CN101440408B - Celery cabbage nucleo-cytoplasmic interreaction male sterility SRAP marker and use thereof for assisting selective breeding - Google Patents
Celery cabbage nucleo-cytoplasmic interreaction male sterility SRAP marker and use thereof for assisting selective breeding Download PDFInfo
- Publication number
- CN101440408B CN101440408B CN 200810236450 CN200810236450A CN101440408B CN 101440408 B CN101440408 B CN 101440408B CN 200810236450 CN200810236450 CN 200810236450 CN 200810236450 A CN200810236450 A CN 200810236450A CN 101440408 B CN101440408 B CN 101440408B
- Authority
- CN
- China
- Prior art keywords
- srap
- plant
- sterile
- fertile
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a Chinese cabbage nucleoplasm interactive male sterility SRAP marker and an assistant method for selective breeding thereof. A nucleoplasm interactive male sterile line, a corresponding restorer line and the genomic DNA of hybrid second-generation segregation population are taken as templates, and a codominant SRAP marker linked to nucleoplasm interactive male sterile gene is screened out through SRAP analysis and repeated tests. The SRAP marker is a specific fragment Rf24-5-3 and a specific fragment ms16-23-3; a homozygous fertile plant has a me3em3-366 specific band; a sterile plant has a me3em3-372 specific band; a heterozygous fertile plant simultaneously has two bands; the crossover value between me3em3-366 and fertile plant gene is 3.876 percent; and the crossover value between me3em3-372 and sterile plant gene is 4.142 percent. The consistency of F2 fertile-plant genotype identification result and F3 family fertility-segregation identification result of the SRAP marker is 92.62 percent, and the accuracy of the SRAP marker in fertile gene detection for the other materials is 100 percent. By applying the SRAP marker, assisted selection for the early molecules of Chinese cabbage nucleoplasm interactive male sterility trait can be carried out, so as to speed up breeding progress.
Description
Technical field
The invention belongs to vegetable variety seed selection and the biological technical field of agricultural, relate to the SRAP mark of the breed breeding of Chinese cabbage and molecular marker assisted selection breeding method, particularly a kind of celery cabbage nucleo-cytoplasmic interreaction male sterility and be used for the application of assisted selection.
Background technology
Since nearly three more than ten years, plants male sterility is the popular domain of Crop Genetic Breeding, biological study always.Cytoplasmic male sterility (cytoplasmic male sterility, CMS) is wherein to have most to utilize the male sterile type that is worth.And the Chinese cabbage take leaf-head as product, although do not need restorer, it is convenient to utilize, but the material selective breeding sterile line program of recovering gene bothers with carrying, the cycle is long, adopts molecular marking technique to judge whether with educating gene and sterile gene, quickening seed selection paces in seedling stage.
Vegetables science system of gardening institute of Xibei Univ. of Agricultural ﹠ Forest Science ﹠ Technology carries out Chinese cabbage male sterile research from 20 century 70s, successively breed the allo-plasm of Chinese cabbage male sterile line of the different sourcess such as CMS3411-7 and CMS7311, various trait, and be applied to the production of hybrid seeds of first-filial generation Chinese cabbage.Because traditional fertility Phenotypic Selection will be bloomed by the time, finishes by the field direct viewing.For carrying the excellent material that recovers gene, be sterile line with its transformation, must be through hybridization, the processes such as its genotype are judged in selfing simultaneously with the sterile line test cross, and operating wastes time and energy, and the cycle is long, and breeding process is slow.In order to accelerate Chinese cabbage cytoplasm male sterile breeding speed, adopt modern biotechnology, it is very urgent to carry out molecular mark.
Molecule marker is the popular domain of Recent study, and it has following significant superiority take DNA as research object:
(1) directly with the form performance of DNA, all can detect at each tissue, each developmental stage of plant materials, be not subjected to season, environmental restraint, there is not expression whether problem;
(2) numbers of poles is many, spreads all over whole genome, and the locus that can detect almost is unlimited;
(3) polymorphism is high, and nature exists many allelic variations, does not need the special special genetic stocks of creating;
(4) show as " neutrality ", do not affect the expression of objective trait, with bad proterties without inevitable chain;
(5) there are many molecule markers to show as codominance (codominance), can identify homozygous genotype and heterozygous genes type, complete genetic information is provided, thereby now formed many molecule markers system.
