CN101429507A - Heavy chain and light chain variable region gene of microcapsule algae toxin resistant monoclone antibody, and uses thereof - Google Patents
Heavy chain and light chain variable region gene of microcapsule algae toxin resistant monoclone antibody, and uses thereof Download PDFInfo
- Publication number
- CN101429507A CN101429507A CNA2008102403069A CN200810240306A CN101429507A CN 101429507 A CN101429507 A CN 101429507A CN A2008102403069 A CNA2008102403069 A CN A2008102403069A CN 200810240306 A CN200810240306 A CN 200810240306A CN 101429507 A CN101429507 A CN 101429507A
- Authority
- CN
- China
- Prior art keywords
- gene
- antibody
- variable region
- chain variable
- chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to heavy-chain and light-chain variable region genes of a monoclonal antibody for resisting microcystins and application thereof, which belong to the technical field of biology. The invention provides a heavy-chain variable region gene and a light-chain variable region gene of the monoclonal antibody for resisting the microcystins, recombines the two genes to obtain a single-chain antibody gene, and constructs a vector for the single-chain antibody gene and transforms the gene into colon bacillus. The expression product of the gene has antigen recognition activity, and can be used for detecting and monitoring the microcystins in water body.
Description
Technical field
The present invention relates to the genetically engineered field, particularly relate to a kind of heavy chain and chain variable region gene sequence and application thereof of monoclonal antibody of microcapsule algae toxin resistant.
Background technology
Microcystin (microcystins, the secondary metabolite that the explosive breeding of blue-green algae produces in the water body when MC) being the wawter bloom generation.MCs is the ring seven peptide family of a structural similitude, has found the different MCs of kind more than 80 (WHO, 2004) at present in fresh water, and wherein MC-LR is that present known toxicity is the strongest, a kind of fresh water cyanophycean toxin (Sivonen, 1996 of acute hazard maximum; Han Zhiguo etc., 2001).MC-LR is a kind of hepatotoxin, and this toxin is the strong carcinogenic promoting agent of liver cancer, can cause hepatic necrosis, hemorrhage or apoptosis (Liu etc., 2000).
Wawter bloom frequently occurs in recent years, and area spreads year by year, and China Taihu Lake, Dian Chi, Chaohu, Hongchehu Lake all happen occasionally, and ecological safety and human safe drinking water in serious threat, and be therefore, extremely important to the monitoring that Microcystin in the water body carries out promptly and accurately.How setting up a kind of simple, quick, highly sensitive detection means, reduce harm so that take appropriate measures, is the problem that presses for solution at present.Adopt methods such as HPLC, LC/MS, GC to detect Microcystin in the water body in the traditional detection method mostly, these methods are the step complexity not only, and plant and instrument is also expensive, is not suitable for extensively real-time application.And immunoassay is cheap with it, highly sensitive, workablely become a detection technique that is worthy of popularization, immunodetection is based on the detection method of Ag-Ab specific reaction, aspect the Microcystin in detecting water body, because its detection speed is fast, the rapid screening of the cheap and suitable extensive sample of expense; Its high specific highly sensitive has very wide application prospect for the early warning context of detection.
Immunodetection is a kind of ideal detection method on the whole, and its key is to obtain specificity and binding affinity good antibody, particularly monoclonal antibody.This micromolecular organic pollutant of Microcystin belongs to the haptens material, and its immunogenicity is very weak or do not have an immunogenicity, during promptly directly with its immune animal, be difficult to a large amount of antibody that obtain or do not produce, must be loaded in the macromolecular carrier material, just can become complete antigen; Even after obtaining standard compliant antibody, the preparation of the mass production of this antibody also is an expensive time-consuming job, in one word, utilizes immunologic detection method to detect Microcystin in the water body, and a large amount of preparations of antibody so far remain a difficult problem.
Along with the recombinant antibodies technology that grows up of genetic engineering technique has been brought Gospel for the solution of this difficult problem, the recombinant antibodies technology is the gene splicing with the antigenic activity identified region of monoclonal antibody, be cloned into and transform microorganism in the common carrier, utilize the microorganisms producing single-chain antibody, these single-chain antibodies possess the antigen-binding activity of former monoclonal antibody, McElhiney J. etc. filters out the anti-MC-LR single-chain antibody of a strain from people phage body storehouse, can detect the standard (1 μ g/L) that is lower than World Health Organization's defined drinking water standard
[9], so the detection sensitivity of single-chain antibody is confirmed.And recombinant antibodies technology manufacture order chain antibody is simpler than traditional method for preparing monoclonal antibody, economy, cycle short, therefore be an ideal ancillary technique in the immunoassay technology utilization, in the single-chain antibody preparation of microcapsule algae toxin resistant, wide utilization prospect arranged.
