein variant fully comprises identical structure suitably, and in some embodiments with the aminoacid sequence that comprises the C5 complement protein of following amino acid sequences (series number: 102) (be incorporated in Haviland etc., J Immunol.1991 January 1; 146 (1): 362-8) compare, comprise at least 80% sequence identity, more suitably comprise at least 90% sequence identity, comprise at least 95% sequence identity with being more suitable for.

1 mgllgilcfl iflgktwgqe qtyvisapki frvgaseniv iqvygyteaf datisiksyp

61 dkkfsyssgh vhlssenkfq nsailtiqpk qlpggqnpvs yvylevvskh fskskrmpit

121 ydngflfiht dkpvytpdqs vkvrvyslnd dlkpakretv ltfidpegse vdmveeidhi

181 giisfpdfki psnprygmwt ikakykedfs ttgtayfevk eyvlphfsvs iepeynfigy

241 knfknfeiti karyfynkvv teadvyitfg iredlkddqk emmqtamqnt mlingiaqvt

301 fdsetavkel syysledlnn kylyiavtvi estggfseea eipgikyvls pyklnlvatp

361 lflkpgipyp ikvqvkdsld qlvggvpvtl naqtidvnqe tsdldpsksv trvddgvasf

421 vlnlpsgvtv lefnvktdap dlpeenqare gyraiayssl sqsylyidwt dnhkallvge

481 hlniivtpks pyidkithyn ylilskgkii hfgtrekfsd asyqsinipv tqnmvpssrl

541 lvyyivtgeq taelvsdsvw lnieekcgnq lqvhlspdad ayspgqtvsl nmatgmdswv

601 alaavdsavy gvqrgakkpl ervfqfleks dlgcgagggl nnanvfhlagltfltnanad

661 dsqendepck eilrprrtlq kkieeiaaky khsvvkkccy dgacvnndet ceqraarisl

721 gprcikafte ccvvasqlra nishkdmqlg rlhmktllpv skpeirsyfp eswlwevhlv

781 prrkqlqfal pdslttweiq gvgisntgic vadtvkakvf kdvflemnip ysvvrgeqiq

841 lkgtvynyrt sgmqfcvkms avegictses pvidhqgtks skcvrqkveg ssshlvtftv

901 lpleiglhni nfsletwfgk eilvktlrvv pegvkresys gvtldprgiy gtisrrkefp

961 yripldlvpk teikrilsvk gllvgeilsa vlsqeginil thlpkgsaea elmsvvpvfy

1021 vfhyletgnh wnifhsdpli ekqklkkklk egmlsimsyr nadysysvwk ggsastwlta

1081 falrvlgqvn kyveqnqnsi cnsllwlven yqldngsfke nsqyqpiklq gtlpvearen

1141 slyltaftvi girkafdicp lvkidtalik adnfllentl paqstftlai sayalslgdk

1201 thpqfrsivs alkrealvkg nppiyrfwkd nlqhkdssvp ntgtarmvet tayalltsln

1261 lkdinyvnpv ikwlseeqry gggfystqdt inaiegltey sllvkqlrls mdidvsykhk

1321 galhnykmtd knflgrpvev llnddlivst gfgsglatvh vttvvhktst seevcsfylk

1381 idtqdieash yrgygnsdyk rivacasykp sreesssgss havmdislpt gisaneedlk

1441 alvegvdqlf tdyqikdghv ilqlnsipss dflcvrfrif elfevgflsp atftvyeyhr

1501 pdkqctmfys tsnikiqkvc egaackcvea dcgqmqeeld ltisaetrkq tackpeiaya

1561 ykvsitsitv envfvkykat lldiyktgea vaekdseitf ikkvtctnae lvkgrqylim

1621 gkealqikyn fsfryiypld sltwieywpr dttcsscqaf lanldefaed iflngc

In embodiments more of the present invention, the sequence consistent with the target variant is to use following BLAST to measure.Term between two or more nucleic acid or protein sequence " sequence unanimity; " instigate in order to following a kind of sequence comparison program or by the visual inspection method, compare with the highest corresponding arrangement, have amino acid residue or nucleoside identical or that particular percentile is identical between two or more sequences or subsequence.For sequence relatively, typically, a kind of sequence is used as reference sequences, compares with another cycle tests.When using sequence comparison program, test and reference sequences are transfused to computer, then indicate the subsequence coordinate if needed, and implementation sequence algorithm routine constant.Sequence comparison program is subsequently according to the program constant calculations cycle tests and the consistent percentage ratio of sequence between reference sequences of design.Can carry out the sequence comparison program of following the best, for example, location clustalw algorithm, Smith ﹠amp; Waterman, Adv, Appl.Math.2:482 (1981), homology array algorithm, Needleman﹠amp; Wunsch, J Mol.Biol.48:443 (1970), the research of similarity method, Pearson ﹠amp; Lipman, Proc.Nat ' l.Acad.Sci.USA 85:2444 (1998), the Computer Processing of these algorithms (GAP, BESTFIT, PASTA, with the TFASTA in the Wisconsin heredity software kit, hereditary computer set, 575 Scinece Dr., Madison, Wis.), or by visual inspection (usually row, Ausubel etc.) as follows.

The algorithm that is suitable for measuring the consistent percentage ratio of sequence is the algorithm (following " BLAST ") that uses in the basic location algorithm research tool, see, for example, Altschul etc., JMol.Biol.215:403-410 (1990) and Altschul etc., Nucleic Acids Res, 15:3389-3402 (1997).The software of carrying out the BLAST analysis obtains by NCBI (following " NCBI ") is open.Use software among the NCBI, for example, the default parameters that BLASTN (nucleotide sequence) and BLASTP (aminoacid sequence) measure sequence identity is described in McGinnis etc., Nucleic Acids Res, 32:W20-W25 (2004).

In another embodiment of the present invention, provide and comprised following any fit fully identical ability: series number: 1-2,5-67,75-81,83 or 88-98 in conjunction with the C5 complement protein.In another embodiment of the present invention, fit have comprise following any fit fully identical structure and in conjunction with the ability of C5 complement protein: series number: 1-2,5-67,75-81,83 or 88-98.In embodiment of the present invention, the fit sequence that has of the present invention comprises any chemical modification, corresponding to any series number: 1-2, and 5-67,75-81,83 or 88-98.In another embodiment, of the present invention fitly use as the active component in the pharmaceutical composition.In another embodiment, fit or comprise that fit compositions of the present invention is used for the treatment of multiple any complement of selecting-relevant disease or the imbalance that comprise from following group: complement-relevant heart imbalance (for example, myocardial damage; The complication of the C5 mediation that bypass operation of coronary artery (CABG) is relevant, as postoperative hemorrhage, neutrophil cell and leukocyte activity increase the danger of myocardial infarction and cognitive disorders; Narrow; The complement complication of the C5 mediation relevant) with percutaneous coronary intervention (pci), ischemical reperfusion injury (for example, myocardial infarction, apoplexy, cold injury), complement-relevant inflammation imbalance (for example, asthma, arthritis, repel after pyemia and the organ transplantation), with the Autoimmune Disorders of complement-relevant (for example, myasthenia gravis, systemic lupus erythematosus (sle) (SLE), pneumonia, external complement activity, the ocular disease that antibody-mediated complement activity is relevant with complement, as diabetes retinitis and the age-relevant degeneration of macula (AMD).

In a kind of embodiment, of the present invention resisting-the fit bag of C5

-fluorine modified nucleoside, 2 '-the OMe modified nucleoside

-OMe ") and 2 '-mixture of OH purine residue.(series number: 1) see the following form 1, its structure is seen Fig. 3 A to the fit descriptive sequence of anti-C5 of modifying.Most of purine and (A and G) have 2 '-OMe, except only have two G residues still be 2 '-OH (residue that highlights).The residue of zone circle represents to be modified to simultaneously 2 '-the active pyrimidine cohort of anti-C5 that H and insufficient change are fit (the ARC330 in 1 of seeing the following form (series number: 2, Fig. 3 B)).The residue that underscore shows among Fig. 3 A represents to comprise 2 '-fluorine and 2 '-H modify (but be not 2 '-OMe) purine residue, and the residue of band frame represents to comprise 2 '-fluorine or 2-OMe modify (but be not 2 '-H) pyrimidine residue.The residue that has an arrow () must contain 2 '-fluorine modifies.Have arrow () if residue do not contain 2 '-fluorine modifies, and will fit hemolytic activity significantly be weakened.In the preferred embodiment, of the present invention resisting-C5 is fit to be comprised corresponding to series number: the nucleotide sequences in 1.

According to the embodiment that of the present invention resisting-C5 is fit is that (series number: 4), it shows in Fig. 3 C and be described in United States Patent (USP) series number 6395888 that it is by all being incorporated in this paper in this citation to ARC186.21 pyrimidine residues of all of ARC186 have 2 '-fluorine modifies.Main purine (14 residues) has 2 '-OMe modifies, except three be 2 '-OH purine residue (highlighting among Fig. 3 C).Of the present invention anti--C5 is fit also can comprise different 2 '-fluorine and 2 '-mixing that H modifies.It is for example, of the present invention that another is anti--and C5 is fit to be ARC330 (series number: 2) among Fig. 3 B.ARC330 (series number: 2) comprise 72 '-H modifies (expression of drawing a circle among Fig. 3 B), 14 have 2 '-pyrimidine residue that fluorine is modified, 14 2 '-purine residue that OMe modifies and three 2 '-OH purine residue (outstanding expression among Fig. 3 B).

Following table 1 has been explained other comprises 2 '-fluorine modifies, 2 '-OMe modifies, 2 '-OH purine residue, with be connected non--immunogenicity, the high-molecular weight compounds of different sizes (for example, fit compositions PEG), its each all derive from ARC186 (series number: 4).The present invention includes the fit of following table 1 description.That the present invention also comprises following description but lack 3 required ' medicated cap (for example, oppositely deoxidation pyrimidine medicated cap) fit and/or following description comprise the fit of 3 ' medicated cap (for example, oppositely dT), wherein this 3 ' medicated cap is non-needs.

Use in the method for describing in embodiments more of the present invention anti--C5 is fit can be comprise any following description fit: serial number NOS1 to 69,75,76,81,91,95 and 96.

Except as otherwise noted, the nucleotide sequence in the following table 1 with 5 ' to 3 ' reverse presentation.For each sequence in the table 1, all 2 '-OMe purine or pyrimidine modify and represent with " m " before the corresponding nucleoside; All 2 '-the fluorine pyrimidine modifies and to represent with " f " before the corresponding nucleoside; The deoxidation of all purine or pyrimidine is modified and is represented with " d " before the corresponding nucleoside; Purine that any nothing " m, " " f, " or " d " show or pyrimidine represent 2 '-OH residue nucleoside.Further, " 3T " represents reverse deoxidation pyrimidine, and " NH " expression hexylamine connects " NH ₂＂ represents the hexylamine end, ＂ PEG " expression has the polyethylene group of specified molecular weight, fit that biotin connects of " biotin " expression 5 ' have.

Table 1:

Serial number: 1

X ₁X ₂fCfCrGfCX ₃X ₄fUX ₅X ₆X ₇X ₈X ₉X ₁₀X ₁₁rGX ₁₂X ₁₃X ₁₄X ₁₅X ₁₆X ₁₇X ₁₈X ₁₉X ₂₀X ₂₁X ₂₂X ₂₃fUfUX ₂₄X ₂₅X ₂₆X ₂₇X ₂₈fCX ₂₉

Wherein:

X ₁=fC or mC

X ₂=rG or gy

X ₃=rG or mG

X ₄=rG or mG

X ₅=fC or dC

X ₆=fU or dT

X ₇=fC or dC

X ₈=rA or mA

X ₉=rG or mG

X ₁₀=rG or mG

X ₁₁=fC or dC

X ₁₂=fC or mC

X ₁₃=fU or mU

X ₁₄=rG or mG

X ₁₅=rA or mA

X ₁₆=rG or mG

X ₁₇=fU or dT

X ₁₈=fC or dC

X ₁₉=fU or dT

X ₂₀=rG or mG

X ₂₁=rA or mA

X ₂₂=rG or mG

X ₂₃=fU or dT

X ₂₄=rA or mA

X ₂₅=fC or dC

X ₂₆=fC or dC

X ₂₇=fU or dT

X ₂₈=rG or mG

X ₂₉=rG or mG

ARC330 (serial number: 2)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC185 (serial number: 3)

GAfCGAfUGfCGGfUfCfUfCAfUGfCGfUfCGAGfUGfUGAGfUfUfUAfCfCfUfUfCGfUfC

ARC186 (serial number: 4)

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-3T

ARC187 (serial number: 5)

40kDa PEG-NH-

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-3T

Wherethebranched 40kDa PEG is，3-bis(mPEG-[20kDa])-propyl-2-(4’-butamide)

ARC188 (serial number: 6)

AGGAfCGAfUGfCGGfUfCfUfCAfUGfCGfUfCGAGfUGfUGAGfUfUfUAfCfCfUfUfCGfUfC

ARC189 (serial number: 7)

AGfCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG

ARC250 (serial number: 8)

GGfCGfCfCGfCGGfUfCfUfCAGGfCGfCfUGAGfUfCfUGAGfUfUfUAfCfCfUGfCG

ARC296 (serial number: 9)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAdCdCfUmGfCmG-3T

ARC297 (serial number: 10)

mCmGmCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAdCdCfUmGmCmG-3T

ARC331 (serial number: 11)

dCmGdCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGdCmG

ARC332 (serial number: 12)

dCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC333 (serial number: 13)

fCmGdCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC334 (serial number: 14)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGdCmG

ARC411 (serial number: 15)

fCmGmCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC412 (serial number: 16)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGmCmG

ARC413 (serial number: 17)

mCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC414 (serial number: 18)

mCmGmCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGmCmG

ARC415 (serial number: 19)

fCmGfCdCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC416 (serial number: 20)

fCmGfCfCGdCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC417 (serial number: 21)

fCmGfCdCGdCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC418 (sequence table: 22)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGdCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC419 (sequence table: 23)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCTmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC420 (serial number: 24)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGdCTmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC421 (sequence table: 25)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGTfUfUAfCfCfUmGfCmG

ARC422 (serial number: 26)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUTfUAfCfCfUmGfCmG

ARC423 (sequence table: 27)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUTAfCfCfUmGfCmG

ARC424 (sequence table: 28)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGTTTAfCfCfUmGfCmG

ARC425 (serial number: 29)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCTmGfCmG

ARC426 (sequence table: 30)

fCmGfCfCGfCmGmGmUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAdCdCfUmGfCmG

ARC427 (sequence table: 31)

fCmGfCmCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC428 (serial number: 32)

fCmGfCfCGmCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC429 (serial number: 33)

fCmGfCmCGmCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC430 (serial number: 34)

fCmGfCfCGfCmGmGfUdCfUdCmAmGmGdCGmCfUmGmAmGfUdCfUmGmAmGfUfUfUAfCfCfUmGfCmG

ARC431 (sequence table: 35)

fCmGfCfCGfCmGmGfUdCfUdCmAmGmGdCGfCmUmGmAmGfUdCfUmGmAmGfUfUfUAfCfCfUmGfCm

ARC432 (serial number: 36)

fCmGfCfCGfCmGmGfUdCfUdCmAmGmGdCGmCmUmGmAmGfUdCfUmGmAmGfUfUfUAfCfCfUmGfCmG

ARC433 (serial number: 37)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGmUfUfUAfCfCfUmGfCmG

ARC434 (serial number: 38)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUmUfUAfCfCfUmGfCmG

ARC435 (serial number: 39)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUmUAfCfCfUmGfCmG

ARC436 (serial number: 40)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGmUmUmUAfCfCfUmGfCmG

ARC437 (serial number: 41)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCmUmGfCmG

ARC438 (sequence table: 42)

fCmGfCfCdGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC439 (sequence table: 43)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCdGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCmG

ARC440 (serial number: 44)

fCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUdAfCfCfUmGfCmG

ARC457 (serial number: 45)

mGfCmGfUfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmAfCmGm

C

ARC458 (serial number: 46)

mGmGmGfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmCmCmC

ARC459 (serial number: 47)

mGfCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCmGmAmGfUfUfUAfCfCfUmGfCmGm

C

ARC473 (serial number: 48)

mGmGmAfCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmG

fCmGfUfCfU-3T

ARC522 (serial number: 49)

mGmGfCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGmCmUmGmAmGTdCTmGmAmGTfUfUAdCdCTmGfCm

GmCmC

ARC523 (serial number: 50)

mGmGmCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGmCmUmGmAmGTdCTmGmAmGTTTAdCdCTmGdCm

GmCmC

ARC524 (serial number: 51)

mGmGmCmGdCdCGdCmGmGTdCTdCmAmGmGdCGmCmUmGmAmGTdCTmGmAmGTTTmAdCdCTmGdC

mGmCmC

ARC525 (serial number: 52)

mGmGmCmGdCdCGdCmGmGTdCmUmCmAmGmGdCGmCmUmGmAmGmUmCmUmGmAmGTTTmAdCdC

TmGdCmGmCmC

ARC532 (serial number: 53)

Biotin-

AGfCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG

ARC543 (serial number: 54)

mGmGfCmGfCfCGfCmGmGfUdCTdCmAmGmGdCGfCfUmGmAmGTdCTmGmAmGfUfUfUAfCfCfUmGfCm

GmCmC

ARC544 (serial number: 55)

mGmGfCmGfCfCGfCmGmGfUmCmUmCmAmGmGmCGfCfUmGmAmGmUmCmUmGmAmGfUfUfUAfCfCfU

mGfCmGmCmC

ARC550 (serial number: 56)

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUmAfCfCfUmGfCmG-

3T

ARC551 (serial number: 57)

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGmCmUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-

3T

ARC552 (serial number: 58)

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGTfUfUAfCfCfUmGfCmG-3T

ARC553 (serial number: 59)

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGmCmUmGmAmGfUfCfUmGmAmGfUfUfUmAfCfCfUmGfCmG-

3T

ARC554 (serial number: 60)

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGmCmUmGmAmGfUfCfUmGmAmGTfUfUmAfCfCfUmGfCmG-

3T

ARC657 (serial number: 61)

20kDa PEG-NH-

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-3T

ARC658 (serial number: 62)

30kDa PEG-NH-

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-3T

ARC672 (serial number: 63)

NH2-

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-3T

ARC706 (serial number: 64)

10kDa PEG-NH-

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-3T

ARC1537 (serial number: 65)

40kDa PEG-NH-

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-3T

ARC1730) (serial number: 66)

PEG20K-NH-

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-NH-

PEG20K

ARC1905 (serial number: 67)

40K PEG-NH--

fCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfUfUfUAfCfCfUmGfCmG-3T

Where the branched 40kDa PEG is 2，3-bis(mPEG-[20kDa])-propyl-1-carbamoyl

ARC243 (serial number: 68)

GGfCGAfUfUAfCfUGGGAfCGGAfCfUfCGfCGAfUGfUGAGfCfCfCAGAfCGAfCfUfCGfCfC

ARC244 (serial number: 69)

GGfCfUfUfCfUGAAGAfUfUAfUfUfUfCGfCGAfUGfUGAAfCfUfCfCAGAfCfCfCfC

The present invention further comprises fit in the following table 2.Fit in the table 2 with 5 ' to 3 ' direction indication, and shown SELEX with dRmY ^TMThe fit ribose sequence of selecting under the condition.Come among the present invention in some embodiments of this selection (in listed sequence, reacting), purine (A and G) be deoxidation and pyrimidine (U and C) 2 '-OMe.The fit medicated cap (for example, 3 '-oppositely dT) that comprises in some embodiments.Fitly in some embodiments comprise a kind of PEG.

Show 2/dRmY to resist-C5 is fit

Serial number	ARCNO	Sequence
				75	ARC913	GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCACAGGCAUACAUACGCAGGGGUCGAUCGAUCGAUCAUCGAUG
76	ARC874	CCUUGGUUUGGCACAGGCAUACAUACGCAGGG
			81	ARC954	CGUUCUACCUUGGUUUGGCACAGGCAUACAUACGCAGGGGUCGAUCG
91	--	GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCCCAGGCAUAUAUACGCAGGGAUUGAUCCGUUACGACUAGCAUCGAUG
			95	--	GGGAGAGGAGAGAACGUUCUACCUUAGGUUCGCACUGUCAUACAUACACACGGGCAAUCGGUUACGACUAGCAUCGAUG
96	--	GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCNCAGGCAUANAUACGCACGGGUCGAUCGGUUACGACUAGCAU

Other of conjugated complement PROTEIN C 5 of the present invention are fit to be described in the following example 3.The fit U.S. Provisional Patent Application 60/544542,60/547747 that further comprises that C5 is special, 60/581685 and 60/608048, its each by all being incorporated in this paper in this citation.

In some embodiments, aptamer therapeutics agent of the present invention has affinity and the specificity bigger to its target, and reduces non-abiogenous nucleoside and replace the side effect that causes when the aptamer therapeutics agent is broken in patient or main body body.In some embodiments, of the present inventionly comprise that fit therapeutic combination does not contain or contain the less nucleoside of fluoridizing.

Of the present inventionly fitly can use in any field known oligonucleotide synthetic technology synthetic, comprise that solid phase oligonucleotide synthetic technology as known in the art (sees, for example, Froehler etc., Nucl.Acid.Res.14:5399-5467 (1986) and Froehler etc., Tet.Lett.27:5575-5578 (1986)) and liquid phase process (see as three ester synthetic methods, for example, Sood etc., Nucl.Acid Res.4:2557 (1997) and Hirose etc., Tet.Lett, 28:2449 (1978)).

The present invention is also included within stable, treat and/or prevent in the method for eye imbalance, with PDGF of the present invention and/or VEGF and/or its homoreceptor PDGFR and VEGFR special fit the associating use anti--C5 medicine.Correspondingly, the method for foregoing description also can be used to prepare of the present invention fit, to suppress combining of aglucon (for example, PDGF or VEGF) and its target such as homology receptor.

Anti--the embodiment that PDGF is fit that uses in the method for the present invention is described in international patent application no PCT '/US2005/039975, filed on November 2nd, 2005, by all being incorporated in this paper, the particularly ARC513 of Miao Shuing in this citation, ARC594, ARC127 and ARC404.

The special fit embodiment of the VEGF that uses in the method for the present invention is described in the United States Patent (USP) series number: 5919455,5932462,6113906,6011020,6051698 and 6147204.For example, with of the present invention anti--the treatment eye imbalance of the medication combined use of C5 fit can be that EYE001 (previous NX1838), particularly pegaptanib with PEGization or non-PEGization receives injection (Macugen , Eyetech Pharmaceuticals, Inc and Pfizer, Inc.NY, NY).

Anti--the C5 antibody drug

Of the present invention resisting-C5 medicine comprises direct antagonist antibody and its application in the treatment of the eye imbalance of C5 mediation at complement protein C5.C5 antagonist antibody of the present invention is closely in conjunction with C5 and prevent its activity and cracking.In the special embodiment, invention comprise to administered anti--C5 antibody to be reducing, at least a symptom, particularly diabetes retinitis of stable and/or prevention eye imbalance, exudative and/or non-exudative AMD symptom.

Antagonist antibody of the present invention comprises that monoclonal suppresses antibody.Monoclonal antibody, or its fragment comprise all immunoglobulin families, as IgM, and IgG, IgD, IgE, IgA, or its subgroup are as IgG subgroup or its mixture.IgG and its subgroup are as IgG ₁, IgG ₂, IgG _2a, IgG _2b, IgG ₃Or IgG _MIgG hypotype IgG.sub.1/kapa and IgG.sub.2b/kapp are included in and use in the embodiment.The fragment that merits attention is the antibody fragment of all flat ends or modification, it has one or two antigen and replenishes binding site, mammal C5 had high combination and neutralization activity, as the part of forming by light chain and heavy chain of having corresponding to the antibody of antibody combining site, as Fv, Fab or F (ab ') 2 fragments, or list-thigh fragment.Flat terminal two-chain fragment such as Fv, Vab or F (ab ') the 2nd, useful especially.These fragments can obtain by enzyme method, as by chemical oxidation or the genetic manipulation by antibody gene, with papain or pepsin the Fc part are removed from antibody.Also can and be advantageously to use genetic mutation, the fragment of non--Ping end.

New antibody, antibody fragment, or the mixture of its derivatives is 1*10 for the binding affinity scope of C5 ^-7M to 1*10 ^-12M, or 1*10 ^-8M to 1*10 ^-11M, or 1*10 ^-9M to 5*10 ^-10M.

The antibody gene that is used for genetic manipulation can be separated from hybridoma by the technical staff.For this purpose, the cell of preparation antibody is cultivated, when cell fully reaches optimum density, by known method guanidinium isothiocyanate cell lysis, sodium acetate acidify, phenol extracting, chloroform/isoamyl alcohol is handled, and isopropanol precipitating is also used washing with alcohol, separating mRNA from cell.Use reverse transcription by the synthetic cDNA of mRNA.Synthetic cDNA can directly or be inserted into behind genetic manipulation, for example, by the variation of site-directly, introduces and inserts, be inverted, and deletion, or base is substituted into suitable animal, fungus, the also expression in suitable hosts tissue of antibacterial or viral vector.Being used for gene clone on antibacterial, as E.coli or yeast, is pBR322 as the useful antibacterial or the yeast vector of expressing in the saccharomyces cerevisiae, pUC18/19, pACYC184, lambda or yeast mu carrier.

The invention further relates to the cell of synthetic C5 antibody.It comprises animal, fungus, bacterial cell or yeast cells after transforming as mentioned above.It is hybridoma or three-way cross oncocyte easily, typically is hybridoma.These hybridomies can be produced, for example, from the animal of C5 immunity, separate its antibody-production B cell with a kind of known method, select the cell of C5-binding antibody and subsequently with these cell fusion, for example, the mankind or animal, for example, mouse melanin tumor cell, human lymphoblastoid's cell or homology hybridoma (are seen, for example, Koehler etc., (1975) Nature 256:496) or with these cells of suitable viral infection with the preparation immortal cell line.By merging the hybridoma cell line for preparing is useful, and mouse hybridoma cell system is useful especially.The useful IgG type antibody of hybridoma cell line secretion of the present invention.MAb antibody of the present invention is with high-affinity conjugated complement PROTEIN C 5 and reduce or its biologic activity that neutralizes (as, the cracking of C5).

The present invention further comprises the derivatives of these anti--C5 antibody, and it keeps C5-and suppresses active, and change one or more with its as other relevant characteristics of pharmaceutical preparation, for example, serum stability or prepare effectiveness.The embodiment of these anti--C5-antibody derivatives comprises polypeptide, the plan peptide of the antigen-calmodulin binding domain CaM of antibody and with solid or liquid-carrier such as Polyethylene Glycol, the bonded antibody of glass, antibody fragment or polypeptide, synthetic polymer such as polyacrylamide, polystyrene, polypropylene, polyethylene or natural polymer such as cellulose, gel or agarose, or enzyme combination, toxin or radioactivity or non-radioactive activity mark, as ³H, ¹²³I, ¹²⁵I, ¹³¹I, ³²P, ³⁵S, ¹⁴C, ⁵¹Cr, ³⁶C1, ⁵⁷Co, ⁵⁵Fe, ⁵⁹Fe, ⁹⁰Y, ⁹⁹MTc, ⁷⁵Se, or covalent bond fluorescence/chemiluminescent labels such as rhodamine, fluorescein, isothiocyanate, phycoerythrin, phycocyanin, fluorescamine, metallo-chelate, avidin, the antibody of streptomycin or biotin, fragment, or polypeptide.

New antibodies, antibody fragment, mixture and its derivatives can combine with above-mentioned carrier, or with other drug after active and auxiliary substance forms pharmaceutical preparation, directly use after drying such as the lyophilizing.The activity of indication and the embodiment of auxiliary substance are other antibody, antibacterial substance such as routine or sulfonamides antibiotic with sterilization and bacteriostatic activity, antitumor drug, water, buffer, salt, ethanol, fat, wax, the conventional substances of inert media or other preparation injections, as aminoacid, thickening agent or sugar.These pharmaceutical preparatioies are used for the treatment of disease, help stablizing, and reduce and/or prevent the generation of the symptom of at least a eye new vessels imbalance and disease, comprise AMD (exudative and/or non--exudative) and diabetes retinitis.