SRAP (Sequence-related amplified polymorphism, SRAP) be to be that Li and doctor Quiros proposed in calendar year 2001 by California, USA university vegetable crop, cry again based on sequence amplification polymorphism (sequence based amplified polymorphism, SBAP), as a kind of new molecular marking technique, that SRAP has is easy, stable, the characteristics of moderate yield, is evenly distributed in genome, and high-frequency codominance then obviously is better than the AFLP mark.SRAP is based on the molecular marking technique of PCR, have the ease-to-operate same with RAPD, only adopt complicated polyacrylamide gel electrophoresis in conjunction with silver-colored dyeing technique in the detection of amplified production, but compare with the sepharose detection, resolving power improves greatly, and do not use ethidium bromide, and can not cause environmental pollution, reduce operational danger.Repeatedly the revision test result is stable, has overcome the shortcoming of RAPD repeatability poor stability.Compare with AFLP, the operation that it need not be loaded down with trivial details, cost is lower.The upstream primer of SRAP and downstream primer can be general, and matched combined has in twos been save the difficulty of primer development, has reduced the expense of synthetic primer, has also greatly improved the rate of utilization of primer simultaneously.
In a word, molecule marker is not subjected to the condition influence such as genetic expression time, aobvious hidden relation, environmental factors, utilize with the closely linked molecule marker of objective trait and can select at the fertility commitment, reduced the blindness of selecting, shortened the breeding time limit, thereby can greatly improve breeding efficiency, accelerate breeding process.
Summary of the invention
The object of the invention is to.A kind of SRAP mark of celery cabbage nucleo-cytoplasmic interreaction male sterility is provided and adopts this SRAP mark to be used for the application of assisted selection.The present invention adopts the SRAP technology, seeks and the closely linked SRAP molecule marker of fertile gene, lays the foundation for carrying out the celery cabbage nucleo-cytoplasmic interreaction male sterility molecular mark.
In order to realize above-mentioned task, the present invention takes following technical solution:
A kind of SRAP mark of celery cabbage nucleo-cytoplasmic interreaction male sterility, it is characterized in that this SRAP mark is special segment Rf24-5-3 and special segment ms16-23-3, the total length of special segment Rf24-5-3 is 366bp, the total length of special segment ms16-23-3 is 372bp, and its nucleotide sequence is respectively:
Special segment Rf24-5-3:
TGAGTCCAAACCGGAATGCTAACCTAACCGACTATTAACTAATTTACTGTAGTTGGGCTTGTTTGGGCTTAGTTGGACTCTTGTCTCTTTCATATTTGCTATGTAACTTTGAAAAAAGCCATTGTAGAGAGTAGACAGCGTCTCTCGAATCTGCTTAATCTTCCTCTCCTCACCTTTAATCAATCATCTCCTCCATCCAACTTCTTTTATCTCCTTCTCGCATTTATCTTCTTTACAAAAAAGTCAACCCTTTCCTTATCAGAATCTCCCTCCCATAGCTTTGACTGTCGCAATACCTTAAGATTGATCACTACTCCGACTTTCCTATTTGGAAACATCTTCAAGGTA
GTCAATTCGTACGCAGTC。
Special segment ms16-23-3:
TGAGTCCAAACCGGAATGCTAACCTAACCGACTATTAACTAATTTACACCAATCAAATTCACCGCGAACTCTTGTCTGGGCTTATTAACCGACTTATTTGGGCTTAGATGGGCTTGTTTGGGCTTAGTTGGACTCTTGTCTCTTTCATTTTTGCTATGTAACTTTGAAAAACTCCATTGTAGAGTGTGGACAGCGTCTCTGGAATCTGCTTAATCTTCCTCCTCACCTTTAATCATCTTCTTTTATCTCCTTCTCGCATTTATCTTCTTTACAAAAAGTCAACTCTTTCCTTATCAGAATCTCCCTCCCATCGCTTTAACTATCGCAATACACCGACTTCACATCTTCAAGGTA
GTCAATTCGTACGCAGTC。
The two ends of above-mentioned special segment Rf24-5-3 and special segment ms16-23-3 are the SRAP primer, and its sequence is:
Me3：5’TGAGTCCAAACCGGAAT3’17bp
Em3：5’GTCTGCGTACGAATTGAC3’18bp
The SRAP mark of above-mentioned celery cabbage nucleo-cytoplasmic interreaction male sterility can be used in the application of assisted selection through experiment showed, of contriver.