Summary of the invention
The present invention is directed to defective in the above-mentioned field a kind of heavy chain and chain variable region gene and application thereof of monoclonal antibody of microcapsule algae toxin resistant are provided, for the Microcystin Antibody Preparation provides easy, economic approach.
A kind of heavy chain variable region gene of monoclonal antibody of microcapsule algae toxin resistant, the sequence of its nucleotide sequence shown in Seq ID No.1.
Above-mentioned heavy chain variable region gene encoded polypeptides, its aminoacid sequence is shown in Seq ID No.5.
A kind of chain variable region gene of monoclonal antibody of microcapsule algae toxin resistant, the sequence of its nucleotide sequence shown in Seq ID No.2.
Above-mentioned chain variable region gene encoded polypeptides, its aminoacid sequence is shown in Seq ID No.6.
A kind of gene of single-chain antibody is characterized in that: comprise above-mentioned heavy chain variable region gene sequence and the chain variable region gene sequence shown in Scq ID No.2 shown in Seq ID No.1.
The gene of above-mentioned single-chain antibody, its nucleotide sequence is shown in Seq ID No.3.
The gene order encoded polypeptides of above-mentioned single-chain antibody.
The aminoacid sequence of aforementioned polypeptides is shown in Seq ID No.4.
The expression vector pET-MC that comprises the gene order of described single-chain antibody.
The degenerated primer and the Auele Specific Primer of the above-mentioned heavy chain gene sequence that increases,
Degenerated primer HFR1:5 '-SAR G TN MAG CTG SAG SAG TCW GG-3,
Specificity forward primer V
H-B:5 '-GGG AAT TC
C ATA TGG AGG TTA AGC TGC AGG AGTC-3 ',
Specificity forward primer V
H-F:5 '-CCG CTA CCA CCC CCT CCA GAT CCG CCA CCT CCTGAG GAG ACG GTG ACC GT-3 ';
The degenerated primer and the Auele Specific Primer of the above-mentioned light chain gene sequence that increases,
Degenerated primer LFR:5 '-GAY ATT GTG MTS ACM CAR WCT MCA-3,
Specificity forward primer V
L-B:5 '-CTG GAG GGG GTG GTA GCG GTG GAG GCG GGA GTGATA TTG TGA TGA CAC AGT C-3 ',
Specific reverse primers V
L-F:5 '-GGT
CTC GAGTTA CCG TTT GAT TTC CAG CTT GG-3 '.
Aforementioned polypeptides is as the application of single-chain antibody in detection and quantitative Microcystin.
The present invention adopts the conserved region gene sequences Design degeneracy according to the mouse resource monoclonal antibody to draw HFR1/LFR, the total RNA of hybridoma G5 that expresses the monoclonal antibody of anti-MC-LR with a strain is a template, amplifies two gene fragments (Fig. 1) of 1500bp and 900bp respectively through RT-PCR.After the order-checking, sequential analysis shows that the big fragment of amplification is 1473bp, shown in SeqID No.7, is the dna sequence dna of monoclonal antibody heavy chain, comprises part variable region of heavy chain (V
H), complete CH1, CH2, three constant regions of CH3 and 3 ' end non-coding region, wherein V
HSize is 363bp, 121 amino acid of encoding; The less fragment that increases be 880bp shown in Seq ID No.8, be the light chain dna sequence dna, comprise part variable region of light chain (V
L), complete constant region and 3 ' non-coding region, wherein V
LSize is 336bp, 112 amino acid of encoding.V
HAnd V
LMeet mouse immuning ball protein variable region gene feature, all contain distinctive 2 cysteine residues of 4 framework regions (FR), 3 antigen complementary determining regions (CDR) and antibody, and there is not the codon of termination in the gene, show that the sequence of being cloned is the gene order (Martin of mouse source antibody, A.C.R.Accessing the Kabat Antibody Sequence Database by Computer.PROTEINS:Structure, Function and Genetics, 1996,25:130-133); The fragment that obtains according to amplification designs Auele Specific Primer V
H-B/V
H-F, V
L-B/V
L-F amplifies this monoclonal antibody variable region of heavy chain V
HIts sequence of gene shown in Seq ID No.1 and variable region of light chain V
LIts sequence of gene shown in Seq ID No.2.
The above-mentioned light chain that the present invention obtains, the aminoacid sequence that heavy chain variable region gene sequence encoded polypeptide has monoclonal antibody antigen binding domain territory, can be used as the integral part of single-chain antibody or multivalent antibody, be used for the quantitative of immunodetection or antigenic substance.