New antibodies, antibody fragment, its mixture or derivatives can with above-mentioned solid or liquid-carrier, enzyme, toxin, radiation or non-radioactive labelling or fluorescence/chemiluminescent labeling connects, and is directly used in treatment or diagnosis.

Human C5 monoclonal antibody of the present invention can obtain by method as known in the art.For example, with human C5 immunity mammal.The human C5 of purification can commercial obtain (for example, Quidel Corporation, San Diego, CA or Advanced Research Technologies, San Diego, CA).Alternatively, human C5 can be from human plasma purification.The mammal of preparation Anti-Human class C5 antibody is unrestricted and can is primates, Rodents (as mice, rat or rabbit), cattle, sheep, goat or Canis familiaris L..

Subsequently, antibody-generation cell such as splenocyte separate from immune animal and merge with the myeloma cell.This hybridoma is well known in the art (for example, p3x63-Ag8-653, NS-0, NS-1 or P3U1 cell).Cell fusion surpasses and can carry out according to any conventional method in this area.

Cell after the cell fusion operation is selected to cultivate in the culture medium to select hybridoma at HAT.Screening produces anti-human monoclonal antibody's hybridoma.Screening can be undertaken by certain methods, for example, sandwich enzyme-Lian immunity absorption process (ELISA) or similar approach, wherein the monoclonal antibody of Chan Shenging combines with the hole of fixing human C5.Under this situation, can use the antibody special to the immunoglobulin of immunized animal, as two anti-, it has enzyme labelling such as peroxidase, alkali phosphatase, glucoseoxidase, beta-D-nougat, or analog.By the color of marker enzyme and its substrate reactions and mensuration generation is measured labelling.Can use substrate, as 3, the 3-diaminobenzidine, 2,2-biphenyl is two-o-two anisidines, 4-chloronaphthalene, 4-amino-antipyrine, o-phenylenediamine or its analog.

By above-mentioned operation, can select to produce the hybridoma of anti--C5 antibody.The hybridoma of selecting is subsequently by conventional restriction dilution process or soft agar method clone.As expectation, clone's hybridoma can use serum-comprise or serum-free medium is cultivated in a large number, or injects mouse peritoneal results ascites, thereby obtains a large amount of clone hybridization tumors.

In Anti-Human's class C5 monoclonal antibody of selecting, those have antibody (for example, in a C5 method system based on cell) selected further analysis and the processing that stops the C5 cracking ability.If antibody suppresses the C5 division, the monoclonal antibody of its meaning test has the minimizing or the active ability of human C5 that neutralizes.Be monoclonal antibody specific recognition and/or interference C5 cracking and activity.

The monoclonal antibody here further comprises hybridization and recombinant antibodies, its by will resist-C5 antibody variable (comprising hypermutation) zone and invariant region are (for example, " humanization "), or light chain and heavy chain, or the chain in a kind of species combines with chain in another species, or different proteic fusion and preparing, do not consider species or the specified immunoglobulin group or the subgroup of originating, and antibody fragment [for example, Fab, F (ab) ₂, and Fv], as long as it shows desired biological activity.[see, for example, U.S. Patent number: 4816567 and Mage ﹠amp; Lamoyi, Monoclonal Antibody technology and application, pp.79-97 (Marcel Dekker, Inc.), New York (1987)].

Like this, the characteristic of the antibody that term " monoclonal " expression is obtained is to derive from abundant homologous antibody cohort, and does not require that the method for any qualification is prepared.For example, the monoclonal antibody of the present invention's use can be passed through Kohler ﹠amp; Milstein, the hybridoma method of at first describing among the Nature 256:495 (1975) preparation maybe can prepare (U.S. Patent number: 4816567) by recombinant DNA method." monoclonal antibody " also can be from McCafferty etc., separates in the phage library of the method preparation that Nature 348:552-554 (1990) describes.

" humanization " form of non--human (for example, mice) antibody is the special immunoglobulin of transforming, immunoglobulin chain or its fragment (as Fv, Fab, Fab, ' F (ab) ₂Or the antigen of other antibody-in conjunction with subsequence), it contains the minimum sequence that derives from non--human immunoglobulin.For the overwhelming majority, humanized antibody is human immunoglobulin (received antibody), the residue in the antibody complement of wherein being received decision zone (CDRs) is had an expectation specificity among the CDRs of non--human species (donations antibody), the residue of affinity and adhesion is replaced, as mice, rat or rabbit.In the certain situation, human immunoglobulin Fv frame area (FR) residue is replaced by the non--human FR residue of correspondence.Further, humanized antibody can comprise not being received antibody and also do not inserting the residue of finding in CDR or the FR sequence.These modify the performance of further improving and optimized antibody.Usually, humanized antibody will fully comprise at least a, typically be two kinds, Variable Area, wherein or have or fully all FR residues are the human immunoglobulin concensus sequences.Humanized antibody also comprises immunoglobulin suitably, typically is at least a portion of human immunoglobulin constant region (Fc).

The humanization method of non--human antibodies is as known in the art.Usually, humanized antibody have one or more non--the insertion amino acid residue of human origin.These non--human amino acid residues are often referred to " insertion " residue, and it typically is positioned at " insertion " Variable Area.Humanization can be according to method (Jones etc., (1986) Nature 321:522-525 of Winter and co-workers; Riechmann etc., (1988) Nature332:323-327; With Verhoeyen etc., (1988) Science 239:1534-1536), by being replaced corresponding human sequence antibody, Rodents CDRs or CDR sequence finish.Corresponding, these " humanization " antibody are chimeric antibodys, wherein fully are less than the corresponding sequence that a kind of complete human Variable Area has been replaced by non--human species.In the practice, humanized antibody is typical human antibodies, and some of them CDR residue is replaced by the residue of the identical little point of Rodents antibody with some FR residues.

Being used for preparing the light chain of humanized antibody and the selection of the human Variable Area of heavy chain is very important for reducing immunogenicity.According to so-called " best-meet " method, the Variable Area sequence of Rodents antibody at the mankind variable-screen in the whole known library of regional sequence.The human sequence who with Rodents similarly is is as people's class framework (FR) (Sims etc., (1993) J.Immunol, the 151:2296 of humanized antibody; With Chothia and Lesk (1987) J.Mol.Biol, 196:901).Other method is used the special framework of the concensus sequence of the specific subgroup derive from everyone antibody-like light chain and heavy chain.Identical framework can be used for several different humanized antibodies (Carter etc., (1992) Proc.Natl.Acad.Sci. (USA), 89:5285; With Presta etc., (1993) J.Immuol, 151:2623).

Humanized antibody keeps being even more important with antigenic high-affinity and other favourable biological natures.For reaching this purpose,,, use the threedimensional model of maternal and humanization sequence to prepare humanized antibody by analyzing the humanization product method of maternal sequence and conceptualization according to a kind of practical approach.Three-dimensional immunoglobulin model can commercially obtain and technical staff in the art in know.Computer program is feasible, and it illustrates and show the possible three-dimensional conformation structure of candidate's immunoglobulin sequences of selection.Provide analysis to the observation of these demonstrations, for example, residue has been influenced the analysis of candidate's immunoglobulin in conjunction with its antigenic capacity the possible function of residue in candidate's immunoglobulin sequences function.In this respect, the FR residue can be selected and be merged with the insertion sequence of making peace, thereby obtains the antibody feature of expectation, as the target antigen affinity that increases.Usually, the CDR residue directly and fully influences antigenic combination.

The present invention also comprises direct human monoclonal antibody at C5.These antibody can prepare by hybridoma method.Preparation human monoclonal antibody's human melanoma and mice-people's allos K-1735 have been described, for example, Kozbor (1984) J.Immunol, 133,3001; Brodeur, etc., Monoclonal Antibody Production Techniques and Applications, pp.51-63 (Marcel Dekke, Inc., New York, 1987); With Boemer etc., (1991) J.Imunol., 147:86-95.

Can prepare transgenic animal (for example, mice) at present, it can under the situation that the disappearance endogenous immunoglobulin is produced, prepare human antibodies completely by immunity.For example, tool is described the inhibition fully that the homozygous deletion of heavy chain of antibody land (J.sub.H) gene in the chimeric and germ line mutation mice causes endogenous antibody to produce.Transform the germ-line that the formation of human germ-line immunoglobulin gene enters mutant mice, will when being subjected to antigenic action, produce human antibodies (see, for example, Jakobovits etc., (1993) Proc.Natl.Acad.Sci. (USA), 90:2551; Jakobovits etc., (1993) Nature, 362:255-258; With Bruggermann etc., (1993) Year in Immuno, 7:33).

Alternatively, phage display technology (McCafferty etc., (1990) Nature, (summary is seen 348:552-553) can be used for from non-immune volunteer's immunoglobulin variable (V) regional gene group external preparation human antibodies and antibody fragment, for example, Johnson etc., (1993) Current Opinion in Structural Biology, 3:564-571).Several V-genetic fragments source can be used for phage and show.For example, Clackson etc., ((1991) Nature 352:624-628) separates from the little combinatorial library at random of V gene that derives from immune mouse spleen cell resisting-oxazolone antibody of multiple arrangement.The V genome that derives from non-immune human volunteer can be fabricated, can separate ((1991) J.Mol.Biol according to the method that Marks etc. describes at the antigenic antibody of different queue (comprise self-antigen), 222:581-597, or Griffith etc., (1993) EMBO J, 12:725-734).

In natural immunity was replied, antibody gene was to assemble sudden change (transition sudden change in the body) at high proportion.The change of some introducings will provide higher affinity, and anti-receiving when the antigen subsequence stimulates, and the B cell of demonstration height-affinity surface immunoglobulin preferentially is replicated and breaks up.Use " chain replacement " technology can exemplary natural process (see Marks etc., (1992) Bio.Technol, 10:779-783).In this method, the affinity of " originally " human antibodies that show to obtain by phage can be improved by heavy chain and light chain V district gene are replaced with the spontaneous generation variant that derives from not immune donor V district gene.Present technique can prepare antibody and the antibody fragment with nM affinity scope.The strategy for preparing very large phage antibody library has been described in Waterhouse etc., ((1993) Nucl.Acids Res, 21:2265-2266).

Gene is replaced and also can be used for obtaining human antibodies from Rodents antibody, and wherein the affinity of human antibodies is similar to the Rodents antibody of beginning with specificity.According to this method, it refers to that also " epi-position branding, " is replaced by human V district gene by the heavy chain and the light chain V district gene of the Rodents antibody of phage display technology acquisition, produces Rodents-human chimeric thing.Can separate antigenic selection can restore functionality antigen-in conjunction with the human variant of little point, for example, the selection of epi-position domination (branding) part.When process repeats when replacing remaining Rodents V district, can obtain human antibodies (see PCT WO on April 1st, 93/06213,1993).Be different from the humanization of the Rodents antibody of common CDR grafting, present technique provides human antibodies completely, and it does not have the framework or the CDR of Rodents.

Can be respectively that Eculizumab (also is Soliris as the anti--monoclonal antibody of C5 medicine and the embodiment of antibody fragment in the method for the invention ^TM, Alexion, cheshire, CT) and Pexelizumab (CT), the both is described in USSN 6355245 for Alexion, cheshire, all is incorporated in this paper at this by quoting from.

The present invention is also included within the method for the present invention, with directly at the antagonist antibodies of PDGF and/or VEGF and its homoreceptor PDGFR and/or VEGFR unite use of the present invention anti--the C5 medicine, with stable, data and/or the imbalance of prevention eye.Accordingly, above-mentioned method can be used to prepare antibody antagonist of the present invention to suppress aglucon (for example, PDGF or VEGF) and its receptor, as the combination of homology receptor.Accordingly, PDGF antagonist antibodies of the present invention comprises direct antibody at PDGF and PDGFR target.

The embodiment of the direct antagonist antibodies at VEGF that uses with anti--C5 medicine friendship ties in the method for the present invention is: the bevacizumab in the U.S. Patent number 6054297 (also is Avastin , Genentech, San Francisco CA), all is incorporated in this paper at this by quoting from; And ranibizumab (also is Lucentis , Genentech, San Francisco, CA).

Antisense and ribozyme resist-the C5 medicine

Of the present invention resisting-C5 medicine comprises antisense oligonucleotide and ribozyme, and it is transcribed by the protein that suppresses messenger RNA or the C5mRNA of directly degraded correspondence suppresses C5.The method of using anti--C5 antisense and the imbalance of ribozyme Drug therapy eye also is provided.In the special action scheme, the present invention includes to administered a kind of anti--method of C5 antisense or ribozyme medicine, reducing, the stable and/or symptom of preventing at least a eye imbalance, diabetic retinopathy particularly, the symptom of exudative and/or non--exudative AMD.

The method of design and synthesising antisense scant nucleotide and ribozyme is well known in the art.Extra reference is provided here.

The method of a kind of design special and effective mRNA-target oligonucleotide (antisense ODN s) and ribozyme be evaluation antisense strand and target mRNA centering near the site (himself be folded into partly self-to secondary structure).Combined calculation machine algorithm predicts RNA butt joint peri position point and molecule scanning can prepare special and effective ribozyme and/or the antisense oligonucleotide at most mRNA targets.Described several method measure target RNA molecule to antisense or ribozyme mortifier near the site.A kind of method applications exploiting antisense oligodeoxynucleotideresulted as much as possible is carried out in-vitro screening method and (is seen Monia etc., (1996) Nature Med, 2:668-675; With Milner etc., (1997) Nature Biotechnol, 15:537-541).Another kind then utilizes ODNs random library (Ho etc., (1996) Nucleic Acids Res, 24:1901-1907; Birikh etc., (1997) RNA3:429-437; With Lima etc., (1997) J.Biol, Chem, 272:626-638).Can (see Birikh etc., supra by Rnase H cracking supervision near the site; With Ho etc., (1998) Nature Biotechnol, 16:59-63).Rnase H stimulates the hydrolysis of RNA chain phosphoric acid skeleton in the DNA-RNA two strands.

In the another kind method, comprise and use half-at random that the ODNs of chimeric chemosynthesis set is identified near the site with RNase H cracking synthetic RNA target by external.Lima etc. (is seen, supra) in these sites that primer extension analysis is used in the target molecule.The method of another designated rna antisense target is based on the folding model of area of computer aided RNA.Published several uses at random the effective cracked report of ribozyme library screening (see Campbell etc., (1995) RNA1:598-609; Lieber etc., (1995) Mol.Cell Biol, 15:540-551; With (1997) Biochem such as Vaish, 37:6459-6501).

Other in vitro method, its utilize at random or half-at random ODNs library and RNaseH than computer simulation more useful (Lima etc., supra).Yet, use external synthetic RNA can not predictor in the proximity of antisense ODSs, because the present annealing reciprocal action that studies show that the poly oligonucleotide can be subjected to that RNA-is conjugated protein to be influenced and (sees Tsuchihashi etc., (1993) Science, 267:99-102; Protman etc., (1994) EMBO J, 13:213-221; With Bertrand and Rossi (1994) EMBO J, 13:2904-2912).U.S. Patent number 6562570 is measured when the cell extract that has simulated in vivo environment is provided among the mRNA near the compositions and the method in site, and it is by being incorporated in this paper in this citation.

Concise and to the point, this method comprises antisense ODN natural or external synthetic RNA and evaluation, ribozyme, or the DNA enzyme, or at random or half-at random ODN, ribozyme, or DNA enzyme library, contain the protein-bonded cell extract of endogenous RNA-comprising, or the containing in the protein-bonded reaction medium of one or more RNA-of analog cell extract, under hybridization conditions, hatch altogether.Any and target RNA near the complementary antisense ODN in site, ribozyme, or the DNA enzyme will combine with this site.When the ODN that uses evaluation or an ODN library, RNase H exists when hybridization, or adds after hybridization, with the RNA of cracking hybridization.RNase H can exist when using ribozyme or DNA enzyme, but because the also RNA of cleavable hybridization of ribozyme and DNA enzyme, so it is optional.Under the certain situation, use to comprise endogenous mRNA, in the cell extract of the conjugated protein and RNase H of RNA-at random or half-at random ODN library.

Subsequently, several different methods can be used to identify that target RNA goes up in conjunction with antisense ODS, and ribozyme or DNA enzyme also cracked site take place.For example, the polymerase chain reaction of terminal deoxynucleotidyl transferase-dependence (TDPCR) can be used for this purpose and (sees Komura and Riggs (1998) Nucleic Acids Res, 26:1807-11).Along with TDPCR, reverse transcription step is used for changing RNA into DNA.Among the present invention, the 3 ' end that the TDPCR method needs is by the archaeal dna polymerase (for example, reverse transcription) that uses any suitable R NA to rely on target RNA reverse transcription to be prepared.This is by obtaining being studied portion downstream position (for example, 5 ' to 3 ' direction on the RNA molecule) area hybridization among an ODN primer (PI) and the RNA.Polymerase is terminal to P1 direction repetition DNA with 3 ' with RNA when containing dNTP, and by antisense ODN/RNase H, the cracking site that ribozyme and DNA enzyme produce stops.New dna molecular (referring to first chain here) is as first template of the PCR part of TDPCR, and it is used to identify accordingly can be near target sequence on the RNA.

For example, the TDPCR method also can be used for, and for example, the reverse transcription DNA (rGTP) that has GTP (guanosine triphosphate) reacts when having terminal deoxynucleotidyl transferase (TdT), at (rG) 2-4 tail of dna molecular 3 ' terminal adding.Link crosslinkedly with double-stranded ODN subsequently, it has one and hangs with 3 ' 2-4 of (rG) 2-4 tail base pair on a chain.Add two PCR primers subsequently.Article one, be to connect primer (LP), itself and the TDPCR connection chain complementation (referring to lower chain sometimes) that combines (rG) 2-4 tail.Another primer (P2) can be identical with P1, but also can be nested with P1, for example, its can with the regional complementarity on the target RNA, it is positioned at the downstream (for example, 3 ' to 5 ' direction on the RNA molecule) of P1 calmodulin binding domain CaM at least in part, but it should be in the downstream of the target RNA molecular domains of studying.Research measures whether have can be near the part in site on the target RNA molecule, is the part that is positioned at P2 complementary region downstream.According to known method, carry out PCR when having archaeal dna polymerase and dNTPs, with the dna fragmentation of amplification by LP and P2 definition.Amplified production can be caught and checks order on the automated DNA sequenator subsequently by any known method, and the cracking site of explication is provided.Identify in case carried out this, can in external or body, synthesize the antisense DNA or the ribozyme of defined nucleotide sequence.

Can use synthetic Antisensedigonucleotsequence sequence to the expression of specific gene interfere (see, for example, Lefebvre-d ' Hellencourt etc., (1995) Eur.Cyokine New, 6:7; Agrawal (1996) TIBTECH, 14:376; With Lev-Lehman etc., (1997) Antisense Therap.Cohen and Smicek wait (Plenum Press, NewYork)).Concise and to the point, Antisensedigonucleotsequence sequence can be the short sequence of DNA, typically is the 15-30 nucleoside, but can less than 7 nucleoside (see Wagner etc., (1994) Nature, 372:333), its design and the complementary RNA:AS complex that also forms of target mRNA.This composite form can stop the submission of corresponding mRNA, splicing, lawsuit or translation.In addition, can irritation cell RNase H activity during specific AS nucleotide sequences and its target mRNA hybridization, cause the degraded of mRNA (to see (1996) Semin.Oncol such as Calabretta, 23:78).Under this situation, RNase H is with the part of the RNA in the cracking complex and may discharge more AS and extra target RNA molecular hybridization.The interactive extra active result of AS and genomic DNA forms to make the triple helices structure of transcribing inactivation.

In a non-limiting example, outside above-mentioned antisense sequences, can use ribozyme, or replace inhibition gene function as additional.When antisense therapy was subjected to stoichiometry to consider restriction, it was special needs.Can use ribozyme at identical sequence.Ribozyme is a kind of RNA molecule, and the engagement capacity of its domination RNA carries out cracking at the specific site of target RNA.Quantity by the cracked RNA molecule of ribozyme (is seen Hampel and Tritz (1989) Biochem, 28:4929-33 greater than the 1:1 stoichiometry of prediction; And Uhlenbeck (1987) Nature, 328:596-600).Therefore, the present invention also can use at PDGF or VEGF mRNA accessible areas and contain the ribozyme sequence at suitable contact center.According to preparing with method as known in the art and the conveying ribozyme of further describing here.Ribozyme can be united use with antisense sequences.

The cracking of ribozyme catalysis RNA phosphate ester chain.Several ribozyme structure family is identified, comprise group I intron, RNase P, delta hepatitis virus ribozyme, the hammerhead ribozyme and the hair fastener ribozyme that derive from the artificial RNA of tobacco mosaic virus (TMV) (sTRSV) minus strand (are seen Sullivan (1994) Investig.Dermatolog, (Suppl.) 103:95S; With U.S. Patent number 5225347).Latter two family derives from viroid and virusoid, and wherein ribozyme is considered to be separated into monomer by oligomer and (see Symons (1989) TIBS, 14:445-50 in the production process of rotation recursive copying; Symons (1992) Ann.Rev.Biochem, 61:641-71).Tup and hair fastener ribozyme die body are best suited for for the trans shearing of mRNA gene therapy.Ribozyme among the present invention is with the choice of technology as known in the art.The hair fastener ribozyme is known in clinical practice and is useful especially type.Usually ribozyme is a 30-100 nucleoside length.

When the ribozyme that uses cracking mRNA on the specific recognition sequence of site during with the specific mRNA of cracking, the use of hammerhead ribozyme is useful especially.Hammerhead ribozyme is forming the right flank region position cracking mRNA of complementary base with target mRNA.Crucial part is that target mRNA has following two base sequence: 5 '-UG-3.' hammerhead ribozyme structure and preparation is well known in the art and more detailed description see Haseloff and Gerlach ((1988) Nature, 334:585).

Ribozyme of the present invention comprises that also the RNA endonuclease (is " Cech-type ribozyme ") here, as like abiogenous in the warm tetrahymena (IVS, or L-19IVS RNA), it is further described in Thomas Cech and the partner (sees Zaug etc., (1984) Science, 224:574-578; Zaug and Cech (1986) Science, 231:470-475; Zaug waits (1986) Nature, 324:429-433; International patent application no W088/04300; Been and Cech (1986) Cell, 47:207-216).Cech-type ribozyme has the avtive spot of eight base pairs, and the cracking of target RNA takes place after this site for itself and target RNA sequence hybridization.The present invention includes these Cech-type ribozymes, it is at eight base pair avtive spot sequences.The present invention does not limit the operation mechanism theory of specific language, use hammerhead ribozyme of the present invention to have to surmount the advantage of use at-PDGF/VEGF antisense strand, present report shows that hammerhead ribozyme works by the specific cleavage that suppresses RNA translation and/or mRNA target.

In translation chain scheme, ribozyme can be regulated modified oligonucleotide (for example, improve stability, specific aim, etc.) and be transported to the cell of expressing target mRNA.A kind of useful carrying method is to use the dna structure of " coding " ribozyme that is subjected to strong polIII or the control of polII promoter, thereby makes transformant produce the ribozyme of sufficient amount to destroy the target courier and to suppress its translation.Because ribozyme is different from antisense molecule, be catalytic, so its effect only needs lower IC.

As mentioned above, the nuclease resistance, when it needs, can provide by any method as known in the art, and influence the biologic activity (Iyer etc. of in the use of needs and carrying method antisense dna oligo or ribozyme deficiently, (1990) J.Org.Chem, 55:4693-99; Eckstein (1985) Ann.Rev.Biochem, 54:367-402; Spitzer and eckstein (1998) Nucleic Acids Res, 18:11691-69; With Shaw etc., (1991) Nucleic Acids Res, 18:11691-704).As above about fit description, can carry out antisense oligonucleotide or ribozyme, comprise phosphorus in the phosphoric acid skeleton and oxygen atom are modified, shorten the inner sugar chain of chain-like alkyl or cyclic alkyl or shorten the chain heterocycle or the inner sugar chain of heterocycle with non--restricted representative modification that strengthens the nuclease resistance.Comprise, for example, preparation 2 '-fluoridize, O-methylates, methyl acid phosphate esterification, phosphorothioate, phosphordithiic acid esterification and morpholine oligomer.For example, can between 3 ' terminal 4 to 6 nucleoside thiophosphate to take place crosslinked for antisense oligonucleotide or ribozyme.Alternatively, thiophosphate is crosslinked can connect all nucleoside.The phosphorothioate antisense oligonucleotide does not show tangible toxicity under valid density, and in animal, show the sufficient pharmacokinetics half-life (see Agarwal etc., (1996) TIBTECH, 14:376) and tool ribozyme resistance.Alternatively, the ribozyme resistance of AS-ODN can be provided by 3 '-9 terminal nucleoside ring-shaped sequence CGCGAAGCG.Use anti--biotin association reaction also can be used to improve AS-ODN and (see Boado and Pardridge (1992) Bioconj.Chem, 3:519-23) for the protection of serum ribozyme degraded.According to this theory, the AS-ODN medicine is that 3 '-terminal list is biotinylated.When with biotin reaction, that its formation is higher than is non--in conjunction with 6 times of ODN stability closely, the complex of ribozyme-resistance.

Other researchs have shown the interior scope (Agarwal etc., (1991) Proc.Natl.Acad.Sci. (USA) 88:7595) of the body of antisense oligonucleotide.This process is predicted as the useful purge mechanism of removing allos AS-oligonucleotide from circulation, depends on free 3 '-terminal existence on the oligonucleotide of contact.So the partial thiophosphate in this important site, ring protection or anti--biotin will fully be guaranteed these AS-oligodeoxynucleotide.

Use as mentioned above outside the modified base, also can prepare nucleoside analog, wherein the structure of nucleoside by radical change and be suitable for as the treatment or trial drug.An embodiment of nucleoside analog is many nucleic acid (PNA), and wherein deoxyribose (or ribose) the phosphoric acid skeleton among the DNA (or RNA) replaces with polyamide backbone, its with in polypeptide, found similar.The PNA analog has shown the resistance to enzymatic degradation, and can be in vivo and external long-term existence.Further, PNA is better than dna molecular with combining of complementary dna sequence according to the show.This phenomenon is owing to PNA chain and the ion exclusion of DNA interchain disappearance.Other can comprise polymeric skeleton to the modification that oligonucleotide carries out, and the morpholine polymeric skeleton (is seen, for example, U.S. Patent number 5034506, it is by being incorporated in this paper in this citation), cyclic skeleton, or acyclic skeleton, sugar analogue or other can improve the modification of oligonucleotide pharmacokinetic properties.

Additional aspect of the present invention relates to uses the DNA enzyme to reduce the expression of target mRNA, and for example, the C5 enzyme has been integrated the mechanism characteristic of antisense strand and ribozyme technology.The DNA enzyme of design can be discerned specific target nucleic acid sequence, is similar to antisense oligonucleotide, also is similar to ribozyme, can contact and special cracking target nucleic acid.

Two kinds of DNA enzyme fundamental types are arranged at present, and it all identifies (see, for example, U.S. Patent number 6110462) by Santoro and Joyce.The 10-23DNA enzyme comprises the loop configuration that connects two arms.Two arms provide the specificity of identification specific objective nucleotide sequence, and loop configuration provides the function of the contact under physiological condition.

Briefly, be the DNA enzyme of design specific recognition and cracking target nucleic acid, those of skill in the art must at first identify unique target sequence.Can realize by using the method for listing in the antisense oligonucleotide.Under the particular case, unique or sufficient sequence is the sequence that is rich in 18 to 22 nucleoside of G/C.High G/C content is guaranteed the strong bonded of DNA enzyme and target sequence.

When synthetic dnase, location enzyme and courier's specific antisense recognition sequence is divided, and makes it comprise two arms of DNA enzyme, and the annular of DNA enzyme is between two special arms.

Preparation and the method for using the DNA enzyme see, for example, and U.S. Patent number 6110462.The method of conveying DNA enzyme comprises the method for conveying RNA enzyme described here in external or body.In addition, those of skill in the art can recognize, are similar to antisense oligonucleotide, and the DNA enzyme can be modified suitably to increase stability and to improve degradation-resistant.

The present invention also comprise unite use of the present invention anti--the C5 medicine, with antisense strand at PDGF and/or VEGF, ribozyme and/or DNA enzyme medicine, stable, treat and/or prevent the method for eye imbalance.Accordingly, above-mentioned method can be used to prepare antisense strand, and ribozyme and/or DNA enzyme medicine suppress or stop PDGF and/or vegf expression with of the present invention resisting-C5 medicine.