The method of its assisted selection is, at first carrying out celery cabbage nucleo-cytoplasmic interreaction male sterility is with Elite restorer line hybridization, then individual plant selfing obtains F2 for the Fertility segregation population material, then carry out the individual plant DNA extraction, the SRAP primer amplification, SRAP is marked at law of segregation analysis in the segregating population, selection with positive SRAP mark individual plant specifically comprises the following steps:
1) preparation of gene recombination population material:
With celery cabbage nucleo-cytoplasmic interreaction male sterility system and restorer hybridization, individual plant selfing is chosen 100～200 full F
2For being seeded in the land for growing field crops after seed and the parental seed vernalization vernalization, at Seedling Stage to F
2The individual plant numbering, it is for subsequent use to get seedling leaflet tablet extraction DNA seedling stage, identifies the plant fertility flowering period;
2) DNA extraction
A. get the fresh leaflet tablet that 0.2g removes master pulse, fill in the centrifuge tube of 1.5mL, put into the liquid nitrogen quick-frozen, be ground to rapidly powder with the clean plastics grinding rod of 75% alcohol-pickled mistake;
B. add 700 μ L through 1 * CTAB of 65 ℃ of preheatings extracting solution in centrifuge tube, the prescription of extracting solution is: CTAB 2%, Tris-HCl 100mmol/L, and EDTA 20mmol/L, NaCl 1.4mol/L adds 8 μ L beta-mercaptoethanols again, rapidly mixing;
C. subsequently centrifuge tube is put into 65 ℃ of water-baths, shaken once water-bath 30min in every interval 5min minute;
D. take out centrifuge tube, add with centrifuge tube in the mixture of the isopyknic phenol of liquid, chloroform and primary isoamyl alcohol, wherein, phenol: chloroform: primary isoamyl alcohol=25: 24: 1, shake up 15min after, the centrifugal 10min of 12000r/min under the normal temperature;
E. upper phase (about 700 μ L) is transferred in another centrifuge tube, and added isopyknic chloroform: primary isoamyl alcohol, its ratio are 24: 1, shake up gently 10min, the centrifugal 10min of 12000r/min under the normal temperature;
F. get supernatant (about 500 μ L), add the dehydrated alcohol of the precooling of 2 times of volumes, mixing is united DNA gently, precipitates 30min under-20 ℃ of conditions, the centrifugal 10min of 12000r/min under 4 ℃ of conditions;
G. abandon supernatant, add 500 μ l, 75% washing with alcohol precipitation 2 times, the throw out room temperature is dried;
H. add 500 μ L TE damping fluid dissolving DNAs, add 0.3 μ L RNaseA (10 μ g/ μ L), centrifugal behind the mixing, 37 ℃ of insulation 30min;
I. after DNA dissolves fully, add the dehydrated alcohol of 3mol/L NaAC solution 50 μ L and 2 times of volume precoolings, mixing is united DNA gently, precipitates 30min under-20 ℃ of conditions;
J. at 4 ℃, centrifugal 10min abandons supernatant under the 12000r/m condition, the ethanol washing and precipitating of adding 75% 1～2 time, and rear adding 75% ethanol ,-20 ℃ save backup;
The DNA that extracts through purity detecting, confirms that purifying is better, general 400～500 μ LddH with sterilization
2The O dilution is stored in 4 ℃ for subsequent use;
3) SRAP-PCR amplification:
The SRAP-PCR amplification is carried out in 25 μ L PCR reaction systems, 10 * PCR damping fluid, 2.5 μ L is arranged, Taq archaeal dna polymerase 1Unit, MgCl in the reaction system
2Concentration is 3.0mmol/L, and upstream and downstream Auele Specific Primer concentration is respectively 0.2 μ mol/L, and 4 kinds of dNTP concentration respectively are 0.2mmol/L, template DNA 40ng;
The PCR response procedures is: 94 ℃/5min of denaturation, 94 ℃/60s, 35 ℃/60s, 72 ℃/60s, and after 4 circulations, 94 ℃/60s, 50 ℃/60s, 72 ℃/60s, since the 6th step 35 circulations, 72 ℃ of extension 10min;
Electrophoresis: with 6 * Loading buffer mixing of amplified production and 5 μ L, get 4 μ L and click and enter in 6% non-denaturing polyacrylamide gel, electrophoresis 2.5h under 250V is through 0.2%AgNO
3Take a picture with digital camera after the dyeing, take DL2000marker as standard molecular weight;
4) linkage relationship of SRAP mark and cytoplasmic male sterility shape
Restructuring F for target gene
2And F
3Colony, add up the quantity of SRAP mark in homozygous male fertile individual plant, homozygous male sterile individual plant and assorted and the type male-fertile individual plant, me3em3-366 and can to educate crossover value between the nuclear gene be that crossover value between 3.876%, me3em3-372 and the sterile nucleus gene is 4.142%.Show the 366bp band and can educate gene linkage, the 372bp band is chain with sterile gene.
5) feature of SRAP mark and selection strategy thereof
This SRAP is labeled as the codominant marker, isozygoty can educate the special band of me3em3-372 that can increase in can increase in the individual plant special band of me3em3-366, the sterile individual plant, heterozygosis can be educated individual plant and be had simultaneously two bands; For the restructuring segregating population, exist specific band me3em3-36 can educate nuclear gene with regard to necessarily carrying as long as detect in offspring's individual plant, exist specific band me3em3-372 just necessarily to carry the sterile nucleus gene, need not by the time to bloom and select period, indirectly select the fertility proterties by the SRAP mark, can in early days, fast, accurately select molecular breeding.
