CN101418044A - Immunoglobulin variants and uses thereof - Google Patents

Abstract

The present invention relates to immunoglobulin anamorphosis and uses thereof. The invenion provides a humanied and embeded aiti-CD20 body used for treating positive malignant tumor and auto-immune disease.

Description

Immunoglobulin variants and uses thereof

This case is to be December 16, Chinese application number in 2003 the dividing an application for the patent application of " immunoglobulin variants and uses thereof " that be 200380109682.X, denomination of invention the applying date.

Technical field

The present invention relates to anti-CD 20 antibodies and the purposes in treatment B cell related diseases thereof.

Background technology

Lymphocyte is one of leukocytic several colonies; They are discerned specifically and outside antigen are reacted.Lymphocytic three kinds of primary categories are bone-marrow-derived lymphocyte (B cell), T lymphocyte (T cell) and natural killer (NK) cell.Bone-marrow-derived lymphocyte is to be responsible for antibody to produce and the cell that humoral immunization is provided.The B cell is in the inner maturation of marrow and leave marrow, at their cell surface expression and antigen bonded antibody.When inmature B cell run into first its film-binding antibody during special antigen, cell begins rapid division, its offspring is divided into memory B cell and the effector cell who is called as " plasmocyte ".Memory B cell has the longer life time limit, and continue to express with initial parent cell and have mutually homospecific membrane-bound antibody.Plasmocyte does not produce membrane-bound antibody, but the opposite antibody that produces secreted form.Excretory antibody is the main effects thing of humoral immunization.

(also be known as the differentiation antigen of human B lymphocyte restriction, Bp35) be the hydrophobic transmembrane protein that is positioned on preceding-B and the ripe bone-marrow-derived lymphocyte to CD20 antigen, has the about 35kD of molecular weight.J.Biol.Chem.264 (19): 11282-11287 (1989); With Einfeld et al.EMBO (3): 711-717 (1988) J.7).This antigen is also gone up in the B cell non-Hodgkin's (NHL) that surpasses 90% and is expressed Blood 63 (6): 1424-1433 (1984)), but in hemopoietic stem cell, pro B lymphocyte, normal plasmocyte or other healthy tissues, do not find (Tedder et al.J.Immunol.135 (2): 973-979 (1985)).CD20 is considered to regulate an early stage step in the initial activation process with differentiation of cell cycle.(Tedder et al., supra), and may play a role as calcium channel (Tedder et al.J.Cell.Biochem.14D:195 (1990)).

Because the expression of CD20 in B cell lymphoma, this antigen have been used as this lymphadenomatous useful treatment target of treatment.There are 300,000 people of surpassing to suffer from B cell NHL in the U.S., have every year 56,000 new cases of surpassing to be diagnosed.For example, rituximab

Antibody is used to treatment and has recurrence or refractory rudimentary or follicular, CD20 positive B cell non-Hodgkin's, this antibody be genetic modification (can be at the antigenic chimeric mouse/human monoclonal antibodies of people CD20 from Genentech, Inc.South San Francisco, California, U.S. buys).Rituximab be the U.S. Patent number 5,736,137 (Anderson et al.) of on April 7th, 1998 issue with at U.S. Patent number 5,776, be referred to as " the antibody of C2B8 ＂ in 456.Interaction in vitro mechanism studies show that

Combine with people's complement, and dissolve lymph sample B clone Blood 83 (2): 435-445 (1994)) by the cytotoxicity (CDC) that complement relies on.In addition, it has remarkable activity in the analysis of the cytotoxicity (ADCC) of the cell that antagonist relies on.Preclinical study shows in the body

Subdue the B cell from macaque peripheral blood, lymphoglandula and marrow, supposition is by complement and cell-mediated process Blood 83 (2): 435-445 (1994)).Anti-CD20 antibodies of other indication NHL treatment comprises murine antibody ZevalinTM, itself and radio isotope yttrium ⁹⁰Connect (IDEC Pharmaceuticals, San Diego, CA), and Bexxar ^TM, it is and I ¹³¹Link coupled another completely the antibody of mouse (Corixa, WA).

A major limitation part of the use of murine antibody in the human treatment be human anti-mouse antibody (HAMA) reaction (referring to, Miller for example, R.A.et al. " Monoclonal antibody therapeutictrials in seven patients with T-cell lymphoma " Blood, 62:988-995,1983; And Schroff, R.W., et al. " Human anti-murine immunoglobulin response in patientsreceiving monoclonal antibody therapy " Cancer Res., 45:879-885,1985).Even the chimeric molecule that merge in variable (V) structural domain of rodent antibody and people constant (C) zone still can cause significant immune response (HACA, the anti-chimeric antibody of people) Nature (Lond.), 314:268-270,1985).An effective means that overcomes these restrictions in the clinical utilization of monoclonal antibody is " humanization " murine antibody or from the antibody of inhuman species.(Jones et al.Nature(Lond)，321：522-525，1986；Riechman et al.，Nature(Lond)，332：323-327，1988)。

Therefore, it is favourable producing at the antigenic treatment antibody of CD20, this antibody when administration give patient, during especially for long-term treatment generation minimum or do not have an antigenicity.The present invention satisfies this and other demand.The invention provides and overcome the restrictive anti-CD20 antibodies of present therapeutic composition, and extra benefit is provided, these benefits will be understood from following detailed description.

Summary of the invention

The invention provides CD20 binding antibody or its functional fragment, with and purposes in treatment B cell related diseases.These antibody are monoclonal antibodies.In specific embodiment, be humanized or chimeric in conjunction with the antibody of CD20.Humanized 2H7 variant is included in the variant that has aminoacid replacement among the FR, and the affinity maturation variant that has change in the CDR that transplants.The amino acid that replaces in CDR or FR is not limited to those amino acid that exist in donor or receptor antibody.In other embodiments, the amino-acid residue that anti-CD 20 antibodies of the present invention further comprises the Fc zone changes, and these changes cause effector function to improve, and comprises strengthening CDC and/or ADCC function and B cell killing (being also referred to as the B cell depleting at this).Other anti-CD 20 antibodies of the present invention comprises that those have the antibody of the change that can improve stability.In a special embodiment, the humanization 2H7 variant that stability increases is described among the embodiment 6 below.The variant of the Fucose defective of the ADCC function that has improvement in vivo also is provided.In one embodiment, chimeric anti-CD20 antibodies has mouse variable region and human constant region.A such a special chimeric anti-CD20 antibodies is

(Rituximab; Genentech, Inc.).

In a preferred implementation of all antibody compositions of the present invention and using method, humanized CD20 binding antibody is 2H7.v16, has difference SEQ ID NO.21 as shown in Figure 6 and Figure 7 and 22 light and heavy chain amino acid sequence.When the peptide sequence mentioned in Fig. 6,7 and 8, should be appreciated that preceding 19 left and right sides amino acid that form secretory signal sequence do not exist in mature polypeptide.Except the aminoacid replacement position of in specification sheets, indicating, will have the aminoacid sequence of v16 based on the variable region of all other variants of version 16.Except as otherwise noted, the 2H7 variant will have the light chain identical with v16.

The invention provides and people CD20 bonded humanized antibody or its Fab, wherein antibody is effectively to subduing primate B cell in the body, and this antibody comprises at least CDR3 sequence and people's heavy chain subgroup (subgroup) III (V from the SEQ ID NO.12 of anti-humen CD 20 antibody at H chain variable region (VH) _HThe people of III) (substantially) basically has framework (FR) residue.In one embodiment, primate B cell comes from people and macaque.In one embodiment, antibody further comprises the H chain CDR1 sequence of SEQ ID NO.10 and the CDR2 sequence of SEQ ID NO.11.In another embodiment, aforementioned antibody comprises the L chain CDR1 sequence of SEQ ID NO.4, the CDR2 sequence of SEQ ID NO.5, the CDR3 sequence of SEQ ID NO.6, has total framework (FR) residue of people in fact of people's light chain κ subgroup I (V κ I).In a preferred embodiment, V _LThe FR zone 46 have the donor antibody residue in the position; In a concrete embodiment, V _LFR2 have the aminoacid replacement (Leu in people κ I consensus sequence changes the pro that exists in the m2H7 corresponding position into) of leuL46pro.V _HThe zone further comprises the donor antibody residue on the amino acid position at least 49,71 and 73 of framework.In one embodiment, at V _HIn, the following FR position of people's heavy chain subgroup III is substituted: the AlaH49Gly among the FR2; ArgH71Val among the FR3 and AsnH73Lys.In other embodiments, the CDR zone of humanized antibody further comprises aminoacid replacement, wherein residue neither from donor antibody also not from receptor antibody.

The antibody of aforementioned embodiments can comprise the V of the SEQ ID NO 8 of v16 _HSequence is shown in Figure 1B.In the further embodiment in front, antibody further comprises the V of the SEQID NO 2 of v16 _LSequence is shown in Figure 1A.

In other embodiments, humanized antibody is 2H7.v31, has the light and heavy chain amino acid sequence of SEQ ID NO.21 and 23, respectively as Fig. 6 and shown in Figure 8; Has the 2H7.v31 of the heavy chain amino acid sequence of SEQ ID NO.23 as shown in Figure 8; The 2H7.v96 of aminoacid replacement with S92A of the D56A of H chain of v16 and N100A and L chain.

In the embodiment that separates, antibody in any aforementioned embodiments further is included at least one aminoacid replacement in the Fc zone, this replacement is compared with its original or parental antibody of deriving and has been improved ADCC and/or CDC activity, v.16 the parental antibody that is compared under most of occasions is, is Rituxan in other cases.Have and improve an active antibody like this comprises S298A/E333A/K334A in the Fc zone triple L-Ala replacements.An antibody with S298A/E333A/K334A replacement is the 2H7.v31 with heavy chain amino acid sequence of SEQ ID NO.23.Antibody 2H7.v114 and 2H7.v115 show that ADCC is active and improve at least 10 times by comparison with Rituxan.

In another embodiment, antibody further is included at least one aminoacid replacement in Fc zone, and CDC is active by comparison reduces with its parental antibody of deriving in this replacement, and its parental antibody of deriving in most of the cases is v16.With v16 by comparison the K322A at least that is included in the H chain of the active antibody like this that reduces of CDC replace.The active comparison of ADCC and CDC can be as analyzing described in the embodiment.

In a preferred embodiment, antibody of the present invention is full length antibody, and wherein the VH zone is connected to the human IgG CH.In a preferred embodiment, IgG is human IgG1 or IgG3.

In one embodiment, the CD20 binding antibody is bonded to cytotoxic agent.In a preferred embodiment, this cytotoxic agent is toxin or radio isotope.

In one embodiment, of the present invention be used for the treatment of or the antibody of diagnostic uses produces in Chinese hamster ovary celI.

A kind of composition also is provided, and said composition comprises any one antibody in the aforementioned embodiments, and carrier.In one embodiment, carrier is an acceptable carrier pharmaceutically.These compositions can provide with goods or test kit.

The present invention also provides liquid preparation, comprises the humanization 2H7 antibody of 20mg/mL antibody, 10mM sulfuric acid Histidine pH5.8,60mg/mL sucrose (6%), 0.2mg/mL polysorbate 20 (0.02%).

The present invention also provides isolating nucleic acid, and this nucleic acid encoding any in this disclosed antibody comprises the expression vector of expressing antibodies.

Another aspect of the present invention is the host cell and the host cell that produces this antibody that comprises aforementioned nucleic acid.In the latter's a preferred embodiment, host cell is a Chinese hamster ovary celI.The method that produces these antibody is provided, and this method comprises cultivates the host cell that produces antibody, and reclaims antibody from cell culture.

Another aspect of the present invention is a kind of goods, comprises a container and the composition that is included in wherein, and wherein composition comprises any one antibody in the aforementioned embodiments.For being used for treating NHL, these goods further comprise package insert, and the indication said composition is used to treat non_hodgkin lymphoma.

Further aspect of the present invention is the method for bringing out apoptosis in the inherent B cell of body, comprises the B cell is contacted with any antibody in aforementioned, thereby kills the B cell.

The present invention also provides the method for treatment in this disclosed disease, and this method is for example suffered from the human patient of this disease, and treated this disease by with CD20 binding antibody or its functional fragment administration Mammals.In any treatment autoimmune disease or the positive method for cancer of CD20, in one embodiment, antibody is 2H7.v16, has the light and heavy chain amino acid sequence of SEQ ID NO.21 and 22 respectively, as Fig. 6 and shown in Figure 7.Therefore, an embodiment is the positive method for cancer of treatment CD20, comprises the humanization CD20 binding antibody of the present invention of the patient significant quantity of suffering from this cancer.In a preferred embodiment, the positive cancer of CD20 is that B cell lymphoma or leukemia comprise non_hodgkin lymphoma (NHL) or the dominant Hokdkin disease of lymphocyte (LPHD), lymphocytic leukemia (CLL) or SLL.In the embodiment of treatment B cell lymphoma or leukemic method, antibody is with the about 275-375mg/m of dosage range ²Administration.In other embodiment, methods of treatment further comprises and gives patient at least a chemotherapeutics, for non_hodgkin lymphoma (NHL), chemotherapeutics is selected from the group of being made up of AC, vincristine(VCR) and Prednisolone Acetate (prednisolone) therein.

The method of treatment autoimmune disease also is provided, comprises any one humanization CD20 binding antibody in the aforementioned claim that gives the patient significant quantity, this patient suffers from autoimmune disease.Autoimmune disease is selected from the group of being made up of following: rheumatoid arthritis, juvenile rheumatoid arthritis, systemic lupus erythematous (SLE), wegner's disease (Wegener ' s disease), inflammatory bowel, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), the autoimmunity thrombopenia, multiple sclerosis, psoriasis, IgA nephropathy, the IgM polyneuropathy, myasthenia gravis, vasculitis, diabetes, raynaud's sign (Reynaud ' s syndrome), this Jaeger logical sequence syndrome (sjorgen ' ssyndrome) and glomerulonephritis.When autoimmune disease is rheumatoid arthritis, antibody can with the second therapeutical agent Combined Preparation, this second therapeutical agent is methotrexate preferably.

In these methods of treatment, the CD20 binding antibody can combine administration separately or with second therapeutical agent, and second therapeutical agent is second antibody or chemotherapeutics or immunosuppressor for example.Second antibody can be the antibody in conjunction with CD20 or different B cell antigen or NK or T cell antigen.In one embodiment, second antibody is the anti-CD20 antibodies of labelled with radioisotope.In other embodiments, the CD20 binding antibody is coupled to cytotoxic agent, comprises toxin or radio isotope.