Light chain and heavy chain variable region gene sequence that the present invention obtains can reassemble into a single-chain antibody gene, also can reassemble into the multivalent antibody gene with the variable region gene of other antibody, adopt overlapping extension PCR TRAP that Seq ID No.1 and Seq ID No.2 are stitched together among the present invention and obtain single-chain antibody scFv gene, wherein the transition gene that two gene orders are stitched together is optionally, and the front and back of light chain and heavy chain order does not have special requirement yet.
The present invention preferably adopts (Huston J S such as Huston, Leuinson D, Mudgett-Honter M, et al.Proteinengineering of an antibody binding sites:recovery of specific activity in an anti-digoxin singlechain Fv analogue produced in Escherichia coli.Proc Natl Acad Sci, 1988,85 (16): 5879-5883) 15 peptides of designing according to Fab fragment X line crystalline diffraction analysis of data (Gly4Ser) with rigid structure
3As the connection peptides of light chain and heavy chain, with 15 peptides (Gly4Ser)
3Gene order be designed into heavy chain Auele Specific Primer V
H3 ' the end of-F, light chain Auele Specific Primer V
L5 ' the end of-B is introduced the connection peptides gene order by overlapping extension PCR, obtains the single-chain antibody gene of sequence shown in Seq ID No.3, its nucleotide sequence structure be 5 '-VH-linkcr-VL-3 ' (Fig. 6).
Reorganization obtains scFv gene order codified and includes the light chain of monoclonal antibody and the proteinic aminoacid sequence in antigen binding domain territory of heavy chain.The present invention will obtain reorganization scFv gene order Seq ID No.3 and be building up to acquisition expression vector pET-MC among the carrier pET-28a (+), and transformed into escherichia coli Origami
TM2, the recon called after pScFv of acquisition, the purified back of pScFv expressed proteins demonstrates the albumen that a size is about 30KD on the SDS-PAGE running gel; Detect through Western blot, interpretation of result shows that the mouse-anti His antibody capable expression product of 30KD therewith carries out specific binding reaction, and does not all have association reaction Fig. 3 B with other band, proves that this albumen is the purpose single chain antibody protein.The present invention also detects specific recognition ability between this single-chain antibody and the MC-BSA by the ELISA method, and wherein, MC-BSA is the MC-LR that is coupled on the BSA molecule.Measurement result table 1 shows that scFv antibody and MC-BSA are positive, and compares, and contrasts the reaction that is negative, and testing data shows that this albumen has and antigenic competition bonded ability, and the concentration of bonded intensity and added single-chain antibody is proportionate.The recombinant single chain antibody gene that experimental result explanation the present invention obtains can be at expression in escherichia coli, its expression product can replace monoclonal antibody to carry out the immunodetection reaction to detect or to monitor the Microcystin in the water body, has solved the problems that are difficult to obtain fast in a large number monoclonal antibody.
The polypeptide of single-chain antibody gene sequence encoding of the present invention comprises the light chain and the weight chain variable region amino acid sequence of microcapsule algae toxin resistant monoclonal antibody, the transition peptide that wherein connects light chain and heavy chain is optional, the single-chain antibody gene sequence SeqID No.3 encoded polypeptides sequence that the present invention obtains is shown in Seq ID No.4, sequence shown in the Seq ID No.4 meets the feature of mouse immuning ball protein variable region, contains 4 framework regions (FR) of heavy chain part, 4 framework regions (FR) of distinctive 2 cysteine residues of 3 antigen complementary determining regions (CDR) and antibody and light chain part, distinctive 2 cysteine residues of 3 antigen complementary determining regions (CDR) and antibody (Fig. 4).This aminoacid sequence can replace the monoclonal antibody of microcapsule algae toxin resistant to be used for the immunodetection reaction to detect the Microcystin in the water body.
The single-chain antibody gene that the wood invention obtains can be used as the component units that makes up multivalent antibody, promptly can be applicable to prepare the antibody of multivalence (genetic engineering antibody with three or more functional antigen combining sites) high-affinity.It utilizes the single chain antibody protein of microorganism great expression to can be used for the batch detection and the monitoring of Microcystin in the water body.
Figure of description
The pcr amplification checking of Fig. 1 heavy chain and light chain gene sequence,
M:DL2000 plus marker; 1: the pcr amplification of heavy chain gene; 2: the pcr amplification of light chain gene.
Fig. 2 V
HAnd V
LSplicing.
M:DL2000 plus marker; 1:V
HAnd V
LSplicing product
The SDS-PAGE of Fig. 3 A microcapsule algae toxin resistant scFv,
The Western blot result of Fig. 3 B microcapsule algae toxin resistant scFv.