The present invention is to 258 F
2The individual plant DNA of colony carries out pcr amplification with the SRAP primer and shows, 183 strains have the special band of 366bp in 186 male fertile plants, 65 strains are without the special band of 366bp in 72 male sterile plants, 10 strains of recombinant type plant, account for 3.876% of total plant number, namely 366bp indicia band and the crossover value that can educate between the gene are 3.876%.186 strain fertile plant selfing offsprings are observed the Fertility segregation result obtained 122 strains, account for 65.6%, wherein 38 strains have the special band of 372bp in 40 male fertile plants that isozygoty, and 77 strains have the special band of 372bp in the 82 heterozygosis male fertile plants, consider F
3Fertile plant family colony dwindles, and sterile strain is reduced into 47 male sterile plants by same ratio the special band of 372bp, and 7 strains of recombinant type plant account for 4.142% of total plant number, and namely the crossover value between 372bp indicia band and the sterile gene is 4.142%.In 122 F3 strains of observing, the performance of the fertility of 113 strains and its F
2The specific mark of individual plant is consistent, and accuracy reaches 92.62%.
Description of drawings
Fig. 1 is the Chinese cabbage genomic dna detection figure that the CTAB method is extracted, wherein M:DNA standard molecular weight λ-DNA; 1-16: 16 individual plant DNA that choose at random;
Fig. 2 is the screening figure that can educate pond and sterile pond special primer, wherein M:DNA standard molecular weight DL2000; The arrow indication for can educate the specific spectruming belt me3em3-366 that amplifies in the pond; F: can educate pond DNA; S: sterile pond DNA;
Fig. 3 is that primer me3em3 is to parent and the detected result figure that builds the pond individual plant, wherein M:DNA standard molecular weight DL2000; F: can educate pond DNA; S: sterile pond DNA; C: restorer; F
1: first-filial generation; A: sterile line; 1-10: can educate individual plant; 11-20: sterile individual plant; 2,6: isozygoty and to educate individual plant; 18: the exchange individual plant;
Fig. 4 is that the me3em3 primer is to F
2Individual plant detected result figure, wherein M:DNA standard molecular weight DL2000; 21-32: can educate individual plant; 33-44: sterile individual plant; 26,30-32: isozygoty and to educate individual plant;
Fig. 5 is the detected result figure of me3em3 specific mark in other material, wherein M:DNA standard molecular weight DL2000; F: can educate the DNA pond; S: sterile DNA pond; 45-47: sterile line 06J37; 48-50: restorer 01S275-3; 51-53: restorer 01S279-3; 54-67:F
1Generation;
The SRAP mark that utilizes celery cabbage nucleo-cytoplasmic interreaction male sterility that provides below in conjunction with accompanying drawing and contriver carries out molecule assisted selection method, and the present invention is described in further detail.
Embodiment
The present invention is with Chinese cabbage cytoplasm male sterility line 06J45, restorer 01S325-1, and the F of hybridization generation
1Generation, F
2Colony, F
3Family is the label screening material, with 17 F of sterile line 06J37, restorer 01S275-3,01S279-3 and 2 sterile line 06J452,06J37 and 3 restorer 01S325-1,01S275-3,01S279-3
1Be the checking material for colony.
The research and utilization SRAP technology screening Auele Specific Primer relevant with cytoplasmic male sterility further to the specific fragment cloning and sequencing, passes through F
2Generation and F
3Family is separated performance, calculates linkage distance, with the SRAP tag application in molecular breeding.
At first carry out the Auele Specific Primer screening, the cloning and sequencing of specific band, the checking of SRAP primer and segregating population law of segregation are analyzed.Specific as follows:
1. the genetic analysis of the restorative and sterility of cabbage cytoplasm male sterile
F to 06J45 * 01S325-1
2Segregating population 258 strain plant have carried out the fertility investigation, as a result male fertile plant 186 strains, and male sterile plant 72 strains are through x
2Test shows male-fertile and the male sterile (x that meets 3: 1 of separating
0 2=1.013, x
0.05,1 2=3.841), show that the fertility restorer of this male sterile line is controlled by single dominant gene, sterility is controlled by single recessive gene.