On the other hand, the invention provides the method for treatment autoimmune disease, autoimmune disease is selected from by dermatomyositis (Dermatomyositis), wegner's granulomatosis, ANCA, aplastic anemia, autoimmune hemolytic anemia (AIHA), blood coagulation factor VIII lacks, hemophilia A, the autoimmunity neutrophilic leukocyte reduces, Castleman ' s syndromes, the thorough syndrome of Gourde(G) Paasche (Goodpasture ' s syndrome), solid organ transplantation repels, graft versus host disease (GVHD), the neuropathy of IgM mediation, thrombotic thrombocytopenic purpura (TTP), struma lymphomatosa (Hashimoto ' s Thyroiditis), autoimmune hepatitis, matter pneumonia (HIV) between Lymphoid tissue, the NSIP (bronchiolitis obliterans (non-transplant) vs.NSIP) that bronchiolitis obliterans (Nonimplantation) is corresponding, Ge-Ba two syndromes (Guillain-Barre syndrome), the great vessels vasculitis, giant cells (high iS-One) arteritis (giant cell (Takayasu ' s) ateritis), medium blood vessel vasculitis (mediumvessel vasculitis), mucocutaneous lymphnode syndrome (Kawasaki ' s Disease), polyarteritis nodosa (polyateritisnodosa) comprises the CD20 binding antibody of the patient treatment significant quantity of suffering from this disease.In an embodiment of this method, the CD20 binding antibody is

The present invention also provides isolating nucleic acid, comprises the nucleotide sequence (as shown in figure 19) of the SEQID NO.:24 of macaque (Cynomolgus monkey) CD20, or the degeneracy variant of this sequence.An embodiment is isolating nucleic acid, comprises a sequence, and this sequence encoding has the polypeptide of the aminoacid sequence of SEQ ID NO.25 (as shown in figure 20), or has the SEQ ID NO.25 (Figure 20) that conservative amino acid replaces.Another embodiment is the carrier that comprises aforementioned nucleic acid, comprises the expression vector that is used at host cell expression.Also comprise the host cell that comprises this carrier.Isolated polypeptide also is provided, and this polypeptide comprises aminoacid sequence (the SEQ ID NO.25 of macaque CD20; Figure 20).

The present invention relates to:

One kind with people CD20 bonded humanized antibody or its Fab, wherein antibody is effectively to cutting down primate B cell in the body, and this antibody comprises CDR3 sequence and people's heavy chain subgroup III (V from the SEQ ID NO.12 of anti-humen CD 20 antibody at least at variable region of heavy chain (VH) _HIII) people basically has framework (FR) residue.

2. 1 antibody, described antibody further comprises the heavy chain CDR1 sequence of SEQ ID NO.10 and the CDR2 sequence of SEQ ID NO.11.

3. the antibody of item 2 further comprises the light chain CDR1 sequence of SEQ ID NO.4, the CDR2 sequence of SEQ IDNO.5, the CDR3 sequence of SEQ ID NO.6 and total framework (FR) residue of people basically of people's light chain κ subgroup I (V κ I).

4. aforementioned antibody comprises the V of SEQ ID NO.8 _HSequence (V16 is shown in Figure 1B).

5. 4 antibody further comprises the V of SEQ ID NO.2 _LSequence (V16 is shown in Figure 1A).

6. 3 antibody, wherein V _HThe zone is connected to human IgG chain constant region.

7. 6 antibody, wherein human IgG is IgG1 or IgG3.

8. 1 antibody, wherein antibody is to have the light chain that is respectively SEQ ID NO.21 and 22 and the 2H7.v16 of heavy chain amino acid sequence.

9. 1 antibody, wherein antibody is to have the light chain that is respectively SEQ ID NO.21 and 23 and the 2H7.v31 of heavy chain amino acid sequence.

10. 5 antibody, but the aminoacid replacement (v.96) of S92A among the D56A and N100A and light chain had in the heavy chain.

11. each antibody further is included at least one aminoacid replacement in the Fc zone in aforementioned, ADCC and/or CDC activity are promoted in described replacement.

12. the antibody of item 11, wherein aminoacid replacement is S298A/E333A/K334A.

13. the antibody of item 12, wherein antibody is the 2H7.v31 (as shown in Figure 8) with heavy chain amino acid sequence of SEQ ID NO.23.

14. each antibody further is included at least one aminoacid replacement in the Fc zone among the 1-10, described replacement reduces the CDC activity.

15. the antibody of item 14 comprises at least and replaces K322A.

16. each antibody of 1-10, wherein antibody is 2H7.v114 or 2H7.v115, and relatively ADCC is active improves at least 10 times with Rituxan for described antibody.

17. the antibody of item 1, wherein primate B cell comes from the mankind and macaque.

18. each antibody in aforementioned, this antibody coupling is to the cell toxicant medicament.

19. the antibody of item 18, wherein the cell toxicant medicament is radio isotope or toxin.

20. each antibody in aforementioned, described antibody produces in Chinese hamster ovary celI.

21. an isolating nucleic acid, each antibody in the aforementioned item of its coding.

22. an expression vector, each antibody in the aforementioned item of its coding.

23. a host cell, it comprises the nucleic acid of item 21.

24. the host cell of item 23, each antibody in the aforementioned item of described host cell generation.

25. the host cell of item 24, described host cell is a Chinese hamster ovary celI.

26. produce the method for each antibody in aforementioned, comprise the cell of cultivating the antibody of producing item 24, and from cell culture, reclaim antibody.

27. a composition comprises an antibody and a carrier of 1.

28. the composition of item 27, wherein antibody is 2H7.v16, and carrier is pharmaceutically acceptable carrier.

29. goods comprise a kind of container and are included in wherein composition, wherein said composition comprises in aforementioned each antibody.

30. the goods of item 29 further comprise package insert, described package insert indication said composition can be used for treating non_hodgkin lymphoma.

31. induce the method for apoptosis in the inherent B cell of a body, comprise the B cell is contacted with each antibody in the aforementioned item, thereby kill the B cell.

32. the positive method for cancer of treatment CD20 comprises among aforementioned of the patient significant quantity of suffering from this cancer each humanization CD20 binding antibody.

33. the method for item 32, wherein the positive cancer of CD20 is B cell lymphoma or leukemia.

34. the method for item 33, wherein positive cancer right and wrong He Jiejin lymphomas (NHL) of CD20 or the dominant Hokdkin disease of lymphocyte (LPHD).

35. the method for item 32, wherein cancer is lymphocytic leukemia or SLL.

36. the method for item 34 or 35, wherein antibody is selected from 2H7.v16, v31.v96, v114 or v115, and described antibody has the aminoacid sequence separately shown in accompanying drawing and the table.

37. the antibody of item 34 or 35, wherein antibody is to have to be respectively Fig. 6 and the light chain of SEQ IDNO.21 shown in Figure 7 and 22 and the 2H7.v16 of heavy chain amino acid sequence.

38. the method for item 33, wherein antibody is with about 275-375mg/m ²The dosage range administration.

39. 32 method further comprises and gives patient at least a chemotherapeutics.

40. the method for item 39, wherein cancer is non_hodgkin lymphoma (NHL), and chemotherapeutics is selected from AC, vincristine(VCR) or Prednisolone Acetate.

41. a method for the treatment of autoimmune disease comprises among aforementioned of the patient significant quantity of suffering from this autoimmune disease any one humanization CD20 binding antibody.

42. the method for item 41, wherein this autoimmune disease is selected from the group of being made up of following disease: rheumatoid arthritis, juvenile rheumatoid arthritis, systemic lupus erythematous (SLE), wegner's disease, inflammatory bowel, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), autoimmunity thrombopenia, multiple sclerosis, psoriasis, IgA nephropathy, IgM polyneuropathy, myasthenia gravis, vasculitis, diabetes, Raynand's disease, this Jaeger logical sequence syndrome and glomerulonephritis.

43. the method for item 42, wherein autoimmune disease is a rheumatoid arthritis.

44. 43 method further comprises and gives patient second kind of therapeutical agent.

45. the method for item 44, wherein second kind of therapeutical agent is immunosuppressor.

46. the method for item 45, wherein immunosuppressor is a methotrexate.

47. a treatment is selected from the method by the autoimmune disease in the following group of forming, and comprises CD20 binding antibody or its functional fragment of the patient treatment significant quantity of suffering from this disease: dermatomyositis, wegner's granulomatosis, ANCA (being included under the vasculitis), aplastic anemia, autoimmune hemolytic anemia (AIHA), blood coagulation factor VIII shortage, hemophilia A, the minimizing of autoimmunity neutrophilic leukocyte, Castleman syndrome, the thorough syndrome of Gourde(G) Paasche, solid organ transplantation repel, graft versus host disease (GV _HD), matter pneumonia (HIV), corresponding NSIP, Ge-Ba two syndromes, great vessels vasculitis, giant cells (high iS-One) arteritis, medium blood vessel vasculitis, mucocutaneous lymphnode syndrome and the polyarteritis nodosa of bronchiolitis obliterans (Nonimplantation) between the thrombotic thrombocytopenic purpura (TTP) of IgM mediation, struma lymphomatosa, autoimmune hepatitis, lymph.

48. the method for item 47, wherein the CD20 binding antibody is

49. an isolating nucleic acid, described nucleic acid comprise the nucleotide sequence (as shown in figure 19) of the SEQ ID NO.:24 of macaque CD20, or the degeneracy variant of this sequence.

50. an isolating nucleic acid, described nucleic acid comprise the polypeptide that coding has SEQ ID NO.25 (as shown in figure 20) or has the aminoacid sequence of the SEQ ID NO.25 (as shown in figure 20) that conserved amino acid replaces.

51. a carrier comprises 50 nucleic acid.

52. the carrier of item 51, it is an expression vector, and described expression vector comprises the nucleic acid of the item 49 that can be operatively connected with expression regulation sequence.

53. a host cell comprises 50 nucleic acid.

54. an isolated polypeptide comprises the aminoacid sequence (as shown in figure 20) of the SEQ ID NO.25 of macaque CD20.

55. a liquid preparation comprises humanization 2H7 antibody, 10mM Histidine sulfuric ester pH5.8,60mg/mL sucrose, the 0.2mg/mL polysorbate 20 of 20mg/mL.

Description of drawings

Figure 1A is a sequence alignment, relatively the light chain variable structural domain (V of each among mouse 2H7 (SEQ ID NO.1), humanization 2H7.v16 variant (SEQ ID NO.2) and the people K light chain subgroup I (SEQ ID NO.3) _L) aminoacid sequence.The V of 2H7 and hu2H7.v16 _LCDR as follows: CDR1 (SEQ IDNO.4), CDR2 (SEQ ID NO.5), with CDR3 (SEQ ID NO.6).

Figure 1B is a sequence alignment, is compared as follows the V in source _HPeople's consensus sequence (SEQ IDNO.9) of sequence: mouse 2H7 (SEQ ID NO.7), humanization 2H7.v16 variant (SEQ ID NO.8) and heavy chain subgroup III.The V of 2H7 and hu2H7.v16 _HCDR as follows: CDR1 (SEQ ID NO.10), CDR2 (SEQ ID NO.11), with CDR3 (SEQ ID NO.12).

In Figure 1A and Figure 1B, the CDR1 of each chain, CDR2 and CDR3 fence up with bracket, and its both sides are framework region FR1-FR4, as indicated among the figure.2H7 refers to mouse 2H7 antibody.Asterisk between the two row sequences is illustrated in positions different between two sequences.The residue numbering is according to Kabat et al., Sequences of Immunological Interest.5th Ed.Public Health Service, NationalInstitutes of Health, Bethesda, Md. (1991), inset are with a, b, c, d, represent with e.

Fig. 2 A-E shows the aminoacid sequence of light chain (SEQ ID NO.14) and heavy chain (SEQ ID NO.15) of the Fab of the sequence (SEQ IDNO.13) of the phagemid pVX4 be used for making up the 2H7Fab plasmid and the anti-IFN-α humanized antibody that CDR transplants.

The sequence of the expression plasmid of the chimeric 2H7.v6.8 Fab of Fig. 3 A-E code displaying (SEQ IDNO.16).The aminoacid sequence that shows light chain (SEQ ID NO.17) and heavy chain (SEQ ID NO.18).

Fig. 4 A-B shows sequence (the SEQ ID NO19 that expresses the plasmid pDR1 of light chain immunoglobulin as being used to described in the embodiment 1; 5391bp).PDR1 comprises the sequence of the light chain (Shalaby et al., J.Exp.Med.175:217-225 (1992)) of coding one irrelevant antibody, Humanized CD 3-resisting antibody, and its initial sum terminator codon is with runic and underscore indication.

Fig. 5 A-B shows as sequence (the SEQ ID NO.20 of plasmid pDR2 that is used to express heavy chain immunoglobulin of description among the embodiment 1; 6135bp).PDR2 comprises the sequence of the heavy chain of the irrelevant antibody of a coding, Humanized CD 3-resisting antibody, and (Shalaby et al., above), its initial sum terminator codon is indicated with runic and underscore.

Fig. 6 shows the aminoacid sequence (SEQ ID NO.21) of the complete light chain of 2H7.v16.DIQ preceding 19 amino acid in the past are non-existent secretion signal sequences in the mature polypeptide chain.

Fig. 7 shows the aminoacid sequence (SEQ ID NO.22) of the complete heavy chain of 2H7.v16.EVQ preceding 19 amino acid in the past are non-existent secretion signal sequences in the mature polypeptide chain.V with Figure 1B _HSequence (SEQ ID NO.8) and complete sequence of heavy chain comparison, people γ 1 constant region comes from the amino acid position 114-471 among the SEQ ID NO.22.

Fig. 8 shows the aminoacid sequence (SEQ ID NO.23) of the complete heavy chain of 2H7.v31.EVQ preceding 19 amino acid in the past are non-existent secretion signal sequences in the mature polypeptide chain.Light chain identical with 2H7.v16 (referring to Fig. 6).

Fig. 9 shows as the 2H7.v16 described in the embodiment and the relative stability of 2H7.v73 IgG variant.Analytical results is proofreaied and correct to hatching preceding numerical value, reports with the residue per-cent after hatching.

Figure 10 is a schema, sums up from mouse 2H7 to the amino acid change up to the subgroup of the humanization pattern of v75.

Figure 11 is the summary of average absolute B cell counting [CD3-/CD40+] in all groups (in conjunction with 2H7 research and Rituxan research), described in embodiment 10.

Figure 12 shows as the result in the representative ADCC test on the 2H7 of Fucose defective variant described in the embodiment 11.

Figure 13 shows the result of annexin V dyeing with the function construction of antibody concentration.In the presence of crosslinked second antibody, with the irrelevant IgG1 control antibodies (Herceptin of Ramos cell; Circular), Rituximab (square) or rhuMAb 2H7.v16 (trilateral) handle, and uses facs analysis.Figure 13-15 is described in embodiment 13.

Figure 14 shows the result of the two dyeing of annexin V and iodine third ingot as the function construction of antibody concentration.In the presence of crosslinked second antibody, with the Ramos cell with irrelevant IgG1 control antibodies (

Circular), Rituximab (square) or rhuMAb 2H7.v16 (trilateral) handle, and uses facs analysis.

That Figure 15 shows is alive, the cell counting of being unstained (per 10) is as the function construction of antibody concentration.In the presence of crosslinked second antibody, with the Ramos cell with irrelevant IgG1 control antibodies ( Circular), Rituximab (square) or rhuMAb 2H7.v16 (trilateral) handle, and uses facs analysis.