M: albumen Marker; 1 and 5: the Origammi 2 bacterium liquid that transform pET-28a; 2 and 4: the Origami2 bacterium liquid that changes pET-M; 3 and 6: the scFv of recovery.
The aminoacid sequence of Fig. 4 single-chain antibody gene sequence encoding.
The scFv albumen that Fig. 5 microcapsule algae toxin resistant scFv albumen and purifying reclaim,
M: albumen Marker; 1: the Origami 2 thick bacterium liquid that transform pET-MC; 2,3,4,5 be respectively NTA-0, NTA-20, NTA-40 and NTA-60; 6: the scFv of recovery.
Fig. 6 is the rough schematic of scFv expression vector.
Embodiment
1 material and method
The hybridoma cell strain G5 of secretion microcapsule algae toxin resistant (MC-LR) antibody is provided by Nutrition and Food Safety Office of China Disease Prevention and control Centre.Cloning vector pMD18-T is available from TaKaRa company; Expression vector pET-28a (+) and JM109 (be kept at the laboratory, contriver place of processing of farm products institute of Chinese Academy of Agricultural Sciences this patent, the public can obtain).Origami
TM2 available from Novagen company.
RNAiso Reagent, ExTaq, T4 dna ligase and restriction enzyme are available from TaKaRa company; M-MLV ThermoScript II, dNTPs and RNA enzyme inhibitors are available from Promega company; The Microcystin standard substance are U.S. Beacon company product; Antigenic synthesizing of MC-BSA finished by Beijing Bo Aosen Bioisystech Co., Ltd; Mouse-anti His antibody and sheep anti-mouse igg-HRP are available from sky root company; BCA method protein concentration quantification kit is available from Beijing hundred Tyke Bioisystech Co., Ltd.
2 design of primers
Degenerated primer HFR1 and LFR: according to conserved region gene sequences Design (Zhongde Wang, Murisiku Raifu, Meredith Howard, Laurie Smith, the et al. of mouse source immunoglobulin gene
Universal PCR amplification of mouse immunoglobulin gene variable rcgions:the design ofdegenerate primers and an assessment of the effect of DNA polymerase 3X to 5X exonucleaseactivity.Journal of Immunological Methods 233_2000.167-177), respectively with the heavy chain gene IgH and the light chain gene IgL of HFR1, Anchor and LFR, Anchor amplification antibody.
Auele Specific Primer: V
H-B/V
H-F, V
L-B/V
L-F, wherein V
H-B/V
H-F is right according to the Auele Specific Primer of the sequencing sequence design of the heavy chain of antibody gene IgH that amplifies, and the heavy chain variable region gene sequence is used to increase.V
L-B/V
L-F is right according to the Auele Specific Primer of the sequencing sequence design of the light chain of antibody gene IgL that amplifies, and the chain variable region gene sequence is used to increase.In addition at V
H3 ' the end of-F, V
L5 ' the end of-B has designed the gene order of connection peptides, and the gene order that is used for overlapping extension PCR introducing connection peptides is as follows: " GGTAGTAGCTACGTATCCTTCGATGTCTGGGGCGCAGGGACCACG ".Be (Huston J S such as Huston, Leuinson D, Mudgett-Honter M, et al.Protein engineering of an antibodybinding sites:recovery of specific activity in an anti-digoxin single chain Fv analogue produced inEscherichia coli.Proc Natl Acad Sci, 1988,85 (16): 5879-5883) 15 peptides of designing according to Fab fragment X line crystalline diffraction analysis of data (Gly4Ser) with rigid structure
3Gene order.
Above primer is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
The amplification of embodiment 1 monoclonal antibody heavy chain and light chain gene sequence
The extraction of the total RNA of step 1 hybridoma
Adopt RNAiso Reagent test kit to extract cell total rna.
CDNA first chain is synthesized in step 2 reverse transcription
Total RNA with extraction is a template, carries out reverse transcription with primer I gR, and reaction system is: total RNA 3.0 μ l, 5 * reverse transcription buffer, 2.0 μ l, dNTPs (2.5mM each) 2 μ l, HPRI (40u/ μ l) 0.5 μ l, M-MLV0.5 μ l, IgR0.5 μ l, DEPC-H
2O 1.5 μ l.