2. method DNA extraction in a small amount
A. get the fresh leaflet tablet that 0.2g removes master pulse, fill in the centrifuge tube of 1.5mL, put into the liquid nitrogen quick-frozen, be ground to rapidly powder with the clean plastics grinding rod of 75% alcohol-pickled mistake;
B. add 700 μ L through 1 * CTAB of 65 ℃ of preheatings extracting solution in centrifuge tube, the prescription of extracting solution is: CTAB 2%, Tris-HCl 100mmol/L, EDTA 20mmol/L, NaCl 1.4mol/L; Add again 8 μ L beta-mercaptoethanols, rapidly mixing;
C. subsequently centrifuge tube is put into 65 ℃ of water-baths, water-bath 30min shook once in middle every interval 5min minute;
D. take out centrifuge tube, add the mixture with the isopyknic phenol of centrifugal liquid in pipe, chloroform and primary isoamyl alcohol, wherein, phenol: chloroform: primary isoamyl alcohol=25: 24: 1, shake up 15min after, the centrifugal 10min of 12000r/min under the normal temperature;
E. upper phase (about 700 μ L) is transferred in another centrifuge tube, add isopyknic chloroform: primary isoamyl alcohol, its ratio are 24: 1, shake up gently 10min, the centrifugal 10min of 12000r/min under the normal temperature;
F. get the dehydrated alcohol that supernatant (about 500 μ L) adds the precooling of 2 times of volumes, mixing is united DNA gently, precipitates 30min, 4 under-20 ℃ of conditions.The centrifugal 10min of 12000r/min under the C condition;
G. abandon supernatant, add 500 μ l, 75% washing with alcohol precipitation 2 times, the throw out room temperature is dried;
H. add 500 μ L TE damping fluid dissolving DNAs, add 0.3 μ L RNaseA (10 μ g/ μ L), mixing, centrifugal rear 37 ℃ of insulation 30min;
I. after DNA dissolves fully, add the dehydrated alcohol of 3mol/L NaAC solution 50 μ L and 2 times of volume precoolings, mixing is united DNA gently, precipitates 30min under-20 ℃ of conditions;
J. at 4 ℃, centrifugal 10min abandons supernatant under the 12000r/m condition, the ethanol washing and precipitating of adding 75% 1～2 time, and rear adding 75% ethanol ,-20 ℃ save backup;
The DNA that extracts through purity detecting, confirms purifying better (such as accompanying drawing 1), and 400～500 μ L ddH2O dilution with sterilization is stored in 4 ℃ for subsequent use.
3. screening amplification polymorphism primer screening and the labeled analysis of polymorphism SRAP primer
This test shares 88 kinds of SRAP combination of primers and increases in can educating pond and sterile pond, through statistics, about nearly 20 bands of each swimming lane.Screen at last 6 pairs of primers that polymorphism arranged pair, wherein me3em3 is through 3 repeat amplification protcols, all show consistent difference can educating between pond and the sterile pond, can educate pond DNA cloning product and have more the special band that 1 size is 366bp (such as accompanying drawing 2) than sterile pond DNA cloning product.And then with this primer to the parent with build the amplification of pond individual plant, the as a result stable appearance of the special band of 366bp (such as accompanying drawing 3), illustrate that this band and fertile gene are closely related, called after me3em3-366 finds primer me3em3 amplification parent 06J45 and 01S325-1, F simultaneously
1(such as accompanying drawing 3), 3 kinds of banding patterns have appearred in the result, are respectively: recovery fertile plant 01S325-1 amplifies the special band of single 366bp, sterile strain 06J45 amplifies single 372bp band, F
1Amplify simultaneously 366bp and 372bp band, build in fertile plant that the fertile plant banding pattern has appearred in 2 strains in the individual plant of pond, F has appearred in 8 strains
1Banding pattern, sterile strain builds that 1 strain is F in the individual plant of pond
1Banding pattern, 9 strains be sterile strain banding pattern, as seen this two band has the codominance characteristics.
4.SRAP codominant marker's checking and linkage analysis
With primer me3em3 Amplification Analysis F
2Segregating population (such as accompanying drawing 3, Fig. 4).Through 3 kinds of banding pattern ratios of statistics be: male parent banding pattern: F
1For banding pattern: maternal banding pattern=59: 131: 68, through x
2Test meets 1: 2: 1 law of segregation (x
0 2=0.691, x
0.05,2 2=5.991), this shows that this SRAP mark is a kind of codominant marker, can distinguish homozygote and heterozygote.Through F
3The family phenotype is to F
2Aforementioned proportion and F are found in the genotypic deduction of fertile plant individual plant
2Segregation ratio for Fertile Genotype is identical, 122 F that observing
3In the strain, the performance of the fertility of 113 strains and its F
2The specific mark of individual plant is consistent, accuracy reached for 92.62% (such as table 1), be that these three kinds of banding patterns have represented respectively 3 kinds of Fertile Genotypes 1 (RfRf): 2 (Rfrf): the segregation ratio of 1 (rfrf), 366bp is with and can educates gene linkage, and the 372bp band is chain with sterile gene.