Figure 16,17,18 show as embodiment 14 described in the inhibition of in nude mice, the Raji cell tumour being grown.Animal is used PBS (contrast) or uses

Or rhuMAb 2H7.v16 handles weekly with 5mg/kg (Figure 16), 0.5mg/kg (Figure 17) or 0.05mg/kg (Figure 18) and (indicates as vertical arrows; Every group of n=8 mouse), totally 6 weeks.

Figure 19 show as embodiment 15 described in Nucleotide (SEQ ID NO.24) and amino acid (the SEQ ID NO.25) sequence of macaque CD20.

Figure 20 shows the aminoacid sequence (SEQ ID NO.25) of macaque CD20.The residues different with people CD20 have underscore, and people's residue (SEQ ID NO.26) directly indicates under the monkey residue.The ectodomain of inferring of monkey CD20 is represented with boldface type.

Figure 21 show as at embodiment 15 described in, the macaque cell of expression CD20 and hu2H7.v16 .v31 combine with Rituxan's.Analyze antibodies macaque CD20 and replace FITC link coupled mouse 2H7 and macaque CD20 bonded ability.

Figure 22 shows the cumulative scheme of rheumatoid arthritis clinical experimental stage I/II dosage.

Figure 23 is presented at the carrier of expressing 2H7.v16 in the Chinese hamster ovary celI.

Detailed description of preferred embodiments

" CD20 ＂ antigen is a nonglycosylated phospholamban of striding, and has the about 35kD of molecular weight, finds on the surface that surpasses 90% B cell from peripheral blood or lymphoid organ.CD20 pre B cell in early days expressed between the growth period, and kept breaking up up to plasmocyte.It is not found on human stem cell, lymph ancester cell or normal plasmocyte.CD20 exists on normal B cell and Malignant B cell.Other name of CD20 comprises " differentiation antigen of bone-marrow-derived lymphocyte restriction " and " Bp35 ＂ in the literature.CD20 antigen is at for example Clark and Ledbetter, Adv.Can.Res.52:81-149 (1989) and Valentine et al.J.Biol.Chem.264 (19): describe 11282-112871989).

Term " antibody " uses with the most wide in range meaning, and contains monoclonal antibody (comprising full length monoclonal antibodies), multi-specificity antibody (for example bi-specific antibody) and antibody fragment especially, as long as they demonstrate required biological activity or function.

CD20 binding antibody of the present invention and the biological activity of humanization CD20 binding antibody comprise combining of antibody and people CD20 at least, more preferably combine with people and other primate (comprising macaque, rhesus monkey, chimpanzee) CD20.Antibody will be not to be higher than 1 x 10 ^-8The Kd value in conjunction with CD20, preferably the Kd value is not higher than about 1 x 10 ^-9, and kill in can body or subdue the B cell, preferably when with suitable negative comparing, kill or subdue at least 20%, the such antibody treatment of described negative contrast.It can be one or more result in ADCC, CDC, apoptosis or other mechanism that the B cell is subdued.In some embodiments of the disease treatment here, specific effector function or mechanism compare and may more need with other, and some variant of humanization 2H7 to obtain biological function for example ADCC be preferred.

" antibody fragment " comprises the part of full length antibody, normally its antigen combination or variable region.The example of antibody fragment comprises Fab, Fab ', F (ab ') ₂, with the Fv fragment; Double antibody; Wire antibody (linearantibody); The single-chain antibody molecule; With the multi-specificity antibody that forms by antibody fragment.

" Fv " is the minimum antibody fragment that comprises complete antigen identification and combining site.This fragment is made up of the dipolymer that a heavy chain and variable region of light chain structural domain form with tight, non-covalent associating.Six hypermutation rings of the folding generation of these two structural domains (each three ring of heavy chain and light chain) provide antigen bonded amino-acid residue and give the antibody antigen binding specificity.Yet, even one variable domains (perhaps only comprising half specific to the Fv of antigenic three CDR) has the ability of identification and conjugated antigen, though avidity is lower than whole combining site.

Term " monoclonal antibody " finger as used herein obtains certainly the antibody of the antibody colony of homogeneous in fact, and the independent antibody that promptly constitutes this colony is same except the abiogenous sudden change that those may exist on a small quantity.Monoclonal antibody is a high degree of specificity, at single antigen site.In addition, with each monoclonal antibody of (polyclone) Antibody Preparation opposite---described conventional antibody generally comprises the different antibodies at different determinants (epi-position)---of routine at the single determinant on the antigen.The characteristic of modifier " mono-clonal " indication antibody does not allow to be interpreted as to require to produce antibody through any specific method for obtaining certainly the antibody of homogeneous colony in fact.For example, the monoclonal antibody of using according to the present invention may be by Kohler et al., the hybridoma method production that Nature 256:495 (1975) describes first, maybe can by recombinant DNA method production (referring to, for example, U.S. Patent number 4,816,567).Utilize for example at Clackson et al., the technology of describing among the Nature 352:624-628 (1991) and Marks et al., J.Mol.Biol.222:581-597 (1991), " monoclonal antibody " also can separate from phage antibody library.

" functional fragment " of CD20 binding antibody of the present invention is more such fragments, it is possessed with the complete full-length molecule of its deutero-and compares the ability of identical in fact avidity in conjunction with CD20, and, comprise and subdue the B cell through for example described here external or body inner analysis and show biological activity in the measurement of carrying out.

Term " variable " refers to this fact, and promptly there is extensive difference in some fragment of variable structural domain in antibody sequence.The combination of V structural domain mediation antigen, and define the specificity of specific antibody to its specific antigen.Yet mutability is not equally distributed in 110 amino acid spans of variable domains.On the contrary, the variable region comprises that geostationary several sections sequences are called framework region (FR), is the 15-30 amino acid long, by extremely variable short zone separately, is called " hypervariable region ", each 9-12 amino acid long therebetween.Each comprises four FR the variable domains of natural heavy and light chain, takes β lamella configuration basically, is connected by three hypervariable regions, and the hypervariable region forms shack, and sometimes forms the part of β laminated structure.The hypervariable region of each chain was closely maintained together by FR in ten minutes, and participate in the formation of the antigen-binding site of antibody (referring to Kabat et al. with the hypervariable region of another chain, Sequences of Proteinsof Immunological Interest, 5th Ed.Public Health Service, National Institutes ofHealth, Bethesda, MD.1991)).Constant domain does not directly relate to antibody and combines with antigenic, but demonstrates various effector functions, for example participates in the antibody-dependant cell cytotoxicity (ADCC) at antibody.

Term " hypervariable region " refers to that when used herein antibody is responsible for antigen bonded amino-acid residue.The hypervariable region generally include from " complement determining area " or " CDR " (for example among the VL approximately residue 24-34 (L1), 50-56 (L2) and 89-97 (L3) on every side, with V _HIn about 31-35B (H1), 50-65 (H2) and 95-102 (H3) (Kabat et al. on every side, Sequences of Proteins of Immunological Interest, 5th Ed.Public Health Service, National Institutes of Health, Bethesda, MD. (1991))), and/or from the residue of " hypermutation ring " (V for example _LMiddle residue 26-32 (L1), 50-52 (L2) and 91-96 (L3) are with V _HMiddle 26-32 (H1), 52A-55 (H2) and 96-101 (H3) (Chothia and Lesk, J.Mol.Biol.196:901-917 (1987)).

As mentioning at this, " consensus sequence " or total V structural domain sequence are artificial sequences, are derived from the comparison to the aminoacid sequence of known person immunoglobulin variable domain sequence.Based on these relatively, the amino acid whose recombinant nucleic acid sequence of preparation coding V structural domain, this sequence has for the sequence that is derived from people and people H chain subgroup III V structural domain.Should have the V sequence without any known antibodies binding specificity or avidity.

The part of the heavy and/or light chain of " chimeric antibody " (immunoglobulin (Ig)) with derive from specific species or belong to specific antibody type or the identical or homology of corresponding sequence of the antibody of subclass, and the rest part of chain with derive from another species or belong to the identical or homology of corresponding sequence of the antibody of another antibody type or subclass, as long as they demonstrate this required biological activity (U.S. Patent number 4,816,567; With Morrison et al., Proc.Natl.Acad.Sci.USA 81:6851-6855 (1984)).In this employed humanized antibody subgroup that is chimeric antibody.

" humanization " form of inhuman (for example, mouse) antibody is a chimeric antibody, and it comprises the minmal sequence that derives from non-human immunoglobulin.Largely, humanized antibody is human normal immunoglobulin (receptor or a receptor antibody), wherein receptor's hypervariable region residue by from inhuman species (donor antibody) for example mouse, rat, rabbit or non-human primate's hypervariable region residue substitute, this hypervariable region residue has required specificity, avidity and ability.In some cases, Fv framework region (FR) residue of human normal immunoglobulin is substituted by corresponding inhuman residue.In addition, humanized antibody can comprise the residue that does not have discovery in receptor's antibody or the donor antibody.These modifications are used to further improve for example binding affinity of antibody performance.Usually, humanized antibody will comprise all at least one and two variable domains typically basically, wherein be equivalent to non-human immunoglobulin the hypermutation ring all or basically all hypermutation rings and all or basically all FR zones are human normal immunoglobulin sequences, though the FR zone can comprise one or more aminoacid replacement that improves binding affinity.The number of these aminoacid replacement in FR typically is no more than 6 in heavy chain, be no more than 3 in light chain.Humanized antibody at random also comprises at least a portion of constant region for immunoglobulin (Fc), at least a portion of human normal immunoglobulin constant region typically.Detailed content is referring to Jones et al., Nature321:522-525 (1986); Reichmann et al., Nature 332:323-329 (1988); With Presta, Curr.Op.Struct.Biol.2:593-596 (1992).

Antibody " effector function " refers to be attributable to those biological activitys in antibody Fc zone (native sequences Fc zone or aminoacid sequence variant Fc zone), and changes with antibody isotype.The example of antibody mediated effect subfunction comprises: Clq is in conjunction with the cell toxicant that relies on complement; The Fc receptors bind; The cell-mediated cytotoxicity (ADCC) that antibody relies on; Phagolysis; The downward modulation of cell surface receptor (for example B-cell receptor); With the B cell activation.

" the cell-mediated cytotoxicity that antibody relies on " or " ADCC " refer to a kind of cytotoxicity form, wherein be present in some cytotoxic cell (for example natural killer (NK) cell, neutrophil and scavenger cell) on the secretion Ig of Fc receptors bind make these cytotoxic effector cells specifically combine with carrying antigenic target cell, and then kill this target cell with cytotoxin.Antibody " arms " cytotoxic cell, and be absolute demand to such killing and wounding.Main cell-NK cell of mediation ADCC-only express Fc γ RIII, and monocytes Fc γ RI, Fc γ RII and Fc γ RIII.FcR on hematopoietic cell is expressed in Ravetch and Kinet, summarizes in Annu.Rev.Immunol9:457-92 (1991) the 464th page table 3.Be the ADCC activity of purpose of appraisals molecule, can carry out external ADCC test,, describe in 362 or 5,821,337 for example at U.S. Patent number 5,500.The useful effector cell of such test is comprised peripheral blood lymphocytes (PBMC) and natural killer (NK) cell.Perhaps or additionally, the ADCC activity of molecules of interest can body in assessment, for example, in the animal model disclosed in Clynes et al.PNAS (USA) 95:652-656 (1998) for example.

" Fc acceptor " or " FcR " described and antibody Fc zone bonded acceptor.Preferred FcR is native sequences people FcR.In addition, preferred FcR is the FcR (a γ acceptor) in conjunction with IgG antibody, and comprise Fc γ RI, Fc γ RII, with the acceptor of Fc γ RIII subclass, comprise the differently spliced forms of allele variant and these acceptors.Fc γ RII acceptor comprises Fc γ RIIA (" activated receptor ") and Fc γ RIIB (" inhibition acceptor "), and it has similar aminoacid sequence, and the main difference of this aminoacid sequence is its tenuigenin structural domain.Activated receptor Fc γ RIIA comprises the activation motif (ITAM) of immunity receptor tyrosine for the basis at its tenuigenin structural domain.Suppress acceptor Fc γ RIIB and comprise the inhibition motif (ITIM) of immunity receptor tyrosine for the basis at its tenuigenin structural domain.(referring to summary M.in

, Annu.Rev.Immunol.15:203-234 (1997)).FcR is at Ravetch and Kinet, Annu.Rev.Immunol9:457-92 (1991); Capel et al., Immunomethods 4:25-34 (1994); With summary among the de Haas et al.J.Lab.Clin.Med.126:330-41 (1995).Other FcR comprises the FcR that those will be differentiated in the future, is included in term ＂ FcR at this " in.This term also comprises newborn infant's acceptor FcRn, and it is responsible for parent IgG is transferred to fetus (Guyer et al.J.Immunol.117:587 (1976) and Kim et al., J.Immunol.24:249 (1994)).WO 00/42072 (Presta) describes antibody variants, that it has an improvement or reduce with the FcR binding ability.The content of this patent publications here is incorporated herein by reference especially.Also referring to, Shields et al.J.Biol.Chem.9 (2): 6591-6604 (2001).

" people effector cell " is the white corpuscle of expressing one or more FcR and exercising effector function.Preferably, cell is expressed Fc γ RIII at least and is exercised the ADCC effector function.The example of the human leukocyte of mediation ADCC comprises peripheral blood lymphocytes (PBMC), natural killer (NK) cell, monocyte, cytotoxic T cell and neutrophil leucocyte, serves as preferred with PBMC and natural killer cell.The effector cell may for example separate from blood from natural origin.

" depend on the cytotoxicity of complement " or " CDC " refers to that there is the dissolving of target cell down in complement.First component (Clq) by complement system and the antibodies of suitable subclass start the activation of CCP, and described antibody is and its related antigen bonded.Be the assessment complement activation, can carry out the CDC test,, describe among the J.Immunol.Methods 202:163 (1996) for example as Gazzano-Santoro et al..

At U.S. Patent number 6,194, among 551B1 and the WO99/51642 polypeptide variants has been described, have the Fc zone aminoacid sequence of change and the Clq binding ability of increase or reduction.The content of those patent publications is incorporated herein by reference especially at this.Also referring to Idusogie et al.J.Immunol.164:4178-4184 (2000).

The N-glycosylation site is at the Asn297 of CH2 structural domain among the IgG.The present invention also provides CD20 bonded, humanized antibody composition, this antibody has the Fc zone, wherein about 80-100% of antibody (and preferably about 90-99%) comprises ripe core sugar structure in the composition, and this sugar structure lacks Fucose, is attached to the Fc zone of glycoprotein.Composition like this is proved to be to demonstrate at this and is combining last surprising improvement with Fc γ RIIIA (F158), and this combination interacts effectively with human IgG not as Fc γ RIIIA (V158).Therefore, the anti-CD20 antibodies composition that the composition is here described before estimating to be better than is particularly for the patient that Fc γ RIIIA (F158) is expressed in treatment.In normal, healthy African American and white people, Fc γ RIIIA (F158) is more common than Fc γ RIIIA (V158).Referring to Lehrnbecher et al.Blood 94:4220 (1999).The application further shows the collaborative increase of Fc γ RIII combination and/or ADCC function, and this collaborative increasing is derived from this glycosylation variation and the associating of the amino acid sequence modifications in glycoprotein Fc zone.