Anti--the C5RNAi medicine

Embodiments more of the present invention use RNA to interfere the material of (RNAi) and the expression of method affect C5.Accordingly, of the present invention resisting-C5 medicine comprises anti--C5RNAi medicine.Present invention resides in the method that the present invention treats eye imbalance and use anti--C5RNAi medicine.In the special embodiment, the present invention includes to administered anti--the C5RNAi medicine to be reducing, at least a symptom, particularly diabetes retinitis in the stable and/or prevention eye imbalance, exudative and/or non--the exudative AMD symptom.

RNAi is the sequence-special posttranscriptional gene process of inhibition that takes place in the eukaryotic cell.Usually, this process comprises the degraded by the particular sequence mRNA of the double-stranded RNA (dsRNA) of sequence homology mediation.For example, corresponding to the expression of the long dsRNA of specific strand mRNA (ssmRNA) this courier that will degrade, thus the expression of " interference " corresponding gene.Accordingly, the gene of any selection can suppress by introducing corresponding to this gene mRNA dsRNA whole or fully part.When expressing long dsRNA, it at first is degraded to the short dsRNA oligonucleotide of 21 to 22 base pair length by nuclease III according to the show.Accordingly, RNAi can work by the expression of introducing or corresponding short homology dsRNAs.In fact, as described belowly use corresponding short homology dsRNA and have specific advantage.

Mammalian cell has the approach that influences of at least two kinds of double-stranded RNAs (dsRNA).In RNAi (sequence-specific) approach, as mentioned above, initial dsRNA at first breaks and is short (si) RNA of interference.SiRNA has the justice and the antisense strand of about 21 nucleoside, is formed on the siRNA that each 3 ' end has two outstanding about 19 nucleoside.Short intervening rna is considered to provide sequence information, makes specific messenger RNA location degrade.On the contrary, non-specific approach has the dsRNA of any sequence to cause, as long as it is at least 30 base pair length.Non-specific response be because dsRNA has two kinds of enzymatic activity: PKR (double-stranded RNA-activated protein kinase), its activity form can make transcription initiation silver eIF2 phosphorylation synthetic to stop all proteins, and 2; 5 ' oligo-adenylate synthetase (2; 5 '-AS), its synthetic molecule that activates RNase L, it is a kind of enzyme at all mRNA.Non-special approach can represent the host to the replying of pressure or viral infection, and, usually, be minimized in the nonspecific effect approach specific using method in the present invention.Significantly, normal dsRNA is essential for causing unrestricted approach, and is corresponding, be shorter than gene inhibition that the dsRNA of 30 base pairs causes for RNAi and be useful especially (see, for example, Hunter etc. (1975) J.Biol.Chem, 250:409-17; Manche etc., (1992) Mol.Cell Biol, 12:5239-48; Minks etc., (1979) J.Biol.Chem, 254:10180-3; With Elbashir etc., (2001) Nature, 411:494-8).

Its length of specific double chain oligonucleotide that is used for RNAi is less than 30 base pairs, and can comprise 25,24,23,22,21,20,19,18 or 17 base pairs.Suitably, dsRNA oligonucleotide of the present invention can comprise 3 ' protruding terminus.Non--restricted exemplary 2-nucleoside 3 ' is outstanding can comprise any kind nucleoside and even can comprise 2 '-deoxythymidine residue, it can be made a price reduction the synthetic expense of RNA and strengthen the nuclease resistance of siRNA in cell culture medium and transformant and (see Elbashi etc., (2001) Nature, 411:494-8).

Also can use longlyer in the particular of the present invention, be 50,75,100 or even 500 base pairs or longer dsRNA.Effectively the exemplary concentration of RNAi is about 0.04nM, 0.1nM, 0.5nM, 1.0nM, 1.5nM, 25nM or 100nM, though according to the naturality of processing cell, at gene can be used other concentration by the factor that the technical staff discerns with other.Exemplary dsRNA can by chemosynthesis or the use suitable expression vector be external or body is interior synthetic.Exemplary synthetic RNA comprises the RNA (for example, quickening orthophosphite RNA and orthophosphite thymidine (Proligo, Germany)) of 21 nucleoside that use method chemosynthesis as known in the art.Can use in this area method to oligonucleotide Deproteinization and gel-purified (see, for example, E1bashir etc., (2001) Genes Dev, 15:188-200).Longer RNA can only use promoter as known in the art, as the t7 rna polymerase promoter transcription.Single RNA target is positioned at two possible directions in external promoter downstream, and two chains will transcribing out target are to produce the dsRNA oligonucleotide of desired destination sequence.

The particular sequence that is used for design oligonucleotides can be target gene (for example, any adjacent nucleotide sequences of expressing in C5).Program as known in the art and algorithm can be used to select suitable target sequence.In addition, as mentioned above, utilize the program of the specific single-chain nucleic acid sequence secondary structure of design prediction, make selection can betide those sequences that expose the strand zone among the folding mRNA, can select optimized sequence.The method and composition that designs suitable oligonucleotide as seen, for example, U.S. Patent number 6251588, it is incorporated in this paper by citation at this.MRNA is considered to linear molecule usually, contains the synthetic information of albumen in its RNA sequence.Research has shown and has had a large amount of secondarys and tertiary structure among many mRNA.RNA secondary structure element is mainly formed by the Watson-Crick type reciprocal action of the zones of different of identical RNA molecule.Important structural element comprises double-stranded region in the cell, hair fastener winding, double-stranded RNA ledge and internal loopback.When the secondary structure element is in contact with one another or forms tertiary structure with primary structure, produce more complicated three-Wei structure.Many researchs after measured a large amount of RNA composite constructions in conjunction with energy and amplify out many rules that can be used to predict the RNA secondary structure (see, for example, Jaeger etc., (1989) Proc.natl.Acad.Sci. (USA) 86; 7706 (1989); With Turner etc., (1988) Ann.Rev.Biophys.Biophys.Chem, 17:167).This rule can be used for identifying the RNA structural element, and, particularly, identify the single stranded RNA zone, its can represent mRNA at reticent RNAi, the useful especially fragment of ribozyme or antisense technology.Accordingly, the specific fragment of mRNA target can be identified the dsRNA oligonucleotide that mediates with designated rna i and be designed suitable ribozyme of the present invention and hammerhead ribozyme compositions.

The dsRNA oligonucleotide can use carrier compositions, as liposome, the external source target gene is transformed into cell, it is well known in the art, for example, and Lipofectamine 2000 (Life Technologies, Rockville Md.), the bonding cell line of describing as manufacturer.The conversion of the dsRNA oligonucleotide of Eastern Wei Dynasty's endogenous gene can use Oligofectamine to carry out (Life Technologies).Transformation efficiency can use the hGFP of in mammal cell line cotransformation coding pAD3, by fluorescence microscope detect (Kehlenback etc., (1998) J.Cell.Biol, 141:863-74).The efficient of RNAi can be used any mensuration in the several different methods that guides dsRNA.It includes, but are not limited to, new albumen is synthetic suppressed after, use the antibody of recognition objective gene outcome, carried out Western blot analyzes and Northern blot analyzes to measure the level that exists of target mRNA the endogenous library sufficient reacting time.

The additional set compound of the RNAi technology that the present invention uses, methods and applications are seen U.S. Patent number 6278039,5723750 and 5244802, it is incorporated in this paper by citation at this.

The present invention is also included within and unites in the method for the present invention the RNAi medicine and of the present invention the resisting-the C5 medicine of using PDGF and/or VEGF to suppress, and with stable, treats and/or prevents the eye imbalance.Accordingly, above-mentioned method can be used to prepare with of the present invention anti--the inhibition PDGF of C5 drug combination and/or the RNAi medicine of VEGF.

Anti--C5 albumen and poly-peptide

In embodiments more of the present invention, anti--the C5 medicine is a kind of protein or poly-peptide.The present invention includes the method for using anti--C5 albumen or the imbalance of poly-peptide Drug therapy eye.In the special embodiment, present invention resides in minimizing, stable and/or prevent at least a eye diagonosis of disorder, particularly diabetes retinitis, in the method for exudative and/or non--exudative AMD symptom to main body use a kind of anti--C5 albumen or poly-peptide medicine.

For example, TP10 (Avant Imunotherapeutics, Inc.Needham, MA), a kind of solubility branch's complement receptors type i and anti--C5 albumen or poly-peptide medicine, it is described in U.S. Patent number 5212071,5252216,5256642,5456909,5472939,5840858,5856297,5858969,5971481,6057131,6169068 and 6316604, its each all be incorporated in this paper by citation at this, can be used for method of the present invention.APT070 (also is Mirococept , Inflazyme Pharmaceuticals, LTD, Richmond, B.C. Canada) and can be used for method of the present invention.

The present invention is also included within to unite in the method for the present invention and uses protein and/or poly-peptide to resist-PDGF and/or anti-VEGF medicine and of the present invention resisting-the C5 medicine, with stable, treats and/or prevents the eye imbalance.

Micromolecule resists-the C5 medicine

In embodiments more of the present invention, anti--the C5 medicine is a kind of micromolecule, particularly little organic molecule.Present invention resides in and use anti--C5 small-molecule drug in the method for the treatment of the eye imbalance.In the special embodiment, present invention resides in minimizing, stable and/or prevent at least a eye diagonosis of disorder, particularly diabetes retinitis, in the method for exudative and/or non--exudative AMD symptom to main body use a kind of anti--the C5 small-molecule drug.

The present invention is also included within to unite in the method for the present invention and uses micromolecule to resist-PDGF and/or anti-VEGF medicine and of the present invention resisting-the C5 medicine, with stable, treats and/or prevents the eye imbalance.For example, of the present invention resisting-C5 medicine can be in anti--PDGF medicine Imatinib Mesylate (Gleevec , Novartis Pharmaceuticals, Inc.East Hanover NJ) unites use.Of the present invention anti--the C5 medicine also can with the medication combined use of anti-VEGF, as sorafenib (Nexava Onyx Pharmaceticals, Inc.Emeryville, CA and B ayer Pharmaceuticals Corportion, West Haven, CT); Sunitnabmalate (Sutent , Pfizer, Inc.NY, NY).

Anti--the C3 medicine

In some embodiments, material of the present invention comprises that it is functionally regulated with a series of aptamers of high-affinity conjugated complement PROTEIN C 3, for example, stops, in the complement protein C3 body and/or the activity of cell base method.These are fit to provide low-toxicity, safety, method of the present invention with effective adjusting, with treatment, stable and/or prevent multiple complement-relevant ocular disease or imbalance, comprise, for example, eye acute or chronic inflammatory disease and/or immunity-mediation is lacked of proper care, struvite conjunctivitis comprises the anaphylaxis macropapillary conjunctivitis, macular edema, uveitis, endophthalmitis, scleritis, cornea festers, xerophthalmia, glaucoma, diabetic retinopathy, corneal graft rejection, the complication that operated eye is relevant, the inflammation relevant with cataract operation as the intraocular lens implants, Behcet ' s disease, immune compound vasculitis, Fuch ' s disease, the Xiao Liu Harada disease, Asian TV Station's postretinal fiberization, keratitis, vitreous body-retinitis, eye parasitic infection/transfer, the degeneration of color retinal pigment, cytomegalovirus retinitis, choroiditis, degeneration of macula, age related macular degeneration (" AMD "), non--exudative (" dryness ") AMD, or the imbalance of eye neovascularization, comprise diabetes retinitis or exudative (" wetting ") AMD.These are fit also can to use in eye diagnosis.

These are fit also can to comprise modification described herein, for example, (for example, PEG) connects, integrates the medicated cap group, integrate modified nucleoside, and the phosphoric acid skeleton is modified with lipotropy or high-molecular weight compounds.

In one embodiment of the invention, provide isolating, non--abiogenous fit in conjunction with the C3 complement protein.In another embodiment, provide in the method for the invention and to have used, with treatment, that eye stable and/or prevention complement-mediation is lacked of proper care is isolating, non--abiogenous fit in conjunction with the C3 complement protein.In some embodiments, the dissociation constant (" Kd ") of isolating, non--abiogenous fit and C3 complement protein is less than 100 μ M, less than 1 μ M, less than 500nM, less than 100nM, less than 50nM, less than 1nM, less than 500pM, less than 100pM, less than 50pM.In embodiments more of the present invention, dissociation constant is to measure with the burl dyeing titration method of describing in the following example 2.

In another embodiment, the function of the aptamer regulated C3 complement protein that uses among the present invention particularly suppresses C3 complement protein function and/or C3 complement protein variant function.C3 complement protein variant used herein comprises the variant of carrying out with the abundant similar functions of C3 complement protein.C3 complement protein variant fully comprises identical structure suitably, and compare with the aminoacid sequence of the C3 complement protein that comprises following amino acid sequences in some embodiments, comprise at least 80% sequence identity, more suitably comprise at least 90% sequence identity, comprise at least 95% sequence identity with being more suitable for, De Bruijn, MH and Fey, GH (1985) human complement composition C3:cDNA coded sequence and derivation primary structure.Proc Natl Acad Sci USA 82，708-12。

Fit U.S. Patent Application Serial 6140490,6395888 and 6566343 of being further described in of other conjugated complement PROTEIN C 3 of the present invention, its each by all being incorporated in this paper in this citation.

Anti--Clq is fit

In some embodiments, material of the present invention comprises that it is functionally regulated with a series of aptamers of high-affinity conjugated complement PROTEIN C lq, for example, stops, in the complement protein Clq body and/or the activity of cell base method.

These are fit to provide low-toxicity, safety, method of the present invention with effective adjusting, with treatment, stable and/or prevent multiple complement-relevant ocular disease or imbalance, comprise, for example, eye acute or chronic inflammatory disease and/or immunity-mediation is lacked of proper care, struvite conjunctivitis comprises the anaphylaxis macropapillary conjunctivitis, macular edema, uveitis, endophthalmitis, scleritis, cornea festers, xerophthalmia, glaucoma, diabetic retinopathy, corneal graft rejection, the complication that operated eye is relevant, the inflammation relevant with cataract operation as the intraocular lens implants, Behcet ' s disease, immune compound vasculitis, Fuch ' s disease, the Xiao Liu Harada disease, Asian TV Station's postretinal fiberization, keratitis, vitreous body-retinitis, eye parasitic infection/transfer, the degeneration of color retinal pigment, cytomegalovirus retinitis, choroiditis, degeneration of macula, age related macular degeneration (" AMD "), non--exudative (" dryness ") AMD, or the imbalance of eye neovascularization, comprise diabetes retinitis or exudative (" wetting ") AMD.These are fit also can to use in eye diagnosis.

These are fit also can to comprise modification described herein, for example, (for example, PEG) connects, integrates the medicated cap group, integrate modified nucleoside, and the phosphoric acid skeleton is modified with lipotropy or high-molecular weight compounds.

In one embodiment of the invention, provide isolating, non--abiogenous fit in conjunction with the Clq complement protein.In another embodiment, provide in the method for the invention and to have used, with treatment, that eye stable and/or prevention complement-mediation is lacked of proper care is isolating, non--abiogenous fit in conjunction with the Clq complement protein.In some embodiments, the dissociation constant (" Kd ") of isolating, non--abiogenous fit and Clq complement protein is less than 100 μ M, less than 1 μ M, less than 500nM, less than 100nM, less than 50nM, less than 1nM, less than 500pM, less than 100pM, less than 50pM.In embodiments more of the present invention, dissociation constant is to measure with the burl dyeing titration method of describing in the following example 2.

In another embodiment, the function of the aptamer regulated Clq complement protein that uses among the present invention particularly suppresses Clq complement protein function and/or Clq complement protein variant function.Clq complement protein variant used herein comprises the variant of carrying out with the abundant similar functions of Clq complement protein.Clq complement protein variant fully comprises identical structure suitably, and compare with the aminoacid sequence of the Clq complement protein that comprises following amino acid sequences in some embodiments, comprise at least 80% sequence identity, more suitably comprise at least 90% sequence identity, comprise at least 95% sequence identity with being more suitable for, Sellar, GC, Blake, DJ and Reid, the A-of KB (1991) coding human complement subcomponent Clq, the gene expression characteristics and the structure of B-and C-chain.The complement that human Clq aminoacid sequence derives from.BiochemJ.274，481-90。

Fit U.S. Patent Application Serial 6140490,6395888 and 6566343 of being further described in of other conjugated complement PROTEIN C lq of the present invention, its each by all being incorporated in this paper in this citation.

In some embodiments of aptamer therapeutics agent of the present invention, comprise anti--C5, C3 and/or Clq have affinity and the specificity bigger to its target, and reduce non-abiogenous nucleoside and replace the side effect that causes when the aptamer therapeutics agent is broken in patient or main body body.

Of the present invention resisting-complement is fit, comprise of the present invention resisting-C5, C3 and/or C1q are fit, can use in any field known oligonucleotide synthetic technology synthetic, comprise that solid phase oligonucleotide synthetic technology as known in the art (sees, for example, Froehler etc., Nucl.Acid.Res.14:5399-5467 (1986) and Froehler etc., Tet.Lett.27:5575-5578 (1986)) and liquid phase process (see, for example as three ester synthetic methods, Sood etc., Nucl.Acid Res.4:2557 (1997) and Hirose etc., Tet.Lett, 28:2449 (1978)).

The present invention is also included within stable, treat and/or prevent in the method for eye imbalance, with special fit of PDGF of the present invention and/or VEGF and/or its homoreceptor PDGFR and VEGFR unite use of the present invention anti--complement is fit (comprise anti--C5, C3 and/or Clq are fit).

Anti--the embodiment that PDGF is fit that uses in the method for the present invention is described in international patent application no PCT '/US2005/039975, filed on November 2nd, 2005, by all being incorporated in this paper, the particularly ARC513 of Miao Shuing in this citation, ARC594, ARC127 and ARC404.

The special fit embodiment of the VEGF that uses in the method for the present invention is described in the United States Patent (USP) series number: 5919455,5932462,6113906,6011020,6051698 and 6147204.For example, with of the present invention anti--treatment eye imbalance fit that complement is fit unites use can be that EYE001 (previous NX1838), particularly pegaptanib with PEGization or non-PEGization receives injection (Macugen , Eyetech Pharmaceuticals, Inc and Pfizer, Inc.NY, NY).

Pharmaceutical composition

The present invention also comprises the fit molecule, particularly conjugated complement PROTEIN C 5 of the pharmaceutical composition, particularly conjugated complement PROTEIN C 5 that contain a kind of resisting-C5 medicine and stops it cracked fit.In some embodiments, in compositions is suitable for and comprise the active constituents of medicine of the present invention of effective quantity, it can individualism or unites one or more drug acceptable carriers.If this chemical compound has toxicity, then be low-down, make it particularly useful.

Compositions of the present invention can be used for the treatment of or prevent a kind of pathology, as a kind of disease or imbalance, or reduces the slight illness of these diseases among the patient or diagonosis of disorder.For example, compositions of the present invention can be used for the treatment of or prevent complement-relevant heart imbalance (for example, myocardial damage; The complication of the C5 mediation that bypass operation of coronary artery (CABG) is relevant, as postoperative hemorrhage, neutrophil cell and leukocyte activity increase the danger of myocardial infarction and cognitive disorders; Narrow; The complement complication of the C5 mediation relevant) with percutaneous coronary intervention (pci), ischemical reperfusion injury (for example, myocardial infarction, apoplexy, cold injury), complement-relevant inflammation imbalance (for example, asthma, arthritis, repel after pyemia and the organ transplantation), with the Autoimmune Disorders of complement-relevant (for example, myasthenia gravis, systemic lupus erythematosus (sle) (SLE), pneumonia, external complement activity, the ocular disease that antibody-mediated complement activity is relevant with complement, as diabetes retinitis and the age-relevant degeneration of macula (AMD).In the special embodiment, compositions of the present invention is used for reducing, and eye stable and/or prevention C5-mediation is lacked of proper care, and particularly diabetes retinitis is exudative and/or non--exudative AMD.

In some embodiments, compositions of the present invention can be used to stablize, and treats and/or prevents the pathology among the patient, as ocular disease or imbalance.For example, compositions of the present invention can be used to stablize, and treats and/or prevents the relevant eye imbalance of complement, as: eye acute or chronic inflammatory disease and/or immunity-mediation is lacked of proper care, and struvite conjunctivitis comprises the anaphylaxis macropapillary conjunctivitis, macular edema, uveitis, endophthalmitis, scleritis, cornea festers, xerophthalmia, glaucoma, diabetic retinopathy, corneal graft rejection, the complication that operated eye is relevant, the inflammation relevant with cataract operation as the intraocular lens implants, Behcet ' s disease, immune compound vasculitis, Fuch ' s disease, the Xiao Liu Harada disease, Asian TV Station's postretinal fiberization, keratitis, vitreous body-retinitis, eye parasitic infection/transfer, the degeneration of color retinal pigment, cytomegalovirus retinitis, choroiditis, degeneration of macula, age related macular degeneration (" AMD "), non--exudative (" dryness ") AMD, or the imbalance of eye neovascularization, comprise diabetes retinitis or exudative (" wetting ") AMD.

Compositions of the present invention is used for complement protein C5 relevant or the disease of initiation or patient's dispenser of imbalance, and this C5 albumen is suppressed by of the present invention resisting-C5 medicine or of the present invention resisting-C5 medicine specific bond.In some embodiments, compositions of the present invention is for suffering from, or the patient who is in ocular disease or imbalance is useful especially, its with of the present invention anti--the fit inhibition of complement and/or of the present invention anti--complement protein of the fit specific bond of complement is relevant or by its initiation.

In some embodiments, provide suffering from or be in the compositions of the main body treatment of complement-relevant eye imbalance.In the particular, providing suffering from or being in complement-relevant eye imbalance, is the compositions that the imbalance of non--exudative AMD and/or eye neovascularization danger, the particularly main body of diabetes retinitis and exudative-AMD are treated especially.In some embodiments, be in dangerous main body and have retinal pigment drusen and/or change, but do not have clinical visual sensitivity loss.Use opthalmascope to measure drusen, typically on the retina red background, show yellow spotting and granule.Clinical visual sensitivity loss uses diabetes retinitis early treatment table (" ETDRS table ") to show with the vision minimizing of 1 to 3 row.The vision that other degeneration of macula are relevant changes distortion and/or the blind spot (dim spot) that comprises by Amsler grid mensuration, and change of darkness adaption (erythrocyte Gernral Check-up) or color identification change (diagnosis of taper cell health).In some embodiments, being in dangerous main body is to compare with the wild type complement factor H, has the main body of its variant.See, for example, the variant that Edwards etc. describe, Science vol 308, pp421-422 (2005), hageman, G etc., PNAS, vol.102, pp.7227-7231 (2005), and Haines, J etc., Science, vol.308, pp419-421 (2005).Be in dangerous main body in some embodiments and all have drusen, no vision sensitivity loss and complement factor H variant.In some embodiments, be in that dangerous main body is determined to go out to have drusen.In some embodiments, the main body that is in danger of treatment is determined to be gone out to have drusen and has clinical visual sensitivity loss and/or the change of other visions.

Compositions of the present invention can be used for the treatment of the patient with pathology or the method for main body, and in the certain preferred embodiments, it is an eye pathology.Method of the present invention comprises administered is resisted-the C5 medicine, special fit of C5 or comprise identical compositions particularly, thereby anti--C5 medicine conjugated complement PROTEIN C 5, and with complement protein C5 combine its biological function of change, for example, thus prevent the pathology of cracking treatment C5 mediation in its body.In the special embodiment, the combination of of the present invention resisting-C5 medicine, special fit of C5 particularly of the present invention, particularly at retinal tissue, the RPE cell, choroid vascular and/or retinal capillary are in the patient of the imbalance for the treatment of VEGF and/or PDGF mediation, particularly the imbalance of eye neovascularization can reduce the somatomedin of VEGF and/or PDGF expression and/or bFGF and/or other stimulation of endogenous cells growth as in AMD and/or the diabetes retinitis.

In some embodiments, of the present invention anti--complement is fit, particularly of the present invention anti--C5 is fit, with sufficient quantity to main body by eye or near the eyes administration to reduce eye VEGF and/or PDGF Level of Expression of Retinoic Acid.In the special embodiment of the inventive method, with anti--complement is fit, the main body that particularly of the present invention resisting-C5 is fit to be used, being defined as having or being in the eye neovascularization lacks of proper care dangerous, wherein VEGF and/or PDGF express to reduce and to help prevention, and be stable and/or be reduced by at least a kind of eye neovascularization diagonosis of disorder.

Patient or main body with eye pathology, for example, the patient who treats with method of the present invention can make vertebrates, more particularly is mammal, or with being the mankind especially.

In the practice, of the present invention anti--the C5 medicine, fit or its drug acceptable salt or prodrug that C5 particularly of the present invention is special, quantity administration with effective its desired biological activity of demonstration, for example, show fit combination, prevent the cracking of target protein for its receptor.

One aspect of the present invention comprises the associating of the complement imbalance treatment of a kind of fit compositions of the present invention and other C5 mediation.The invention describes an of the present invention fit compositions of uniting in the embodiment with the eye imbalance treatment of other complement-mediations.Imbalance compositions of the present invention can comprise, for example, surpasses a kind of fit.Among some embodiment, the fit compositions that comprises one or more The compounds of this invention of the present invention with other useful compositions administering drug combinations, resists-the inflammation medicine a kind of immunosuppressant, a kind of antiviral drugs, or analog as a kind of.In addition, chemical compound of the present invention can with above-mentioned cytotoxin, cytostatics, or chemotherapeutics such as a kind of alkylating agent, anti--metabolite, mitotic inhibitor or administration of cytotoxin antagonist combination.In the special embodiment, of the present invention resisting-the C5 medicine, usually, the available dosage form of at present co-administered known treatment medicine is suitable.

" therapeutic alliance " (or " altogether-treatment ") comprise and using of the present invention resisting-the C5 medicine, fit compositions that C5 particularly of the present invention is special and at least a second medicine, as specific medicine, with the advantageous effects that provides these medicines to work in coordination with-act on.The advantageous effects of associating includes, but are not limited to, and is united the pharmacokinetics or the pharmacodynamics of acquisition by medicine and works in coordination with-exercising result.Typically with one section definition the time interval co-administered these medicines (according to selected associating, be generally several minutes, hour, day or the week).In some embodiments, second medicine can be anti-VEGF medicine and/or anti--PDGF medicine.

In the embodiment of said method, wherein this method comprises that further to administered anti-VEGF medicine, the anti-VEGF medicine can be selected: a kind of nucleic acid molecules from the group that comprises following material, a kind of fit, a kind of antisense molecule, a kind of RNAi molecule, a kind of albumen, one peptide species, a kind of ring type polypeptide, a kind of antibody or antibody fragment, a kind of sugar, a kind of polymer and a kind of micromolecule.

In the embodiment of said method, wherein this method further comprise to administered anti--the PDGF medicine, anti--PDGF medicine can be selected from the group that comprises following material: a kind of nucleic acid molecules, a kind of fit, a kind of antisense molecule, a kind of RNAi molecule, a kind of albumen, one peptide species, a kind of ring type polypeptide, a kind of antibody or antibody fragment, a kind of sugar, a kind of polymer and a kind of micromolecule.

In some embodiments of said method, wherein this method further comprise to administered anti--blood vessel drug eluting, this is anti--blood vessel drug eluting is a kind of porphyrin derivatives.In some embodiments of porphyrin derivatives, it is injection verteporfin (Visudyne , Novartis Pharmaceuticals Corporation, East Hanover, NJ).In some embodiments, this method further comprises with laser active porphyrin derivatives.

" therapeutic alliance " can, but be not usually, mean a part that comprises as isolating single therapy method, use two or more these medicines, it reaches combined results of the present invention by way of parenthesis or at random." therapeutic alliance " comprises that mode is used these medicines sequentially, and promptly each medicine is used at different time, and uses these medicines in mode fully simultaneously, or at least two kinds of medicines.Mode fully simultaneously can comprise, for example, administered comprised the single pill of fixed proportion medicine or the single pill of a plurality of every kind of medicines.In another embodiment, administration fully simultaneously can comprise for example, administered being had every kind of medicine fixed proportion injection, or a plurality of, the single capsule of each medicine.