In order to determine the genetic distance between specific fragment and the fertile gene, the F that has increased and built up by 06J45 * 01S325-1 with primer me3em3
2258 individual plants of segregating population, 183 strains have the special band of 366bp in 186 male fertile plants as a result, in 72 male sterile plants 65 strains without the special band of 366bp, 10 strains of recombinant type plant, account for 3.876% of total plant number, namely 366bp indicia band and the crossover value that can educate between the gene are 3.876%.186 strain fertile plant selfing offsprings are observed the Fertility segregation result who has obtained 122 strains, account for 65.6%, wherein 38 strains have the special band of 372bp in 40 male fertile plants that isozygoty, 77 strains have the special band of 372bp in the 82 heterozygosis male fertile plants, consider that fertile plant family colony dwindles, sterile strain is reduced into 47 male sterile plants by same ratio the special band of 372bp, and 7 strains of recombinant type plant account for total plant number
4.142%, (such as table 1).
The genetic linkage analysis of table 1me3em3 specific mark and fertile gene
5.SRAP codominant marker's selection effect
In order to verify the SRAP mark me3em3-366 effect that auxiliary male sterile is selected in cytoplasmic male sterile gene transformation process, choose the sterile line 06J37 (at random choose three individual plants) different from the used examination material of SRAP label screening; Restorer 01S275-3,01S279-3 (each chooses three individual plants at random); The progeny population of 2 sterile lines and 3 restorers: F
1For 17 of colonies (each colony chooses three individual plants at random), carry out SRAP labeled analysis (such as accompanying drawing 5).As a result sterile line, restorer and F
1Above-mentioned 3 kinds of banding patterns have been reproduced fully, illustrate that above these materials have identical genetic background with the used material of selection markers, and the accuracy of prediction reached 100% when this mark of these material uses was selected, and namely the accuracy of this SRAP marker assisted selection reaches 100%.This result shows that this SRAP is marked at the assisted Selection that can be used for male sterility gene in the transformation of Chinese cabbage cytoplasm male sterility gene.
6.SRAP codominant marker's sequential analysis
Downcut respectively specific band Rf24-5-3 from the polyacrylamide gel with male parent banding pattern and maternal banding pattern individual plant and ms16-23-3 carries out cloning and sequencing, the result shows, the specific fragment length that specific band Rf24-5-3 comprises primer sequence is 366bp, and the specific fragment length that specific band ms16-23-3 comprises primer sequence is 372bp.Specific fragment ms16-23-3 has only been Duoed 6 bases than specific fragment Rf24-5-3.
Specific band Rf24-5-3 total length 366bp, sequence is as follows:
TGAGTCCAAACCGGAATGCTAACCTAACCGACTATTAACTAATTTACTGTAGTTGGGCTTGTTTGGGCTTAGTTGGACTCTTGTCTCTTTCATATTTGCTATGTAACTTTGAAAAAAGCCATTGTAGAGAGTAGACAGCGTCTCTCGAATCTGCTTAATCTTCCTCTCCTCACCTTTAATCAATCATCTCCTCCATCCAACTTCTTTTATCTCCTTCTCGCATTTATCTTCTTTACAAAAAAGTCAACCCTTTCCTTATCAGAATCTCCCTCCCATAGCTTTGACTGTCGCAATACCTTAAGATTGATCACTACTCCGACTTTCCTATTTGGAAACATCTTCAAGGTA
GTCAATTCGTACGCAGTC
Specific band ms16-23-3 total length 372bp, sequence is as follows:
TGAGTCCAAACCGGAATGCTAACCTAACCGACTATTAACTAATTTACACCAATCAAATTCACCGCGAACTCTTGTCTGGGCTTATTAACCGACTTATTTGGGCTTAGATGGGCTTGTTTGGGCTTAGTTGGACTCTTGTCTCTTTCATTTTTGCTATGTAACTTTGAAAAACTCCATTGTAGAGTGTGGACAGCGTCTCTGGAATCTGCTTAATCTTCCTCCTCACCTTTAATCATCTTCTTTTATCTCCTTCTCGCATTTATCTTCTTTACAAAAAGTCAACTCTTTCCTTATCAGAATCTCCCTCCCATCGCTTTAACTATCGCAATACACCGACTTCACATCTTCAAGGTA
GTCAATTCGTACGCAGTC
Two ends are the SRAP primer sequence
Me3：5’TGAGTCCAAACCGGAAT3’17bp
Em3：5’GTCTGCGTACGAATTGAC3’18bp
These two sections nucleotide sequences are inputted respectively GenBank, with the Blast program homology search and sequence comparison are carried out in the nucleotide sequence storehouse, the result does not find homologous sequence, illustrates that this sequence is the new sequence in the Chinese cabbage.Therefore with these two the special segment Rf24-5-3 of special band called after and special segment ms16-23-3.