" isolating " antibody is to differentiate and the antibody that separates and/or reclaim from its component of physical environment.The contaminant component of its physical environment is to disturb the diagnosis of antibody or the material that treatment is used, and can comprise enzyme, hormone and other proteic or non-proteic solute.In a preferred embodiment, antibody will be purified to (1) as determining through the Lowry method, calculate by weight greater than 95% of antibody, and most preferably calculate by weight and surpass 99%, (2) enough obtain degree by at least 15 residues that utilize revolving cup sequenator (spinning cup sequenator) N-terminal or internal amino acid sequence, perhaps (3) under reduction or non-reduced condition, utilize Coomassie blue or preferably silver dyeing be issued to homogeneous at SDS-PAGE.Isolated antibody is included in the original position antibody of reconstitution cell inside, because at least one component in the antibody physical environment will not exist.Yet usually, isolated antibody will be by at least one purification step preparation.

" isolating " nucleic acid molecule is to differentiate and isolated nucleic acid molecule that from least one pollutent nucleic acid molecule it usually is related with this pollutent nucleic acid molecule in the natural origin of antibody nucleic acid.Isolated nucleic acid molecule is different when occurring in nature is found with it on its form or the environment.Therefore isolated nucleic acid molecule is different from the nucleic acid molecule that it exists in nature cell.Yet isolated nucleic acid molecule is included in the nucleic acid molecule that is comprised in the cell of common expressing antibodies, and for example nucleic acid molecule is positioned on the chromosome position different with nature cell in this cell.

Representation " control sequence " refers to express the required dna sequence dna of encoding sequence that can be operatively connected in a specific host organism.Be suitable for procaryotic control sequence and for example comprise promotor, optional operon sequence, and ribosome bind site.The known genuine karyocyte utilizes promotor, polyadenylation signal and enhanser.

It is " can be operatively connected " when nucleic acid is placed in functional relationship with another nucleotide sequence.For example, if the DNA of presequence or secretion property leader sequence is expressed as protein before participating in the polypeptide excretory, the DNA of itself and polypeptide can be operatively connected.If promotor or enhanser influence transcribing of sequence, it is operably connected with encoding sequence.If or ribosome bind site is placed in the position that promotes translation, then it is operably connected with encoding sequence.Usually, " being operably connected " refers to that connected dna sequence dna is contiguous, and under the situation of secretion property leader sequence, is contiguous and under read state.Yet it is contiguous that enhanser needs not to be.Connection is by finishing in the connection of suitable restriction site.If such site does not exist, use synthetic oligonucleotide connector or joint according to common way.

" carrier " comprises and shuttling back and forth and expression vector.Typically, the plasmid construction thing comprises replication origin (for example ColE1 replication origin) and selected marker (for example penbritin or tetracyclin resistance), is respectively applied for plasmid duplicating and selecting in bacterium." expression vector " refers to a kind of carrier, and it is included in and expresses antibody of the present invention in bacterium or the eukaryotic cell, comprises control sequence or controlling element that antibody fragment is required.Suitable carriers discloses below.

The cell that produces humanization CD20 binding antibody of the present invention comprises bacterium and eukaryotic host cell, has wherein introduced the nucleic acid of encoding antibody.Proper host cell discloses below.

Word " mark " refers to detectable compound or composition when used herein, and it engages with antibody directly or indirectly.Mark can itself be detectable (for example mark of labelled with radioisotope or fluorescence) or, under the situation of enzymatic labelling, can the detectable substrate compounds of catalysis or the chemically changed of composition.

" autoimmune disease " this from and at the nonmalignant disease or the disorder of intrasubject (oneself) antigen and/or tissue.

As what here use, ＂ B cell is subdued ＂ and is referred to after medicine or antibody treatment with the level minimizing of b cell level in animal or people by comparison before such a the processing.Utilize well-known test, b cell level is measured in the test of for example describing in EXPERIMENTAL EXAMPLE.The B cell is subdued can be completely or part.In one embodiment, the B cell of expressing CD20 subdues at least 25%.Be not subjected to the restriction of any mechanism, the possible mechanism that the B cell is subdued comprises two or more combinations in the modulation of ADCC, CDC, apoptosis, calcium current or the mmi machine system.

Term " cytotoxic agent " is as referring to a kind of material as used herein, and this material suppresses or overslaugh cell function and/or cause cytoclasis.Term intention comprises radio isotope (I for example ¹³¹, I ¹²⁵, Y ⁹⁰With Re ¹⁸⁶), chemotherapeutics and toxin for example enzymatic activity toxin or its fragment of bacterium, fungi, plant or animal-origin.

" chemotherapeutics " is compound useful in cancer therapy.The chemotherapeutics example comprises alkylating agent, as thio-tepa (thiotepa); Ring phosphonic amide (cyclosphamide) (CYTOXAN ^TM); Alkyl sulfonic ester such as busulfan (busulfan), improsulfan (improsulfan) and piposulfan (piposulfan); Aziridine such as benzcarbimine (benzodopa), carboquone (carboquone), meturedepa (meturedopa) and uredepa (uredopa); Aziridine and methylamelamine comprise altretamine (altretamine), triethylenemelamine (triethylenemelamine), triethylenephosphoramide, triethylenethio-hosphopramide and tri methylol melamine (trimethylolomelamine); Mustargen (nitrogen mustards) is as Chlorambucil, Chlornaphazine, courage phosphamide (cholophosphamide), Emcyt (estramustine), ifosfamide (ifosfamide), mustargen (mechlorethamine), Nitromin hydrochloride; Alkeran (melphalan), Novoembichin (novembichin), phenesterine, prednimustine (prednimustine), trofosfamide (trofosfamide), uracil mustard; Nitrosourea (nitrosureas) is as Carmustine (carmustine), chlorozotocin (chlorozotocin), fotemustine (fotemustine), lomustine (lomustine), nimustine (nimustine), ranomustine (ranimustine); Microbiotic such as aclacinomycin, actinomycin, authramycin, azaserine, bleomycin, sanarnycin (cactinomycin), calicheamicin (calicheamicin), carabicin, carminomycin, carzinophylin (carzinophilin), Toyomycin (chromomycin), dactinomycin, daunorubicin (daunorubicin), detorubicin (detorubicin), 6-diazonium-5-oxygen-L-nor-leucine, and Zorubicin (doxorubicin, Adriamycin), pidorubicin (epirubicin), esorubicin (esorubicin), idarubicin (idarubicin) is sent out ripple mycin (marcellomycin), mitomycin, mycophenolic acid, U-15167 (nogalamycin), Olivomycine (olivomycin), peplomycin (peplomycin), potfiromycin, tetracycline, triferricdoxorubicin (quelamycin), rodorubicin (rodorubicin), streptonigrin; U-9889 (streptozocin), tubercidin, ubenimex (ubenimex), zinostatin (zinostatin), zorubicin (zorubicin); Antimetabolite such as methotrexate, 5 FU 5 fluorouracil (5-FU); Folacin such as N10,9-dimethylfolic acid (denopterin), methotrexate, Teropterin (pteropterin), trimetrexate (trimetrexate); Purine analogue fludarabine (fludarabine), Ismipur, ITG, Tioguanine; Pyrimidine analogue such as Ancitabine (ancitabine), azacitidine (azacitidine), 6-azauridine, carmofur (carmofur), cytosine arabinoside, two deoxyuridines, the pyridine of how western fluorine urine, enocitabine (enocitabine), floxuridine, 5-FU; Androgens such as clausterone, dromostanolone propionate (dromostanolong propionate), Epitiostanol (epitiostanol), mepitiostane (mepitiostane), testolactone (testolactone); Anti-suprarenal gland class such as aminoglutethimide (aminoglutethimide), mitotane (mitotane), Win-24540 (trilostane); Folic acid supplement such as frolinic acid; Aceglaton; Aldophosphamide glucosides (aldophosphamideglycoside); Amino-laevulic acid (aminolevulinic acid); Amsacrine (amsacrine); Bestrabucil; Bisantrene (biasntrene); Edatrexate (edatraxate); Defosfamide (defofamine); Omaine; Diaziquone (diaziquone); Eflornithine (elfornithine); Elliptinium acetate (elliptinium acetate); Etoglucid (etoglucid); Gallium nitrate; Hydroxyurea; Lentinan (lentinan); Lonidamine (lonidamine); Mitoguazone (mitoguazone); Mitoxantrone (mitoxantrone); Mopidamol (mopidamol); C-283 (nitracrine); Pentostatin (pintostatin); Phenamet; Pirarubicin (pirarubicin); Podophyllum emodi var chinense tree acid (podophyllinic acid); 2-ethyl hydrazides; Procarbazine (procarbazine); Razoxane (razoxane); Sizofiran (sizofiran); Spirogermanium (spirogermanium); Tenuazonic acid; Triaziquone; 2,2 ', 2 ＂-RA3 (trichlorrotriethylamine); Urethane (urethan); Vindesine; Dacarbazine (dacarbazine); Mannomustin; Mitobronitol (mitobronitol); Mitolactol; Pipobroman (pipobroman); Gacytosine; Arabinoside (" Ara-C "); Tespamin (thiotepa); Taxan (taxoid), as taxol (

Bristol-Myers Squibb Oncology, Princeton, NJ) and doxetaxel (

Rhone-Poulenc Rorer, Antony, France); Chlorambucil; Gemcitabine (gemcitabine); 6-thioguanine; Purinethol; Methotrexate; Platinum analogs such as cis-platinum and carboplatin; Platinum; Zuyeyidal (etoposide) (VP-16); Ifosfamide; Ametycin; Mitoxantrone; Vincristine(VCR); Vincaleucoblastine; Vinorelbine (vinorelbine); New mould acyl ammonia (navelbine); Dithranol (novantrone); Vumon (teniposide); Daunorubicin; Aminopterin; Xeloda; Ibandronate (ibandronate); CPT-11; Topoisomerase enzyme inhibitor RFS 2000; Er Fujiajiniaoansuan (DMFO); Vitamin A acid; Esperamicins; Capecitabine; And the pharmacologically acceptable salt of above-mentioned any material, acid or derivative.This definition also comprise can regulate or inhibitory hormone to the hormone antagonist preparation of the effect of tumour, comprise tamoxifen (tamoxifen) as the estrogen antagonist preparation, raloxifene (raloxifene), aromatase inhibitor 4 (5)-imidazoles, 4-trans-Hydroxytamoxifen, trioxifene (trioxifene), keoxifene, LY117018, onapristone (onapristone), and toremifene (Fareston); With his ammonia (flutamide) of androgen antagonist preparation such as fluorine, Nilutamide (nilutamide), bicalutamide, Leuprolide (leuprolide) and goserelin (goserelin); With the pharmacologically acceptable salt of above-mentioned any material, acid or derivative.

" treatment " or " processing " or " mitigation " had both referred to that therapeutic treatment also referred to preventative or preventive measure, wherein purpose be prevent or slow down (weakening) at pathologic condition or disorder.If behind the CD20 binding antibody of the present invention of individual the method according to this invention amount of receiving treatment, show the observable and/or measurable minimizing of one or more S﹠S of this specified disease, this individuality quilt is positive cancer of " treatment " CD20 or autoimmune disease successfully.For example, for cancer, cancer cells reduced number or cancer cells disappear; Gross tumor volume reduces; Suppress (promptly slow down to a certain extent and preferably stop) metastases; Suppress tumor growth to a certain extent; Prolong the time of remission, and/or alleviate to a certain extent and the associated one or more symptoms of this specific cancer; Reduce the incidence of disease and mortality ratio, with the matters such as improvement of quality of life.Patient also can feel the attenuating of disease sign or symptom.Treatment can obtain response fully, is defined as the disappearance of all cancer signs, perhaps partial response, and wherein tumor size reduces, and preferably surpasses 50%, more preferably surpasses 75%.If patient's state of an illness is steady, also be considered to treat.In a preferred embodiment, the cancer of cancer patient is not still made progress after 1 year, preferably after 15 months.Assess disease successfully treat with these parameters of improving be metric easily by the conventional procedure of being familiar with for this area doctor.

" treatment significant quantity " refers to effective " treatment " disease or the antibody of disorder or the amount of medicine in individuality.For cancer, the pharmacological agent significant quantity can reduce the quantity of cancer cells; Reduce gross tumor volume; Suppress of the infiltration of (promptly slow down to a certain extent and preferably stop) cancer cells to peripheral organs; Suppress (promptly slow to a certain extent and preferably stop) metastases; Suppress tumor growth to a certain extent; And/or alleviate one or more symptoms relevant to a certain extent with cancer.Referring to aforementioned definition to " treatment ".

" chronic " administration referred to the continuous mode administration described medicament opposite with acute mode, thereby keep initial result of treatment (activity) in the longer time." intermittence " administration is not to be to carry out continuously incessantly and be actually periodic treatment.

Method of the present invention and composition

The invention provides in conjunction with people CD20 and preferably also in conjunction with the humanized antibody of other primate CD20, comprise a heavy chain, this heavy chain comprises at least one of inhuman species anti-humen CD 20 antibody (donor antibody), preferably two or all H chain CDR and as all framework residues basically of the total antibody of people of receptor's antibody.Donor antibody can come from various inhuman species, comprises mouse, rat, cavy, goat, rabbit, horse, primate, but is mouse antibodies the most frequently.Here " all basically " refer to that the receptor FR zone of humanized antibody can be included in original non-existent one or more aminoacid replacement in the total FR sequence of people.These FR change can be included in the residue that does not find in receptor or the donor antibody.

In one embodiment, donor antibody is a murine antibody, and the variable region comprises each CDR and FR sequence of H shown in Figure 1A and the 1B and L chain.In a specific embodiment, the residue of human Fab's framework is corresponding to people V κ subgroup I and V _HThe consensus sequence of subgroup III, these consensus sequences are respectively shown in Figure 1A and Figure 1B.Humanization 2H7 antibody of the present invention has at least one CDR of the H chain of mouse donor antibody.In one embodiment, the CDR that comprises donor antibody H and L chain in conjunction with the humanization 2H7 antibody of people CD20.

In a full length antibody, humanization CD20 binding antibody of the present invention will comprise humanized variable domains, and this structural domain is connected with the constant domain of human normal immunoglobulin.In a preferred embodiment, CH is from human IgG, preferably IgG1 or IgG3.The light chain constant domain is preferably from people κ chain.

Unless otherwise instructed, aminoacid replacement of in EXPERIMENTAL EXAMPLE below, indicating or the change position, the humanization 2H7 antibody pattern here will have the V and the C-structure territory sequence of 2H7.v16 light chain (Fig. 6, SEQ IDNO.21) and H chain (Fig. 7, SEQ ID NO.22).

