CN101418268A

CN101418268A - Production of novel bacterial exopolysaccharides by using Phyllobacterium sp.nov.921F bacterial strain

Info

Publication number: CN101418268A
Application number: CNA2008100025802A
Authority: CN
Inventors: 江晓路; 王鹏; 管华诗
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2007-10-26
Filing date: 2008-01-09
Publication date: 2009-04-29

Abstract

The invention relates to a bacterium capable of producing bacterial exopolysaccharide, and provides a method for producing the bacterial exopolysaccharide by using the strain. The strain has the characteristics of simple nutritional requirement, easy culture, and high yield of the exopolysaccharide. In particular, a semisynthetic medium in the invention is used for to ferment the strain to obtain higher sugar yield. The strain is cultured in a gravy liquid medium containing 3 percent of sucrose for 72 hours, and the yield of a strain exopolysaccharide reaches 1.5 grams per 100 millimeters. The bacterial exopolysaccharide is white powder and is soluble in water, and the weight-average molecular weight thereof is 736 kD, wherein the apparent viscosity of 1.0 percent sugar solution at room temperature is 655 mps. A study on the property of the bacterial exopolysaccharide shows that the polysaccharide consists of glucose, galactose, and repetitive units formed by pyruvic acid substituents, and the mol ratio of the three components is 1 to 1 to 1. The polysaccharide is different from that produced from any industrial production strains in the past; at the same time, as the strain for producing the bacterial exopolysaccharide, the strain of the invention has the characteristics of high product yield, good stability, short production cycle and low cost, and can realize industrial application and production.

Description

Produce the novel bacteria exocellular polysaccharide with Phyllobacterium sp.nov.921F bacterial strain

Technical field

Biotechnology

Background technology

The bacterial strain of having reported at present that can produce exocellular polysaccharide has following a few class: the acidic polysaccharose that the D-glucose that Pseudomonas aeruginosa (P.aeruginosa) produces, D-semi-lactosi, D-seminose, L-rhamnosyl and D-glucuronic acid are formed, the exocellular polysaccharide that the glucose that Chlamydomonas ulvaensis produces, wood sugar constitute, and in conjunction with the D-seminose of bacillus (M.tuberculosis), the polysaccharide that pectinose is formed.Suis S.equi and S.zooepidernicus can produce the hyaluronic acid of being made up of glucuronic acid and glucosamine.Thermophilus streptococcus (S.Thermophilus) can produce the polysaccharide that is made of repeating unit D-semi-lactosi, D-glucose and N-acetyl semi-lactosi.The yellow sporangium of Wild Rape (Xanthomonas Campestris) can produce xanthan gum, and structure is made up of D-glucose, D-seminose, D-glucuronic acid.Also there is the kind of minority can produce the homogeneity glycan, for example the outer dextran of the born of the same parents of leuconos toc (Leuconostoc sp.) and Pediococcus (Pediococcus sp.) generation; The outer bacteria cellulose of the born of the same parents that bacillus aceticus (A.xylinum) produces etc.

Phyllobacterium sp.nov.921F can produce exocellular polysaccharide, and by known to inspection information, the literature search, the exocellular polysaccharide that does not produce about leaf bacillus Phyllobacterium is studied report at present according to the inventor.

Summary of the invention

The purpose of this invention is to provide a kind of bacterial strain Phyllobacterium sp.nov.921F, and utilize this bacterial strain to produce the method for bacterium exocellular polysaccharide.