The special segment Rf24-5-3 total length of the nucleotide sequence 366bp of the special segment Rf24-5-3 of SRAP mark and special segment ms16-23-3, sequence is as follows:
TGAGTCCAAACCGGAATGCTAACCTAACCGACTATTAACTAATTTACTGTAGTTGGGCTTGTTTGGGCTTAGTTGGACTCTTGTCTCTTTCATATTTGCTATGTAACTTTGAAAAAAGCCATTGTAGAGAGTAGACAGCGTCTCTCGAATCTGCTTAATCTTCCTCTCCTCACCTTTAATCAATCATCTCCTCCATCCAACTTCTTTTATCTCCTTCTCGCATTTATCTTCTTTACAAAAAAGTCAACCCTTTCCTTATCAGAATCTCCCTCCCATAGCTTTGACTGTCGCAATACCTTAAGATTGATCACTACTCCGACTTTCCTATTTGGAAACATCTTCAAGGTA
GTCAATTCGTACGCAGTC
Special segment ms16-23-3 total length 372bp, sequence is as follows:
TGAGTCCAAACCGGAATGCTAACCTAACCGACTATTAACTAATTTACACCAATCAAATTCACCGCGAACTCTTGTCTGGGCTTATTAACCGACTTATTTGGGCTTAGATGGGCTTGTTTGGGCTTAGTTGGACTCTTGTCTCTTTCATTTTTGCTATGTAACTTTGAAAAACTCCATTGTAGAGTGTGGACAGCGTCTCTGGAATCTGCTTAATCTTCCTCCTCACCTTTAATCATCTTCTTTTATCTCCTTCTCGCATTTATCTTCTTTACAAAAAGTCAACTCTTTCCTTATCAGAATCTCCCTCCCATCGCTTTAACTATCGCAATACACCGACTTCACATCTTCAAGGTA
GTCAATTCGTACGCAGTC
Two ends are the SRAP primer sequence
Me3：5’TGAGTCCAAACCGGAAT3’17bp
Em3：5’GTCTGCGTACGAATTGAC3’18bp
Claims (2)
1. the SRAP mark of a celery cabbage nucleo-cytoplasmic interreaction male sterility is characterized in that, the special segment Rf24-5-3 nucleotide sequence of this SRAP mark is:
TGAGTCCAAACCGGAATGCTAACCTAACCGACTATTAACTAATTTACTGTAGTTGGGCTTGTTTGGGCTTAGTTGGACTCTTGTCTCTTTCATATTTGCTATGTAACTTTGAAAAAAGCCATTGTAGAGAGTAGACAGCGTCTCTCGAATCTGCTTAATCTTCCTCTCCTCACCTTTAATCAATCATCTCCTCCATCCAACTTCTTTTATCTCCTTCTCGCATTTATCTTCTTTACAAAAAAGTCAACCCTTTCCTTATCAGAATCTCCCTCCCATAGCTTTGACTGTCGCAATACCTTAAGATTGATCACTACTCCGACTTTCCTATTTGGAAACATCTTCAAGGTA
GTCAATTCGTACGCAGTC；
Wherein, the sequence of two ends underlining is the SRAP primer.
2. the SRAP mark of a celery cabbage nucleo-cytoplasmic interreaction male sterility is characterized in that, the special segment ms16-23-3 nucleotide sequence of this SRAP mark is:
TGAGTCCAAACCGGAATGCTAACCTAACCGACTATTAACTAATTTACACCAATCAAATTCACCGCGAACTCTTGTCTGGGCTTATTAACCGACTTATTTGGGCTTAGATGGGCTTGTTTGGGCTTAGTTGGACTCTTGTCTCTTTCATTTTTGCTATGTAACTTTGAAAAACTCCATTGTAGAGTGTGGACAGCGTCTCTGGAATCTGCTTAATCTTCCTCCTCACCTTTAATCATCTTCTTTTATCTCCTTCTCGCATTTATCTTCTTTACAAAAAGTCAACTCTTTCCTTATCAGAATCTCCCTCCCATCGCTTTAACTATCGCAATACACCGACTTCACATCTTCAAGGTA
GTCAATTCGTACGCAGTC；
Wherein, the sequence of two ends underlining is the SRAP primer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810236450 CN101440408B (en) | 2008-12-25 | 2008-12-25 | Celery cabbage nucleo-cytoplasmic interreaction male sterility SRAP marker and use thereof for assisting selective breeding |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810236450 CN101440408B (en) | 2008-12-25 | 2008-12-25 | Celery cabbage nucleo-cytoplasmic interreaction male sterility SRAP marker and use thereof for assisting selective breeding |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101440408A CN101440408A (en) | 2009-05-27 |
| CN101440408B true CN101440408B (en) | 2013-04-03 |
Family
ID=40725017
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200810236450 Expired - Fee Related CN101440408B (en) | 2008-12-25 | 2008-12-25 | Celery cabbage nucleo-cytoplasmic interreaction male sterility SRAP marker and use thereof for assisting selective breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101440408B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1736170A (en) * | 2005-08-11 | 2006-02-22 | 西北农林科技大学 | Breeding method of bolting-resistant Chinese cabbage |
-
2008
- 2008-12-25 CN CN 200810236450 patent/CN101440408B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1736170A (en) * | 2005-08-11 | 2006-02-22 | 西北农林科技大学 | Breeding method of bolting-resistant Chinese cabbage |
Non-Patent Citations (6)
| Title |
|---|