Use every kind of medicine according to priority or fully simultaneously and can play effect, but be not limited to, local approach, oral route, intravenous route, intramuscular approach, eye approach and directly absorb by mucosal tissue by any suitable pathways.The data medicine can pass through identical or different administration.For example, the medicine of first kind of selection in compositions can pass through drug administration by injection, and the other treatment medicine of compositions can pass through topical.

Alternatively, for example, all medicines can pass through drug administration by injection by topical or all medicines.The order that medicine uses is not strict with, except as otherwise noted." therapeutic alliance " also can comprise administering therapeutic medicine and extra associating other biological active component as mentioned above.Wherein therapeutic alliance further comprise a kind of non--Drug therapy, non--Drug therapy can be carried out in any time when, as long as obtain therapeutic alliance medicine and the synergistic advantageous effects of non--Drug therapy.For example, in suitable situation, when non--Drug therapy is removed temporarily, in the time of may be for a couple of days or several weeks, still can obtain advantageous effects from medicine.

Treatment of the present invention or materia medica compositions generally include a kind of therapeutic activity composition that a kind of medicine can be accepted the effective quantity in the medium that dissolves or be dispersed in.Medicine can accept medium or carrier comprises any and all solvents, disperse medium, and parcel, antibacterium and antifungal drug wait to blend absorption delay medicine and analog.These media of pharmaceutically active substance and the use of medicine are as known in the art.Auxiliary active component also can be integrated into therapeutic combination of the present invention.

Those of skill in the art can know medicine or pharmacology preparation of compositions according to describing here.Typically, these compositionss can be prepared as injection, and it can be liquid solution or dispersant; Be suitable for before injection, dissolving, or be scattered in the solid form of liquid; The tablet of oral administration and other solids; Slow releasing capsule; Or the form of other any present uses, comprise eye drop, cream, washing liquid, ointment, inhalant and analog.The use of disinfectant preparation, as the surgeon, the salt washing liquid of the treatment operative site specific region that doctor physician or health care personnel use also can be by special use.Compositions also can be passed through microdevice, and microgranule or spongy body are carried.

With the form of preparation, therapeutic agent can be in the mode that conforms to dosage form, and to play the quantity administration of materia medica effect.Preparation can as above-mentioned injection, also can comprise medicament slow release capsule and analog with the administration easily of multiple dosage form.

Herein, the volume of the quantity of active component and the compositions used depends on the host animal of treatment.The practicalness composition of the reactive compound that administration is required depends on practitioner's judgement and all is special for every kind of situation.

The minimum volume of the compositions that the dispersed activity composition is required is typically used.Suitable administering mode also is variable, but typically by initial application chemical compound and monitored results, and is further giving extra controlled dose at interval subsequently.

For example, for tablet or capsule form oral administration (for example, gel capsule), active pharmaceutical ingredient can be accepted the interior carrier coupling with a kind of oral, non--drug toxicity, as ethanol, and glycerol, water and analog.In addition, when expecting or needing, suitable conjugate, lubricant, disintegrating agent and stain also can be integrated in the mixture.Suitable conjugate comprises starch, aluminium-magnesium silicate, paste, gel, methylcellulose, sodium carboxymethyl cellulose and/or polyvinylpyrrolidone, sugar is as glucose or beta-lactose, corn sweetener naturally, nature and synthetic rubber such as Radix Acaciae senegalis, tragacanth or alginic acid, Polyethylene Glycol, wax and analog.The lubricant that uses in these dosage forms comprises enuatrol, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silicon, Talcum, stearic acid, its magnesium salt or calcium salt and/or Polyethylene Glycol and analog.Dispersant includes, but are not limited to, starch, methylcellulose, agar, bentonite, xanthan gum starch, agar, alginic acid or its sodium salt, or effervescent mixture, and analog.Diluent comprises, for example, and lactose, glucose, sucrose, mannose, Sorbitol, cellulose and/or glycine.

Chemical compound of the present invention also can be with oral dosage form, as slow release and lasting tablet or capsule, pill, powder, granule, elixir, tincture, suspending agent, syrup and the Emulsion of discharging.

Injectable composition is isoosmotic solution of water or suspension suitably, and suppository is suitably by lipomul or dispersant preparation.Compositions can be aseptic/and comprise adjuvant, as preservative agent, stabilizing agent, wetting agent or emulsifying agent, chaotropic agent, osmotic pressure is regulated salt and/or buffer.In addition, it also can comprise the other treatment medicine.Compositions is according to the mixing of routine, granulation or packaging method preparation, and typically comprise approximately 0.1% to 75%, be 1 to 50% active component suitably.

Liquid, particularly injectable composition, can, for example, by dissolving, preparations such as dispersion.Active component dissolves in the solvent of pharmaceutical purity or mixes, for example, water, salt, D/W, glycerol, ethanol, and analog are to form injection solution or dispersant.In addition, can prepare the fixed form that before injection, is dissolved in liquid.

Chemical compound of the present invention can same intravenous (inject or inculcate), intraperitoneal, and subcutaneous or intramuscular form administration, all types of service are known for the those of ordinary skill in the drug world.Can be with conventionally form, liquid solution or suspension preparation injection.

The injection administration is generally used for subcutaneous, intramuscular or intravenous injection and inculcate use.In addition, a kind of method of drug administration by injection uses slow release or sustained release system is inculcated, and it guarantees the lasting level of maintenance dose, and according to U.S. Patent number 3710795, it is incorporated in this paper by citation at this.

In addition, suitable compound of the present invention can be by the suitable intranasal media of local use, and inhaler is with the intranasal form administration, or the known percutaneous plaster form administration of use those skilled in the art.During with the administration of transdermal delivery system form, the dosage transporting pattern will for persistence but not intermittent.Other suitable local prepared products comprise cream, ointment, and washing liquid, aerosol spray and gel, wherein the concentration of active component typically is 0.01% to 15%, w/w or weight/volume.

For solid composite, excipient comprises pharmaceutical grade mannitol, lactose, starch, magnesium stearate, saccharin sodium, Talcum, cellulose, glucose, sucrose, magnesium carbonate, and analog.The reactive compound of above-mentioned definition also can use Polyethylene Glycol, and the propylene glycol is prepared as suppository as carrier.In some embodiments, suppository is suitably by fats emulsion or suspension preparation.

Chemical compound of the present invention also can be with the administration of liposome induction system, as little unilamellar vesicle, and big unilamellar vesicle and multilamellar vesicle.Liposome can comprise cholesterol, stearyl amine or phosphatidylcholine by multiple phospholipid preparation.In some embodiments, a kind of fat composition film is with the form of pharmaceutical aqueous solution hydration with formation fat layer packaging medicine, as describing in the U.S. Patent number 5262564.For example, fit molecule described herein can with lipophilic compound or only with known method in this area make up non--immunogenicity, high-molecular weight compounds forms complex.The embodiment of nucleic acid-related complex is provided in U.S. Patent number 6011020.

Chemical compound of the present invention also can be united with the soluble compound as pharmaceutical carrier.These polymer can comprise polyvinylpyrrolidone, pyran co-polymer, poly-hydroxypropyl-Methacrylamide-phenol, poly-hydroxy ethyl aspanamidephenol, or the polyethyleneoxidepolylysine of palmityl residue replacement.In addition, chemical compound of the present invention can be used to obtain one group of biological degradation polyalcohol that controlled drug discharges and combine, for example, polylactic acid, polyepsilon caprolactone, poly butyric, poe, polyformaldehyde, poly-dihydropyran, copolymer is prevented in poly-basic acrylate and crosslinked or hydrogel both sexes.

In the preferred embodiment, chemical compound of the present invention can be by in the vitreous body, and near the eyes, ophthalmic in the conjunctiva, or is striden sclera and injected pleasing to the eye chamber or directly enter eye or tissue near the eyes.Chemical compound of the present invention can be injected into subtenon space or eyeball rear space.Chemical compound of the present invention also can be delivered to a chamber or tissue by arriving the system's blood and the body fluid of eye and its tissue, thus by the injection of persistence system, by intravenous, intramuscular or subcutaneous delivery administration.In the conjunctiva, in the vitreous body or stride sclera to use pharmaceutical composition of the present invention be that the useful of systemic administration medicine replenished, with treatment ocular disease and/or eye symptom systemic disease.Stable among the present invention, treat and/or prevent in some embodiments of diabetes retinitis and/or Behcet ' s disease method, anti--complement is fit not to be systemic administration, it is topical suitably.

Chemical compound of the present invention also can be implanted a kind of biolytic micro-polymer system by operation, be delivered to a chamber or tissue with storage or lasting release gels or polymer form, for example, microdevice, microgranule, or sponge, or other slow release of implanting when the treatment ocular disease are striden the sclera device, or a kind of eye conveyer device, for example, polymer contact crystal continues conveyer device.Chemical compound of the present invention also can be locally applied to a chamber or tissue, and for example, the collyrium form has the contact lens form of The compounds of this invention, or use electric current with medicine the iontophoresis from surface transport to the eyes depths.

As expectation, the pharmaceutical composition of using also can contain the nothing-toxic auxiliary substances of trace, as wetting agent or emulsifying agent, and pH buffer and other materials such as sodium acetate, and triethanolamine oleate.

Using fit dosage method is according to multiple factor, comprises type, species, age, weight, sex and patient's medical condition; The seriousness of treatment symptom; Route of administration; Patient's kidney and liver function; With specific fit or its salt that uses.The doctor of ordinary skill or veterinary can determine and specify prevention, reverse or stop effective quantity of the medicine of disease process.

Because obtain the oral dose of the fit compositions of the present invention of appointment effect, its scope is oral 0.05 to 7500mg/ day.Compositions suitably with comprise 0.5,1.0,2.5,5.0,10.0,15.0,25.0,50.0,100.0,250.0,500.0 and the labelling tablet form of 1000.0mg active component provide.Chemical compound of the present invention can be with single dose administration every day, or daily dose can be with twice, three time or four administrations.

Fit compositions of the present invention inculcate dosage, intranasal administration dosage and transdermal dosage compositions scope are 0.05 to 7500mg/ day.Fit compositions of the present invention subcutaneous, intravenous and intraperitoneal dosage range are 0.05 to 3800mg/ day.

The eye dosage range of fit compositions of the present invention is dosing eyes 0.001 to a 10mg/ eye, for example, with weekly to per March once or with continuous releasing device or form, pass through intravitreal injection.

The effective plasma level horizontal extent of fit compositions of the present invention is 0.002mg/mL to 50mg/mL.Effective eye horizontal extent of fit compositions of the present invention is 20nM to 250 μ M.

The effect of treatment

The new vessels imbalance

The effect of treatment new vessels imbalance, AMD for example, particularly exudative or diabetes retinitis, by any acceptable assay method assessment, wherein angiogenesis is slowed down or is eliminated.It comprises direct observation and non-direct assessment, as passing through assessment nbjective symptom or subjective physiological performance.For example, can be based on neovascularization, microangiopathy, the prevention of vascular leakage or angioedema or any its associating symptom, stable and/or reverse assessment therapeutic effect.The assessment suppression therapy effect of eye new vessels imbalance also can or be improved definition by the stable of visual acuity.

Measure separately anti--C5 medicine or unite a kind of anti-VEGF medicine and/or anti--PDGF medicine to stable, reduce in the effect of a kind of symptom and/or the imbalance of prevention eye new vessels, patient also can be to carry out clinical assessment by the ophthalmologist before this injection after injecting a couple of days.The ETDRS visual acuity, Kodachrome shooting and fluoresecein angiography also can be carried out in every month.

Measure separately anti--complement medicine or unite a kind of anti-VEGF medicine and/or anti--PDGF medicine to stable, reduce in the effect of a kind of symptom and/or the imbalance of prevention eye new vessels, patient also can be to carry out clinical assessment by the ophthalmologist before this injection after injecting a couple of days.The ETDRS visual acuity, take pictures in the optical fundus, and optical coherence tomography and fluoresecein angiography also can be carried out in every month.

For example, anti-for assessing-the C5 medicine, particularly a kind of independent C5 special fit or unite a kind of anti-VEGF medicine and/or a kind of anti--effect of PDGF Drug therapy eye new vessels, will be to suffering the patient of the secondary age related macular degeneration of choroidal neovascularizationization under the macula lutea, according to known method in the field of ophthalmology, comprise that independent or multiple peritoneal injection uses the research of anti--C5 medicine, particularly a kind of independent C5 special fit or with a kind of anti-VEGF medicine and/or a kind of anti--associating of PDGF medicine.The patient of the secondary age-related macular degeneration of choroidal neovascularizationization under the macula lutea (CNV) (AMD) will resist-the C5 medicine with the single intravenous injection, and the special fit and/or a kind of PDGF of the special fit and/or a kind of VEGF of particularly a kind of C5 is special fit.Effect is monitored, for example, by ophthalmology assessment and/or fluoresecein angiography.Treat patient after three months and show vision stable or that improve, for example, pictorialization 3-row of ETDRS or bigger vision enhancement are considered to obtain effective dose.

Other eye imbalances

The inflammation conjunctivitis of treatment comprises the anaphylaxis and the macropapillary conjunctivitis of the method assessment of accepting in this area, macular edema, uveitis, endophthalmitis, scleritis, cornea festers, xerophthalmia, glaucoma, ischemic retinal disease, diabetic retinopathy, corneal graft rejection, the complication that operated eye is relevant, the inflammation relevant with cataract operation, Behcet ' s disease as the intraocular lens implants, fundus flavimaculatus, the compound vasculitis of immunity, Fuch ' s disease, Xiao Liu Harada disease, Asian TV Station's postretinal fiberization, keratitis, vitreous body-retinitis, eye parasitic infection/transfer, the degeneration of color retinal pigment, cytomegalovirus retinitis and choroid inflammation.Measure separately anti--complement medicine or associating other drug to stable, reduce in the effect of a kind of symptom and/or the imbalance of prevention eye new vessels, patient also can pass through clinical assessment by the ophthalmologist.Clinical assessment can carry out after a few days and before the infra shot after injection.Clinical assessment can comprise direct observation and non-direct assessment, as passing through assessment nbjective symptom or subjective physiological performance.For example, can be based on the prevention of vascular leakage or angioedema or any its associating symptom, stable and/or reverse assessment therapeutic effect.In the glaucomatous treatment assessment, can assess based on the stability of the health of retinal nerve fibre layer or ocular nerve, it can use Fundus photography or the monitoring of indicative of local optical coherence tomography.

Described herein all publish and patent document all is incorporated in this paper by quoting from this, its each publication or file are specifically with independently by being incorporated in this paper in this citation.Quoting not as a kind of relevant statement in field any and before of publication and patent document, it does not form any relevant interior perhaps data statement yet.By describing in this description, those of skill in the art will recognize that the present invention can be put into practice with different embodiments in the present invention, and below description and embodiment are not the restriction of following claim for the purpose of description.

Embodiment 1

Anti--fit activity of C5 in classics and the selectivity complement pathway

Embodiment 1A: hemolytic test

Complement system is dissolved the ability of 50% antibody-parcel sheep red blood cell (SRBC) standard suspension in the CH50 experimental test serum test sample.Exist or lack various resist-when C5 is fit 0.2% human serum the mixing with the sheep red blood cell (SRBC) of antibody-parcel (DiamedixEZ Complement CH50 Kit, Diamedix Corp, Miami, FL).According to the operation of test kit scheme, at calcic, (GVB in the barbital-buffer salt solution of magnesium and 1% gel ⁺⁺The complement buffer) hatched 30 minutes with 37 ℃.After hatching, sample is through the complete erythrocyte of centrifugation.Measure suspension absorbance (OD at 412nm ₄₁₂) with quantitative solubility hematochrome, itself and haemolysis degree proportional (Green etc., (1995) Chem.Biol.2:683-95).For verifying fit inhibition C5 activity, according to the scheme of ELISA test kit, some haemolysis supernatant are by (C5b-9 ELISA test kit, Quidel, San Diego, the CA of existing of elisa assay C5a and C5b-9; C5a ELISA test kit, BD Biosciences, San Diego, CA).

In reactant liquor, add extra non--PEGization resist-C5 is fit (ARC186) (serial number: 4) will suppress haemolysis in the mode of dosage-dependence, shown in Fig. 7 A, its IC ₅₀Be 0.5 ± 0.1nM, (seeing Fig. 7 B), its value is filtered the K that measures with nitrocellulose _DValue is consistent.At very high fit concentration (〉 10nM), degree that blood is molten and background (serum-free adding) be indistinction fully, shows ARC186 (serial number: 4) can suppress complement activity fully.ARC186 (serial number: 4) fit and 20kDa (ARC657; Serial number: 61), 30kDa (ARC658; Serial number: 62), the 40kDa of branch (1,3-pair (mPEG-[20kDa])-propyl group-2-(4 '-butamide) (ARC187; Serial number: 5), the 40kDa of branch (2,3-pair (mPEG-[20kDa])-propyl group-1-carbamyl) (ARC1905; Serial number: 67), linear 40kDa (ARC1537; 65) and linear 2 * 20kDa (ARC1730 serial number:; Serial number: 66) combination of PEG group has only little effect (Fig. 7 A-Fig. 7 D) to fit inhibition activity in the CH5O hemolytic analysis.

In the extra research, PEGization is anti--the fit ARC1905 of C5 (40kDa of branch (2,3-pair (mPEG-[20kDa])-propyl group-1-carbamyl); Serial number: 67) with the non--PEGization precursor (ARC672 (serial number: 63), in the CH50 hemolytic analysis, compare that contains end 5 '-amino.Human serum solution (Innovative Research, Southfield, MI) mix (Diamedix EZ Complement CH50 Kit with antibody-parcel sheep red blood cell (SRBC), Diamedix Corp, Miami FL), lacks or exists the ARC1905 and the ARC627 of variable concentrations, final serum-concentration is 0.1%, analyzes according to the manufacturer recommendation scheme.Carried out the molten reaction of blood in 1 hour to guarantee cell suspension at 37 ℃ to stir.Hatch the end, centrifugation intact cell (2000rpm, 2 minutes, room temperature), 200 μ L supernatants be transferred to flat polystyrene dish (VWR, cat#62409-003).Measure supernatant in the release of the absorbance (OD415) of 415nm with quantitative solubility hematochrome.Use equation % inhibition=100-100 * (A _Sample-A _Serum-free)/(A _{No fit}-A _Serum-free) calculate the % suppression ratio under each fit concentration, wherein A _SampleBe the sample absorbance of variable concentrations when fit, A _Serum-freeBe the molten absorbance of background blood (contrast of 100% extinction) that serum-free is, A _{No fit}It is the absorbance (contrast of 0% extinction) that no basic complement activity when fit causes.Use equation % to suppress=(% inhibition) _Maximum* [mortifier] ⁿ/ (IC ₅₀ ⁿ+ [mortifier] ⁿ)+background is suppressed to measure the IC50 value with respect to the chart of [mortifier] by %.Use equation IC ₉₀=IC ₅₀* [90/ (100-90)] ^1/nAnd IC ₉₉=IC ₅₀* [99/ (100-99)] ^1/nCalculating derives from IC ₅₀IC ₉₀And IC ₉₉Value.The IC of ARC1905 and ARC627 in this parallel study ₅₀Value is 0.648+/-0.0521 and 0.913+/-0.0679, if further prove conclusively PEGization for fit influential, it is fainter.

The elisa assay of haemolysis supernatant shows that this functional inhibition is consistent with the inhibition that C5a discharges.4) and its PEGization conjugate therefore, haemolysis data show ARC186 (serial number:, be the potential complement inhibitor of height that suppresses the C5 convertase catalytic activity.

The hemolytic analysis of non--PEG formed material show anti--C5 fit not with from multiple non--the C5 cross reaction of primate species, comprise rat, Cavia porcellus, Canis familiaris L. and pig.Yet, in the screening of primates serum, observe obvious inhibiting activity, comprise macaque, Rhesus Macacus and chimpanzee.Use ARC658 (serial number: 62), a kind of ARC186 (serial number: 30kDa-PEG analog 4) in serum of macaque further research anti--in vitro effects that C5 is fit.In a kind of parallel comparison (n=3), it is 0.21 ± 0.0nM that ARC658 suppresses the active IC50 of human complement, and the IC50 that suppresses the macaque complement activity is 1.7 ± 0.4nM (Fig. 8).Like this in this test ARC658 (serial number: 62) effectiveness in serum of macaque is more medium and small 8 ± 3 times than human.

In the research subsequently, there are human serum (Innovative Research, Southfield, MI), macaque (Bioreclamation, Hicksville, NY), or rat blood serum (Bioreclamation, Hicksville in the time of NY), analyzes the 40kDa of branch (2 by the sheep red blood cell (SRBC) hemolytic test, 3-two (mPEG-[20kDa]-propyl group-1-carbamyl) PEGization resists-and C5 is fit, ARC1905 (serial number: the 67) activity in CCP.These tests are carried out in high dilution serum, and human and macaque is 0.1%, and rat is 0.3%, under identical condition, compare ARC1905 and ARC672 as previously mentioned to the hemolytic inhibition effect of sheep red blood cell (SRBC).In a kind of comparison arranged side by side, ARC1905 obtains the inhibition fully (90-99%) to external complement activity in human and serum of macaque, and ARC1905 shows less in rat complement sample or do not have special inhibition active (Figure 59 A).Similar and ARC658, the ARC1905 inhibition effect for the macaque complement activity under experimental condition reduces by 10 times, as the IC that reports among Figure 59 B ₉₀And IC ₉₉What value reflected.

The nitrocellulose filter-binding assay.Independent fit by with γ- ³²(New England Biolabs, Beverly MA) are hatched altogether to carry out at its 5 ' end for P-ATP and polynucleotide kinase ³²The P-labelling.Remove free ATP by gel filtration purification from radioactivity is fit after the polyacrylamide gel electrophoresis.The affinity that-C5 anti-for measuring is fit, radiolabeled fit (≤10pM) with the purification C5 albumen (Quidel that increases concentration (0.05-100nM), San Diego CA) was hatched 15 minutes and 4 hours with room temperature (23 ℃) and 37 ℃ in the phosphate buffer that contains 1mM MgCl2.Use Minifold I dot blot 96-hole vacuum suction filter device (Schleicher﹠amp; Schuell, keene is NH) by nitrocellulose filter analysis association reaction.Use the three layer filtration medium, (from the top to the bottom) is Protran nitrocellulose (Schleicher﹠amp; Schuell), and Hybond-pnylon (Amersham Biosciences, Piscataway is NJ) with GB002 gel hybridization paper (Schleicher﹠amp; Schuell).Nitrocellulose layer, it is with respect to nucleic acid, preferentially selects and protein binding, be suitable for catching in the complex that has the albumen dispensing anti--C5 is fit, but not-compound anti--C5 is fit will to be combined by nitrocellulose and with nylon membrane.Gel hybridization paper is as the Supporting Media of other filter mediums.After the filtration, separate filtering layer, drying also is exposed to fluorescent screen (Amersham Biosciences) and uses Storm 860 Phosphorimager Hybridization imaging system (Amersham Biosciences) is quantitative.

As showing among Fig. 9 and Figure 10, the increase of C5 concentration has increased the ARC186 ratio of catching on the nitrocellulose membrane.Bonded ARC186 for the dependency that increases C5 concentration can use the fine description of list-site combination model (

% combination=C _Maximum/ (1+K _D/ [C5]); C _MaximumMaximum % combination when being saturated [C5]; K _DBe dissociation constant).Fig. 9 and 10 has shown that two kinds of temperature hatch the binding curve of ARC186 after 15 minutes or 4 hours.After hatching in 15 minutes, the ARC186 binding curve in the time of 23 and 37 ℃ is fully indiscriminate, meets the K of 0.5-0.6nM _DValue (Fig. 9).The difference of the binding curve in the time of 23 and 37 ℃ is more obvious with the incubation time increase.Hatched back (Figure 10) in 4 hours, the K that obtains in the time of 23 ℃ _DValue is reduced to 0.08 ± 0.01nM, and the K that obtains 37 ℃ the time _DValue no change (0.6 ± 0.1nM).

Be the theoretical basis of hatching for a long time under the checking room temperature, the affinity of the further analysis room of working power method relaxing the bowels with purgatives of warm nature.The isolating back reaction rate of describing C5ARC186 is vrev=k _-1[C5ARC186], wherein v _RevBe speed (unit is M minute-1), k _-1Be the first separation rate constant (unit for minute ^-1).The forward reaction rate of describing the formation of C5ARC186 complex is v _For=k ₁[C5] [ARC186], wherein v _ForBe speed (unit is M minute-1), k ₁Be the second separation rate constant (unit for minute ^-1).Use the hypothesis first imagination analytical data, that wherein a kind of concentration of reactants (be C5 under this situation) surpasses is another kind of ([C5]〉〉 [ARC186]), so the sufficient no change of maintenance in course of reaction.Under these conditions, forward reaction is described, v by the first process rate equation _For=k ₁' [ARC186], wherein k ₁'=k ₁[C5].

Be to analyze dissociating of C5ARC186, radiolabeled ARC186 (≤10pM) with 5nM C5 albumen in the phosphate buffer that contains 1mM MgCl2 in room temperature (23 ℃) preincubate.The initial dissociation reaction of the ARC186 of-labelling non-by adding (1 μ M), it is as the trapping agent of free C5, and filters by nitrocellulose and to stop with separating and combining and radio-labeled ARC186 freely.By to initial dissociation reaction with filter variation at interval, obtain the ARC186 time course that dissociates.The time course that dissociates shows as the minimizing (equaling the percent in conjunction with C5) of the radio-labeled ARC186 percent of catching on the nitrocellulose membrane, can be with the description of list-exponential damping, wherein %ARC186 combination=100*e ^-k-1t(seeing Figure 11).The rate of departure constant value of being measured by this method is 0.013 ± 0.03 minute ^-1, corresponding to 53 ± 8 minutes half-life (t _1/2=In2/k _-1).

For analyzing association reaction, the balancing speed constant (k that C5ARC186 forms _Eq) measure with the C5 albumen (1-5nM) of variable concentrations.C5 albumen and radiolabeled ARC186 are mixed the formation of initiation complex in room temperature (23 ℃) in the phosphate buffer that contains 1mM MgCl2, and pass through the termination of nitrocellulose isolated by filtration.Described in dissociation reaction, obtain the time course that complex forms by initial action and filtration variation at interval.The equilibration time process shows as the increase of the radio-labeled ARC186 percent of catching on the nitrocellulose membrane, can describe with list-exponential damping, wherein %ARC186 combination=100*e ^-k-1tFigure 12 has shown 1,2 and the equilibration time process of 4nM C5.As expectation, k _EqValue is with [C5] the linear ((k that increases _Eq1nM)=0.19 ± 0.02 minute ^-1(k _Eq2nM)=0.39 ± 0.03 minute ^-1(k _Eq3nM)=0.59 ± 0.05 minute ^-1(k _Eq4nM)=0.77 ± 0.06 minute ^-1(k _Eq5nM)=0.88 ± 0.06 minute ^-1).Under the experimental condition, k _Eq, k ₁And k _-1Between the pass be k _Eq=k ₁[C5]+k _-1Like this, at 0.18 ± 0.01nM ^-1Minute ^-1Situation under, from k _EqCurve chart with respect to [C5] draws k ₁Assessed value (seeing that Figure 12 inserts).

These data show, (for example, 0.1nM), need to prolong and hatch so that the mixture of C5 and radio-labeled ARC186 reaches balance under the C5 of low concentration condition.Under this condition, keq=(0.18 ± 0.1nM ^-1Minute ^-1) (0.1nM)+0.013 minute ^-1=0.03 minute ^-1, corresponding to 22 minutes half-life.Like this, nearly 2 hours incubated at room (～5 half-life) is for complete (〉 95%) balance needs.Short time (for example, 15 minutes) hatch the actual affinity that will significantly underestimate complex, as above show 15 minutes (K _D=0.5nM) with respect to 4 hours (K _D=0.08nM) hatch the difference of the affinity of acquisition.Can be according to concerning K _D=k _-1/ k ₁, calculate the room temperature K of selectivity assessment by dynamics data _DIn the case, the K of calculating _DBe 0.07 ± 0.01nM, itself and the above-mentioned K that measures by the heat power method _DIn full accord.