This humanization CD20 binding antibody will be at least in conjunction with people CD20, and preferably in conjunction with other primate CD20, for example ape and monkey (monkey) comprise macaque and rhesus monkey, with the CD20 of chimpanzee.The sequence of macaque CD20 discloses in embodiment 15 and Figure 19.

CD20 binding antibody of the present invention and the biological activity of humanization CD20 binding antibody comprise combining of this antibody and people CD20, more preferably combine with people and primate (comprising macaque, rhesus monkey, chimpanzee) CD20, and its Kd value is not higher than 1 x 10 ^-8, preferably the Kd value is not higher than about 1 x 10 ^-9, even more preferably the Kd value is not higher than about 1 x 10 ^-10, and can be external or body in kill or subdue the B cell, preferably kill or subdue at least 20% when comparing with the baseline values or the appropriate negative contrast of not crossing with such antibody treatment.

The desired level that the B cell is subdued will depend on disease.For the positive cancer of treatment CD20, perhaps need to subdue to greatest extent B cell as anti-CD20 antibodies target of the present invention.Therefore, for the positive B cell tumour of treatment CD20, be enough preferably to subduing of B cell, with the progress that wards off disease at least, and the progress of disease to be this area skilled practitioners can assess, for example propagation by monitoring tumor growth (size), cancer cells type, transfer, and other S﹠S of this particular cancers.Preferably, the B cell was subdued the progress that is enough to ward off disease at least 2 months, and more preferably 3 months, even more preferably 4 months, more preferably 5 months, even more preferably 6 or more a plurality of months.In addition preferred embodiment in, the B cell is subdued was enough to improve paresthesia alleviateding time at least 6 months, more preferably 9 months, more preferably 1 year, more preferably 2 years, more preferably 3 years, even more preferably 5 years or more for many years.In a most preferred embodiment, the B cell is subdued is enough to treat disease.In preferred embodiments, the B cell in cancer patient subdue be the treatment before baseline values about at least 75 and preferably 80%, 85%, 90%, 95%, 99% and even 100%.

For the treatment autoimmune disease, perhaps need to rely on the disease of individual patient and/or the severity of illness, by adjusting the dosage of CD20 binding antibody, the degree that modulation B cell is subdued.Therefore, can subdue the B cell but need not to be completely.Perhaps, in initial treatment, may need total B cell to subdue, but in treatment subsequently, may adjust dosage and partly subdue only to reach.In one embodiment, compare with the baseline values before the treatment, the B cell subdues at least 20%, and promptly remaining 80% or the positive B cell of CD20 still less.In other embodiments, the B cell subdues 25%, 30%, 40%, 50%, 60%, 70% or more.Preferably, the B cell is subdued is enough to make progression of disease to be paused, and more preferably relaxes the S﹠S of the specified disease under treatment, even more preferably cure diseases.

The present invention also provides dual specific CD20 binding antibody, and wherein antibody arm has the heavy and light chain of humanization of humanization CD20 binding antibody of the present invention, and another arm has the variable region at the second antigenic binding specificity.In specific embodiment, second antigen is selected from by CD3, CD64, CD32A, CD16, NKG2D or other NK and activates the group that part is formed.

Same Rituxan (rituximab) is by comparison), v16 demonstrates ADCC and renders a service about 2 to 5 times of increase, and CDC reduces 3-4 doubly than Rituxan.

Antibody produces

Monoclonal antibody

Monoclonal antibody can be used Kohler et al, Nature, and the hybridoma method that 256:495 (1975) at first describes prepares or prepares by recombinant DNA method (United States Patent (USP) 4,816,567).

In hybridoma method, as above-mentioned immune mouse or other suitable host animal, for example hamster excites generation maybe can produce the lymphocyte of the used proteic antibody of specific combination immunity.Alternatively, described lymphocyte can be by external immunity.After the immunity, lymphocyte can use suitable fusogen for example polyoxyethylene glycol and myeloma cell line fusion separated and subsequently, to form hybridoma (Goding, monoclonal antibody: Principles and Practice, 59-103 page or leaf (Academic Press, 1986)).

Zhi Bei hybridoma is inoculated in suitable culture base and growth therein thus, and this substratum preferably comprises one or more and suppresses not merge parental generation myeloma cell's (being also referred to as fusion partner) the growth or the material of survival.For example, if parental generation myeloma cell lacks hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the selection substratum of hybridoma generally includes xanthoglobulin, aminopterin, and the material of these inhibition of thymus pyrimidine (" HAT substratum ") HGPRT-deficient cells growth.

Those fusion partner myeloma cell lines that selected antibody-producting cell produces antibody and selection do not merged the selection substratum sensitivity of parental generation with stable high level can effectively be merged, be supported to preferred fusion partner myeloma cell for those.Preferred myeloma cell line is a rat bone marrow tumour system, as by SalkInstitute Cell Distribution Center, San Diego, MOPC-21 that California USA provides and MPC-11 mouse tumor, with by American type culture collection, the SP-2 or derivatives thereof that Rockville, MarylandUSA provide is as the X63-Ag8-653 cell.Also describe human myeloma and mouse-people's allos myeloma cell line and can be used for producing human monoclonal antibodies [Kozbor, J.Immunol., 133:3001 (1984); With Brodeur etc., MONOCLONAL ANTIBODIES SPECIFIC FOR technology and application (MarcelDekker, Inc., New York New York, (1987)) 51-63 page or leaf).

Can in the substratum of the hybridoma that contains growth, analyze the generation of anti-described antigenic monoclonal antibody.Preferably, the binding specificity of the monoclonal antibody that hybridoma produced is analyzed as radioimmunoassay (RIA) or enzyme linked immunosorbent assay (ELISA) by immunoprecipitation or by external combination test.

The binding affinity of monoclonal antibody can pass through, Muson etc. for example, and Anal.Biochem., the described Scatchard of 107:220 (1980) analyzes and measures.

Produce hybridoma in case identify with required specificity, avidity and/or active antibody, these cell clones can carry out subclone by limiting dilution, and by standard method (Goding, monoclonal antibody: Principles and Practice, 59-103 page or leaf (Academic Press, 1986)) makes its growth.The substratum that is fit to this purpose comprises for example D-MEM or RPMI-1640 substratum.In addition, by for example the cell peritoneal injection being gone in the mouse, hybridoma is grown in vivo with the form of animal ascites tumour.

The secreted monoclonal antibody of above-mentioned subclone can with the classical antibody purification process as, for example, affinity chromatography (for example using albumin A or Protein G agarose) or ion exchange chromatography, hydroxyapatite chromatography, gel electrophoresis, dialysis etc. separate in ascites or the serum from substratum.

Use traditional method (for example by use can with the gene specific bonded oligonucleotide probe of coding murine antibody heavy chain and light chain) DNA of monoclonal antibody but delamination and order-checking are encoded.Hybridoma is the preferred source of this DNA.In case isolate this DNA, it can be inserted in the expression vector, this carrier transfected subsequently to the host cell Bacillus coli cells for example, monkey COS cell, Chinese hamster ovary (CHO) cell, or do not generate the myeloma cell of antibody protein in addition, thereby in recombinant host cell synthetic monoclonal antibody.Summary literal about the DNA of recombinant expressed encoding antibody in bacterium comprises Skerra et al., Curr.Opinion in Immunol., 5:256-262 (1993) and Pl ü ckthun, Immunol.Revs., 130:151-188 (1992).

In further embodiment, can be from using McCafferty etc., Nature separates monoclonal antibody or antibody fragment in the antibody phage library that the technology that 348:552-554 (1990) describes produces.Clackson etc., Nature, 352:624-628 (1991) and Marks etc., J.Mol.Biol., 222:581-597 (1991) have described the use phage library respectively and have separated mouse and people's antibody.Article has subsequently been described by chain reorganization and has been produced high-affinity (nano level) people antibody (Marks etc., Bio/Technology, 10:779-783 (1992)), and will make up and recombinate in infection and the body as the very large phage library (Waterhouse etc. of construction of strategy, Nuc.Acids.Res., 21:2265-2266 (1993)).Therefore, these technology are that feasible (viable) that is used to separate traditional monoclonal antibody hybridoma technology of monoclonal antibody selects.

Also can adopt following method that the DNA of encoding antibody is modified to produce chimeric or to merge antibody polypeptides: for example, with people's heavy chain and constant region of light chain (C _HAnd C _L) sequence replace homology mouse sequence (United States Patent (USP) 4,816,567; With Morrison etc., Proc.Natl Acad.Sci.USA, 81:6851 (1984)), or the complete or part encoding sequence of immunoglobulin coding sequence and NIg polypeptide (heterologous polypeptide) merged.The NIg peptide sequence can replace the constant region of antibody, or they can replace the variable region of an antigen binding site of antibody to produce chimeric bivalent antibody, this antibody comprises at an antigenic antigen binding site, and has different antigenic specific another antigen binding sites.

Humanized antibody

The humanized method of non-human antibody is described in the art.Preferably, humanized antibody has one or more from inhuman its amino-acid residue of source introducing.These inhuman amino-acid residues often are called " introduction " residue, and they are usually from " introduction " variable region.The humanization process is according to Winter and colleague (Jones etc., Nature, 321:522-525 (1986) substantially; Riechmann etc., Nature, 332:323-327 (1988); Verhoeyen etc., Science, 239:1534-1536 (1988)) described, replace the corresponding sequence of people's antibody by the alterable height region sequence and carry out.Therefore, such " humanization " antibody is chimeric antibody (United States Patent (USP) 4,816,567), and wherein the seldom part of complete human variable region is replaced by the corresponding sequence of inhuman species.In the practice, humanized antibody is people's antibody normally, and wherein some hypervariable region residue and some FR residue of possibility are replaced by the residue in similar site in the rodent animal antibody.

When antibody is used for human treatment's purposes, select humanized antibody to prepare used people's light chain and variable region of heavy chain, antigenicity and HAMA reaction (human antimouse antibody) is extremely important for reducing.According to so-called " the suitableeest " method, at the variable region sequences of the whole library screening rodents antibody of known person variable region sequences.Identify and the immediate people V of rodents V region sequence region sequence, and people's framework region (FR) wherein is accepted (Sims et al., J.Immunol., 151:2296 (1993) as humanized antibody; Chothia et al., J.Mol.Biol., 196:901 (1987)).Another kind method is used from the consensus sequence deutero-specific frame district of everyone antibody with light chain or the specific subgroup of heavy chain.Same framework region can be used to several different humanized antibodies (Carter etc., Proc.Natl.Acad.Sci.USA, 89:4285 (1992); Presta etc., J.Immunol., 151:2623 (1993)).

Importantly, will keep behind the antibody humanization antigenic high binding affinity and other favourable biological nature.For reaching this purpose, in a kind of preferred method, prepare humanized antibody by the method for analyzing parental array and each ways makes conceptual researches humanization product with the three-dimensional model of parental array and humanization sequence.The immunoglobulin (Ig) three-dimensional model has commodity, is that those skilled in the art are familiar with.Also be useful on description and show the computer program of the three-dimensional conformation structure that selected candidate's immunoglobulin sequences is possible.By checking that these displayings result can analyze the effect that residue may be brought into play in the function of candidate's immunoglobulin sequences, promptly analyze the residue that can influence candidate's immunoglobulin (Ig) and its antigen bonded ability.By this method, can and introduce and select FR residue and combination the sequence from receptor sequence, thereby obtain required antibody character, increase as avidity to target antigen.In a word, hypervariable region residue direct and main relating to, influence the antigen bonded.

Humanized antibody can be an antibody fragment, Fab for example, its alternatively with one or more cytotoxicity preparation couplings to produce immune conjugate.Alternatively, humanized antibody can be the antibody of total length, for example total length IgG1 antibody.

People's antibody and phage display method

As humanized alternative, can prepare people's antibody.For example, can prepare transgenic animal (as mouse) now, it can produce a complete set of people's antibody through immunity under the situation that lacks the endogenous immunoglobulin generation.For example, pointed out in chimeric and embryonal system (germ-line) mutant mice the inhibition fully that the homozygous deletion of heavy chain of antibody joining region (JH) gene causes endogenous antibody to generate.People's embryonal system immunoglobulin gene array is transferred in this germline mutation mouse, will be caused under the situation that antigen is attacked, producing people's antibody.For example see Proc.Natl.Acad.Sci.USA such as Jakobovits, 90:2551 (1993); Jakobovits etc., Nature, 362:255-258 (1993); Bruggemann etc., Year in Immuno., 7:33 (1993); United States Patent (USP) 5,545,806,5,569,825,5,591,669 (all authorize GenPharm); 5,545,807; With WO 97/17852.

Perhaps, the never immunoglobulin variable of immune donor (V) district external generation human antibodies of gene pool and antibody fragment of available display technique of bacteriophage (McCafferty etc., natural 348:552-553 (1990)).According to this technology, antibody V district gene (in-frame) in framework is cloned into the main or less important capsid protein gene of filobactivirus (as M13 or fd), and is the functional antibodies fragment at the surface display of phage particle.Because filamentous particle comprises the single stranded DNA copy of phage genome, the selection of carrying out according to the functional characteristics of antibody also causes the encoding gene of the antibody that shows these character is selected.Therefore, phage has imitated the part characteristics of B cell.Phage display can carry out in a variety of forms; These summaries are seen for example Johnson, Kevin S. and Chiswell, David J., Current Opinion inStructural Biology 3,564-571 (1993).Can use a plurality of sources of V gene segment to carry out phage display.Clackson etc., Nature 352, and 624-628 (1991) isolates a collection of various anti--azolactone antibody from the little combinatorial library at random of V gene in immune mouse spleen source.Can be substantially as Marks etc., J.Mol.Biol.222:581-597 (1991), or Griffith etc., EMBOJ.12:725-734 (1993) is described, make up the V gene pool of non-immune human donor, and separate at varied antigen antibody of (comprising autoantigen).Also see United States Patent (USP) 5,565,332 and 5,573,905.

As above discuss, people's antibody also can produce (seeing United States Patent (USP) 5,567,610 and 5,229,275) by external activatory B cell.

Antibody fragment

Under specific situation, use antibody fragment more to have superiority than whole antibody.Segmental smaller size smaller allows to remove fast, and can cause better near noumenal tumour.

Develop multiple technologies and be used to produce antibody fragment.Traditionally, these fragments derive by complete antibody being carried out proteolytic digestion (for example seeing Morimoto etc., J.Biochem.Biojphys.Methods 24:107-117 (1992) and Brennan etc., Science 229:81 (1985)).Yet these fragments can be passed through the recombinant host cell direct production now.Fab, Fv and ScFv antibody fragment all can be at expression in escherichia coli and are therefrom secreted, thereby make these segmental mass production transfigurations easy.Also can be from above-mentioned antibody phage library separation antibody fragment.Alternatively, Fab '-SH fragment can directly reclaim and utilizes the chemical process coupling to form F (ab ') from intestinal bacteria ₂Fragment (Carter etc., Bio/Technology10:163-167 (1992)).According to other method, F (ab ') ₂Fragment can directly be separated from the recombinant host cell culture.The Fab and the F (ab ') that comprise half life in the body of remedying receptors bind epi-position residue and having prolongation ₂Fragment is at United States Patent (USP) 5,869, describes in 046.Those of skill in the art grasp other technology that produces antibody fragment.In other embodiment, the antibody of selection is strand Fv fragment (scFv).See WO93/16185; United States Patent (USP) 5,571,894; With United States Patent (USP) 5,587,458.Fv and sFv have unique shortage constant region in the kind of complete binding site; Therefore, reduce non-specific combination during it is suitable for using in vivo.Can make up the sFv fusion rotein, thereby merge effect protein at amino or the C-terminal of sFv.The Antibody Engineering that sees above, Borrebaeck edits.Antibody fragment also can be " a linear antibody ", for example at United States Patent (USP) 5,641, describes in 870.This kind line style antibody fragment can be single special or two special.