Reaction conditions is: room temperature 10min, 42 ℃ of water-bath 1h behind the cooling 2min, are stored in-20 ℃ in frozen water.The pcr amplification of step 3 heavy chain of antibody and light chain gene sequence:
Respectively with the heavy chain and the light chain gene of HFR1, Anchor and LFR, Anchor amplification antibody.Reaction system is 25 μ l:10 * PCR buffer 2.5 μ l, 2.5mM dNTPs 2 μ l, each 1 μ l of the upstream and downstream primer of 20 μ M, reverse transcription product 1.5 μ l, general T aq 0.5 μ l, ddH
2O is settled to 25 μ l.
Reaction conditions is: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 1min, 72 ℃ of 1min; 2 circulations; 94 ℃ of 30s, 59 ℃ of 1min, 72 ℃ of 1min; 2 circulations; 94 ℃ of 30s, 58 ℃ of 1min, 72 ℃ of 1min; 2 circulations; 94 ℃ of 30s, 57 ℃ of 1min, 72 ℃ of 1min; 30 circulations; 72 ℃ of 10min.
1% agarose gel electrophoresis detects PCR product Fig. 1, downcut the purpose fragment at corresponding length place respectively, reclaim test kit with glue and reclaim the purpose fragment, order-checking back sequence analysis revealed, the big fragment 1473bp of amplification, shown in Seq ID No.7, be the dna sequence dna of heavy chain of antibody, it comprises part variable region of heavy chain (V
H), complete CH1, CH2, three constant regions of CH3 and 3 ' end non-coding region, wherein V
HSize is 363bp, 121 amino acid of encoding; The less fragment that increases is that 880bp such as Seq ID No.8 are depicted as the light chain dna sequence dna, and it comprises part variable region of light chain (V
L), complete constant region and 3 ' non-coding region, wherein V
LSize is 336bp, 112 amino acid of encoding.V
HAnd V
LMeet mouse immuning ball protein variable region gene feature, all contain distinctive 2 cysteine residues of 4 framework regions (FR), 3 antigen complementary determining regions (CDR) and antibody, and do not have the codon of termination in the gene, show that the sequence of being cloned is mouse antibodies gene order heavy chain of antibody and light chain gene difference called after IgH and IgL.
Auele Specific Primer is to V
H-B/V
H-F and V
L-B/V
L-F amplifies heavy chain variable region gene V respectively
HShown in Seq ID No.1 and chain variable region gene V
LShown in Seq ID No.2.The PCR product reclaims test kit with glue and reclaims behind 1% agarose gel electrophoresis.
The V that adopts splicing overlap extension that pcr amplification is obtained
HAnd V
LBe spliced into the scFv gene fragment.
Detailed process is as follows: with the pure sequence V that reclaims
HAnd V
LRespectively add 1 μ l in the PCR reaction tubes after diluting 100 times, system (2 * buffer, 12.5 μ l, 2.5mM dNTP 2.5 μ l, V
H1 μ l, V
L1 μ l, primestar Taq 0.25 μ l, ddH
2O adds to 24 μ l).V is added in PCR reaction amplification 7 circulations (94 ℃ of 30s, 52 ℃ of 1min, 72 ℃ of 1min) then
H-B and V
LEach 0.5 μ l of-F is again with same 30 circulations of reaction conditions amplification.The PCR product reclaims test kit with glue and reclaims behind 1% agarose gel electrophoresis, obtain the fragment (Fig. 2) that size is about 750bp, conforms to the expection size.With fragment reclaim back and pET-28a (+) carrier with Nde I and Xho I respectively enzyme cut, be connected, transformed into escherichia coli JM109 then.Cut the positive recombinant called after pET-MC (Fig. 6) that filters out with PCR checking through enzyme, the sequencing result of positive recombinant shows, scFv full length gene 744bp comprises the V of expection
H, V
LWith Linker sequence (GGGGS) 3, and reading frame is correct.
The expression of embodiment 3 scFv and Western Blot analyze
Will be through sequence verification errorless positive recombinant plasmid pET-MC and control plasmid pET-28a (+) difference transformed into escherichia coli Origami 2 (DE3), picking contains single bacterium colony 37 ℃ of overnight incubation in 3ml LB liquid nutrient medium of recombinant plasmid and control plasmid respectively, 1:100 is diluted in the fresh LB liquid nutrient medium then, and shaking culture is to OD
600Reach 0.4～1.0, adding IPTG respectively is 1mM to final concentration, and 0.5mM and 0.1mM induce destination gene expression in 37 ℃ then.Then with 12% SDS-PAGE electrophoretic analysis.The result shows that the bacterial strain of recombinant plasmid is specific expressed and goes out the albumen (Fig. 3 A) that a size is about 30kD, do not have the corresponding proteins band and transform in the strain protein crude extract of empty plasmid.Preliminary this albumen of proof is target protein.