ARC186 (serial number: 4) also can assess with nitrocellulose filter analysis method by C5 upstream and downstream complement component during relatively complement cascade amplifies for the specificity of C5.From Complement Technologies company (Tyler, TX) albumen of the purification of Gou Maiing and albumen composition comprise: Clq (article No. #A099.18; 2.3 C3 (article No. #A113.c8 μ M); 27 μ M), C5 (article No. #A120.14; 5.4 C5ades Arg (article No. #A145.6 μ M); 60 μ M), sC5b-9 (article No. #A127.6; 1 μ M), factor B (article No. #A135.12; 11 μ M) and factor H (article No. #A137.13P; 6.8 μ M).The albumen of serial dilution is being contained 1mM MgCl ₂, among the PBS of 0.02mg/mL BSA and 0.002mg/mL tRNA, hatched 1-4 hour in 25 ℃ or 37 ℃, be applied to the nitrocellulose filter plant subsequently as mentioned above, set up association reaction.By with data substitution equation: % nitrocellulose combination=amplitude * [C5]/(K _D+ [C5]), measure dissociation constant K according to the % nitrocellulose in conjunction with half-logarithmic chart with respect to [C5] _D

Result among Figure 13 shows the fit C5a of nonrecognition in essence (K _D3 μ M), though hypothesis is because the reciprocal action of itself and C5b composition, can show the more weak affinity (K for solubility C5b-9 _D0.2 μ M).Other complement components show for fit medium extremely more weak affinity.Non--activated C3 is not fully in conjunction with fit; Yet, factor H (K _D～100nM) and, more among a small circle in, Clq (K _D0.3 μ M) combination really.Summary, data show ARC186 (serial number: 4) mainly by by the C5b zone, with high-affinity in conjunction with human C5.Like this, ARC186 and its PEGization derivatives, for example, ARC1905 should not disturb the generation of C3b, and its opsonic action for antibacterial is very important, or C ' activity is had the nature adjusting by regulatory factor.

Fit and combining of high molecular weight PEGs aglucon are caused sterically hinderedly causes weakening of affinity.Therefore PEG-modifies fit because these fit trending towards under the situation of disappearance target protein still in conjunction with nitrocellulose are unsuitable for the nitrocellulose filter method by directly in conjunction with assessment.Yet the relative affinity that these are fit can be by known competition associated methods, at 37 ℃, filters with nitrocellulose and to measure it with radiolabeled, non--PEGization is fit (≤pM) compete the ability of combining target and relative affinity is measured.When cold (for example, non--radio-labeled) competition substrate concentration increased, the proteic radiolabeled fit percent of combining target reduced.As shown in figure 14,4) or the fit (ARC657 (serial number: 61) of PEGization cold ARC186 (serial number:, ARC658 (serial number: 62), and ARC187 (serial number: 5) (0.05-1000nM) (serial number: 4) competition combines 2nM C5 albumen with radiolabeled ARC186.In addition, all fit all the time titration curves show ARC657 near overlapping, and the PEG-of ARC658 and ARC18 is in conjunction with having less for fit and affinity C5 or not having influence.

In similar research, compare ARC672 (ARC186 in conjunction with test with 5 '-terminal amino group by competition; Serial number: 63) measure the joint efficiency of PEG conjugate and C5 with ARC1905 (ARC627 conjugate branch 40kDa (2,3-two (mPEG-[20kDa])-propyl group-1-carbamyl) PEG).To contain 1mMMgCl ₂, 0.01mg/mL BSA, the PBS of 0.002mg/mL tRNA prepare 10 fit μ M storing solutions, and comprise by serial dilution preparation〉and 100-10 * series of samples of fit concentration range doubly.Every kind of fit being added to respectively of 12 μ L contains 96 μ L ³²In 96 orifice plates of the radiolabeled ARC186 of P-, 1.1 * solution of preparation mark labelling and cold competition thing.90 μ L labellings/competition thing solution is added to 10 μ L, 10 * C5 albumen with initial action.The ultimate density of radio-labeled ARC186 is kept constant in each reaction.Association reaction filtered on the nitrocellulose defecator subsequently as previously mentioned at 37 ℃ of balance 15-30 minutes.For data are analyzed, cold competition is fit to be considered to the interactive competition mortifier of ARC186/C5; Carry out standardization by the control reaction (0% competition contrast) that will lack the competition thing and calculate the % inhibition.With data substitution equation: % inhibition=amplitude * [competition thing] ⁿ/ (IC ₅₀ ⁿ+ [competition thing] n), from % suppress with respect to [ARC672] or] semilog diagram of [ARC1905] measures IC ₅₀Value.

Shown in Figure 60, in conjunction with measuring, add the 40kDa of branch (2,3-two (mPEG-[20kDa])-propyl group-1-carbamyl) PEG and have less for fit affinity or do not have effect by competition.IC among Figure 60 ₅₀With respect to the ARC672 of the collinear y-intercept representative of C5 data and the K of ARC1905 _DValue be approximately respectively 0.46+/-0.149nM and 0.71+/-0.130nM.The ARC186K of this value and 37 ℃ of mensuration _DBe worth approaching.

The interactive temperature dependency of ARC1905 and C5 is also assessed by competing method.As mentioned above with ARC1905 serial dilution preparation 10 * series of samples.25 ℃ and 37 ℃ of balance association reactions 1-4 hour, and on the nitrocellulose defecator, filter.The control reaction (% suppresses contrast) by will lacking the competition thing or the data of disappearance C5 albumen (100% suppresses to contrast) are carried out standardization and are calculated inhibition percent.With data substitution equation: % inhibition=amplitude * [competition thing] ⁿ/ (IC ₅₀ ⁿ+ [competition thing] ⁿ), from % suppress with respect to [ARC672] or] semilog diagram of [ARC1905] measures IC ₅₀Value.Shown in Figure 61, ARC1905 at 25 ℃ and 37 ℃ of high-affinities in conjunction with C5.From IC ₅₀Obtain the K of 25 ℃ and 37 ℃ with respect to the collinear y-intercept of C5 data _DValue is 0.15 ± 0.048nM and 0.69 ± 0.148nM respectively.The ARC186/C5 reciprocal action K of this value and said determination _DValue is consistent.

Embodiment 1B: whole blood chemical examination.

Use following whole blood assay anti--C5 is fit in complement system selectivity approach effect.During the disappearance anticoagulant, separating blood from the normal human subject volunteer.The blood of aliquot (not containing anti--anticoagulant) and the ARC186 that increases concentration (serial number: 4) room temperature or 37 ℃ of reactions 5 hours.Sample is through centrifugalize serum, by sC5b-9ELISA (C5b-9ELISA test kit, Quidel, San Diego, the CA) existence of C5b in the mensuration serum.As shown in figure 15, with anti--complement activity that C5b-9 represents, departing between the sample that different temperatures is hatched is 3 μ M.Room temperature data shows that quantitatively suppressing required fit concentration range is 3-6 μ M, and the C5 concentration of report is about 400nM.These results show the anti--fit (ARC186 of C5 that surpasses 10-times of mole excess quantity; Serial number: it is essential 4) suppressing activity fully for C5.

Embodiment 1C: the complement activity of zymosan.

Zymosan is the polysaccharide component of yeast cell wall, and is the potential activator during the selectivity complement cascade amplifies.Blood adds zymosan and can cause the accumulative result of complement activity product in the external sample of blood plasma or serum, comprise the soluble form (sC5b-9) of C5a and C5b-9.Undiluted human serum sample (Center for Blood Research, Inc., Boston, MA), the human whole blood of citric acid treatment (Center for Blood Research, Inc., Boston, MA), or serum of macaque (Charles River laboratory, Wilmington, MA) (serial number: 62) handle, it is an ARC186 (serial number: 30K PEG analog 4) with the ARC658 that increases concentration.For active complement, add in the sample 10 * zymosan suspension (Sigma, St.louis, MO) to final concentration be 5mg/mL.37 ℃ hatch 15 minutes after, centrifugal removal zymosan granule and by C5a and/or sC5b-9ELISA (C5b-9ELISA test kit, Quidel, San Diego, CA; C5a ELISA test kit, BD Biosciences, San Diego CA) measures the complement activity degree.

Lack when fit, with respect in the sample that is untreated～1% activity, zymosan is handled and can be activated～50% serum or whole blood C5.Add anti--C5 is fit to have less effect for the formation of sC5b-9 to 50nM (～10% blood C5 concentration).Yet, show as Figure 16, increase the ARC658 (serial number: 62) can suppress the C5 activity with dosage-dependence form of concentration to the further titration of C5.In human serum or the whole blood, fit with respect to～2 times of C5 moles, (serial number: 62) can observing quantitatively, (～99%) suppresses 0.8-1 μ M ARC658.For obtaining comparable inhibition in the serum of macaque, need the fit of higher concentration.In the case, have only 10 μ M fit, or fit with respect to～20 times of C5 moles, can obtain 99% and suppress.

Similarly in the research,, in human and macaque sample, measure the inhibition effect of ARC1905 (40kDa of branch of ARC186 (2,3-pair (mPEG-[20kDa])-propyl group-1-carbamyl) PEGization form) by using zymosan activating complement selectivity approach.The zymosan A that derives from beer yeast is by Sigma-Aldrich, and the Inc supply (article No. Z4250-1G, St.Louis, MO).Zymosan provides with powder type, and suspends in Dulbecco ' s PBS (Gibco, Carlsbad, CA, article No. 14190-144) with preparation 50mg/mL suspension.(Southfield MI) buys refrigerated normal human subject serum (article No. IPLA-SER) from Innovative Research.(Hicksville NY) buys refrigerated normal serum of macaque (article No. CYNSRM) from Bioreclamation.The 5-10mL serum of supply melts at 37 ℃, packing (～1mL) and be stored in-20 ℃.Before needs use, melt in 37 ℃, and in process of the test, be positioned on ice.The serum ultimate density is～100% in each test.Prepare 20 μ M ARC1905 liquid storages with 0.9% saline solution, and serial dilution comprises～10 * series of samples of 90 times of fit concentration of scope with preparation.Nothing-fit (saline solution is only arranged) sample is as negative (0% suppresses) contrast.

90 μ L serum are added to 96-hole PCR plate (VWR, article No. 1442-9596).The fit sample of 10 μ L directly dilutes serum and mixing in room temperature.Add 8 μ L50mg/mL zymosans in another 96-hole PCR plate.Two boards simultaneously in 37 ℃ pre--hatched 15 minutes.In advance-and after hatching, immediately 80 μ L serum/fit mixture directly are added to 8 μ L zymosans and mixing, making the zymosan ultimate density is 5mg/mL.Sptting plate seals and hatched 15 minutes in 37 ℃.Hatch the end, every hole adds 8 μ L 0.5M EDTA and mixes cessation reaction.Centrifugation zymosan (3700rpm, 5 minutes, room temperature) ,～80 μ L stop supernatant and are transferred to new 96-hole PCR plate and sealing.Supernatant quick-freezing and be stored in-20 ℃ in liquid nitrogen.Be control zymosan-ind background activity, prepare as mentioned above and handles serum sample, except with the alternative zymosan of 8 μ L saline solution.

Measure with C5a ELISA (ALPCO Diagnostics, Windham, NH, article No. EIA-3327) according to C5a ELISA test kit scheme, produce relative level determination C5 level of activity with C5a in each zymosan-activation sample.C5a ELISA test kit comprises human specific reagent and is used for analysed for plasma or the human C5a of serum sample (hC5a).Be necessary to use macaque concentration standard product to measure the reaction of ELISA for macaque C5a.For preparing a cover universal standard, the 0.5mL mankind or serum of macaque and 5mg/mL zymosan were hatched 15 minutes in 37 ℃, added 12.5 μ L 0.5M EDTA and stopped also centrifugal removal zymosan.The concentration of C5a is determined as about 2 μ g/mL hC5a through comparing with the hC5a standard blood plasma that test kit provides in the activated human serum sample of zymosan.The concentration of C5a in the macaque sample is represented with human C5a (hC5a eq) a great deal of, is about 0.6 μ g/mL hC5a eq.The series standard that comprises 0.4-400ng/mL hC5a or 0.12-120ng/mL hC5a eq scope is by dilution preparation (it does not disturb ELISA) in rat blood serum.Standard substance use albumen-preformed precipitate reagent according to the pretreatment of ELISA test kit scheme, and use pre-elisa plate without further diluting.(Molecular dynamies, sunnyvale CA) measure absorption maximum in 450nm (A450) to use VersaMax ultraviolet/visible absorbance plate to read the plate instrument.A450 is changed to corresponding to C5a concentration, and for low C5a, its low value is 0.1-0.2, high C5a, and its high value is for～3.5.For quantitative to C5a in analyzing samples, quantitative upper and lower limit is respectively, and the mankind are 25 and 0.78ng/mL h C5a, and macaque is 15 and 0.94ng/mL hC5a eq.As Figure 62 demonstration A450 is mapped with respect to ng/mL h C5 or hC5a eq, use equation y=((A-D)/(1+ (x/C) ^B))+D obtains standard curve by the 4-parameter.

Before C5a analyzes, according to ELISA test kit scheme with analyzing samples (comprising saline solution and non--zymosan contrast) with albumen-preformed precipitate reagent pre--handle, and in 0.9% saline solution serial dilution.The C5a level that (comprises some nothings-zymosan contrast) in the undiluted analyzing samples typically surpasses upper limit of quantification (ULOQ).Therefore, measure to adapt to the gamut of C5a analyzing samples concentration with 1/5,1/50 and 1/250 dilution factor.Proper (mankind or macaque) standard curve and the quantitative C5a level of dilution factor.Use equation % inhibition=100-100 * (C5a _Sample-C5a does not have zymosan)/(C5a saline solution-C5a _{No zymosan}) % that calculates each fit concentration suppresses.Use equation % to suppress=(% inhibition) _Maximum* [ARC1905] ⁿ/ (IC ₅₀ ⁿ+ [ARC1905] ⁿ)+background suppresses to measure IC with respect to the chart of [ARC1905] from % ₅₀Value.Use equation IC ₉₀=IC ₅₀* [90/ (100-90)] ^1/nAnd IC ₉₉=IC ₅₀* [99/ (100-99)] ^1/nBy IC ₅₀Value is calculated IC ₉₀And IC ₉₉

C3 activity (step in the common complement pathway of C5 upstream) degree can be by the level relatively of C3a in each zymosan-activation sample, with C3a ELISA (Becton-dickinson OptiEIA C3a ELISA test kit, article No. 550499, Franklin Lakes NJ) measures according to C3a ELISA test kit scheme.

Before C3a analyzes, sample (comprising saline solution and nothing-zymosan contrast) serial dilution in 0.9% saline solution.C3a ELISA follows sensitive than C5a; Therefore, need carry out 1/500,1/5000 and 1/25000 dilution to adapt to the gamut of sample C3a concentration.Derive from the test kit standard substance of human serum, substitute C5a analyze in preparation universal standard product and use.Because the C3a level changes little, the mankind-special standard substance provide its abundant indication of level relatively.

Analyzed with Microsoft Excel by the data that C5a and C3 ELISA obtain, average % inhibiting value uses Kaleidagraph (v.3.51, Synergy Software) mapping.Use Excel plug-in card program Slfit4.1 to measure IC ₅₀, IC ₉₀And IC ₉₉Value.The relative effect of the ARC1905 that this method is measured in human and macaque complement activity shows in Figure 63 and Figure 64.As shown in these figures, ARC1905 can externally suppress the C5 activity of selectivity approach fully in human and serum of macaque.In the human serum, the active required ARC1905 concentration of 90% inhibition C5 is 442 ± 23nM in undiluted sample, approximates C5 molar average concentration.Yet, under analysis condition, with IC ₉₀And IC ₉₉The ARC1905 of value representation suppresses effect for the macaque complement activity and reduces 4-6 doubly.

Figure 65 has described with the C3a level determination, and ARC1905 is for the active effect of C3.Special ultimate principle at the complement pathway end is to suppress short-inflammation function of C5a and membrane attack complex (MAC) and cause of disease-attack function of not stoping C3a and the C3b last downstream factor in producing.The data show ARC1905 of Figure 65 until 2 μ M, does not suppress the generation of C3a, shows that the downstream complement activity is not subjected to the ARC1905 negative effect.Use ARC1905 in human and serum of macaque, to obtain suppressing fully fully of the active selectivity approach of C5.ARC1905 suppresses the active ability decimal magnitude of human C5 for suppressing macaque C5 specific activity under the condition of this method.Though do not expect to be limited to theory, ARC1905 is special at C5 for the inhibition effect of complement activity, so the activity of C3 is suppressed.

Embodiment 1D: the pipe ring model of complement activity

The ability of anti--C5 the is fit inhibition complement activity that is exposed to that allosome material causes for test, as in the cardiopulmonary circulation, finding, pipe ring model (Gong etc., (1996) Journal of Clinical Immunology 16,222-9 that we use Nilsson and colleague to describe; Nilsson etc., (1998) Blood 92,1661-7).Tygon S-50-HL medical/surgical pipe (1/4 ' internal diameter) (U.S. Plastics Company ((Lima, OH), article No. #00542) be cut into 300mm length (about 9mL volume) and pour into 5mL and contain the human volunteer blood of 0.4 unit/mL heparin (Celsus) and change ARC658 concentration (serial number: 62) (0-5 μ M).As described in Gong etc., with non--operation silicone tube (3/8 ' internal diameter) (U.S. quantity company (model R-3603, article No. #00271) short segment (～50mm) the Tygon pipe with each length connects into closed hoop.Pipe ring rotated 1 hour with 30rpm in 37 ℃ of water-baths.Content in the ring is added in the polypropylene conical tube that contains EDTA (10nM final concentration) to stop complement activity.Centrifugalize does not have the blood plasma of platelet and passes through elisa assay C5a and C3a (C3a ELISA test kit, Quidel, San Diego, CA; C5a ELISA test kit, BD Biosciences, San Diego, CA).

The whole complement activities that lack when fit are analyzed less with respect to zymosan.Typically, hatching back C5a level in 1 hour increases 6gn/mL, corresponding to can utilize C5 active＜1%.Yet this growth is reproducible and can be by ARC658 (serial number: 62) titration inhibition.Shown in Figure 17, (serial number: 62) fully obtain C5 active 99% and suppress, its level is equal to or slightly less than the molar concentration of C5 in the blood to 300-400nM ARC658.Yet do not expect to be limited to theory, though need less fit acquisition C5 active 99% to suppress than zymosan model in this model, this phenomenon also can show the abundant difference of the complement-active stimulus object that uses in two kinds of methods.The generation of C3a also can be used as a kind of monitoring with checking ARC658 (serial number: 62) be no earlier than C5 in complement cascade amplifies and suppress active step.Hatch C3a level increase 4000ng/mL after 1 hour, corresponding to available C3 active 10%.Different with the C5a generation, (serial number: 62) titration no dependence shows ARC658 (serial number: 62) special prevention C5 cracking to ARC658 in the generation of C3a.

The pipe ring model is with resisting-the fit ARC1905 of C5 (serial number: 67) repeat research.ARC1905 serial dilution preparation in 0.9% saline solution comprises 20 * series of samples of 100 times of fit concentration ranges (10-1000nM final concentration).Comprise the contrast of the sample of uncorrelated fit (ARC127) as non--specific oligonucleotide effect.Nothing-fit (saline solution) sample is as negative control.Single volunteer's blood sample obtains by the standard blood-sampling method.From 5 volunteers' blood directly with 60mL syringe (Becton-Dickinson, (Franklin Lakes, NJ), article No. 309653) draws, and packing is immediately gone into than cutting down Lu Ding (20 μ M final concentration) (Prospec-Tany Technogene Ltd., (Israel), article No. #105BIV01)+/-fit.Anti--blood coagulation ratio cuts down Lu Ding, and a kind of direct thrombin inhibitor substitutes the heparin that disturbs complement activity and uses.

Carry out the pipe ring model as mentioned above.From the volunteer, encircle (diameter 1/4 at～300mm immediately after the blood sampling; Perfusion 5mL blood in the volume～9mL)/fit/than cutting down the Lu Ding sample.With silicones connection tube short segment (～50mm) will manage closed ring formation, produce volume and be～4mL.Pipe ring rotated 1 hour with 32rpm in 37 ℃ of water-baths.After hatching, all 5mL samples are transferred to the 15mL conical tube that contains 100 μ L0.5M EDTA, and (final EDTA concentration is 10mM for Corning, (Corning, NY), Huo Hao @630766).4 ℃ centrifugal (3300rpm, 20 minutes) (Eppendorf centrifuge 5804) stops mobile phone 1mL blood plasma supernatant the sample from each.Supernatant quick-freezing and be stored in-20 ℃ in liquid nitrogen.Be control background activity, the 5mL fresh blood is added to the 15mL conical tube of putting on ice that contains 100 μ L 0.5M EDTA and prepares pre--CPB sample.This sample is by plasma treatment and storage as mentioned above.

As mentioned above by C5a ELISA, with the relative level determination C5 level of activity of C5a generation in each active sample.According to ELISA test kit scheme undiluted plasma sample is carried out C5a ELISA, the C5a standard substance that provide with manufacturer are the C5a sample level relatively quantitatively.Each fit concentration suppresses by equation % inhibition=100-100 * (C5a the % that C5a produces _Sample-C5a _{Before the CPB-})/(C5a saline solution-C5a _{Before the CPB-}) calculate.Use equation % to suppress=(% inhibition) _Maximum* [ARC1905] ⁿ/ (IC ₅₀ ⁿ+ [ARC1905] ⁿ)+background suppresses to measure IC with respect to the chart of [ARC1905] from % ₅₀Value.Use equation IC ₉₀=IC ₅₀* [90/ (100-90)] ^1/nAnd IC ₉₉=IC ₅₀* [99/ (100-99)] ^1/nCalculate IC by the IC50 value ₉₀And IC ₉₉

As mentioned above by C3a ELISA, with the relative level determination C3 level of activity of C3a generation in each active sample.Before C3a analyzes, sample (contrasting before comprising saline solution and CPB-) serial dilution in 0.9% saline solution.C3a ELISA is sensitiveer than C5a, therefore, needs 1/5000 dilution factor to adapt to sample C3a concentration range.By relatively more quantitative, as described in C5a, calculate the % inhibition to sample C3a level with the test kit standard substance.Use Microsoft Excel analytical data, use Kaleidagraph (v3.5 Synergy Software) that the % inhibiting value is mapped.Use Excel plug-in card program Slfit4.1 to measure IC ₅₀, IC ₉₀And IC ₉₉Value.

Five is ARC1905 and irrelevant fit among the volunteer, and ARC127 describes in Figure 66 for the average effect of complement activity.Show that as Figure 67 be produced as with C5a that the C5 of reflection is active to be suppressed fully, ARC1905 can obtain＜500nM, and irrelevant fit unrestraint effect, its value is 1 μ M.Average whole blood IC ₅₀, IC ₉₀And IC ₉₉Value is respectively 119 ± 28.6nM, 268 ± 39.2nM and 694 ± 241nM, (Figure 66).Do not expect to be limited to theory, suppose that ARC1905 is excluded in cell blood volume, it comprises whole 45%.IC ₅₀, IC ₉₀And IC ₉₉Value is suitable for reflecting that C5 suppresses situation in the blood plasma, therefore, is 216 ± 52.0nM, 487 ± 71nM and 1261 ± 438nM.These values show anti--C5 activity of the not obvious interference of cell blood component ARC1905 with consistent by the SC active A RC1905 inhibition parameters calculated of zymosan-mediation.ARC1905 or irrelevant fitly do not suppress C3a to the 1 μ M and produce.Yet do not expect to be limited to theory, it shows that ARC1905 neither suppresses the C3 convertase reaction, does not also suppress other and changes the active step of cascade, as C3 precipitation and invertase assembling.

Embodiment 2

Reselect and check order

C5 is selected in the dRmY set

It is fit to identify the proteic dRmY of human total length C5 to carry out two kinds of selections.C5 albumen (Quidel Corporation, San Diego, CA or Advanced ResearchTechnologies, San Diego, CA) use with total length (" FL ") and part pancreatinization (" TP ") form, two kinds of selections are directly carried out at the albumen target that is fixed on the hydrophobic plate.With respect to unselected set, two kinds of selections all produce the set of being rich in conjunction with total length C5.The all sequences that the embodiment here shows shows with 5 ' to 3 '.

Set preparation: dna profiling sequence

TAATACGACTCACTATAGGGAGAGGAGAGAACGTTCTACN (30) GGTCGATCGATCGATCATCGATG (ARC520; Serial number: 70) use ABI EXPEDITE ^TMDna synthesizer is synthetic, and by the standard method Deproteinization.71) and 3 ' primer CATCGATGATCGATCGATCGACC (serial number: 72) amplification, and be used for the template of Y639F simple point mutation t7 rna polymerase in vitro transcription subsequently template is with 5 ' primer TAATACGACTCACTATAGGGAGAGGAGAGAACGTTCTAC (serial number:.Use 200mM HEPES, 40nM DTT, 2mM spermidine, 0.01% Triton X-100,10% PEG-8000,9.5mM MgCl2,2.9mM MnCl ₂, 2mM NTPs, 2mM GMP, 2mM spermine, 0.01 unit/μ l inorganic pyrophosphatase and Y639F simple point mutation T7 RNA polymerase.

Select: the first round, filter column at nitrocellulose and carry out positive selection step.Concise and to the point, 1 * 10 ¹⁵(incubated at room is 1 hour in 1 * DPBS) in 100 μ l binding buffer liquid at the C5 that contains 3 μ M total length C5 or 2.6 μ M part pancreatinization in the RNA library of molecule (0.5n mole).Use Schleicher ﹠amp; Schuell (Keene, NH) 0.45 μ m nitrocellulose column spinner isolation of RNA: albumen composition and free RNA molecule.Pillar washes in advance with 1mL 1 * DPBS, contains RNA: proteic solution is added to pillar and with 1500g centrifugal 2 minutes.Unless wash three times with the specific junction mixture that gets on from filter membrane, subsequently with the bonded RNA of filter membrane with the 1mL buffer: albumen composition washes 2 eluting with elution buffer (3mM EDTA is preheated to 95 ℃ for 7M carbamide, 100mM sodium acetate).The RNA of eluting precipitates (2 μ L glycogens, 1 volume isopropyl alcohol, 1/2 volume ethanol).RNA with ThermoScript RT-PCRTM system (Invitrogen, Carlsbad is CA) according to manufacturer's explanation, use above-mentioned serial number: 72 3 ' primer carries out reverse transcription, carry out pcr amplification (20nM Tris pH8.4,50mM KCl, 2mM MgCl2 subsequently, 0.5 μ M primer, serial number: 71 and serial number: 72, every kind of dNTP 0.5Mm, 0.05 unit/μ L Taq polymerase (New England Biolabs, Beverly, MA)).Use Centricep pillar (Princeton Separatrions, Princeton, NJ) purification pcr template and be used for transcribing of next round set.

Subsequently one take turns selection in, (Nunc, Rochester NY) carry out separating of combination and free RNA with the hydrophobic plate of Nunc Maxisorp.Be fixed in the plate surface with 100 μ L, the 1 * DPBS that contains 20p mole total length C5 and part pancreatin C5 in 1 hour in room temperature respectively.Remove supernatant, (1 * DPBS) washes 4 times with 120 μ L lavation buffer solutions in the hole.The albumen hole is to contain the 1 * DPBS buffer sealing as the competition thing of 0.1mg/mL yeast tRNA and 0.1mg/mL salmon sperm DNA.The concentration of the set of using is usually above 5 times of protein concentration.In conjunction with RNA also in room temperature in conjunction with emptying aperture 1 hour removing any sequence in conjunction with plastics, and in not protein-contg blind hole, hatch before the positive is selected step, from set, to remove any sequence in conjunction with the competition thing.The RNA library is in incubated at room 1 hour, with fixation of C 5 bonded RNA in option board by add the RT mixture (3 ' primer, serial number: 72 and Thermoscript RT, Invitrogen) directly reverse transcription, and hatched 1 hour in 65 ℃.Last cDNA is used for PCR (Taq polymerase, New England Biolabs) template.The set template DNA of amplification is removed salt with Centrisep pillar (Princeton Separations) according to the explanation of manufacturer, and is used for transcribing of RNA library that next round selects.What each was taken turns transcribes set with 10% polyacrylamide gel purification.

Use sandwich to filter in conjunction with (dot blot) method monitoring selection course.5 '- ³²The RNA library (trace) and the C5 of P-labelling, 1 * DPBS add 0.1mg/mL tRNA and 0.1mg/mL salmon sperm DNA in incubated at room 30 minutes, carry out nitrocellulose with dot blot device (Schleicher and Schuell) subsequently and the nylon sandwich filters.Take turns the bonded RNA of calculating and monitoring and nitrocellulose library percent with simple scan (+/-300nM C5) per 3.Use albumen titration and dot blot device to measure library K as mentioned above _dValue.