Bispecific antibody

Bispecific antibody is the antibody that at least two kinds of different epi-positions is had binding specificity.Typical bispecific antibody can be in conjunction with the proteinic two kinds of different epi-positions of CD20.Other this kind antibody can be with the CD20 binding site and at another combination of proteins Sites Combination.Perhaps, anti-CD20 arm can with combine white corpuscle on trigger the arm combination of molecule, trigger molecule for example Fc acceptor (Fc γ R) for example Fc γ RI (CD64), Fc γ RII (CD32) and the Fc γ R (CD16) of TXi Baoshouti molecule (for example CD3) or IgG, or NKG2D or other NK cell-stimulating part, with cytophylaxis mechanism at be positioned on the CD20 express cell.Bispecific antibody also can be used to cellulotoxic preparation is positioned on the cell of expressing CD20.These antibody tool CD20 arms and in conjunction with the arm of cytotoxicity preparation (for example saporin (saporin), anti-alpha-interferon, vinca alkaloids, ricin A chain, methotrexate or radio isotope haptens).Bispecific antibody can be prepared into full length antibody or antibody fragment (F (ab ') for example ₂Bispecific antibody).

WO96/16673 has described dual specific anti-ErbB/anti-Fc γ RIII antibody, United States Patent (USP) 5,837, and 234 have disclosed dual specific anti-ErbB/anti-Fc γ RI antibody.In WO98/02463, show dual specific anti-ErbB/Fc Alpha antibodies.United States Patent (USP) 5,821,337 have instructed dual specific anti-ErbB/anti-cd 3 antibodies.

The method for preparing bi-specific antibody is known in the art.The traditional preparation process of total length bi-specific antibody is based on two coexpressions that heavy chain immunoglobulin-light chain is right, and wherein these two chains have not homospecificity (Millstein et al, Nature, 305:537-539 (1983)).Because the random assignment of heavy chain immunoglobulin light chain, these hybridomas (" four chain knurls " (quadroma)) produce the possible mixture of 10 kinds of different antibodies molecules, wherein have only a kind of correct dual specific structure that has.Purifying (being undertaken by the affinity chromatography step usually) to described correct molecule is very complicated, and output is very low.Similarly method discloses among the EMBO J, 10:3655-3659 (1991) at WO93/08829 and Traunecker etc.

According to another different methods, the antibody variable region (antibody-antigen binding site) with required binding specificity can be merged with the constant region for immunoglobulin sequence.The preferred immunoglobulin heavy chain constant region with at least a portion that comprises hinge area, CH2 and CH3 district of this fusion merges.Preferably make and contain light chain and appear at least in a kind of fusion in conjunction with first CH (CH1) in required site.Can be with coding heavy chain immunoglobulin syzygy, and in case of necessity, the DNA of coding light chain immunoglobulin inserts different expression vectors, cotransfection is to suitable host cell.In the three peptide species chains that use non-geometric ratio made up with the embodiment that obtains required bi-specific antibody optimum yield, this provided the big handiness of adjusting on the segmental mutual ratio of three peptide species.But also can express with equal proportion and when obtaining high yield or described ratio when the output of required chain combination is not had special meaning, the encoding sequence of two kinds or all three peptide species chains is inserted same expression vector at least two peptide species chains.

In a preferred embodiment of this method, described bi-specific antibody is made of (second binding specificity is provided) the heterozygosis heavy chain immunoglobulin-light chain on heterozygosis heavy chain immunoglobulin with first binding specificity on the one arm and other one arm.Found that this unsymmetrical structure helps isolating required dual specific compound from the mixing of undesired immunoglobulin chain, because there is light chain immunoglobulin in half that have only this bispecific molecule, this makes to separate and is more prone to.This method is disclosed among the disclosed WO94/04690 on March 3rd, 1994.The further details of preparation bi-specific antibody can referring to, Suresh etc. for example, Methods in Enzymology, 121:210 (1986).

According to United States Patent (USP) 5,731,168 described another kind of methods can be transformed the interface between a pair of antibody molecule, the per-cent maximum of the feasible heterodimer that obtains from reconstitution cell is cultivated.Preferred interface comprises at least a portion of CH3 structural domain.In the method, the little side chain of one or more amino acid that comes from the first antibody molecule interface is replaced by larger side chain (as tyrosine or tryptophane).The complementation " ditch " identical or close with described bulky side chain size can be by replacing the amino acid bulky side chain and forming on the interface of second antibody molecule with little side chain (as L-Ala or Threonine).This provides a kind of mechanism, and it makes other the undesired end product of rate ratio such as the homotype dimer height of heterodimer.

Bi-specific antibody comprises cross-linking antibody or " allos link coupled " antibody.For example, one of antibody in the allos conjugate and avidin coupling be can make, another antibody and vitamin H coupling made.Have viewpoint to think, this antibody-like can be used for the immune system cell undesired cell (United States Patent (USP) 4,676,980) that leads, also can be used for treating HIV infect (WO91/00360, WO92/200373, EP03089).Allos coupling antibody can be by any suitable cross-linking method preparation.Suitable cross-linked formulations and multiple crosslinking technological are known in the art, and at United States Patent (USP) 4,676, obtain in No. 980.

The existing document of technology for preparing bi-specific antibody from antibody fragment.For example, bi-specific antibody can utilize chemistry to connect preparation.Brennan etc. have described among the science 229:81 (1985) complete antibody through proteolysis cutting preparation F (ab ') ₂Segmental method.These fragments are reduced when dimercapto recombiner Sodium metaarsenite exists, thus the sulfydryl of stabilize adjacent, and the formation of prevention intermolecular disulfide bond.Fab ' the fragment that generates is converted into sulphur nitrobenzoate (TNB) derivative.Wherein a kind of Fab '-TNB derivative changes into Fab '-mercaptan again through the mercaptoethylamine reduction, mixes with other Fab '-TNB derivative of equimolar amount to form bi-specific antibody again.So the bi-specific antibody that produces can be used as used reagent in the selectivity immobilization of enzyme.

Recent progress has promoted Fab '-SH fragment from colibacillary direct recovery, and this fragment can form bi-specific antibody through chemical coupling.Shalaby etc., J.Exp.Med., 175:217-225 (1992) has described full-length human bispecific antibody F (ab ') ₂The generation of molecule.Each Fab ' fragment secretes respectively from intestinal bacteria, and external direct chemical coupling forms bi-specific antibody.So the bi-specific antibody of preparation can combine with crossing the cell and the normal human T-cell that express the ErbB2 acceptor, can also cause the lytic activity of human cell's poison lymphocyte to HBT's target.

Directly the multiple technologies of preparation and separation bispecific antibody fragment are also existing from reconstitution cell is cultivated describes.For example, available leucine zipper prepares bi-specific antibody.Kostelny etc., J.Immunol., 148 (5): 1547-1553 (1992).To be connected by gene fusion with the Fab ' part of two kinds of different antibodies from the proteic leucine zipper peptide of Fos and Jun.Make the homodimer of antibody be reduced into monomer, reoxidized the heterodimer that forms antibody then at hinge area.This method also can be used for preparing the antibody homodimer.Hollinger etc., Proc.Natl.Acad.Sci.USA, 90:6444-6448 (1993) described " bivalent antibody " technology provides the another kind of method for preparing bispecific antibody fragment.Contain V in the described fragment _H, it is by joint and V _LLink to each other, this joint is very short, makes can't match between two structural domains of same chain.Therefore, the V on the same fragment _HAnd V _LStructural domain be forced to another fragment on complementary V _LAnd V _HThe structural domain pairing, thus two antigen binding sites formed.Reported the another kind of strategy for preparing bi-specific antibody with strand Fv (sFv) dimer in addition.See Gruber etc., J.Immunol., 152:5368 (1994).

The invention still further relates to the above antibody of divalence.For example can prepare three specific antibodies.J.Immunol.147:60 such as Tutt (1991).

Multivalent antibody

Multivalent antibody is easier of the antigenic cell internalizing (and/or alienation) of expression with this antibodies than bivalent antibody.Antibody of the present invention can be the multivalent antibody (for example tetravalent antibody) (they are not the IgM classes) with three or more antigen binding sites, can prepare this antibody easily by the nucleic acid that makes the encoding said antibody polypeptide chain is recombinant expressed.Multivalent antibody can comprise Dimerized structural domain and three or more antigen binding sites.Preferred Dimerized structural domain comprises Fc district or hinge area, or is made up of it.In this article, antibody comprises a Fc district and the three or more individual N-terminal antigen binding site in Fc district that is positioned at.Preferred multivalent antibody comprises three to about eight antigen binding sites at this, or is made up of them, but preferred four antigen binding sites.Multivalent antibody comprises at least one polypeptide chain (and preferred two polypeptide chains), and wherein said polypeptide chain comprises two or more variable regions.For example, polypeptide chain can comprise VD1-(X1) _n-VD2-(X2) _n-Fc, wherein VD1 is first variable region, and VD2 is second variable region, and Fc is a polypeptide chain in Fc district, and X1 and X2 represented amino acid or polypeptide, n are 0 or 1.For example, polypeptide chain can comprise V _H-CH1-flexible connector (flexible linker)-V _H-CH1-Fc district chain; Or V _H-CH1-V _H-CH1-Fc district chain.The multivalent antibody of this paper preferably further comprises at least two (preferred four) variable region of light chain polypeptide.For example the multivalent antibody of this paper can comprise from about two to about eight variable region of light chain polypeptide.The variable region of light chain polypeptide of this paper comprises variable region of light chain and further comprises the CL structural domain alternatively.

Other is amino acid modified

The invention still further relates to amino acid sequence modifications to CD20 binding antibody described herein.For example, may wish to improve binding affinity and/or other biological characteristics of antibody.The aminoacid sequence variant of anti-CD20 antibodies can change by import suitable Nucleotide in anti-CD20 antibodies nucleic acid, or prepares by method of peptide synthesis.Described modification comprises, as the disappearance of the residue in the aminoacid sequence of this anti-CD20 antibodies, and/or inserts and/or replacement.Can carry out arbitrary combination to obtain final construct, as long as this final construct has desired characteristic to disappearance, insertion and replacement.Amino acid whose variation also can change the translation post-treatment of anti-CD20 antibodies, as changing the number or the position of glycosylation site.

A kind ofly differentiate that the effective ways in the specific residue that is in the mutagenesis optimum position in the anti-CD20 antibodies or zone are Cunningham and Wells, science 244:1081-1085 (1989) described " alanine scanning mutagenesis ".Here, (for example identify a residue or one group of target residue, charged residue such as arginine, aspartic acid, Histidine, Methionin and L-glutamic acid) and with neutral or electronegative amino acid (most preferably L-Ala or Polyalanine) replacement, so that influence amino acid and the antigenic interaction of CD20.Those amino acid positions that confirm replacement is had a function sensitive are by point is introduced further or other variant improves replacing.So, being predetermined although introduce the site of variant amino acid sequence, sudden change itself needs not to be predetermined.For example,, carry out L-Ala scanning or random mutagenesis, and screen the expressed active anti-CD20 antibodies variant of expection that has at described target codon or zone for analyzing effect in the sudden change of appointment site.

Aminoacid sequence inserts and to comprise amino-and/or fusion of carboxyl-end (its length from a residue to the polypeptide that comprises 100 or more residues), and the insertion of the interior single or multiple amino-acid residues of sequence.The terminal example that inserts comprises anti-CD20 antibodies that has the terminal methionyl residue of N-or the antibody that merges with the cytotoxicity polypeptide.Other of anti-CD20 antibodies molecule inserts variant and comprises N or C-terminal and the enzyme (for example ADEPT) that makes this anti-CD20 antibodies or increase the polypeptide of this antibody serum half life and merge the syzygy of formation.

Another kind of variant is the aminoacid replacement variant.These variants make that at least one amino-acid residue is replaced by different residues in the anti-CD20 antibodies molecule.The most interesting site that replaces mutagenesis comprises the hypervariable region, also can change FR.Conservative replacement sees Table " the preferential replacement " hurdle of 1.If these replacements cause the change of biologic activity, then can introduce in the table 1 the more material alterations on " replacing for example " hurdle, or the further more material alterations described in hereinafter the amino acid classification, and the screening product.

The aminoacid replacement table

Original residue	Replace for example	The preferential replacement
			Ala(A)	val；leu；ile	val
Arg(R)	lys；gln；asn	lys
			Asn(N)	gln；his；asp；lys；arg	gln
Asp(D)	glu；asn	glu
			Cys(C)	ser；ala	ser
Gln(Q)	asn；glu	asn
			Glu(E)	asp；gln	asp
Gly(G)	ala	ala
			His(H)	asn；gln；lys；arg	arg
Ile(I)	Leu; Val; Met; Ala; Phe; Nor-leucine	leu
			Leu(L)	Nor-leucine; Ile; Val; Met; Ala; Phe	ile
Lys(K)	arg；gln；asn	arg
			Met(M)	leu；phe；ile	leu
Phe(F)	leu；val；ile；ala；tyr	tyr
			Pro(P)	ala	ala
Ser(S)	thr	thr
			Thr(T)	ser	ser

Trp(W)	tyr；phe	tyr
			Tyr(Y)	trp；phe；thr；ser	phe
Val(V)	Ile; Leu; Met; Phe ala; Nor-leucine	leu

The substantial modifications of the biological characteristics of antagonist can be finished by selecting to replace, the effect of described replacement is being kept the structure that (a) replaces district's polypeptide framework, for example laminated structure or helical conformation, (b) electric charge of this molecule target site or hydrophobicity, (c) there were significant differences for these several respects of the size of side chain.Natural residue can be divided into according to total side chain characteristic:

(1) hydrophobicity: nor-leucine, methionine(Met), L-Ala, Xie Ansuan, leucine, Isoleucine

(2) neutral hydrophilic: halfcystine, Serine, Threonine

(3) acidity: aspartic acid, L-glutamic acid

(4) alkalescence: l-asparagine, glutamine, Histidine, Methionin, arginine

(5) influence the residue of side chain orientation: glycine, proline(Pro) and

(6) aromatic series: tryptophane, tyrosine, phenylalanine.

Non-conservative replacement will limit the member of above-mentioned a certain class by another kind of replacement.