In order to prove that this albumen is target protein to be expressed, carry out Western Blot with His monoclonal antibody and sheep anti-mouse igg-HRP and analyze.After the SDS-PAGE electrophoresis finishes, gel is taken off, soak, cut out pvdf membrane (with methyl alcohol soak 1min earlier) and filter paper one simultaneously and coexist and soak in the electricity commentaries on classics damping fluid with putting into transfering buffering liquid after the clear water rinsing.Change placement successively on the folder at electricity: filter paper--gel--pvdf membrane--filter paper, each interlayer bubble of Ex-all.Gel side joint negative pole, tunica fibrosa side joint positive pole, constant voltage 80V electricity changeed 2～3 hours.Take off pvdf membrane,, add confining liquid room temperature sealing 1 hour with the flushing of TBST damping fluid.Added anti-His monoclonal antibody incubated at room 1 hour.TBST washes film three times, and each 5～10 minutes, the sheep anti mouse polyclonal antibody of adding horseradish peroxidase-labeled, incubated at room 1 hour.It is the same to wash film, adds the colour developing of TMB (3,3 ' 5,5 '-tetramethyl benzidine) substrate, uses flushing with clean water when waiting to develop the color to desired level, termination reaction, and the airing tunica fibrosa is taken a picture or is placed on shady and cool lucifuge place and preserves standby.
Western Blot analytical results shows that mouse-anti His antibody is the abduction delivering product of 30kD reaction therewith only, and with other bands all reactionless (Fig. 3 B), prove that this albumen is target protein.
The purifying of embodiment 4 scFv and antigen-binding activity are measured
Purifying:
Picking transforms the mono-clonal of recombinant plasmid from the flat board, be inoculated in the 5ml LB liquid nutrient medium, and 37 ℃ of overnight incubation, be transferred to the ratio of overnight culture in 1:100 in the 500ml LB liquid-based next day, continues 37 ℃ of shaking tables cultivations 2～3 hours to OD
600Reach 0.4～1.0, add the IPTG of 0.1mM,, carry out the abduction delivering of target protein in 15 ℃ of incubated overnight.The centrifugal 10min of room temperature 4000rpm collects thalline, and the NTA-0 Buffer that is resuspended in 1/20 cell growth volume adds N,O-Diacetylmuramidase to 1mg/ml with cell suspension, and mixing is placed 40min on ice, the ultrasonication cell.Add 10% Triton X-100, making its final concentration is 0.05%, and fully mixing is placed 15min on ice, on ice the ultrasonication cell.4 ℃ of centrifugal 15min of 15000rpm, cleer and peaceful precipitation in the collection, the target protein of solubility expression promptly is present in the supernatant.
With the NTA resin chromatography column of packing into, with the NTA-0 Buffer balance of 10 times of volumes.Above-mentioned sample is added in the NTA chromatography column, collects penetrating component, be used for the SDS-PAGE analysing protein in conjunction with situation.NTA-0Buffer with 5 times of NTA volumes washes post, to go out the albumen of non-specific combination.Use the NTA-20 of 5 times of NTA volumes respectively, NTA-40, NTA-60, NTA-80, NTA-100, NTA-200 Buffcr wash-out is collected elutriant, and every pipe is collected a NTA volume.NaOH solution with 0.5M behind the target protein wash-out is washed post, to remove the target protein of minor agglomeration may on post and other non-proteic impurity.SDS-PAGE determines the distribution situation of target protein in elutriant.Measure protein concentration with the BCA method.
Determination of activity
In 96 hole enzyme plates, every hole adds the MC-BSA of 100 μ L, 0.5 μ g/mL, hatches 2h, PBST washing 4-6 time, the skim-milk sealing 1h with 2% through 37 ℃.The enzyme plate of above-mentioned bag quilt is after washing plate, the purifying protein extracting solution that adds 100 μ L doubling dilutions is respectively hatched 2h through 37 ℃, wash plate after, the mouse-anti His antibody that adds 100 μ L 1:1500 dilution, hatch 2h through 37 ℃ again, wash plate after, add the sheep anti-mouse igg-HRP of 100 μ L 1:2500 dilution again, hatch 2h for 37 ℃, add substrate TMB in 37 ℃ of colour developings after washing plate,, and under the 450nm wavelength, measure each hole light absorption value with the sulfuric acid color development stopping of 2mol/L.Make negative control, the positive contrast of anti-MC-LR monoclonal antibody with the bacterial strain crude extract that transforms empty plasmid.Each handles three repetitions.Measurement result (table 1) shows that scFv antibody and MC-BSA are positive, and with the reduction of scFv antibody concentration, the light absorption value that is reflected at the 450nm place descends gradually, compares, and contrasts the reaction that is negative.Testing data shows that this single-chain antibody can combine with Microcystin generation specificity.