Select data: two kinds of selections all surpass natural library through 10 after taking turns amplification.See Figure 18.The 10th takes turns, library K _dValue is approximately 115nM for total length, pancreatinization be 150nM, but the combination degree among both only is 10% at stable phase.TOPO TA clone's test kit (Invitrogen) clone and order-checking are used in the R10 library.

Sequence information: to 45 cloning and sequencings in each library.(serial number: 75) 24%, 2 group of copy and the unique sequence that occupies R10 total length library remedies residue to monoclonal ARC913.The 8 identical ARC913 sequences that copy are contained in R10 pancreatin library, and (serial number: 75), but this library is mainly another sequence (AMX221.A7; 46%).Clone ARC913 (serial number: 75) K _dValue is about 140nM, and combination degree is 20%.See Figure 19.

Listed unique sequence is 5 ' to 3 ' direction in the table 3, expression dRmY SELEX ^TMThe fit nucleotide sequence of selecting under the condition.In embodiment of the present invention, (and listed as the sequence) purine (A and G) that derives from selection is deoxidation, pyrimidine (U and C) and 2 '-OMe.The listed sequence of table 3 can contain or not contain medicated cap (for example, 3 '-oppositely dT).Following fit unique sequence is closely followed 5 ' fixed sequence program GGGAGAGGAGAGAACGUUCUAC (serial number: 73), and extend to 3 ' fixed nucleic acid sequence GUCGAUCGAUCGAUCAUCGAUG (serial number: 74) from nucleoside 23.

The fit nucleotide sequences of table 3:C5dRmY

ARC913 (serial number: 75)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCACAGGCAUACAUACGCAGGGGUCGAUCGAUCGAUCAUCGAUG

Hemolytic analysis: use above-mentioned haemolysis method, with ARC186 (serial number: 4) (anti--C5 is fit, positive control) and unselected dRmY library (negative control) relatively, analysis ARC913 (serial number: 75) for the effect of complement system classical pathway.In the haemolysis inhibition method, at disappearance ARC913 (serial number: in the time of 75) with the sheep red blood cell (SRBC) of 0.2% human serum and antibody-Bao quilt (Diamedix EZ Complement CH50 test, Diamedix Corporation, Miami, FL) mixing.Containing calcium, the Barbiturate buffer (GVB of magnesium and 1% gel ⁺⁺The complement buffer) tests in, and hatched 1 hour in 25 ℃.Hatch the back sample through centrifugal.Measure the 415nm absorbance (OD of supernatant ₄₁₅).Relatively represent to suppress active with the % hemolytic activity of contrast with haemolysis.See Figure 20.Fit IC ₅₀Be 30nM as calculated.

Embodiment 3

Composition and sequence optimisation

Embodiment 3A:ARC913 optimizes

(serial number: six kinds of structures 75) are through transcribing, and gel-purified is measured and the combining of C5 with dot blot based on ARC913.ARC954 is similar to maternal clone, its K _dValue is 130nM, and combination degree is 20%, and ARC874 (serial number: 96) be another kind of clone in conjunction with C5, its K _dValue is 1Mm.

The listed independent sequence of table 4 is 5 ' to 3 ' direction, derive from dRmY SELEX condition select fit.(and listed sequence the represent) purine (A and G) that derives from this selection in embodiment of the present invention is deoxidation, and pyrimidine (U and C) is 2 '-OMe.Listed each can comprise or not comprise medicated cap (for example, 3 '-oppositely dT) in the table 4.

The minimum clone's of table 4.ARC913 nucleotide sequences

ARC874 (serial number: 76)

CCUUGGUUUGGCACAGGCAUACAUACGCAGGG

ARC875 (serial number: 77)

CCUUGGUUUGGCACAGGCAUACAAACGCAGGG

ARC876 (serial number: 78)

GGGUUUGGCACAGGCAUACAUACCC

ARC877 (serial number: 79)

ARC878 (serial number: 80)

GGCGGCACAGGCAUACAUACGCAGGGGUCGCC

ARC954 (serial number: 81)

CGUUCUACCUUGGUUUGGCACAGGCAUACAUACGCAGGGGUCGAUCG

The optimization of embodiment 3B:ARC913: doping gravity treatment

Mixing, (serial number: C5 binding affinity 75) is also measured crucial in conjunction with factor to optimize clone ARC913 in gravity treatment.The doping gravity treatment is used for required sequence is exposed to active clone or minimer.Synthetic with what design based on unique sequence, the degeneration library is selected.Deterioration level is generally 70% to 85% of wild type nucleoside.Usually, can obtain natural mutation, the change of sequence can strengthen affinity under the certain situation.Composition sequence information can be used to identify minimum knot matched moulds body and be positioned to optimize effect.

The preparation in library: template sequence

TaatacgactcactataGGGAGAGGAGAGAACGTTCTACN ₍₃₀₎75) GTTACGACTAGCATCGATG (serial number: 82) be based on ARC913 (serial number:, originating from doped level with each is that the residue of 15% random areas is synthetic, for example, each is (" N ") site at random, it is that (serial number: the nucleoside 83), 15% probability are a kind of of other three kinds of nucleoside to wild-type sequence CTTGGTTTGGCACAGGCATACATACGCAGGGGTCGATCG that residue has 85% probability.

The template and the RNA library that prepare the doping gravity treatment as mentioned above.Template through primer taatacgactcactataGGGAGAGGAGAGAACGTTCTAC (serial number: 84) and CATCGATGCTAGTCGTAAC (serial number: 85) amplification.Carry out twice selection with total length C5, use high salt concentration solution in a kind of washing step of selection.Carry out system of selection as mentioned above, except: 1) the 1st take turns use hydrophobic plate (and in circulation subsequently), positive step of a step is only arranged; And 2) all do not use the competition thing in selecting.C5 concentration and RNA library concentration are maintained 200nM and 1 μ M respectively.

Doping gravity treatment data.The selection of normal and high salt concentration through 5 take turns circulate after enrichment.The 5th takes turns, the k in library _dValue is 165nM in high salt concentration is selected, and normal-salt is 175nM in selecting.The combination degree of both stable phases all is 20%.(CA) clone R4 library is to 48 cloning and sequencings in each library for Invitrogen, carlsbad to use TOPO TA clone test kit.12 clones in each library transcribe and carry out the single-point hybridization analysis with 500nM C5.Use above-mentioned dot blot method to measure dissociation constant (K again _Ds).By with data substitution equation: segment RNA combination=amplification * K _d/ (+[K _d] C5), 11 best clones' that identify in the assessment simple scan K _DsThree best K _dThe clone be serial number: 91 (73nM), serial number: 96 (84nM) and serial numbers: 95 (92nM).Table 5 has been listed 11 clones' sequence.

The listed sequence of table 5 is 5 ' to 3 ' direction, the fit nucleotide sequences that expression is selected with dRmY SELEX condition.Derive from (and listed sequence represent) of this selection in embodiment of the present invention, as describing in the literary composition, corresponding sequence comprises the dRmY associating of residue, and wherein purine (A and G) is deoxidation, and pyrimidine (U and C) is 2 '-OMe.Listed each can comprise or not comprise medicated cap (for example, 3 '-oppositely dT) in the table 5.Following fit unique sequence is closely followed 5 ' fixed sequence program GGGAGAGGAGAGAACGUUCUAC (serial number: 86), and extend to 3 ' fixed nucleic acid sequence GUUACGACUAGCAUCGAUG (serial number: 87) from nucleoside 23.

The cloned sequence of table 5. doping gravity treatment

(serial number: 88)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCACAGGCAUACAUACGCAGGGGUCGAUCGGUUACGACUAGCAUCGAUG

(serial number: 89)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCACAGGCAUACAUACGCAGGUGUCGAUCUGUUACGACUAGCAUCGAUG

(serial number: 90)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCACAGGCAUAAAUACGCAGGGCUCGAUCGGUUACGACUAGCAUCGAUG

(serial number: 91)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCCCAGGCAUAUAUACGCAGGGAUUGAUCCGUUACGACUAGCAUCGAUG

(serial number: 92)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCGCAGGCAUACAUACGCAGGUCGAUCGGUUACGACUAGCAUCGAUG

(serial number: 93)

GGGAGAGGAGAGAACGUUCUACCUUGUUGUGGCACAGCCAACCCUACGCACGGAUCGCCCGGUUACGACUAGCAUCGAUG

(serial number: 94)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCACAGGCAUACAUACGCAGGUCGAUCGGUUACGACUA

(serial number: 95)

GGGAGAGGAGAGAACGUUCUACCUUAGGUUCGCACUGUCAUACAUACACACGGGCAAUCGGUUACGACUAGCAUCGAUG

(serial number: 96)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCNCAGGCAUANAUACGCACGGGUCGAUCGGUUACGACUAGCAU

(serial number: 97)

GGGAGAGGAGAGAACGUUCUACCUUUCUCUGCCACAAGCAUACCUUCGCGGGGUUCUAUUGGUUACGACUAGCAUCGAUG

(serial number: 98)

GGGAGAGGAGAGAACGUUCUACCUUGGUUUGGCACAGGCAUAUAUACGCAGGGUCGAUCCGUUACGACUAGCAUCGAUG

Embodiment 3C; The PEG of 40kDa branch of ARC186 modifies

Oligonucleotide 5 ' NH ₂-

FCmGfCfCGfCmGmGfUfCfUfCmAmGmGfCGfCfUmGmAmGfUfCfUmGmAmGfU fUfUAfCfCfUmGfCmG-3T-3 ' (ARC672; serial number: 63) quickening dna synthesizer (ABI; Foster City; CA) go up RNA phosphoramidite (the Glen Research that the commercial 2 '-OMe RNA that provides and 2 '-F RNA and TBDMS-protection are provided according to the scheme of manufacturer; Sterling, VA) and oppositely deoxidation pyrimidine CPG standard substance are synthetic.Terminal amino group functional group and 5 '-ammonia-trim, 6-(trifluoroacetamido) hexyl-(2-cyanoethyl)-(N, N-diisopropyl)-phosphoramidite, C6-TFA (Glen Research, Sterling, VA) combination.After the Deproteinization, oligonucleotide is gone up purification and through ethanol precipitation with ion exchange chromatography at Super Q 5PW (30) resin (Tosoh Biosciences).

Amido modified fit with the different PEG aglucon combination in synthetic back.It is fit that to be dissolved in water/DMSO (1:1) solution to concentration be between 1.5 to 3mM.Adding pH8.8 sodium carbonate buffer to final concentration is 100mM, the PEG reagent of the expectation that surpasses 1.7 times of its moles in oligonucleotide and dissolving and the equal-volume acetonitrile (for example combines, ARC1905 40kDa Sunbright GL2-400NP p-nitrophenyl phosphate [NOFCorp, Japan], or ARC 187 40kDa mPEG2-NHS esters [Nektar, Huntsville AL]).Last product carries out ion-exchange chromatogram purification with Super Q 5PW (30) resin (TosohBiosciences), and uses amberchrom CG300-S resin (Rohm and Haas) to carry out reverse chromatograms to desalt, and lyophilizing.Figure 21 has shown that (serial number: structure 5), Figure 22 has shown ARC1905 (serial number: structure 67) to ARC187.

Embodiment 4

The isolation perfusion heart model

Embodiment 4A:ARC186 principle tests

The mean concentration of complement component C5 is about 500nM in the human plasma.When the dabbling separation mouse heart of Krebs Heinseleit buffer is exposed to 6% human plasma, but the amplification of activation of human complement cascade causes C5 to be cracked into C5a and C5b.Composition C5b subsequently with complement component C6, C7, C8 and C9 form complex, (" MAC " or C5b-9), it can damage cardiovascular and cardiac muscle causes the myocardial damage (end diastolic pressure of increase like this to be called " membrane attack complex ", arrhythmia) and asystole (Evants etc., Molecular Immunology, 32,1183-1195 (1995)).Previous, suppress cracked monoclonal of human C5 and single-chain antibody (list of Pexelizumab or Pexelizumab-chain scFv form) and can in this model, test and show inhibition (Evans etc., 1995) myocardial damage and dysfunction.

This model is used to set up C5-and suppresses fit ARC186 (serial number: 4), be similar to Pexeluzimab, suppress the complement damage of the isolation perfusion mouse heart of human C5-mediation.(Wilmington MA) buys the C57B1/6 mice from Charles River laboratory.Concise and to the point, behind the deep anaesthesia, separate the heart of each mice, and insert large artery trunks, with Krebs Heinseleit buffer continous pouring with flat terminal syringe needle.(mice is special, and Boston MA) is inserted into left ventricle with the METHOD FOR CONTINUOUS DETERMINATION rhythm of the heart and intraventricular pressure for pressure transducer.Balance 15 minutes, establishment of base line, subsequently heart with contain 6% human plasma+/-buffer that variable concentrations is fit perfusion (seeing Figure 23).In this research of describing as Evans etc., we find depletion to occur with Krebs Heinseleit buffer+6% human plasma in 5 minutes, and only continue to beat above 2 hours with the heart of buffer continous pouring.Therefore, the length of every kind of test is defined as 15 minutes.Figure 23 has described the result of study that ARC186 carries out.

Continuous monitoring and record intraventricular pressure can obtain pressure variation (Figure 24 and 25).Minimum intersection point is represented end diastolic pressure (" EDP "), and the highest intersection point is represented systolic pressure (" SP ").The baseline pressure curve post that is positioned at the vertical black line left side in each figure is designated as " 0." (Evans etc., 1995) as described above, show the quick rising that press at left ventricular diastolic end with the dabbling heart of 6% human plasma, in 5 minutes, culminate during asystole (heart stops) at last.Be added in the human plasma with the irrelevant fit of 50-times of molar excess, also observe the EDP and the asystole (Figure 24) that have increased.

When ARC186 with equimolar amounts adding system in the time, EDP also has quick increase, (Figure 25) culminates during asystole.Show complement-mediation damage, in the EDP of rising and asystolic all three groups of hearts, test last heart and be tangible edematus and edema shape.When adding 10-in the blood plasma doubly or during the ARC186 (Figure 25) of 50-times of molar excess, ventricular pressure curve is kept normally, and does not observe asystole.In addition, in these groups, do not observe aforesaid edema and swelling yet.

In each test, noted down heart rate at interval in every 5-minute, to the average heart rate mapping of each compartment in each group.Show not have fit perfusion or occur asystole immediately, usually in 5 minutes with irrelevant fit dabbling heart as Figure 26.With etc. the ARC186 that is added in the system of mole two delay asystolic appearance significantly.Yet the heart in this group is still depleted at last.Add to surpass 10-doubly or the ARC186 of 50-times of mole in each test, all protected heart rate.

The heart (10-doubly and the ARC186 of 50-times of molar excess) that calculates representational failure heart (no fit or 50-times of molar excess irrelevant fit) and relative ARC186-protection surpasses the cardiac weight increase percent of baseline.As shown in figure 27, the heart of ARC186 protection obviously reduces than the weight of failure heart in the matched group.

Because ARC186 suppresses C5 but not the cracking of C3, from the effluent of the isolating cardiac of ARC186 protection, find C3 pyrolysis product (C3a), but not C5 pyrolysis product (C5a or C5b).For showing that directly ARC186 suppresses the cracking of human plasma C5, each organizes ELISA kit measurement (the C5b-9ELISA test kit that the relative level of human complement PROTEIN C 5a in the effluent and C5b (C5 pyrolysis product) and C3a (C3 pyrolysis product) provides by commerce, Quidel, San Diego, CA; C5a and C3aELISA test kit, BD biosciences, San Diego, CA).ARC186 suppresses the cracking of human plasma C5 and the generation of C5a (Figure 28) and C5b-9 (Figure 29) with the form that metering relies on.On the contrary, ARC186 is cracked into C3a and the no effect of C3b (Figure 30) for human C3, further shows the molecular specificity of C5.

In case produce, complement C3b and C5b fragment deposit in the tissue that closes on the complement activity site.After test was finished, mouse heart was at OCT medium (Sakura Rinetek, Torrance, CA) freezing in, section is also used the dyeing of standard immunoassay group, observes human C3b (clone H11, Chemicon, Temecula, CA), human C5b-9 (clone aE11, DAKO, Carpinteria, CA) or control mice IgG (VectorLaboratories, Burlingame, existence CA).The result of this research that Figure 31 shows.

As described in this research, based on aforesaid research, test is anti--C5 antibody Pexeluzimab complement system effect (Evans, Molecular Immunol 32:1183, (1995), use Krebs Heinseleit buffer and the dabbling mouse heart that separates of 6% heparinization human plasma, with tissue injury's external model of complement component C5-mediation C5-is suppressed fit ARC186 and test.Use this model, show that C5-suppresses the cracking that fit (a) suppresses human plasma C5 (but not C3), (b) suppress human C5 (but not C3) and suppress the myocardial damage that human C5b-9 mediates with clinical related concentrations (5 μ M surpass C510 times of mole) in the structural deposition of mouse heart with (c).These data show are when the human complement cascade is amplified in when being activated on the relevant mode of physiology, and C5-suppresses fit and can suppress the cracking of plasma C 5 and prevent myocardial damage and depletion.

The effect that embodiment 4B:PEGization is fit

Identical among the material that uses in this research and method and the above embodiments 4A.Figure 32 shows EXPERIMENTAL DESIGN and result.Test first half end user heparinoid blood plasma (Center for Blood Research, Inc., Harvard Medical School, Boston, MA) originate as complement, second portion uses heparinization macaque blood plasma, and (Charles River Laboratories, Wilmington MA) originates as complement.Fit (the ARC658 of PEGization; Serial number: 62) be added in the system with the molar ratio that increases.Though all relevant ventricular pressure curves all are collected, tabular has gone out the existence or the disappearance of the diastolic pressure in latter stage (EDP) that increases, and no matter whether asystole takes place, and the time is until heart failure (being defined as EDP increases and asystolic appearance).

In the process of the test that human plasma carries out; (serial number: optimal dose 62) is after measured for waiting mole (500nM) for ARC658; and in the test of non-human primates blood plasma, need 50-times of molar excess (25 μ M) to be subjected to the damage (seeing Figure 32) of C5b-mediation with the protection heart.

Show in these data and the in vitro tests anti--that C5 is fit is consistent for the difference of human and non--human primates C5 affinity.Do not expect to be limited to theory, in our the macaque PK/PD research subsequently that embodiment 5 describes, further show 30-times of molar excess fit be that to suppress plasma C 5 cracking of zymosan-mediation required, further support fit affinity to be lower than the viewpoint of human C5 in conjunction with primates C5.

4) and the ARC658 of wider scope (serial number: be effective 62) summary, these studies show that C5-suppresses fit ARC186 (serial number: in mice isolation perfusion heart model.This model also shows than the heart and injury (equimolar amounts) of human C5-mediation, need to use more ARC658 (serial number: 62), further support fit and the in vitro tests data bonded more low-affinity of primates C5 to suppress the heart and injury (30+ molar excess) of macaque plasma C 5-mediation.At last, these data show that macaque need surpass 30-times of mole to study C5 inhibition in total display body at PK/PD.

Embodiment 5 is anti--C5 is fit in animal drug metabolism and pharmacokinetics

Among the embodiment 5A-5G, all concentration datas based on quality only refer to the molecular weight of fit oligonucleotide part, and the quality that is connected with PEG is irrelevant.

The generation of embodiment 5A:C5 mortifier ARC186 in primates and rat plasma Thank to stability

Fit non-PEGization oligonucleotide precursor (for example, ARC186; Serial number: 4) rat and macaque blood plasma (Charles River Labs, Wilmington, MA) the middle test to assess its stability, kinetic rate, and degradation pathway.Use 5 ' end-radio-labeled ( ³²P) fit hatches in 95% blood plasma (Citrated) in 37 ℃ and to surpass 50 hours and test.The time point of all selections is drawn the fit blood plasma that contains of equivalent, and quick-freezing in liquid nitrogen immediately is stored in-80 ℃.Use liquid phase-liquid phase (phenol-chloroform) extracting, gel electrophoresis (10% reduction polyacrylamide sequencing gel) and high definition autoradiography are measured and are analyzed fit in the blood plasma and its metabolism.

Figure 33 shown in rat and the macaque blood plasma, as the log-linear figure of the fit surplus of total length of incubation time parameter.Degradation characteristic in two species appears as fully monophasic, and its constant rate is k～0.002 hour ^-1

Embodiment 5B:ARC657, ARC658 and ARC187 annotate at the rat medium-sized vein Pharmacokinetics after penetrating

For analyzing ARC657 (serial number: 61), 62) and ARC187 (serial number: pharmacokinetic properties 5) ARC658 (serial number:, and required dosage level and administration frequency among the assessment primates and the mankind, at Sprague-dawley rat (the Charles River Labs that inserts conduit, Wilmington carries out pharmacokinetic on MA).Fitly in normal saline solution, make 10mg/mL (oligonucleotide weight) form, and aseptic filtration under aseptic condition (0.2 μ m) is gone in advance in the disinfectant dose jar.Route of administration in the rat studies is by the tail intravenous injection with 10mg/kg dosage.Form by 3 animals for every group in the research, before the administration and the particular point in time sterile blood sampling of administration after 48 hours.Figure 34 has shown research design.The jugular vein conduit that inserts from operation obtains blood sample, directly is transferred in the pipe of EDTA-bag quilt, and the vibration mixing, and be positioned on ice until carrying out the blood plasma operation.

Blood-EDTA pipe was collected blood plasma in centrifugal 5 minutes through 5000rpm, and supernatant (blood plasma) is transferred to new pre--labelling pipe.Plasma sample is stored in-80 ℃ until test.Contain the fluorescence accounting mensuration reagent Oligreen that commerce provides by directly blood plasma equivalent being added ^TM(Molecular Probes, Eugen OR) carry out the homogeneous test form plasma sample ARC187 are analyzed.Incubated at room is (5 minutes) after the short time, and lucifuge is with fluorescent screen readout instrument (SpectraMax Gemini XS, Molecular Devices, Sunnyvale, CA) determination test plate.Fluorescence signal in each hole and fit concentration are proportional, by the fluorescent value substitution is calculated concentration of specimens by fluorescence concentration standard curve (two-fold or triple meansigma methods curves).Obtain the mean plasma concentration of every group of each each time point of animal.Use industrial standard pharmacokinetic model software WinNonLinTM v.4.0 (Pharsight Corp., Mountain View, CA) to plasma concentration relatively and time data carry out the non-analysis (NCA) of cutting apart.Obtain assessment from following basic pharmacokinetic parameter: maximal plasma concentration, C _MaxArea under the concentration-time curve, AUC; Half-life, t1/2; Terminal is removed, C1; With the volume distributed median of constant attitude, V _Ss

Figure 35 has shown mean plasma concentration with respect to the data of time, and maps in Figure 36.Use WinNonLinTM v.4.0 concentration to be cut apart analysis (NCA) with respect to the data of time.This data description of analyzing generation is in Figure 37.

As the expection, the fit ARC187 of 40kDa (serial number: 5) have the longest half-life, and the fit ARC187 of 20kDa (serial number: 61) have the shortest.Obtain (～40mL/kg) Vss shows ARC187 (serial number: 5) for the moderate combination/disappearance of albumen and/or vein external space tissue with respect to known blood plasma volume.Suppose to keep the fit of 5 times of molar excess, ARC187 (serial number: 5) provide and keep the required fit administration frequency of expectation blood plasma level and the clear superiority of total amount originally is provided.

The similar fit research of carrying out in Rodents and primates (data not shown) before is show dose proportionality/linearity, to 30mg/kg, is unexpected so this dosage level will cause the characteristic of nonlinear pharmacokinetics until the dosage height.

Embodiment 5C:ARC187 and ARC1905 be the medicine after the administration in mouse vein For kinetics

(serial number: 4) the oligonucleotide skeleton is different from ARC187 (serial number: pharmacokinetics 5) in order to study the ARC186 that connects with the different PEG of 40kDa branch, female CD-1 mice (from Charles River Labs, Wilmington, MA obtains) on carry out pharmacokinetic.Fitly in normal saline solution, make 2.5mg/mL (oligonucleotide weight) form, and aseptic filtration under aseptic condition (0.2 μ m) is gone in advance in the disinfectant dose jar.Route of administration in the mice study is by the tail intravenous injection with 10mg/kg dosage.Form by 3 animals for every group in the research, before the administration and the particular point in time sterile blood sampling of administration after 72 hours.Figure 38 A has shown the design of research.

With terminal ventricle puncture blood collecting, directly be transferred in the pipe of EDTA-bag quilt, the vibration mixing, and be positioned on ice until carrying out the blood plasma operation.Blood-EDTA pipe was collected blood plasma in centrifugal 5 minutes through 5000rpm, and supernatant (blood plasma) is transferred to new pre--labelling pipe.Plasma sample is stored in-80 ℃ until test.Contain the fluorescence accounting mensuration reagent Oligreen that commerce provides by directly blood plasma equivalent being added ^TM(Molecular Probes, Eugen OR) carry out the homogeneous test form plasma sample ARC187 are analyzed.Incubated at room is (5 minutes) after the short time, and lucifuge is with fluorescent screen readout instrument (SpectraMax Gemini XS, Molecular Devices, Sunnyvale, CA) determination test plate.Fluorescence signal in each hole and fit concentration are proportional, by the fluorescent value substitution is calculated concentration of specimens by fluorescence concentration standard curve (two-fold or triple meansigma methods curves).Obtain the mean plasma concentration of every group of each each time point of animal.Use industrial standard pharmacokinetic model software WinNonLinTM v.4.0 (Pharsight Corp., Mountain View, CA) to plasma concentration relatively and time data carry out the non-analysis (NCA) of cutting apart.Obtain assessment from following basic pharmacokinetic parameter: maximal plasma concentration, C _MaxArea under the concentration-time curve, AUC; Half-life, t1/2; Terminal is removed, C1; With the volume distributed median of constant attitude, V _SsFigure 38 B has shown the data of mean plasma concentration with respect to the time.

Use WinNonLinTM v.4.0 concentration to be cut apart analysis (NCA) with respect to the data of time.This data description of analyzing generation is in Figure 38 C.As expection, the 40kDa PEG that derives from two suppliers has shown identical pharmacokinetics in mice.

Identical ARC187 that above-mentioned use oligreen analyzes and 1905 plasma samples use high performance liquid chromatography (HPLC) to analyze and measure with UV.

Use Microsoft Excel 2003 to calculate the mean plasma concentration value of ARC187 and ARC1905.Before being lower than administration, the plasma concentration value during bioanalysis LIOQ value of (0 time), then gives 0 value.The sample that is lower than the LIOQ value after the administration is ignored from mean plasma concentration calculates.Use WinNonlin, (Pharsight Corporation, Mountainview CA), are used for the PK analysis that model-non-relies on the mean plasma concentration data to version 5.1.Use linear trapezoidal rule assessment plasma concentration-time graph (AUC _{0-is final}) under area.For calculating, be lower than the value that LIOQ analyzes, except the sample before the administration, will from calculating, the PK parameter evaluation ignore.Use equation t _1/2=0.693/ λ z calculates the outer half-life that shows, and wherein λ z is the constant clearance rate of concentration with respect to assessment in the terminal slope decay of time graph.At least three plasma concentration of end behind the peak concentration in mutually are used to measure λ z, and the correlation coefficient (r that measures ²) require 〉=0.85.

Summary, HPLC analyzes and has proved conclusively previous oligreen analysis, shows based on average C _Maximum, AUC _{0-is final}And AUC _0-∞Parameter compares, and ARC1905 and ARC187 have biological identity property.AUC between ARC1905 and ARC187 _{0-is final}And AUC _0-∞The difference of value (being measured by HPLC) is equal at biology can be accepted to require in ± 20%.

Embodiment 5D: inject C5 mortifier ARC657 after the administration in the mouse vein, AR The tissue distribution research of C658 and ARC187

(Wilmington MA) obtains female CD-1 mice from Charles River Labs.Preparation 5mg/mL ARC657 (serial number: 61), 62) and ARC187 (serial number: 5) inject salt solution ARC658 (serial number:.Under aseptic condition with dosage form aseptic filtration (0.2 μ m) as in advance-dose jar of degerming in, animal with the dosage of 25mg/kg by the administration of tail intravenous injection.Every group comprises 3 animals and 4 time points, before the t=administration, and 3,6,12 hours.After the blood-letting, (flushing of V～30mL) is to remove the blood that retains in any vascular with a large amount of saline solution for the vascular system of each animal.Collection organization's (heart, lung, kidney) weighs, and homogenizes in normal saline solution with 50%w/v, is stored in-80 ℃ until analysis.