Anyly do not participate in keeping the cysteine residues of the correct configuration of anti-CD20 antibodies can be replaced, substitute by Serine usually, improve the oxidative stability of molecule and prevent wrong crosslinked.Otherwise, can in antibody, add halfcystine and connect to improve its stability (especially when antibody is antibody fragment such as FV fragment).

The special preferred type that replaces variant comprises and replaces parental antibody (one or more residue of humanized antibody or people's antibody hypervariable region for example.Usually, the selected gained variant that is used for further exploitation should have improved biologic activity with respect to its parental antibody of originating.Producing of this replacement variant, to make things convenient for method be the affinity maturation that has utilized phage display.Briefly, make several sites (as 6-7 site) sudden change of hypervariable region so that produce all possible aminoacid replacement in each site.The antibody variants of Chan Shenging is illustrated on the filobactivirus particle with the unit price form like this, and it is the syzygy with the M13 gene III product of each particle internal packing.Whether the variant that screens phage display then has biologic activity described herein (as binding affinity).In order to identify alternative hypervariable region decorating site, can identify antigen in conjunction with the hypervariable region residue of making main contribution by alanine scanning mutagenesis.Perhaps or in addition, it is also more favourable to determine the point of contact between CD20 and the antibody to analyze the crystalline structure of antigen-antibody complex.These contact residues and contiguous residue are the candidate locus that replaces according to technology described herein.In case produce such variant, as described herein they are all screened, select in one or more related experiment, have superperformance antibody so that further exploitation.

The another kind of amino acid variant of antibody has changed the original glycosylation pattern of this antibody.The so-called change is exactly one or more sugar component that removes in the antibody, and/or adds one or more and be not present in glycosylation site in this antibody originally.

The glycosylation of antibody is generally the N-connection or O-connects.N-connects and refers to sugar component is linked to each other with the side chain of asparagine residue.Tripeptide sequence l-asparagine-X-Serine is to make sugar component carry out the recognition sequence that the side chain enzymatic links to each other with l-asparagine with l-asparagine-X-Threonine (wherein X is any amino acid except that proline(Pro)).Therefore, exist above-mentioned any tripeptide sequence all can produce the potential glycosylation site in the polypeptide.O-connects glycosylation and refers to N-acetylgalactosamine, semi-lactosi or wood sugar are attached to hydroxy-amino-acid, mainly is Serine, Threonine, but also available 5-oxyproline and 5-hydroxylysine.

Adding glycosylation site in antibody molecule can be by changing aminoacid sequence, makes it comprise one or more above-mentioned tripeptide sequence (connecting under the situation of glycosylation site adding N-) and realizes.This change also can be by adding in original antibody sequence or replacing one or more Serine or threonine residues realizes (adding under the situation that O-connects).

The nucleic acid molecule of the aminoacid sequence variant of coding anti-CD20 antibodies is by prepared in various methods known in the art.These methods include but not limited to separate (under the situation of natural acid sequence variant) from natural origin, or carrying out oligonucleotide mediated (or fixed point) mutagenesis by anti-CD20 antibodies to the variant of early stage preparation or not variation, PCR mutagenesis and cassette mutagenesis prepare.

Perhaps wish aspect effector function, to modify antibody of the present invention, for example cell-mediated cytotoxicity (ADCC) that relies on the antigen that strengthens antibody and/or the cytotoxicity (CDC) that depends on complement.This can reach by introducing one or more aminoacid replacement in the antibody Fc zone.Alternatively or in addition, cysteine residues can be introduced into the Fc zone, thus allow formation interchain disulfide bond in this district.So the antibody homodimer of producing can have the internalization ability of improvement, and/or increases the cytotoxicity (ADCC) of the cell killing and the cell that antibody relies on of complement-mediated.See Caron et al., J.ExpMed.176:1191-1195 (1992) and Shopes, B.J.Immunol.148:2918-2922 (1992).Also can utilize the isodigeranyl functional cross-link agent preparation of describing as Wolff et al.Cancer Research 53:2560-2565 (1993) to have the antibody homodimer of enhanced anti-tumor activity.Perhaps, antibody can be made it have two Fc zones by transformation, and can have the dissolving and the ADCC ability of enhanced complement-mediated thus.See Stevenson et al.Anti-Cancer Drug Design 3:219-230 (1989).

Be to prolong the serum half-life of antibody, can add antibody (particularly antibody fragment),, describe in 277 for example at United States Patent (USP) 5,739 with remedying the receptors bind epi-position.As employed here, the epi-position in IgG molecule (for example IgG1, IgG2, IgG3, or IgG4) Fc zone " remedied the receptors bind epi-position " and refer in term, and it is responsible for prolonging serum half-life in the body of IgG molecule.

Other antibody modification

Also relate to other modification of antibody at this.For example, antibody can with a kind of connection the in the various non-protein polymers, polyoxyethylene glycol for example, polypropylene glycol, polyoxyalkylene, or the multipolymer of polyoxyethylene glycol and polypropylene glycol.Antibody also can be in colloid drug delivery system (for example liposome, albumin microsphere spherolite, microemulsion, nano particle and Nano capsule), perhaps in coarse emulsion, catch in microcapsule, described microcapsule are for example by condensation technique or interfacial polymerization preparation, for example, be Walocel MT 20.000PV or gelatin microcapsule and polyisobutene acid methyl esters microcapsule respectively.This technology is at Remington ' sPharmaceutical Sciences, 16th edition, and Oslo, A., Ed. discloses in (1980).

Screening has the antibody of desired characteristic

The antibody that can have some biological characteristics as the selection of describing among the experiment embodiment.

The growth inhibitory effect of anti-CD20 antibodies of the present invention can be assessed by methods known in the art, for example utilizes endogenous or express the cell of CD20 after with the CD20 gene transfection.For example, tumor cell line and CD20 cells transfected can be handled several days (for example, 2-7 days) in various concentration with anti-CD-20 monoclonal antibody of the present invention, dye with Viola crystallina or MTT, or analyze with other colorimetric assay.Another method of measuring propagation is that comparison is being handled cell with anti-CD20 antibodies existence of the present invention or not ³The picked-up of H-thymidine.After antibody treatment, harvested cell, and on scintillometer, measure radioactive amount of mixing DNA.Suitable comprises with the selected clone of the growth-inhibiting antibody treatment of known this cell line growth of inhibition over against shining.

For selecting the antibody of inducing cell death, can be with respect to the forfeiture of contrast assessment film integrality, the forfeiture of film integrality is absorbed indication with for example iodate third ingot (PI), Trypan Blue or 7AAD.PI picked-up test can be carried out under shortage complement and immune effector cell.The tumour cell of expressing CD20 separately and substratum hatch, perhaps hatch with the substratum of the suitable monoclonal antibody that comprises for example about 10 μ g/ml of concentration.Cell was hatched 3 days.After each the processing, wash cell, five equilibrium is gone into the 12x75 pipe (every pipe 1ml, every test group 3 pipes) of 35 millimeters band filter cap, to remove cell mass.Sample can be used FACSCAN ^TMFlow cytometer and FACSCONVERT ^TMCellQuest software (BectonDickinson) is analyzed.Determine that with the PI picked-up antibody of inducing statistics to go up the necrocytosis level of remarkable meaning can be chosen as the antibody of inducing cell death.

For screen with by the epi-position bonded antibody on the CD20 of purpose antibodies, can carry out the conventional hybridization blockade test, for example at antibodies, aLaboratory Manual, described in the Cold SpringHarbor Laboratory, Ed Harlow and David Lane (1988).This test can be used for judging whether tried antibody is combined on the identical site or epi-position with anti-CD20 antibodies of the present invention.Perhaps or in addition, can carry out epitope mapping with methods known in the art.For example, antibody sequence can for example carry out mutagenic treatment by L-Ala scanning, to differentiate contact residues.Test sudden change antibody is suitable folding to guarantee to the combination of polyclonal antibody at the beginning.In a different methods, corresponding to the peptide of CD20 different zones can be used on test antibody or with test antibody and have characterize or the competition experiments of the antibody of known epi-position in.

Carrier, host cell and recombination method

The present invention also provides coding humanization CD20 the isolating nucleic acid of binding antibody, comprises the carrier and the host of this nucleic acid, and the recombinant technology for preparing this antibody.

For the described antibody of preparation of recombinating, separate its coding nucleic acid and insert in the replicating vector so that further clone's (DNA amplification) or express.The DNA of encoding said antibody can separate and check order (for example use can specificity in conjunction with the oligonucleotide probe of the gene of encoding antibody heavy chain and light chain) at an easy rate with ordinary method.There is variety carrier to utilize.Carrier component generally includes but is not limited to one or more following component: signal sequence, replication orgin, one or more marker gene, enhancer element, promotor, and transcription termination sequence.

(i) signal sequence component

The CD20 binding antibody of the present invention generation of not only can directly recombinating, also can be used as the fusion polypeptide that merges with the heterologous polypeptide generation of recombinating, described heterologous polypeptide preferred signals sequence or other have the polypeptide of specificity cracking site on the N-terminal of maturation protein or polypeptide.The sequence of (promptly by the signal peptidase cracking) is preferably discerned and process to selected allos signal sequence by host cell.For the prokaryotic host cell that can not discern and process natural CD20 binding antibody signal sequence, signal sequence is selected from, for example, alkaline phosphatase, penicillinase, the prokaryotic organism signal sequence of 1pp or thermally-stabilised enterotoxin 1 I leader sequence replaces.In order to carry out yeast secretary, the natural signals sequence can be substituted by, for example, the yeast invertase leader sequence, alpha factor leader sequence (comprising sugar yeast (Saccharomyces) alpha factor leader sequence and kluyveromyces (Kluyveromyces) alpha factor leader sequence), or the acid phosphatase leader sequence, albicans glucoamylase leader sequence, or the signal of WO90/13646 description.In mammalian cell expression, the secretion leader sequence of mammalian signal sequence and virus can adopt as hsv gD signal.

The DNA of these prosomas and the DNA of coding CD20 binding antibody are connected in the reading frame.

(ii) replication orgin

Expression vector and cloning vector all comprise the nucleotide sequence that this carrier is duplicated in one or more selected host cell.Generally speaking, in cloning vector, this sequence is can make this carrier be independent of host chromosome DNA and the sequence of duplicating, and comprises replication orgin or autonomously replicating sequence.Such sequence all is well-known in various bacteriums, yeast and virus.The replication orgin of plasmid pBR322 is fit to most of gram negative bacteriums, and 2 μ plasmid starting points are fit to yeast, and multiple viral starting point (SV40, polyomavirus (Polyoma), adenovirus, VSV or BPV) can be used for the cloning vector in the mammalian cell.The replication orgin component generally is not mammalian expression vector necessary (use of SV40 starting point mostly just is because it comprises early promoter).

(iii) select gene element

Expression vector and cloning vector can comprise the selection gene, also claim selective marker.The typical albumen of selecting genes encoding to have following character: (a) give microbiotic or other toxin (as penbritin, Xin Meisu, methotrexate or tsiklomitsin) resistance, (b) remedy auxotrophy, or the crucial nutrition that (c) provides complex medium not supply with, the gene of genus bacillus (Bacilli) the D-alanine racemase of for example encoding.

An example of selection scheme is the growth that utilizes drug limits (arrest) host cell.Those are produced by heterologous gene success cell transformed and give the albumen of drug resistance, thereby survive in this selection environment.The example that this dominance is selected adopts medicine Xin Meisu, mycophenolic acid and Totomycin.

Another the routine selective marker that is suitable for mammalian cell is allow to identify those of the cell that can absorb described antibody nucleic acid, as DHFR, and thymidine kinase, metallothionein(MT)-I type and-the II type, preferred primates metallothionein gene, adenosine deaminase, ornithine decarboxylase etc.

For example, after cell is selected gene transformation by DHFR, all transformant are cultivated in the substratum that comprises methotrexate (Mtx is a kind of state of conflict antagonist of DHFR), come identification of cell earlier.When adopting wild-type DHFR, proper host cell is active defective Chinese hamster ovary (CHO) clone of DHFR.

Perhaps, the be encoded dna sequence dna of CD20 binding antibody of host cell (the wild-type host who especially comprises endogenous DHFR), the wild-type dhfr protein, and after another kind of selective marker such as aminoglycoside 3 '-phosphotransferase (APH) conversion or the cotransformation, can select by culturing cell in containing at the substratum of the selective reagents of this selective marker such as aminoglycoside antibiotics (as kantlex, Xin Meisu or G418).Referring to United States Patent (USP) 4,965,199.

Be applicable to that the suitable selection gene of zymic is the trp1 gene (Stinchcomb etc., Nature, 282:39 (1979)) that is present among the yeast plasmid YRp7.The trp1 gene provides selective marker (Jones, Genetics, 85:12 (1977)) for the yeast mutant (for example ATCC 44076 or PEP4-1) that can not grow in tryptophane.After this, the existence of trp1 damage provides by growth in the condition that lacks tryptophane and has detected the effective environment that transforms in the yeast host cell genome.Similarly, Leu2-defective yeast bacterial strain (ATCC 20,622 or 38,626) can be come complementary by the known plasmid that carries the Leu2 gene.

In addition, the carrier that is derived from 1.6 μ m cyclic plasmid pKDl can be used to transform kluyveromyces (Kluyveromyces).Alternatively, Van den Berg, Bio/Technology, 8:135 (1990) have reported a kind of expression system that is used at newborn kluyveromyces (K.lactis) mass preparation reorganization calf chymosin.The somebody discloses stable, the multiple copied expression vector that is used for secreting by the kluyveromyces industrial strain ripe recombination human serum albumin.Fleer etc., Bio/Technology, 9:968-975 (1991).

(iv) promotor component

Expression vector and cloning vector comprise the promotor that can be discerned by host living beings usually, and it can be operated with the nucleic acid of described coding CD20 binding antibody and link to each other.The promotor that is applicable to prokaryotic hosts comprises the phoA promotor, β-Nei Xiananmei and lactose promoter systems, alkaline phosphatase, tryptophane (trp) promoter systems, and heterozygosis (hybrid) promotor such as tac promotor.But other known bacterium promotor also is suitable.The promotor that is applicable to bacterial system can also comprise with the DNA of coding CD20 binding antibody can operate Shine-Dalgarno (S.D.) sequence that links to each other.

Eukaryotic promoter sequence is known.Nearly all eukaryotic gene has the AT-enrichment region at the about 25-30 in a transcripting start point upstream base place.A lot of genes have another kind of sequence at 70-80 base place, its transcripting start point upstream: the CNCAAT district, wherein N can be any Nucleotide.3 ' end of most of eukaryotic genes is AATAAA sequences, and it can be used as a kind of signal and is used for adding the poly-A tail to encoding sequence 3 ' end.All these sequences all are suitable for inserting in the carrier for expression of eukaryon.

The example that is applicable to the promoter sequence of yeast host comprises: the promotor of glycerol 3-phosphate acid kinase or other glycolytic ferment, described other glycolytic ferment such as Hydratase, phosphoenolpyruvate, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvic carboxylase, phosphofructokinase, glucose-6 phosphoric acid isomerase, glycerol 3-phosphate mutase, pyruvate kinase, triosephosphate isomerase, glucose phosphate isomerase and glucokinase.