The ELISA reaction result of table 1 scFv
x±s，n＝3
SEQUENCE?LISTING
＜110〉Atomic Energy Utilization Inst. of China Agricultural Sciences Academy
＜120〉a kind of heavy chain of monoclonal antibody of microcapsule algae toxin resistant and chain variable region gene and application thereof
<130>P08566/NC
<160>8
<170>PatentIn?version?3.3
<210>1
<211>363
<212>DNA
＜213〉heavy chain variable region gene VH
<400>1
<210>2
<211>336
<212>DNA
＜213〉chain variable region gene VL
<400>2
<210>3
<211>744
<212>DNA
＜213〉nucleotide sequence of single-chain antibody scFv gene
<400>3
<210>4
<211>248
<212>PRT
＜213〉aminoacid sequence of single-chain antibody scFv
<400>4
<210>5
<211>121
<212>PRT
＜213〉VH amino acid sequence coded
<400>5
<210>6
<211>112
<212>PRT
＜213〉VL amino acid sequence coded
<400>6
<210>8
<211>1473
<212>DNA
＜213〉heavy chain gene IgH Gene Partial nucleotide sequence
<400>8
<210>8
<211>880
<212>DNA
＜213〉light chain gene IgL Gene Partial nucleotide sequence
<400>8
Claims (10)
1. the heavy chain variable region gene of the monoclonal antibody of a microcapsule algae toxin resistant, its nucleotide sequence is shown in Seq ID No.1.
2. the described heavy chain variable region gene encoded polypeptides of claim 1, its aminoacid sequence is shown in Seq ID No.5.
3. the chain variable region gene of the monoclonal antibody of a microcapsule algae toxin resistant, its nucleotide sequence is shown in Seq ID No.2.
4. the described chain variable region gene encoded polypeptides of claim 3, its aminoacid sequence is shown in Seq ID No.6.
5. the gene of a single-chain antibody is characterized in that: comprise the nucleotide sequence of the described heavy chain variable region gene shown in Seq ID No.1 of claim 1 and the nucleotide sequence of the described chain variable region gene shown in Seq ID No.2 of claim 3.
6. the gene of single-chain antibody according to claim 5, its nucleotide sequence is shown in Seq ID No.3.
7. the polypeptide of the genes encoding of the described single-chain antibody of claim 5.
8. polypeptide according to claim 7, its aminoacid sequence is shown in Seq ID No.4.
9. the expression vector pET-MC that comprises the gene order of the described single-chain antibody of claim 6.
10. claim 2,4,7 described polypeptide are as the application of single-chain antibody in detection and quantitative Microcystin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102403069A CN101429507A (en) | 2008-12-18 | 2008-12-18 | Heavy chain and light chain variable region gene of microcapsule algae toxin resistant monoclone antibody, and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102403069A CN101429507A (en) | 2008-12-18 | 2008-12-18 | Heavy chain and light chain variable region gene of microcapsule algae toxin resistant monoclone antibody, and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101429507A true CN101429507A (en) | 2009-05-13 |
Family
ID=40645145
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008102403069A Pending CN101429507A (en) | 2008-12-18 | 2008-12-18 | Heavy chain and light chain variable region gene of microcapsule algae toxin resistant monoclone antibody, and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101429507A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012142899A1 (en) * | 2011-04-21 | 2012-10-26 | 畿晋庆三联（北京）生物技术有限公司 | Anti-cyanobacteria recombinant antibody polypeptide, gene thereof, and preparation method thereof |
| CN109843907A (en) * | 2016-10-17 | 2019-06-04 | 新南创新有限公司 | Recombinate Microcystin production |
| CN110028581A (en) * | 2019-03-22 | 2019-07-19 | 华南农业大学 | A kind of preparation method and application of Microcystin Fab fragments |
| CN111592596A (en) * | 2020-06-02 | 2020-08-28 | 江苏省农业科学院 | Microcystin broad-spectrum recognition single-chain antibody and application thereof in epitope prediction |
| CN111718412A (en) * | 2020-03-27 | 2020-09-29 | 清华大学 | Broad-spectrum microcystin monoclonal antibody and preparation method thereof |
| CN116462755A (en) * | 2023-06-16 | 2023-07-21 | 北京建工环境修复股份有限公司 | Monoclonal antibody or antigen binding fragment of anti-microcystin LR |
-
2008
- 2008-12-18 CN CNA2008102403069A patent/CN101429507A/en active Pending
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012142899A1 (en) * | 2011-04-21 | 2012-10-26 | 畿晋庆三联（北京）生物技术有限公司 | Anti-cyanobacteria recombinant antibody polypeptide, gene thereof, and preparation method thereof |