The ELISA-type method of using the hybridization basis to organize ARC657 (serial number: 61), 62) and ARC187 (serial number: 5) analyze ARC658 (serial number:.In this method, the biotin labeled probe predetermined fixed that with concentration is 125nM was in 96 orifice plates 3 hours.Plate washes 5 times with 1 * PBS.With 150 μ l/ hole 1 * SuperBlock TBS (Pierce Chemical, Rockford, IL) sealing plank.At this flushing plate, cover and be stored in 4 ℃ until use.In separator tube, sample is measured probe in 90 ℃ of annealing 10 minutes at (5 '-fluorescein) sample that contains 200nM FAM-labelling, places on ice immediately.Concentration standard product and blood plasma/organize check sample also with sample-mensuration probe solution pre--annealing, and be added in the test plate hole that contains the plain probe of fixed biologically, in 45 ℃ of annealing 2.5 hours.Wash plate once more, with 100 μ l/ holes add the anti--fluorescein monoclonal antibody contain 1 μ g/mL and to connect horseradish peroxidase (anti--FITC MAb-HRP, Molecular Probes, Eugene, 1 * PBS OR), and hatching about 1 hour.As above wash plate once more.Add 100 μ l contain fluorescence HRP substrate (QuantaBlu, Pierce Chemical, Rockford, solution IL), lucifuge was hatched 20-30 minute.After hatching 45 minutes, add stop buffer to stop the reaction of formation of fluorescence precipitation with 100 μ l/ holes.(Sunnyvale CA) reads plate with 325nm exciting light and 420nm absorbing light for SpectraMax Gemini XS, Molecular Devices in fluorescence microwell plate readout instrument.Every hole is measured 10 times.Three kinds of in the heart tissue all are fit at three time point determinings (Figure 39).

Embodiment 5E: C5 mortifier ARC657, ARC658 and ARC in the research 1 Pharmacokinetics and pharmacodynamics behind the 187 macaque intravenous administrations

ARC657 (serial number: 61), 62) and ARC187 (serial number: 5) in normal saline solution, make the 10mg/mL form, and aseptic filtration under aseptic condition (0.2 μ m) is gone in advance in the disinfectant dose jar ARC658 (serial number:.The route of administration that is used for macaque research is with 30mg/kg dosage intravenous injection (being about 50-times of molar excess) by operation implanted unit ductus arteriosus.Figure 40 has described research design.Obtain blood sample from femoral catheter, be transferred to immediately in the pipe of sodium citrate bag quilt, the vibration mixing is placed on ice until centrifugal separation plasma (3000rpm 5 minutes).Blood plasma is divided into 25 μ l, is stored in-80 ℃, and each sample is got a Oligreen that uses fluorescence-basis of describing in the aforementioned P of Rats K chapters and sections ^TMMethod is assessed fit concentration.

The primates plasma concentration is represented with form in Figure 41 with respect to the data of time.As expection, the fit ARC187 of 40kDa PEG (serial number: 5) in blood plasma, keep maximum duration, and the fit ARC657 of 20kDa PEG (serial number: 61) keep the shortest time.Data show among Figure 41 is two-and gap model will make data the most suitable.Like this, the pharmacokinetic parameter assessed value of reporting among Figure 42 derives from and uses industrial standard pharmacokinetic model software WinNonlinTM v.4.0 (Pharsight corp., Mountain view, two-gap model CA).

Show that as Figure 42 all are fit to have similar C _MaximumValue between 23 and 30 μ M, shows that fit dosage (30mg/kg) can fully obtain the concentration of the fit relative C550 times molar excess of blood plasma (50 times of molar excess are about 25 μ M).Dull its has the difference of 10000 molecular weight, ARC657 (20kDa PEG) (serial number: 61) with ARC658 (30kDa PEG) (serial number: 62) have similar exposure (AUC), t _{1/2 (α)}And t _{1/2 (β)}Be worth, have the t of prolongation than other molecules _{1/2 (α)}With slightly long t _{1/2 (β)}

The extra plasma sample of collecting in the pharmacokinetic is used for analyzed in vitro subsequently and measures the effect that primates C5 suppresses.Carry out the zymosan activity test as mentioned above to measure primates C5b-9 and C5a quantity.In a variety of forms to data mappings, comprise C5b-9 concentration with respect to the sample time (Figure 43 a), C5b-9 concentration is with respect to fit concentration (Figure 43 b), C5a concentration with respect to sample time (Figure 43 c) and C5a concentration with respect to fit concentration (Figure 43 d).

The fit ARC187 of 40kDa PEG (serial number: 5) suppress the cracking (C5b-9 and C5a concentration) of primates C5 for a long time.When to C5b-9 and C5a data during with respect to fit concentration mapping, it shows that C5 suppresses fit concentration and must surpass 30 times of moles, no matter and the PEG bulk of molecule, to suppress C5 cracking (Figure 43 b and 43d) fully.

Summary, macaque PK/PD data shows that (a) is as expection, need at least 30 times of excessive fit (fit concentration of about 15 μ M blood plasma) with known C5 in the intravital cracking of macaque, no matter and the size of PEG group, (b) C5-suppresses the fit overt toxicity that do not cause in these species, and (c) when animal gives relative high dose (50 times of molar excess), the fit level of blood plasma maintains analysis level when at duration of test and makes it to calculate pharmacokinetic parameter.

Embodiment 5F:C5 mortifier ARC658 and ARC187 give at the macaque intravenous Pharmacokinetics behind the medicine and pharmacodynamics-research 2

62) and ARC187 (serial number: 5)) research is 2 similar to above-mentioned research 1, except a) only having assessed two chemical compounds (ARC658 (serial number:; B) animal in every group increases to 4; And c) deleted 1-minute plasma sample, substituted with 144 hours samples and be based on more multi-site data to prove conclusively the terminal half-life.This two kinds of forms and dosage, blood sampling is consistent with the method for description in the above-mentioned research 1 with the separating plasma technology.Figure 44 has described and has studied 2 design.

After research 2 is finished, as study 1 analysed for plasma measuring the fit concentration of blood plasma of different time points behind a) intravenous administration, and b) effect that suppresses of C5.

The fit concentration of blood plasma is as function (Figure 45) mapping of time, and ARC658 (serial number: 62) and ARC187) (serial number: represent with form in Figure 39 and 40 by early results 5).The fit ARC187 of 40kDa PEG (serial number: 5) in blood plasma, exist for a long time.The inspection of Figure 45 show two-gap model can the time data best-fits.Like this, the pharmacokinetic parameter assessed value of reporting among Figure 46 derives from and uses WinNonlinTM v.4.0 (Pharsight corp., Mountain view, two-gap model CA).

In the comparison of the pharmacokinetic parameters that above-mentioned PK/PD research 1 and research 2 produce, (serial number: 62) and ARC187) (serial number: data 5) are except the t of ARC187 for ARC658 _{1/2 (α)}All be similar outside the measured value.Yet do not expect to be limited to any theory, ARC187t in two kinds of researchs _{1/2 (α)}The difference of measured value may cause owing to less sample size in the preliminary study.

62) and ARC187 (serial number: C 5) show ARC658 (serial number: as Figure 46 _MaximumBe worth similar.Opposite, drug exposure (AUC) is with ARC187 (serial number: 5) obviously bigger in the animal of Chu Liing.ARC187 is than ARC658 (serial number: 62) have longer t _{1/2 (α)}Value and t _{1/2 (β)}Be worth these data, the data that produce in PK/PD research 1 show that C5-suppresses fit ARC187 and can provide C5 inhibition in the most effective body with given dose.

The extra plasma sample of collecting in the pharmacokinetic is used for analyzed in vitro subsequently and measures the effect that primates C5 suppresses.Carry out the zymosan activity test as mentioned above to measure primates C5b-9 and C5a quantity.With respect to fit concentration (Figure 48) data are mapped with respect to fit concentration (Figure 47) and C5a concentration with C5b-9 concentration.Show in the PK/PD research 1 that as described above C5 suppresses fit concentration must surpass 30 times of moles (fit for plasma C 5 concentration), or about 15 μ M, no matter and the PEG bulk of molecule, with the cracking (Figure 41 and 42) that suppresses primates C5 fully.

By the tables of data in Figure 39 and 40 is checked, show that 30-mg/kg I.V. injects after, ARC658 (serial number: 62) keep 15 μ M after 4 hours and keep 15 μ M after ARC1878 hour.Like this, give similar drug dose, the fit ARC187 of 40K provides and has doubled the fit ARC658 of 30K (serial number: clinical effectiveness 62).

Summary, macaque must be so that look younger and transform in the C5 body suppressing for the aptamer therapeutics of 530 times of molar excess of plasma C.These data and previous external (haemolysis) and the data consistent in a junctor interior (isolation perfusion mouse heart) research, it shows that C5-has lower affinity than human C5 in conjunction with fit in primates C5.Having shown that C5-is consistent fitly can pass through the intravenous injection administration with height to 30mg/kg dosage safety ground, it equals 50 times of molar excess fit of C5 concentration.

The intravenous push administration of embodiment 5G:ARC1905 in macaque

The pharmacodynamics of C5 mortifier ARC1905 is by the assessment of macaque intravenous administration.The fit 7.5mg/mL form of in normal saline solution, making, and aseptic filtration under aseptic condition (0.2 μ m) is gone in advance in the disinfectant dose jar.Macaque (n=4) by intravenous injection with dosage 0 (saline solution contrast) or 30mg/kg administration.By peripheral vein or arterial blood drawing, blood sample (0.5mL) directly is transferred to dipotassium (K ₂) the EDTA pipe, place and wet on ice, 4 ℃ of collections in centrifugal 30 minutes.

Plasma sample is measured the effect of ARC1905 in primates C5 suppresses with in vitro tests.The zymosan test that the ARC1905 that describes among the embodiment 1C is relevant is used to measure the quantity that primates C5a produces.Administration 0.5 and after 2 hours the minimizing of back-zymosan C5a value show that ARC1905 suppresses cracked mode in the body of C5 in macaque, with ARC187 with same concentrations and identical route of administration, use the mode of zymosan activity test external test similar.

Embodiment 5H:C5 mortifier ARC187 in the macaque medium-sized vein, inject administration and Pharmacokinetics of inculcating and pharmacodynamics

Inculcate assessment ARC187 (serial number: pharmacokinetics 5) (PK) and pharmacodynamics (PD) characteristic by carrying out intravenous behind the macaque intravenous push immediately.Figure 49 has shown this research design.

Use the pharmacokinetic parameter that draws in the intravenous push research of listing among Figure 50 to calculate and obtain required bolus dose and the infusion rate of target stabilization sub stage 1 μ M plasma concentration.

Three macaques are used for the ARC187 administration, and intravenous push dosage is 1mg/kg, carry out intravenous with 0.0013mg/kg/ minute immediately and inculcate 48 hours.Collect whole blood sample in 0-192 hour from treating the back, place and wet on ice, be used for the blood plasma test, be stored in-80 ℃ subsequently.High performance liquid chromatogram (HPLC) method of using fluorescence to adjust colouring method (describing among the embodiment 5B) and GLP-checking is measured the ARC187 plasma concentration.The HPLC method of measuring ARC187 in the macaque blood plasma is by ClinTrials Bio-Research (Montreal, Canada) checking.Verification operation requires (21 CFR § 58) to finish according to U.S. food Drug Administration (FDA) laboratory operation standard (GLP).With selectivity, linearity, quantitatively lower bound (LLOQ) is delayed, precision and accuracy in batch, precision and accuracy between batch, liquid storage stability, injection stability, short-term substrate stability, freeze-thaw stability, long-term substrate stability and dilution factor are verified the HPLC method at interval.Available linear kinetics concentration range is 0.080 to 50.0 μ M after measured.

The ARC187PK characteristic of measuring under these conditions is consistent with the estimated performance that only uses intravenous perfusion PK parameter (seeing Figure 51) to produce.The target plasma concentration of 1 μ M occurs and is maintained until in 5 minutes inculcating overall process after administration.Inculcate stop after, fitly shown that the half-life is, remove at t1/2 (β)～40～60 hour end eventually.

Aforesaid zymosan activity test is made amendment, 10 times of dilutions of macaque sample blood plasma are gone into 10% human plasma and are handled with the 5mg/mL zymosan, and (serial number: 5) the pharmacodynamics activity in macaque is carried out external assessment to ARC187 to use the plasma sample of collecting in the PK research.With the C5 activity that is produced as reaction of C5a lysate, by the special ELISA of human C5a measure (C5a ELISA test kit, BD Biosciences, San Diego, CA).The standard curve that the zymosan test of being undertaken by the sample with the known ARC187 level preparation of use obtains is compared, and measures the active A RC187 concentration (seeing Figure 52) in each sample.Originally studies show that ARC187 during inculcating and keep its anti--complement activity afterwards, its level is fully consistent with above-mentioned pharmacokinetic properties.

Embodiment 5I: predict human needs dosage

Prevention, improve, or treatment CABG operation related complication required dosage based on following hypothesis: the first, patient CABG gives single before operation anti--fit intravenous push of C5, the 24-48 hour continous pouring in CABG operation back is to set up and to keep the stabilization sub stage plasma concentration of 1.5 μ M.Only use in the research of aforementioned macaque intravenous push and inject and add that the pharmacokinetic parameter of inculcating acquisition calculates bolus dose and infusion rate.The ARC187 bolus dose of assessment is 1mg/kg, and relevant infusion rate is 0.0013mg/kg/ minute.Inject for this and to add the method for inculcating in 48 hours, the whole medicine requirements of the ARC187 of expection are 0.4g, and wherein wt only refers to oligonucleotide weight (seeing Figure 53 table the 7 row).Figure 53 table the 2 row have reacted the weight of the PEG office that is connected with ARC187, the 3rd row reactions ARC187 oligonucleotide molecules amount (fit for here, comprise ARC186 (serial number: oligonucleotide sequence 4) is identical), the 4th row have reacted as what describe among the above-mentioned embodiment 3C and have passed through amino reactive chemistry and ARC186 (serial number: the molecular weight of the 40kDA PEG that 4) is connected, the ARC187 α phase half-life in the 5th row reaction double parted pattern, the ARC187 β phase half-life in the 6th row reaction double parted pattern..

Embodiment 6

Anti--C5 is fit and the reciprocal action of heparin/protamine

Anti--a kind of expection that C5 is fit is used to be prevention or to slow down the prophylactic agent of the relevant side reaction inflammation of bypass operation of coronary artery (CABG).The anticoagulant collection heparin of high concentration (3-5 unit/mL or 1-2 μ M) during CABG administration in case tampon disease and keep the unimpeded of bypass pump; After this process, reverse the effect of heparin, and reply normal haemostasis by the protamine (～5 μ M) of using similar high concentration.Possible any reciprocal action has the potential danger to patient between these medicines, need to measure anti--activity and (2) that C5 is fit (1) does not change two kinds of medicines and does not show the natural hemostatic effect that makes patient's anticoagulation therapy complicated.

Heparin is to have pure anionic sulfated polysaccharides, and mean molecule quantity 15kDa has the effect by the protease in the reciprocal action inhibition of coagulation cascade of promotion and antithrombase.Protamine, a kind of high-cation polypeptide can be by being the low feature interaction inhibition heparin activity of partial electrostatic effect at least under nature.ARC187 (serial number: function center 5), be similar to heparin, be high anionic.Like this, can imagine that ARC187 can non-specific bond heparin-binding site or protamine and disturb the activity of these molecules.Following research ARC187 inherent (for example, heparin-similarly) anticoagulation characteristic, ARC187 is to the effect of heparin function, ARC187 is to the effect of the neutral heparin of protamine and the protamine effect to ARC187 complement rejection characteristic.

Embodiment 6A:ARC187 is to the vitro effect of blood coagulation

Use coagulation cascade outer arm and inner arm standard clinical tests respectively, clotting time (PT) and activated partial thromboplastin time (aPTT) research ARC187 (serial number: 5) for the intrinsic effect of blood plasma blood coagulation.Shown in Figure 54, there is not change with the Citrated human plasma titration of the design dosage of surplus (high) for PT to 20 μ M, aPTT has a small amount of rising.

Be the vitro effect of assessment ARC187 for heparin and protamine function, the blood of 3 individualities adds 4-5 unit/mL heparin, with the relevant heparin level of use in the CABG operation.The blood coagulation situation of these samples is used assessment active setting time (ACT), and the whole blood alcohol coagulation test is generally used for monitoring perioperative heparin activity.At these heparin concentrations, when not having other additives, ACT when having the 4U/mL heparin apparently higher than baseline～150 second to～500 seconds, or increase when having the 5U/mL heparin～800 seconds.Adding 10 μ M ARC187 in these samples has less effect for clotting time, shows that ARC187 does not disturb the anticoagulant active of heparin.

The blood coagulation effect of heparin can be by 6-8 μ M protamine (4U/mL heparin) or 12 μ M (5U/mL heparin) titration neutralization.Exist heparin and in and ACT value and the abundant indistinction of baseline during the protamine of concentration.Because the nucleic acid center of ARC187 (12kDa) has more macromolecule than protamine (5kDa), expect that the ARC187 of molar concentrations such as adding in the protamine can reverse the neutralizing effect of protamine fully fully.Yet, have less effect with inducing in advance of the isocyatic ARC187 of protamine for ACT.When existing or lacking 10 μ M ARC187, shown similar ACT value with the blood sample of concentration protamine in containing, shown that ARC187 only has less effect for the procoagulant activity of protamine.Figure 55 has described these results.

Embodiment 6B:ARC187 is to the vivo effect of blood coagulation

Clinical dosage heparin and clinical/subclinical/super clinical dosage protamine are used the fit ARC187 of anti--C5 simultaneously, and (serial number: heparin and protamine function reciprocal action are studied in the time of 5), exist with the ARC187 that measures whether subclinical/super clinical plasma concentration and can disturb the reverse of protamine to the effect of heparin anticoagulant.Figure 56 has described this result of study, and briefly, the ARC187 of 10 μ M (for example, surpassing 10 times of moles of clinical dosage) does not have influence for the ACT baseline value in all dosage test heparin.Similarly, the active degree of heparin anti-coagulating is not influenced by 10Mm ARC187.During disappearance ARC187, the minimum effective dose of protamine is～30% (clinical dosage=100%).In addition, 30% protamine is not subjected to surpass the influence of the ARC187 (for example, 10 μ M) of 10 times of moles of clinical dosage to the reverse of heparin anticoagulant effect.Like this, (for example, CABG) use ARC187 not have influence for the typical doses heparin and the protamine that use simultaneously in the clinical practice as complement inhibitor.

Embodiment 6C: heparin and protamine to ARC187 anti--shadow of complement function Ring

Describe as embodiment 1, to measure heparin and protamine in the zymosan collection activation Citrated whole blood sample for ARC187 (serial number: the 5) effect of anti--complement activity.Before zymosan activated, ARC186 was added to 4 kinds of Citrated blood samples under the condition: 1) non-processor (no heparin or protamine); 2) 4U/mL heparin; 3) 6 μ M protamines; 4) 4U/mL heparin+6 μ M protamines.Along with the activation of zymosan, (San Diego is CA) to the C5 active level for C5b-9ELISA test kit, Quidel to measure blood plasma sC5b-9 with ELISA.Every kind of condition does not have obvious deviation (seeing Figure 57) with the active result who suppresses to represent with respect to ARC187 concentration of C5.1-2 μ M ARC187 can obtain to suppress fully under all conditions.Like this, the heparin and the protamine of difference or associating with the concentration of using, do not influence anti--complement activity of ARC187 in the CABG operation.

Embodiment 7

Choroidal artery new life

The newborn common model of the choroidal artery of laser mediation as age-related macular degeneration.It also can be as the model of diabetes retinitis.Use the effect of anti--C5 medicine, be that described herein resisting-complement is fit in the preferred embodiment of the invention, to choroidal artery new life's prevention and stable and/or slow down, in model described below, assess, Krzystolik, M.G. etc., Arch Opthalmol, vol.120, pp338-346 (2002).

When assessment choroidal artery new life's prevention, anti--the C5 medicine, particularly in conjunction with and to suppress the C5 of macaque complement protein C5 function special fit, go into the eye of each monkey by intravitreal injection, and a contrast eye application media.Fit injection a couple of days is carried out laser photocoagulation to the eyes of each macaque to several weeks.By ophthalmologic examination, colour phhotograpy and fluorescein angiographic are monitored the eyes of each animal.The eyes median nexus film angiogenesis (angiography assessment) of anti--C5 medicine, the particularly special aptamer therapeutics of C5 is starkly lower than the matched group eyes, and anti--special medicine of C5 is considered to effective.When assessment unite anti--C5 medicine and a kind of anti-VEGF medicine and/or a kind of anti--during the treatment in prevention choroidal artery new life of PDGF medicine, as above test, except a couple of days before the laser coagulation to several weeks, the eye of each animal is treated with anti--C5 medicine and anti-VEGF medicine and/or anti--PDGF medicine.

In another embodiment, when assessment during for choroidal artery new life's prevention, anti--complement is fit, particularly suppresses the fit of macaque complement protein such as C5 or C3, is injected into the eye of each macaque, and a contrast eye application media.Fit injection a couple of days is carried out laser photocoagulation to the eyes of each macaque to several weeks.By ophthalmologic examination, colour phhotograpy and fluorescein angiographic are monitored the eyes of each animal.Anti--the C5 medicine, particularly the eyes median nexus film angiogenesis (angiography assessment) of anti--complement aptamer therapeutics is starkly lower than the matched group eyes, anti--complement is fit to be considered to effective.When assessment unite fit and a kind of anti-VEGF medicine of anti--complement and/or a kind of anti--during the treatment in prevention choroidal artery new life of PDGF medicine, as above test, except a couple of days before the laser coagulation to several weeks, the eye of each animal with anti--complement is fit and anti-VEGF medicine and/or anti--PDGF medicine are treated.

When the stable of assessment choroidal artery new life and/or when delaying, the eyes of each macaque are carried out laser coagulation.After the laser coagulation a couple of days to several weeks, of the present invention anti--C5 is fit by the ocular administration of intravitreal injection to each animal, and another eye application media.In the embodiment, anti--C5 medicine is that a kind of resisting-complement is fit.In the preferred embodiment, described resisting-complement is fit is that C5 and/or C3 suppress antibody.Fit injection a couple of days is carried out laser photocoagulation to the eyes of each macaque to several weeks.By ophthalmologic examination, colour phhotograpy and fluorescein angiographic are monitored the eyes of each animal.The eyes median nexus film angiogenesis (angiography assessment) of anti--C5 medicine, particularly C5 aptamer therapeutics is identical or when being starkly lower than the matched group eyes, resist-complement is fit to be considered to effective.When assessment unite anti--C5 medicine and a kind of anti-VEGF medicine and/or a kind of anti--during the treatment in prevention choroidal artery new life of PDGF medicine, as above test, except a couple of days before the laser coagulation to several weeks, the eye of each animal is treated with anti--C5 medicine and anti-VEGF medicine and/or anti--PDGF medicine.

Similar to above-mentioned macaque assessment, anti--C5 medicine and anti--complement is individually fit or with anti-VEGF medicine and/or anti--PDGF is medication combined, in prevention, stable and/or delay effect among the choroidal artery new life, can use anti--C5 medicine of adjusting Muridae C5 complement protein, or the C5 complement protein of other species is assessed in mice or other species.In another embodiment, similar to above-mentioned macaque assessment, anti--complement is individually fit or with anti-VEGF medicine and/or anti--PDGF is medication combined, in prevention, stable and/or delay effect among the choroidal artery new life, can use adjustment, particularly the Muridae complement protein of inhibition expectation is anti--and complement is fit, or the complement protein of other expectations is assessed in mice or other species.See, for example, Bora etc., Journal of Immunolgy, 174:491-497 (2005).

Embodiment 8

The retinal degeneration mouse model of non--exudative AMD

Have the mouse model of monokaryon chemical attractants albumen 1 (MCP-1 or Ccl-2) or its homology C-C chemoattractant receptor 2 (Ccr-2) sudden change can be exemplary human the age-the related macular degeneration symptom, comprise the generation of drusen, atrophy of pigment receptor and choroidal artery new life.See Ambati etc., Nature Medicine.2003 November 2003; 9 (11): 1390-7.This mouse model has shown that the C5 in tangible retinal pigment epithelium and the choroid assembles, and shows complement expression and disease association.In addition, CD46 (film of complement is in conjunction with instrumentality), vitronectin (MAC instrumentality) and the existence of C3c (catabolite of C3b) in retinal pigment epithelium and/or choroid show complement activity have taken place.

When the stable of assessment retinal degeneration and/or when delaying, of the present invention anti--complement is fit, for example mice C5 or C3 suppress fit and go into the eye of each animal by intravitreal injection, and another eye application media.Monitor the retinal degeneration of the eyes generation of each animal, comprise that the complement product in the RPE/ choroid is assembled, the newborn scope of the local atrophy of abnormal electrical physiology and/or RPE and/or sensillum opticum and choroidal artery.Wherein anti--complement is fit, particularly in the eye of anti--C5 or anti--C3 aptamer therapeutics, when the scope of retinal degeneration is same as and/or is starkly lower than the contrast eyes, fitly be considered to have stable and/or delay effect.

The present invention is illustrated with the method for describing and give an example, and those skilled in the art can recognize that the present invention can implement by multiple embodiments, and above description and be to be in illustration purpose for example is not as the restriction of following claim.

Sequence table

＜110〉Archemix Corp.