Separation and purification of the present invention goes out the bacterial strain Phyllobacterium sp.nov.921F that a strain derives from the fungus sporophore surface, has the characteristic that produces exocellular polysaccharide, and depositary institution is called for short CCTCC, and preserving number is M205043.Characteristics of the present invention are:

Isolate a strain first and have the Phyllobacterium sp.nov.921F bacterial strain that produces the bacterium exocellular polysaccharide.This bacterial strain Gram-negative, direct rod shape, 0.4-0.8 μ m * 0.8-2.0 μ m.Adnation flagellar movement with 1 to several utmost point hairs or long wave shape.Aerobic, be the strict aerobic respiration metabolic type of terminal electron acceptor with the molecular oxygen.Optimum temperuture is 28～34 ℃.The catalase positive.Chemoheterotrophic bacteria utilizes various sugared glucose, lactose, sucrose, maltose, pectinose and organic acid (malonate, gluconate) as carbon source.Can utilize ammonium salt, nitrate and most amino acids as nitrogenous source.Not hydrolyzed starch, pectin and Mierocrystalline cellulose.According to the result of uncle Jie Shi Bacteria Identification handbook the 9th edition, the form that the present invention relates to bacterial strain conforms to Phyllobacterium (Phyllobacterium sp.) with physiological and biochemical property is most of.According to uncle Jie Shi handbook the 9th edition, the form of bacterial strain of the present invention is consistent with Phyllobacterium with physiological and biochemical property, determines that it is Phyllobacterium, compares different but its form belongs to known bacterium with physiological and biochemical property and this.The feature of this bacterial strain and other bacterial classifications of Phyllobacterium (contrast see Table 1) carry out the 16SRNA gene sequencing to this bacterial classification, and the sequence of the Phyllobacterium similarity of comparing is the highest among its result and the Genebank, and its similarity is 98.7%.It is simple that this bacterial classification has a nutritional requirement, easily cultivates the characteristics that exopolysaccharides is high.This polysaccharide is made up of the repeating unit that glucose, semi-lactosi and pyruvic acid substituting group form, and the mole ratio of components is 1:1:1.The polysaccharide that this polysaccharide any industrial producing strain different from the past is produced is a kind of novel bacteria exocellular polysaccharide that can realize industrial application.

Description of drawings

Fig. 1: standard sugar gas chromatographic analysis result.

Fig. 2: Phyllobacterium sp.nov.921F bacterial strain is produced exocellular polysaccharide acidolysis end product gas chromatographic analysis result.

Fig. 3: molecular weight is the second order ms analytical results of 805 fraction polysaccharides.

Fig. 4: molecular weight is the second order ms analytical results of 1200 fraction polysaccharides.

Embodiment

1. the separation and purification of bacterial strain:

The acquisition of Phyllobacterium sp.nov.921F bacterial strain of the present invention: gather the fungus sporophore sample from Changbai Mountain Yu Mai, join 25ml enrichment medium (sucrose 2g, NaNO are housed ₃1g, K ₂HPO ₄0.5g, MgSO ₄0.5g, NH ₄Cl0.5g, FeSO ₄0.01g, H ₂O 1000ml, in triangular flask pH7.2), 30 ℃, 160r/mim shake-flask culture 3d.After then enrichment culture liquid suitably being diluted with stroke-physiological saline solution, get 0.2ml coating primary dcreening operation isolation medium (sucrose 10g, NaNO ₃1g, K ₂HPO ₄0.5g, MgSO ₄0.5g, NH ₄Cl 0.5g, FeSO ₄0.01g, agar 15g, H ₂O 1000ml, pH7.5) flat board.Be inverted for 30 ℃ and cultivate 48h, obtaining to choose has the milky bacterium colony of thickness on the flat board, obtain the bacterium that a strain can be produced exocellular polysaccharide.

2. the evaluation of bacterial strain:

It is that bacterial strain is identified by form and Physiology and biochemistry that " uncle Jie Shi bacteriology identification handbook " the 9th version carries out bacterial strain that separation is obtained, its feature is consistent with Phyllobacterium, determine that it is Phyllobacterium, this genus has 7 kinds of report at present, and the physiological and biochemical property in contrast belongs to belongs to known bacterium with this and compares different (the feature contrast of Phyllobacterium sp.nov.921F and other bacterial classifications of Phyllobacterium sees Table 1).Again this bacterial classification is carried out the 16SrDNA gene sequencing, the result is as follows:

CATGCgAGTCGAGCGCCCCGCAAGGGGAGCGGCAGACGGGTGAGTAACGCGTGGGAATCTACCCATCTCTACGGAAT

AACTCAGGGAAACTTGTGCTAATACCGTATACGCCCTTTTGGGGAAAGATTTATCGGAGATGGATGAGCCCGCGTTG

GATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCCATAGCTGGTCTGAGAGGATGATCAGCCACACTG

GGACTGAGACACGGCCCAgACTccTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGC

CATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTCACCGGTGAAGATAATGACGGTAACCGGAGAAG

AAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAA

GCGCACGTAGGCGGACTATTAAGTCAGAGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTTTGATACTGGCAGTC

TTGAGTTCGAGAGAGGTGAGTGGAATTCCGAGTGTAGAGGTGAAATTCGTAGATATTCGGAGGAACACCAGTGGGCG

AAGGCGGCTCACTGGCTCGATACTGACGCTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGT

CCACGCCGTAAACTATGAGAG

The sequence of the Phyllobacterium similarity of comparing is the highest among its result and the Genebank, and its similarity is 98.7%.According to above result this kind is designated as Phyllobacterium sp.nov.921F.

3. produce exocellular polysaccharide with Phyllobacterium sp.nov.921F bacterial strain:

The pre-culture of bacterial classification is inoculated in 100ml fermention medium (sucrose 30g, peptone 7g, K are housed ₂HPO ₄2g, MgSO ₄0.25g, FeSO ₄0.01g, H ₂O 1000ml, pH 8) the 250ml triangular flask in, behind 30 ℃ of shake-flask culture 48h, nutrient solution is crossed film removes thalline.Then, 95% ethanol that adds 2 times of volumes is in fermented liquid, glass stick stirs to flocks occurring, preserve down after 12 hours for 4 ℃, centrifugal removal supernatant liquor is after precipitation is redissolved with distilled water, Crude polysaccharides removes albumen through the Sevag method, be further purified the product polysaccharide with ethanol sedimentation again, lyophilize obtains the polysaccharide finished product.

4.Phyllobacterium sp.nov.921F analysis of polysaccharide:

At first utilize alditol acetate derivative vapor-phase chromatography (GC) that monose is formed and determine, promptly get the 25mg sample and add 3mL 2mol/L trifluoroacetic acid (TFA), 100 ℃ of hydrolysis 6 hours, decompression eliminates TFA, adds 50mg NaBH again ₄With 5mg internal standard substance inositol, it is carried out derivatize after, with gas chromatographic column on the sample (DB225 capillary column (30cm * 25mm)).Determine the monose composition and keep the content that peak area is determined each monose relatively according to relative retention time.Fig. 1 is the standard sugar analytical results, and Fig. 2 is this polysaccharide acidolysis end product, and through comparison as can be known, this polysaccharide is made up of glucose, semi-lactosi, and its mol ratio is 1:1.

Again the product of degrading is carried out classification through Bio-Gel P4 and obtain 3 components, determine that through the one-level mass spectrum molecular weight is respectively 806,1200 and 1594.It is carried out second order ms (Fig. 3, Fig. 4) respectively, and the result shows that this polysaccharide is made up of the repeating unit that glucose, semi-lactosi and pyruvic acid substituting group form, and a mole ratio of components is 1:1:1.

Discriminating between table 1 Phyllobacterium (Phyllobacterium) is planted

Claims

1. a leaf bacillus (Phyllobacterium sp.nov.921F), this bacterial classification carries out preservation by China typical culture collection center, and depositary institution is called for short CCTCC, and preserving number is M205043.

2. an a kind of leaf bacillus (Phyllobacterium sp.nov.921F) produces its 16SrDNA nucleotide sequence of sugared bacterium: SEQ ID NO.1.

3. the bacterium exocellular polysaccharide of a leaf bacillus (Phyllobacterium sp.nov.921F) bacterial strain generation is characterized in that being made up of the repeating unit that glucose, semi-lactosi and pyruvic acid substituting group form, and a mole ratio of components is 1:1:1.