| CN109843907A (en) * | 2016-10-17 | 2019-06-04 | 新南创新有限公司 | Recombinate Microcystin production |
| CN110028581A (en) * | 2019-03-22 | 2019-07-19 | 华南农业大学 | A kind of preparation method and application of Microcystin Fab fragments |
| CN110028581B (en) * | 2019-03-22 | 2022-02-11 | 华南农业大学 | Preparation method and application of microcystin antibody Fab fragment |
| CN111718412A (en) * | 2020-03-27 | 2020-09-29 | 清华大学 | Broad-spectrum microcystin monoclonal antibody and preparation method thereof |
| CN111718412B (en) * | 2020-03-27 | 2022-09-13 | 清华大学 | Broad-spectrum microcystin monoclonal antibody and preparation method thereof |
| CN111592596A (en) * | 2020-06-02 | 2020-08-28 | 江苏省农业科学院 | Microcystin broad-spectrum recognition single-chain antibody and application thereof in epitope prediction |
| CN111592596B (en) * | 2020-06-02 | 2022-02-08 | 江苏省农业科学院 | Microcystin broad-spectrum recognition single-chain antibody and application thereof in epitope prediction |
| CN116462755A (en) * | 2023-06-16 | 2023-07-21 | 北京建工环境修复股份有限公司 | Monoclonal antibody or antigen binding fragment of anti-microcystin LR |
| CN116462755B (en) * | 2023-06-16 | 2023-10-03 | 北京建工环境修复股份有限公司 | Monoclonal antibody or antigen binding fragment of anti-microcystin LR |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8841419B2 (en) | Hybridoma cell line 10G4 and a monoclonal antibody against the total of aflatoxin B1, B2, G1 and G2 | |
| CN101429507A (en) | Heavy chain and light chain variable region gene of microcapsule algae toxin resistant monoclone antibody, and uses thereof | |
| CN104017080B (en) | A kind of dog source single-chain antibody and construction method thereof and application | |
| CN103819561A (en) | Anti-CD24 (Cluster of Differentiation 24) monoclonal antibody, and variable region sequence and application thereof | |
| CN112111009B (en) | Variable region sequence of specific anti-pyraclostrobin antibody and recombinant full-length antibody thereof | |
| CN111748033B (en) | Separation antibody combined with novel coronavirus NP protein and detection kit containing same | |
| CN112111011B (en) | Variable region sequence of specific anti-thiamethoxam antibody and recombinant full-length antibody thereof | |
| CN114276445B (en) | Rotavirus recombinant protein specific antibody, plasmid vector and method | |
| CN106397582B (en) | HPV16E7 protein nano antibody and preparation method and application thereof | |
| CN113698475B (en) | Monoclonal antibody of anti-porcine delta coronavirus N protein and porcine delta coronavirus colloidal gold rapid detection test strip | |
| CN109336973B (en) | Anti-transferrin antibodies and uses thereof | |
| CN112111010B (en) | Variable region sequence of specific anti-thiacloprid antibody and recombinant complete antibody thereof | |
| CN112010969B (en) | High-affinity enhanced green fluorescent protein nano antibody and screening method of coding gene thereof | |
| CN113563472A (en) | Variable region sequence of specific anti-chlorothalonil antibody and recombinant full-length IgG antibody thereof | |
| CN110272494A (en) | The application of TIM-3 antigen, nano antibody and its screening and identification method, nano antibody | |
| CN113603786B (en) | Bispecific antibodies that specifically bind SARS-CoV-2S protein and N protein | |
| CN110256562A (en) | PD-1 nano antibody, preparation method and applications | |
| CN113999301B (en) | anti-SARS-CoV-2 (COVID-19) S protein RBD monoclonal antibody | |
| CN104812773A (en) | Antibody for epitope tagging, hybridoma cell line and uses thereof | |
| CN111892657A (en) | Antibody and fragment thereof, kit and method for detecting blood group antigen of Mitigo | |
| CN105646713A (en) | Monoclonal antibody and application thereof | |
| CN114773462B (en) | Recombinant single-chain antibody for detecting bovine CRP protein and application thereof | |
| CN104830805B (en) | Anti-human Clonorchiasis Sinensis monoclonal antibody hybridoma and its monoclonal antibody and application | |
| CN107383200B (en) | Preparation method and application of mouse-derived anti-human IgE monoclonal antibody | |
| AU2021100586A4 (en) | A PD-1 Nanobody and Its Preparation Method and Application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090513 |