＜120〉complement that uses in the treatment ocular disorders is in conjunction with fit and anti--C5 medicine

<130>23239-591-061

＜140〉do not specify

<141>2007-03-08

<150>U.S.S.N.60/780,905

<151>2006-03-08

<150>U.S.S.N.60/848,274

<151>2006-09-29

<160>102

＜170〉patent version 3 .2

<210>1

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

＜223〉 position 3,4, and 6 and 37 cytosine is 2 '-fluorizated

<220>

＜221〉other features

＜223〉position 90.30 and 31 uridine be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(1)

＜223〉n of position 1 is 2 '-fluorizated cytosine or the 2 '-o-cytosine that methylates

<220>

＜221〉other features

<222>(2)..(2)

＜223〉n of position 2 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(7)..(7)

＜223〉n of position 7 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(8)..(8)

＜223〉n of position 8 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(10)..(10)

＜223〉n of position 10 is 2 '-fluoridizes cytosine or deoxidation cytosine

<220>

＜221〉other features

<222>(11)..(11)

＜223〉n of position 11 is 2 '-fluorizated uridine or deoxythymidine

<220>

＜221〉other features

<222>(12)..(12)

＜223〉n of position 12 is 2 '-fluoridizes cytosine or deoxidation cytosine

<220>

＜221〉other features

<222>(13)..(13)

＜223〉n of position 13 is 2 '-OH ribosidoadenine or the 2 '-o-ribosidoadenine that methylate

<220>

＜221〉other features

<222>(14)..(14)

＜223〉n of position 14 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(15)..(15)

＜223〉n of position 15 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(16)..(16)

＜223〉n of position 16 is 2 '-fluorizated cytosine or deoxidation cytosine

<220>

＜221〉other features

<222>(18)..(18)

＜223〉n of position 18 is 2 '-fluorizated cytosine or the 2 '-o-cytosine that methylate

<220>

＜221〉other features

<222>(19)..(19)

＜223〉n of position 19 is 2 '-fluorizated uridine or the 2 '-o-uridines that methylate

<220>

＜221〉other features

<222>(20)..(20)

＜223〉n of position 20 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(21)..(21)

＜223〉position 21 n that put are 2 '-OH ribosidoadenine or the 2 '-o-ribosidoadenine that methylate

<220>

＜221〉other features

<222>(22)..(22)

＜223〉n of position 22 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(23)..(23)

＜223〉n of position 23 is 2 '-fluorizated uridine or deoxythymidine

<220>

＜221〉other features

<222>(24)..(24)

＜223〉n of position 24 is 2 '-fluorizated cytosine or deoxidation cytosine

<220>

＜221〉other features

<222>(25)..(25)

＜223〉n of position 25 is 2 '-fluorizated uridine or deoxythymidine

<220>

＜221〉other features

<222>(26)..(26)

＜223〉n of position 26 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(27)..(27)

＜223〉n of position 27 is 2 '-OH ribosidoadenine or 2 ' the o ribosidoadenine that methylate

<220>

＜221〉other features

<222>(28)..(28)

＜223〉n of position 28 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(29)..(29)

＜223〉n of position 29 is 2 '-fluorizated uridine or deoxythymidine

<220>

＜221〉other features

<222>(32)..(32)

＜223〉n of position 32 is 2 '-OH ribosidoadenine or the 2 '-o-ribosidoadenine that methylate

<220>

＜221〉other features

<222>(33)..(33)

＜223〉n of position 33 is 2 '-fluorizated cytosine or deoxidation cytosine

<220>

＜221〉other features

<222>(34)..(34)

＜223〉n of position 34 is 2 '-fluorizated cytosine or deoxidation cytosine

<220>

＜221〉other features

<222>(35)..(35)

＜223〉n of position 35 is 2 '-fluorizated uridine or deoxythymidine

<220>

＜221〉other features

<222>(36)..(36)

＜223〉n of position 36 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<220>

＜221〉other features

<222>(38)..(38)

＜223〉n of position 38 is 2 '-OH guanosine or the 2 '-o-guanosines that methylate

<400>1

<210>2

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation and position 11,23 and 25, and it is a deoxythymidine

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, wherein ribosidoadenine

Be 2 '-OH

<400>2

<210>3

<211>42

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all pyrimidines be 2 '-fluorizated

<400>3

<210>4

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>4

<210>5

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉cytosine position 1 is with a kind of 40kDa branch that is connected with nucleoside by amino chain (1,3-pair (mPEG-[20kDa])-propyl group-2-4-butamide)) the PEG modification

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>5

<210>6

<211>44

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(44)

＜223〉all pyrimidines be 2 '-fluorizated

<400>6

<210>7

<211>40

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all purine are that 2 '-O-methylates; Except position 2,7 and 19, wherein guanosine is 2 '-OH and position 1 and 34, and wherein ribosidoadenine is 2 '-OH

<400>7

<210>8

<211>40

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all pyrimidines be 2 '-fluorizated

<400>8

<210>9

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16,24,33 and 34, wherein cytosine is deoxidation and position 11,23 and 25, and it is a deoxythymidine

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>9

<210>10

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates, and except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated, except position 10,12,16,24,33 and 34, wherein cytosine is deoxidation; Position 1,3 and 37, wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>10

<210>11

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates, and except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 1,3,10,12,16,24 and 37, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>11

<210>12

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 1,10,12,16 and 24, wherein cytosine is deoxidation and position 11,23 and 25, and it is a deoxythymidine

<400>12

<210>13

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 3,10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>13

<210>14

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein the guanine nucleoside is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16,24 and 37, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>14

<210>15

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 3, wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>15

<210>16

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 37, wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>16

<210>17

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 1, wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>17

<210>18

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 1,3 and 37, wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>18

<210>19

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 4,10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>19

<210>20

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 6,10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>20

<210>21

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 4,6,10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>21

<210>22

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16,18 and 24, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>22

<210>23

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,19,23 and 25, it is a deoxythymidine

<400>23

<210>24

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16,18 and 24, wherein cytosine is deoxidation; With position 11,19,23 and 25, it is a deoxythymidine

<400>24

<210>25

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23,25 and 29, it is a deoxythymidine

<400>25

<210>26

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23,25 and 30, it is a deoxythymidine

<400>26

<210>27

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23,25 and 31, it is a deoxythymidine

<400>27

<210>28

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23,25,29,30 and 31, it is a deoxythymidine

<400>28

<210>29

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines are 2 '-flouro; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23,25 and 35, it is a deoxythymidine

<400>29

<210>30

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16,24,33 and 34, wherein cytosine is deoxidation; Position 9, wherein uridine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>30

<210>31

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 4, wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>31

<210>32

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 6, wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>32

<210>33

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 4 and 6, wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>33

<210>34

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 18, wherein cytosine is that 2 '-O-methylates

<400>34

<210>35

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 19, wherein uridine is that 2 '-O-methylates

<400>35

<210>36

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 18, wherein cytosine is that 2 '-O-methylates; With position 19, wherein uridine is that 2 '-O-methylates

<400>36

<210>37

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 29, wherein uridine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>37

<210>38

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 30, wherein uridine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>38

<210>39

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 31, wherein uridine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>39

<210>40

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 29,30 and 31, wherein uridine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>40

<210>41

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 35, wherein uridine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>41

<210>42

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5, wherein guanosine is deoxidation; Position 17, wherein guanosine is 2 '-OH; With position 32, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>42

<210>43

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5, wherein guanosine is 2 '-OH; Position 17, wherein guanosine is deoxidation; With position 32, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>43

<210>44

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH; With position 32, wherein ribosidoadenine is deoxidation

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; With position 11,23 and 25, it is a deoxythymidine

<400>44

<210>45

<211>40

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all purine are that 2 '-O-methylates; Except position 6 and 18, wherein guanosine is 2 '-OH; With position 33, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 11,13,17 and 25, wherein cytosine is deoxidation; Position 40, wherein cytosine is that 2 '-O-methylates; With position 12,24 and 26, it is a deoxythymidine

<400>45

<210>46

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH; With position 32, wherein ribosidoadenine is deoxidation

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 10,12,16 and 24, wherein cytosine is deoxidation; Position 36,37 and 38 wherein cytosine is that 2 '-O-methylates; With position 11,23 and 25, it is a deoxythymidine

<400>46

<210>47

<211>40

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all purine are that 2 '-O-methylates; Except position 6 and 18, wherein guanosine is 2 '-OH; With position 33, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 11,13,17 and 25, wherein cytosine is deoxidation; Position 40, wherein cytosine is that 2 '-O-methylates; With position 12,24 and 26, it is a deoxythymidine

<400>47

<210>48

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(44)

＜223〉all purine are that 2 '-O-methylates; Except position 8 and 20, wherein guanosine is 2 '-OH; With position 35 wherein ribosidoadenine be 2 '-OH

<220>

＜221〉other features

<222>(1)..(44)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(45)..(45)

＜223〉thymidine position 45 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>48

<210>49

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all purine are that 2 '-O-methylates; Except position 7 and 19, wherein guanosine is 2 '-OH; With position 34, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(42)

＜223〉cytosine of meeting be 2 '-fluorizated; Except position 12,14,18,26,35 and 36, it is the deoxidation cytosine; With position 20,41 and 42, wherein cytosine is that 2 '-O-methylates

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all uridine s be 2 '-fluorizated; Except position 21, wherein uridine is that 2 '-O-methylates; With position 13,25,27,31 and 37, it is a deoxythymidine

<400>49

<210>50

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all purine are that 2 '-O-methylates; Except position 7 and 19, wherein guanosine is 2 '-OH; With position 34, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all cytosine s be 2 '-fluorizated; Except position 12,14,18,26,35,36 and 39, it is the deoxidation cytosine; With position 3,20,41 and 42, wherein cytosine is that 2 '-O-methylates

<220>

＜221〉other features

<222>(1)..(42)

＜223〉uridine position 11 be 2 '-fluorizated; Uridine position 21 is that 2 '-O-methylates; Position 13,25,27,31,32,33 and 37 is deoxythymidines

<400>50

<210>51

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all purine are that 2 '-O-methylates; Except position 7 and 19, wherein guanosine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(42)

＜223〉the cytosine position 5,6, and 8,12,14,18,26,35,36 and 39 is deoxidation cytosine; With cytidine position 3,20,41 and 42 be that 2 '-O-methylates

<220>

＜221〉other features

<222>(1)..(42)

＜223〉uridine position 21 is that 2 '-O-methylates; Position 11,13,25,27,31,32,33 and 37 is deoxythymidines

<400>51

<210>52

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all purine are that 2 '-O-methylates; Except position 7 and 19, wherein guanosine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(42)

＜223〉the uridine position 13,21, and 25 and 27 is that 2 '-O-methylates; Position 11,31,32,33 and 37 is deoxythymidines

<220>

＜221〉other features

<222>(1)..(42)

＜223〉the cytosine position 5,6, and 8,12,18,35,36 and 39 is deoxidation cytosine; With cytosine position 3,14,20,26,41 and 42 be that 2 '-O-methylates

<400>52

<210>53

<211>40

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉ribosidoadenine position 1 has a biotin that is connected with 5 ' end

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all purine are that 2 '-O-methylates; Except position 3,8 and 20, wherein guanosine is 2 '-OH; With position 2, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all pyrimidines be 2 '-fluorizated

<400>53

<210>54

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all purine are that 2 '-O-methylates; Except position 7 and 19, wherein guanosine is 2 '-OH; With position 34, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all cytosine s be 2 '-fluorizated; Except position 12,14,18 and 26, it is the deoxidation cytosine; With position 41 and 42, wherein cytosine is that 2 '-O-methylates

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all uridine s be 2 '-fluorizated; Position 13,25 and 27 is deoxythymidines

<400>54

<210>55

<211>42

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all purine are that 2 '-O-methylates; Except position 7 and 19, wherein guanosine is 2 '-OH; With position 34, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all cytosine s be 2 '-fluorizated; Except position 12,14,18,26,41 and 42, wherein cytosine is that 2 '-O-methylates

<220>

＜221〉other features

<222>(1)..(42)

＜223〉all uridine s be 2 '-fluorizated; Except position 13,25 and 27, wherein uridine is that 2 '-O-methylates

<400>55

<210>56

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>56

<210>57

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 18, wherein cytosine is that 2 '-O-methylates; With position 19 wherein uridine be that 2 '-O-methylates

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH; With position 32, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>57

<210>58

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 29, it is a deoxythymidine

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH; With position 32, wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>58

<210>59

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 18, wherein cytosine is that 2 '-O-methylates; With position 19, wherein uridine is that 2 '-O-methylates

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>59

<210>60

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated; Except position 18, wherein cytosine is that 2 '-O-methylates; Position 19, wherein uridine is that 2 '-O-methylates; With position 29, it is a deoxythymidine

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is oppositely deoxythymidines (3 '-3 ' is crosslinked) of a3 '

<400>60

<210>61

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉cytosine of position 1 is to modify with a kind of 20kDaPEG that is connected with nucleoside by amino chain

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>61

<210>62

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉cytosine of position 1 is to modify with a kind of 20kDaPEG that is connected with nucleoside by amino chain

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>62

<210>63

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉cytosine of position 1 is modified by 5 ' the amino chain

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>63

<210>64

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉cytosine of position 1 is to modify with a kind of 20kDa PEG that is connected with nucleoside by amino chain

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>64

<210>65

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉cytosine of position 1 is to modify with a kind of 40kDa PEG that is connected with nucleoside by amino chain

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>65

<210>66

<211>38

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉cytosine of position 1 is to modify with a kind of 20kDa PEG that is connected with nucleoside by amino chain

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(38)..(38)

＜223〉guanosine of position 38 is to modify with a kind of 20kDa PEG that is connected with nucleoside by amino chain

<400>66

<210>67

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(1)

＜223〉cytosine of position 1 is with a kind of 40kDa branch that is connected with nucleoside by amino chain (2,3-pair (mPEG-[20kDa])-propyl group-1-carbamyl) PEG modification

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all pyrimidines be 2 '-fluorizated

<220>

＜221〉other features

<222>(1)..(38)

＜223〉all purine are that 2 '-O-methylates; Except position 5 and 17, wherein guanosine is 2 '-OH and position 32, and wherein ribosidoadenine is 2 '-OH

<220>

＜221〉other features

<222>(39)..(39)

＜223〉thymidine of position 39 is a kind of 3 ' reverse deoxythymidines (3 '-3 ' is crosslinked)

<400>67

<210>68

<211>46

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(46)

＜223〉all pyrimidines be 2 '-fluorizated

<400>68

<210>69

<211>40

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(40)

＜223〉all pyrimidines be 2 '-fluorizated

<400>69

<210>70

<211>92

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic template

<220>

＜221〉other features

<222>(40)..(69)

＜223〉n can be any nucleoside (a, c, g, perhaps t)

<400>70

<210>71

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic primer

<400>71

<210>72

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic primer

<400>72

<210>73

<211>22

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fixed area

<400>73

<210>74

<211>23

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fixed area

<400>74

<210>75

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(75)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>75

<210>76

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(32)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>76

<210>77

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(32)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>77

<210>78

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(25)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>78

<210>79

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(25)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>79

<210>80

<211>32

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(32)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>80

<210>81

<211>47

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(47)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>81

<210>82

<211>88

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic template

<220>

＜221〉other features

<222>(40)..(69)

＜223〉n can be any nucleoside (a, t, c, perhaps g)

<400>82

<210>83

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic template

<400>83

<210>84

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic primer

<400>84

<210>85

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic primer

<400>85

<210>86

<211>22

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fixed area

<400>86

<210>87

<211>19

<212>RNA

＜213〉artificial sequence

<220>

＜223〉synthetic fixed area

<400>87

<210>88

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(80)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>88

<210>89

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(80)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>89

<210>90

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(80)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>90

<210>91

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(80)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>91

<210>92

<211>78

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(78)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>92

<210>93

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(80)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>93

<210>94

<211>69

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(69)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>94

<210>95

<211>79

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(79)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>95

<210>96

<211>75

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(75)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<220>

＜221〉other features

<222>(34)..(34)

＜223〉n can be any nucleoside (a, t, u, c, perhaps g)

<220>

＜221〉other features

<222>(43)..(43)

＜223〉n can be any nucleoside (a, t, u, c, perhaps g)

<400>96

<210>97

<211>80

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(80)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>97

<210>98

<211>79

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic fit

<220>

＜221〉other features

<222>(1)..(79)

＜223〉wherein all purine are that deoxidation and all pyrimidines are that 2 '-O-methylates

<400>98

<210>99

<211>93

<212>DNA

＜213〉artificial sequence

<220>

＜223〉synthetic template

<220>

＜221〉other features

<222>(25)..(54)

＜223〉n can be any nucleoside (a, t, c, perhaps g)

<400>99

<210>100

<211>92

<212>DNA

＜213〉synthetical

<220>

＜223〉synthetic template

<220>

＜221〉other features

<222>(24)..(53)

＜223〉n can be any nucleoside (a, t, c, perhaps g)

<400>100

<210>101

<211>92

<212>DNA

＜213〉synthetical

<220>

＜223〉synthetic template

<220>

＜221〉other features

<222>(24)..(53)

＜223〉n can be any nucleoside (a, t, c, perhaps g)

<400>101

<210>102

<211>1676

<212>PRT

＜213〉synthetical

<220>

＜223〉synthetic C5

<400>102

Claims (88)

1. treatment, the method for stablizing and/or preventing a kind of ocular disease of complement-mediated, this method comprise the step of using a kind of resisting-treatment effective dose that complement is fit to required patient.

2. according to the process of claim 1 wherein that the ocular disease of being treated is a kind of eye neovascular disease.

3. according to the process of claim 1 wherein that the ocular disease of being treated is a degeneration of macula.

4. according to the process of claim 1 wherein that the ocular disease of being treated is a diabetic renal papillary necrosis.

5. according to the process of claim 1 wherein that the ocular disease of the complement-mediated of being treated is an age-related macular degeneration.

6. according to the process of claim 1 wherein that the ocular disease of the complement-mediated of being treated is from by struvite conjunctivitis, comprise the anaphylaxis macropapillary conjunctivitis, macular edema, uveitis, endophthalmitis, scleritis, cornea festers, xerophthalmia, glaucoma, diabetic retinopathy, corneal graft rejection, the complication that operated eye is relevant, the inflammation relevant with cataract operation as the intraocular lens implants, Behcet ' s disease, fundus flavimaculatus, immune compound vasculitis, Fuch ' s disease, the Xiao Liu Harada disease, Asian TV Station's postretinal fiberization, keratitis, vitreous body-retinitis, eye parasitic infection/transfer, the degeneration of color retinal pigment, the cytomegalovirus retinitis is selected in the group that choroiditis is formed.

7. the method for stablizing the eye neovascular disease of complement-mediated comprise to required patient use enough dose a kind of anti--complement is fit stablizes the eye neovascular disease of complement-mediated.

8. according to the method for claim 7, the disease that wherein is used for stablizing the eye new vessels is a degeneration of macula.

9. according to the method for claim 7, the eye neovascular disease that wherein is stabilized is a diabetic renal papillary necrosis.

10. according to the method for claim 7, the degeneration of macula that wherein is stabilized is an age-related macular degeneration.

11. according to the method for claim 7, the degeneration of macula that wherein is stabilized is exudative type AMD.

12. according to claim 7, any one method in 8,9,10 or 11, wherein use effective dose anti--complement is fit to keep in the main body the identical vision precision of the vision precision of the main body fit with using anti--complement at least.

13. according to claim 7, any one method in 8,9,10,11 or 12, wherein use effective dose anti--complement is fit to keep the identical retinal vessel density of main body fit with using anti--complement at least in the main body.

14. the method for the eye new vessels imbalance of treatment complement-mediated comprises that a kind of anti--eye new vessels that complement is fit stablize complement-mediation of using enough dose to required patient lacks of proper care.

15. according to the method for claim 14, wherein the imbalance of Zhi Liao eye new vessels is a degeneration of macula.

16. according to the method for claim 15, wherein Zhi Liao degeneration of macula is an age-related macular degeneration.

17. according to the method for claim 14, wherein Zhi Liao degeneration of macula is exudative age-related macular degeneration.

18. according to the method for claim 14, wherein the imbalance of Zhi Liao eye new vessels is a diabetic renal papillary necrosis.

19. according to claim 14, any one method in 15,16,17 or 18, wherein use effective dose anti--complement is fit so that the vision precision of the vision precision of the main body main body fit with using anti--complement is compared increases.

20. according to claim 14, any one method in 15,16,17,18 or 19, wherein use effective dose anti--complement is fit so that the retinal vessel density of the main body main body retinal vessel density fit with using anti--complement is compared to some extent reduces.

21. treat the method for the eye new vessels imbalance of clinical complement-mediated, comprise the clinical symptoms that a kind of resisting-complement is fit prevents the eye new vessels imbalance of complement-mediation of using enough dose to required patient.

22. according to the method for claim 21, wherein Yu Fang eye new vessels diagonosis of disorder is the degeneration of macula symptom.

23. according to the method for claim 22, wherein Yu Fang degeneration of macula symptom is the age-related macular degeneration symptom.

24. according to the method for claim 23, wherein Yu Fang degeneration of macula symptom is exudative age-related macular degeneration symptom.

25. according to the method for claim 21, wherein the diagonosis of disorder of Yu Fang eye new vessels is the diabetic renal papillary necrosis symptom.

26. according to claim 21, any one method in 22,23,24,25 or 26 further comprises and identifies whether main body is in the step of the danger that the eye new vessels of clinical complement-mediation lacks of proper care.

27. according to the method for claim 26, wherein authentication step comprises the existence of measuring vitreous body wart in the main body and measures the vision precision and do not have clinical loss.

28. according to the method for claim 26, further comprise and measuring in the main body, identify to be in dangerous main body with respect to the complement factor H variant of wild type complement factor H.

29. according to claim 21, any one method in 22,23,24,25,26,27 or 28, the loss of wherein using the anti--main body vision precision that complement is fit to be compared with the prevention main body vision precision fit with using anti--complement of effective dose.

30. according to claim 21,22,23,24,25,26, any one method in 27 or 28, the abundant rising of wherein using the anti--main body retinal vessel density that complement is fit to be compared with the retinal vessel density of the prevention main body fit with using anti--complement of effective dose.

31. any one method in the aforesaid claim, wherein anti--complement is fit to be the fit of the complement target selected from comprise following group of a kind of inhibition: enzyme complement pathway composition and non--enzyme complement pathway composition.

32. any one method in the aforesaid claim, wherein anti--complement is fit to be a kind of the fit of complement target that suppress, wherein the complement target is that a kind of film is attacked pathway components.

33. any one method in the aforesaid claim, wherein anti--complement is fit to be the fit of the complement target selected from comprise following group of a kind of inhibition: CCP composition, selectivity complement pathway composition, hemagglutinin pathway components.

34. any one method in the aforesaid claim, wherein anti--complement is fit to be a kind of also suppress fit that combine with the complement component target of selecting from comprise following group: C1, C1q, C1r, C1s, C2, C3, C3a, C3a receptor, C4, C5, C5a, C5a receptor, C5b, C6, C7, C8, C9, factor B, factor D, properdin, mannose be in conjunction with hemagglutinin (MBL), the MBL relevant serine protease 2 with MBL of serine protease 1 of being correlated with.

35. according to any one method in the aforesaid claim, wherein the complement component target is a kind of human target protein.

36. according to any one method in the aforesaid claim, wherein anti--complement is fit to be the fit of a kind of C5 of inhibition.

37. according to any one method in the aforesaid claim, wherein C5 in conjunction with fit be from comprise following group, to select: serial number 1 to 69,75,76,81,91,95 and 96.

38. according to the method for claim 32, wherein C5 in conjunction with fit be ARC186, ARC187, ARC1905.

39. according to any one method in the aforesaid claim 1 to 35, wherein anti--complement is fit to be a kind of combination and to suppress the fit of C3.

40. according to any one method in the aforesaid claim 1 to 35, wherein anti--complement is fit to be a kind of combination and to suppress the fit of C1q.

41. according to any one method in the aforesaid claim 1 to 35, wherein anti--complement is fit to be a kind of combination and to suppress the fit of C1q.

42. according to any one method in the aforesaid claim, wherein anti--complement is fit to be the fit of a kind of combination and inhibitive factor B and factor D.

43. according to any one method in the aforesaid claim, wherein anti--complement is fit by carrying administration in the vitreous body.

44. according to any one method in the aforesaid claim, wherein anti--complement is fit by carrying administration near the eyes.

45. according to any one method in the aforesaid claim, wherein use anti--complement is fit to be included in the storage form.

46. according to any one method in the aforesaid claim, wherein main body is human.

47. a treatment C5, the method for the eye imbalance of C5a and/or C5b-9 mediation, wherein method comprises the anti--C5 medicine of required administered effectively being treated eye imbalance dosage.

48. according to the method for claim 47, wherein the imbalance of the eye of treatment is a kind of eye new vessels imbalance.

49. according to the method for claim 47, wherein the imbalance of the eye of treatment is a kind of degeneration of macula or diabetic retinopathy.

50. according to the method for claim 47, wherein the treatment the age-relevant degeneration of macula is an exudative AMD.

51. a stable C5, the method for the eye new vessels imbalance of C5a and/or C5b-9 mediation, wherein method comprises required administered effectively stablize C5, the resisting-the C5 medicine of the eye new vessels imbalance dosage of C5a and/or C5b-9 mediation.

52. according to the method for claim 51, wherein stable eye new vessels imbalance is a degeneration of macula.

53. according to the method for claim 52, wherein degeneration of macula is an exudative AMD.

54. according to the method for claim 51, wherein stable eye new vessels imbalance is a diabetic retinopathy.

55. according to claim 51, any one method in 52,53 or 54, wherein use effective dose anti--the C5 medicine is fit to keep the main body vision precision level identical at least with using anti--C5 drug main body vision precision level.

56. according to claim 51, any one method in 52,53 or 54, wherein use effective dose anti--the C5 medicine is fit to keep and to use anti--retinal vessel density that C5 medicine main body is identical at least.

57. a treatment C5, the method for the eye new vessels imbalance of C5a and/or C5b-9 mediation, wherein method comprises and required administered is effectively reduced C5, anti--C5 medicine of the eye new vessels diagonosis of disorder dosage of C5a and/or C5b-9 mediation.

58. according to the method for claim 57, wherein the imbalance of the eye new vessels of treatment is a degeneration of macula.

59. according to the method for claim 58, wherein degeneration of macula is an exudative AMD.

60. according to the method for claim 57, wherein the imbalance of the eye new vessels of treatment is a diabetic retinopathy.

61. according to claim 57, any one method in 58,59 or 60, anti--C5 medicine of wherein using effective dose is to provide the main body vision precision of comparing raising with the main body vision precision of using anti--C5 medicine.

62. according to claim 57, any one method in 58,59 or 60, anti--C5 medicine of wherein using effective dose is to provide the main body retinal vessel level of density of comparing minimizing with the main body retinal vessel level of density of using anti--C5 medicine.

63. one kind comprise to administered anti--the C5 medicine is with the clinical C5 of prevention in main body, the method of the eye new vessels imbalance of C5a and/or C5b-9 mediation, wherein method comprises required administered is effectively prevented C5, anti--C5 medicine of the eye new vessels imbalance clinical symptoms dosage of C5a and/or C5b-9 mediation.

64. according to the method for claim 63, wherein Yu Fang eye new vessels diagonosis of disorder is the degeneration of macula symptom.

65. according to the method for claim 64, wherein the prevention the age-relevant degeneration of macula symptom is the exudative AMD symptom.

66. according to the method for claim 63, wherein Yu Fang eye new vessels diagonosis of disorder is the diabetic retinopathy symptom.

67. according to the method for claim 63,64 or 65, wherein main body is in the danger that the imbalance of eye new vessels takes place.

68., wherein further comprise by existence and the mensuration vision precision of measuring the vitreous body wart not having the step that the main body that is in danger is identified in clinical loss according to the method for claim 67.

69. according to the method for claim 67 or 68, further comprise and measure complement factor H variant in the main body, identify to be in dangerous main body.

70. according to claim 63, any one method in 64,65,66,67,68 or 69, the loss of the main body vision precision that anti--C5 medicine of wherein using effective dose is compared with the main body vision precision of using anti--C5 medicine with prevention.

71. according to claim 63,64,65,66, the raising of the main body retinal vessel level of density that any one method in 67,68 or 69, anti--C5 medicine of wherein using effective dose are compared with the main body retinal vessel level of density of using anti--C5 medicine with prevention.

72. require in 47 to 71 any one method according to aforesaid right, further comprise step to administered anti-VEGF medicine.

73. according to the method for claim 72, wherein the anti-VEGF medicine is to select from comprise following group: nucleic acid molecules, fit, antisense molecule, RNAi molecule, protein, polypeptide, cyclic peptide, antibody or antibody fragment, sugar, polymer, micromolecule.

74. require in 47 to 73 any one method according to aforesaid right, further comprise to administered anti--step of PDGF medicine.

75. according to the method for claim 74, wherein anti--the PDGF medicine is to select from comprise following group: nucleic acid molecules, and fit, antisense molecule, RNAi molecule, protein, polypeptide, cyclic peptide, antibody or antibody fragment, sugar, polymer, micromolecule.

76. require in 47 to 75 any one method according to aforesaid right, wherein anti--the C5 medicine is to select from comprise following group: nucleic acid molecules, and fit, antisense molecule, the RNAi molecule, protein, polypeptide, cyclic peptide, antibody or antibody fragment, sugar, polymer, micromolecule.

77. require in 47 to 76 any one method according to aforesaid right, wherein anti--the C5 medicine is that a kind of C5 is special fit.

78. according to the method for claim 77, wherein C5 is special fitly selects from following group: serial number 1-67,75-81 and 88-98.

79. according to the method for claim 78, wherein C5 special fit be serial number: 5 or serial number: 67.

80. according to aforesaid right require in 47 to 79 any one method, anti--C5 medicine of wherein using be a kind of before medicine.

81. require in 47 to 80 any one method according to aforesaid right, wherein the anti-VEGF medicine be a kind of before medicine.

82. require in 47 to 81 any one method according to aforesaid right, wherein anti--PDGF medicine be a kind of before medicine.

83. require in 47 to 83 any one method according to aforesaid right, wherein further comprise use a kind of anti--blood vessel drug eluting.

84. 3 method according to Claim 8, wherein anti--blood vessel drug eluting is a kind of porphyrin derivatives.

85. 4 method wherein further comprises the method with laser active porphyrin derivatives according to Claim 8.

86. require in 47 to 85 any one method according to aforesaid right, wherein anti--C5 medicine is carried by dosing eyes.

87. require in 47 to 86 any one method according to aforesaid right, wherein anti--C5 medicine is carried by the glass vivo medicine-feeding.

88. require in 47 to 87 any one method according to aforesaid right, wherein main body is human.

Images