| Li G, Quiros C F.Sequence-related amplified polymorphism (SRAP), a new marker system based on a simple PCR reaction: its application to mapping and gene tagging in Brassica.《Theor Appl Genet》.2001,第103卷455-461. |
| Sequence-related amplified polymorphism (SRAP), a new marker system based on a simple PCR reaction: its application to mapping and gene tagging in Brassica;Li G, Quiros C F;《Theor Appl Genet》;20011231;第103卷;455-461 * |
| 大白菜SRAP反应体系的建立与优化;杨琦, 张鲁刚;《西北农业学报》;20071231;第16卷(第3期);119-123 * |
| 张鲁刚,等.玻里马胞质大白菜雄性不育系CMS3411-7温度敏感特性的研究.《园艺学报》.2001,第28卷(第5期),415-420. |
| 杨琦, 张鲁刚.大白菜SRAP反应体系的建立与优化.《西北农业学报》.2007,第16卷(第3期),119-123. |
| 玻里马胞质大白菜雄性不育系CMS3411-7温度敏感特性的研究;张鲁刚,等;《园艺学报》;20011231;第28卷(第5期);415-420 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101440408A (en) | 2009-05-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mujeeb-Kazi et al. | Breeding strategies for structuring salinity tolerance in wheat | |
| CN106868131B (en) | SNP molecular marker of upland cotton No. 6 chromosome related to fiber strength | |
| Kulwal et al. | Genomics interventions in crop breeding for sustainable agriculture | |
| CN105063033B (en) | A kind of molecular labeling of Brassica Napus knee ospc gene and its application in anti-clubroot breeding | |
| CN109234428A (en) | A kind of molecular labeling and selection of cabbage type rape high erucic acid gene | |
| CN109880930A (en) | The molecular labeling and its identification method of a kind of rice cold tolerance main effect QTL qCTS12 and application | |
| Zhang et al. | Breeding by selective introgression: Theory, practices, and lessons learned from rice | |
| CN102586244B (en) | Radish cytoplasmic male sterility molecular markers and method for assisting selective breeding using same | |
| CN102703438A (en) | Molecular marker of brassica napus L. grain weight character and preparation method and application | |
| CN104293900B (en) | Haplotype related to Zea mays L. drought resistance and molecular marker thereof | |
| CN102121052B (en) | Specific molecular marker sequence for identifying recessive genic male sterility mutant gene ms 26 and its wild type allele | |
| CN104109713B (en) | With the multilocus assisted selection method that wheat conventional breeding whole process is combined | |
| CN103740817B (en) | Method for identifying male sterile cytoplasm based on kenaf atp8 gene | |
| CN111088258B (en) | Rice photo-thermo-sensitive nuclear male sterility gene tms3650 and molecular marker and application thereof | |
| CN103952403B (en) | The closely linked molecular marker of rice bacterial blight resistance new gene Xa39 | |
| CN110951753B (en) | Rice photo-thermo-sensitive nuclear male sterility gene tms2759 and molecular marker and application thereof | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN108103237A (en) | The InDel molecular labelings and its detection primer that are isolated with rice bacterial leaf spot disease-resistant gene xa34 (t) and application | |
| CN102304513A (en) | Closely interlocked molecular mark of rice new gene source-sink 1 (SS1) | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN110551843A (en) | Codominant marker primer capable of distinguishing RTSW homozygous heterozygous genotypes of tobacco anti-spotted wilt sites, distinguishing method and application thereof | |
| CN101440408B (en) | Celery cabbage nucleo-cytoplasmic interreaction male sterility SRAP marker and use thereof for assisting selective breeding | |
| CN102534026B (en) | Method for assisting identification of 100-seed weight related loci of soybeand special primer thereof | |
| CN111100869B (en) | Molecular marker co-separated from rice photo-thermo-sensitive nuclear male sterility character and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130403 Termination date: 20141225 |
|
| EXPY | Termination of patent right or utility model |