Other Yeast promoter, be those inducible promoters that have the advantage of transcribing in addition by growth conditions control, be the promoter region of following gene: alcoholdehydrogenase 2, different cell pigment C (isocytochromeC), acid phosphatase, degrading enzyme, metallothionein(MT), the glyceraldehyde-3-phosphate dehydrogenase relevant, and the enzyme of responsible maltose and galactose utilization with nitrogen metabolism.The carrier and the promotor that are applicable to yeast expression in EP 73,657, have been further described.It also is favourable that yeast enhanser and Yeast promoter are united use.

In mammalian host cell, transcribing the CD20 binding antibody from carrier is to be subjected to, promoter regulation for example, described promotor is from viral genome, as polyoma virus, bird pox virus (fowlpoxvirus), adenovirus (as adenovirus 2), bovine papilloma virus, avian sarcomata virus, cytomegalovirus, retrovirus, hepatitis B virus, the promotor of simian virus 40 (SV40) most preferably, from the mammiferous promotor of allos, as actin promoter or immunoglobulin promoter etc., from the heat-shocked promotor, prerequisite is that these promotors are compatible with host cell systems.

Early stage and the late promoter of SV40 virus can be used as the SV40 restriction fragment that also comprises SV40 virus replication starting point and obtains easily.The immediate early promoter of human cytomegalic inclusion disease virus can be used as Hind III E restriction fragment and obtains easily.United States Patent (USP) 4,419 discloses the system that comes expressible dna in mammalian hosts with bovine papilloma virus as carrier in 446.United States Patent (USP) 4,601 has been narrated in 978 this system has been improved.Other sees Reyes etc., Nature, 297:598-601 (1982) about under herpes simplex virus thymidine kinase promotor control in mouse cell expressing human interferon-cDNA.Alternatively, can be with the Rous sarcoma virus long terminal repeat as promotor.

(v) enhancer element component

DNA usually the transcribing in higher eucaryote of code book invention CD20 binding antibody increases by enhancer sequence is inserted in the carrier.The enhancer sequence of present known a lot of mammalian genes (sphaeroprotein, elastoser, albumin, alpha-fetoprotein and Regular Insulin).But use the enhanser of eukaryotic cell virus usually.Example is included in the SV40 enhanser (bp100-270) of replication origin side in late period, and the sub-enhanser of cytomegalovirus early promoter is at the polyoma enhanser and the adenovirus enhanser of replication origin side in late period.Also can be referring to Yaniv, Nature, the described enhancing element that is used to activate eukaryotic promoter of 297:17-18 (1982).Enhanser can montage insert 5 ' or 3 ' side of antibody coding sequence in the carrier, but is preferably placed at 5 ' side of promotor.

(vi) Transcription Termination component

Be used for the expression vector of eukaryotic host cell (yeast, fungi, insect, plant, animal, people or from the karyocyte of other multicellular organism), can also comprise Transcription Termination and mRNA are stablized necessary sequence.These sequences are usually from eukaryotic cell or the DNA of virus or 5 ' (being 3 ' once in a while) non-translational region of cDNA.These zones comprise the segmental nucleotide fragments of polyadenylation in the non-translational region of mRNA that is transcribed into the coding multivalent antibody.A kind of effective Transcription Termination component is Trobest polyadenylation district.Referring to WO94/11026 and expression vector disclosed herein.

(vii) select and transformed host cell

Clone or express the suitable host cell of the DNA in the carrier described herein, comprise above-mentioned prokaryotic organism, yeast or higher eucaryotic cells.The prokaryotic organism that are suitable for this purpose comprise eubacterium, as Gram-negative or gram positive bacterium, enterobacteriaceae (Enterobacteriaceae) for example, as Escherichia (Escherichia), for example, intestinal bacteria (E.coli), enterobacter (Enterobacter), Erwinia (Erwinia), Klebsiella (Klebsiella), the mycetozoan bar belongs to (Proteus), Salmonella (Salmonella) (as Salmonella typhimurtum (Salmonellatyphimurium)), Serratia (Serratia) (as serratia marcesens (Serratiamarcescans)) and Shigella (Shigella) etc., and bacillus (Bacilli) is as subtilis (B.subtilis) and Bacillus licheniformis (the B.licheniformis) (DD 266 that published on April 12nd, 1989 for example, the 41P of Bacillus licheniformis described in 710) etc., Rhodopseudomonas (Pseudomonas) is as pseudomonas bacteria pseudomonas (P.aeruginosa), and streptomycete (Streptomyces).Preferred escherichia coli cloning host is intestinal bacteria 294 (ATCC 31,446), but other bacterial strain, as intestinal bacteria B, intestinal bacteria X1776 (ATCC 31,537) and intestinal bacteria W3110 (ATCC 27,325) they also are suitable.These examples are to be used for explanation, and unrestricted.

Full length antibody, antibody fragment and antibody fusion protein can produce in bacterium, particularly when not needing glycosylation and Fc effector function, for example when the treatment antibody coupling when cell toxicant medicament (for example toxin) and immune conjugate self are presented at the effectiveness of destroying on the tumour cell.Full length antibody has the longer transformation period in circulation.Production is faster and has more cost-efficient in intestinal bacteria.The expression in bacterium for antibody fragment and polypeptide, see for example United States Patent (USP) 5,648,237 (Carter et.al.), United States Patent (USP) 5,789,199 (Joly et al.) are with United States Patent (USP) 5,840,523 (Simmons et al.) have wherein described to be used for optimized expression and excretory translation initiation region (TIR) and signal sequence, and these patents are hereby incorporated by.After expressing, antibody separates in soluble constituent from the Bacillus coli cells pasty mixture, and depends on isotype, can be by for example albumin A or G column purification.Final purification can carry out with the program that is similar to the antibody that purifying expresses in Chinese hamster ovary celI.

Except prokaryotic organism, eukaryotic microorganisms such as filamentous fungus or yeast also are to be suitable for encoding the clone or the expressive host of carrier of CD20 binding antibody.Yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) or common bread yeast are the most frequently used eucaryon host microorganisms such as low.Also have a plurality of other genus, kind and strain to have supply of commodities, and can be used for the present invention, for example schizosaccharomyces pombe (Schizosaccharomycespombe); Genus kluyveromyces (Kluyveromyces) host, for example newborn kluyveromyces (K.lactis), (ATCC 12 for Kluyveromyces fragilis (K.fragilis), 424), (ATCC 16 for Bulgaria's kluyveromyces (K.bulgaricus), 045), (ATCC 24 for Brunswick Man kluyveromyces (K.wickeramii), 178), (ATCC 56 for K.waltii, 500), fruit bat kluyveromyces (Kdrosophilarum) (ATCC 36,906), heat-resisting kluyveromyces (K.thermotolerans) and Marx's Crewe Vickers yeast (K.marxianus) etc.; The West alpine yarrow mould (yarrowia) (EP 402,226); Pichia pastoris phaff (pichia pastoris) (EP 183,070); Candida (Candida); Trichodermareesia (EP 244,234); Neurospora crassa (Neurospora crassa); Permitted Wang Shi yeast belong (schwanniomyces) and permitted Wang Shi yeast (schwanniomyces occidentalis) etc. as the west; And filamentous fungus, for example neurospora (Neurospora), Penicillium (Penicillium), Tolypocladium and Aspergillus host such as Aspergillus nidulans (A.nidulans) and aspergillus niger (A.niger) etc.

Be suitable for expressing the host cell of glycosylation CD20 binding antibody from multicellular organism.The example of invertebral zooblast comprises plant and insect cell.At present from following host, identified a large amount of baculovirus strains and variant and allowed the type insect host cell accordingly: fall army worm (Spodoptera Frugiperda, caterpillar), Aedes aegypti (Aedes aegypti, mosquito), Aedes albopictus (Aedes albopictus, mosquito), Drosophila melanogaster (fruit bat) and bombyx mori (Bombyxmori) etc.The various virus strain that are used for transfection can obtain publicly, the for example L-1 variant of California Y level noctuid (Autographac alifornia) NPV and the Bm-5 strain of bombyx mori NPV, and these viruses can be at this as virus of the present invention, in particular for transfection fall army worm cell.

The plant cell cultures of cotton (cotton), corn (corn), potato (potato), soybean (soybean), petunia (petunia), tomato (tomato) and tobacco (tobacco) also can be used as the host.

Yet paying close attention to maximum is vertebrate cells, and breeds vertebrate cells become ordinary method in cultivating (tissue culture).Effectively the example of mammalian host cell line is the monkey kidney CV1 clone (COS-7, ATCC CRL 1651) that transforms with SV40; Human embryonic kidney cell line (293 cells or 293 cells, Graham etc., J.Gen Virol.36:59 (1977)) through in suspension culture, growing after cloning again; Hamster children hamster kidney cell (BHK, ATCC CCL 10); Chinese hamster ovary cell/-DHFR (CHO, Urlaub etc., Proc.Natl.Acad.Sci.U.S.A.77:4216 (1980)); Mouse podocyte (TM4, Mather, Biol.Reprod.23:243-251 (1980)); Monkey-kidney cells (CV1 ATCCCCL 70); African green monkey kidney cell (VERO-76, ATCC CRL-1587); Human cervical carcinoma cell (HELA, ATCC CCL 2); Madin-Darby canine kidney(cell line) (MDCK ATCC CCL 34); Buffalo (buffalo) rat hepatocytes (BRL 3A, ATCC CRL 1442); Human pneumonocyte (W138, ATCC CCL 75); Human liver cell (Hep G2, HB 8065); Mouse mammary tumor (MMT 060562, ATCC CCL 51); TRI cell (Mather etc., Annals N.Y.Acad.Sci.383:44-68 (1982)); MRC 5 cells; The FS4 cell; And human hepatocellular carcinoma cell line (Hep G2).

Host cell transforms with above-mentioned expression or the cloning vector that is used to prepare the CD20 binding antibody, and cultivates on modified version tradition nutritional medium, and described substratum is through improving the gene that has been suitable for evoked promoter, screening transformant or the required sequence of amplification coding.

(viii) cultivate host cell

The host cell that is used for producing CD20 binding antibody of the present invention can be cultivated at various substratum.Commercially available substratum such as Ham ' s F10 (Sigma), ((MEM), Sigma), ((DMEM) Sigma) all is suitable for cultivating described host cell to minimum essential medium for RPMI-1640 (Sigma) and Dulbecco improvement Eagle substratum.In addition, Ham et al., Meth.Enz.58:44 (1979), Barnes et al., Anal.Biochem.102:255 (1980), U.S.Pat.Nos.4,767,704; 4,657,866; 4,927,762; 4,560,655; Or 5,122, and 469; WO 90/03430; WO 87/00195; Or U.S.Patent Re.30,985 described any substratum also can be used as the host cell substratum.Any above-mentioned substratum can add hormone and/or other somatomedin (as Regular Insulin, transferrin, or Urogastron) as required, and salt is (as sodium-chlor, calcium, magnesium, and phosphoric acid salt), damping fluid (as HEPES), Nucleotide (as adenosine and thymidine), microbiotic is (as Gentamycin ^TM), trace elements (being defined as the common mineral compound that occurs with the final concentration of micromole's level) and the glucose or the equivalent energy.Can also comprise proper concn well known by persons skilled in the art any other must additive.Culture condition, as temperature, pH etc. are those that used on selected expressive host, and also are conspicuous to those skilled in the art.

(ix) antibody purification

When using recombinant technology, described antibody can be created in the cell, and in periplasmic space, or direct secretion is in substratum.If described antibody is to be created in the cell, at first to remove particulate state residue (for host cell or cracked fragment) by for example centrifugal or Ultrafiltration.Carter et al., Bio/Technology10:163-167 (1992) have described a kind of isolating method of antibody that will be secreted in the colibacillus periplasm space.In brief, sodium acetate (pH3.5) is being arranged, EDTA, and under the situation of phenylmethylsulfonyl fluoride (PMSF) existence cell mass was thawed about 30 minutes.Cell debris can be removed by centrifugal., to the situation of substratum, at first use such as commercially available albumen such as Amicon or MilliporePellicon ultra filtration unit usually and concentrate the supernatant that filter concentrates this class expression system at antibody-secreting.Can comprise proteinase inhibitor such as PMSF in above-mentioned arbitrary step, so that the arrestin hydrolysis can also comprise microbiotic, so that prevent the growth of external contaminant (adventitious contaminant).

Can utilize from the antibody compositions of described cell preparation, for example, method purifying such as hydroxyapatite chromatography, gel electrophoresis, dialysis and affinity chromatography, preferred affinitive layer purification technology.Albumin A depends on the kind and the isotype of any immunoglobulin fc region that exists in the described antibody as the suitability of affinity ligand.Albumin A can be used for purifying based on people γ 1, the antibody of γ 2 or γ 4 heavy chains (Lindmarketal., J.Immunol.Meth.62:1-13 (1983)).Protein G is proposed to be used in all mouse isotypes and is used for people γ 3 (Guss et al., EMBO is (1986) J.5:15671575).The matrix that affinity ligand adheres to is the most normal to be agarose, also can adopt other matrix.The matrix of mechanically stable is for example controlled the glass (controlled pore glass) or poly-(benzene divinyl) benzene (poly (styrenedivinyl) benzene) in aperture and is compared with agarose, and its flow velocity is faster and the treatment time is shorter.When antibody comprises C _HDuring 3 districts, can use Bakerbond ABX ^TMResin (J.T.Baker, Phillipsburg, NJ) purifying.Other protein purification technology, ion exchange column fractional separation for example, ethanol sedimentation, reversed-phase HPLC, silicon layer is analysed, heparin SEPHAROSE ^TMChromatography, positively charged ion or anionite-exchange resin (for example poly aspartic acid post) chromatography, chromatofocusing, SDS-PAGE and ammonium sulfate precipitation also can adopt, and this depends on the antibody that is reclaimed.

After any preliminary purification step, between the about 2.5-4.5 of pH, utilize elution buffer that the mixture that comprises purpose antibody and pollutent is hanged down the pH hydrophobic interaction chromatography, preferably under low salt concn, carry out (for example about 0-0.25M salt).

Antibody coupling matter

Antibody can be coupled to cytotoxic agent for example toxin or radio isotope.In some embodiments, toxin is that calicheamicin, maytansinoid, dolastatin, auristatin E and its analogue or derivative are preferred.

Preferred medicine/toxin comprises dna damage agent, microtubule polymerization or separates polygalacturonase inhibitor and metabolic antagonist.The preferred classes of cell toxicant medicament comprises, for example, enzyme inhibitors is dihydrofolate reductase inhibitor for example, with the thymidylate synthase inhibitor, the DNA intercalator, dna cleavage agent, topoisomerase enzyme inhibitor, anthracene nucleus class antibiosis family medicine, Vinca medicine, mitomycin element, bleomycin, cell toxicant nucleosides, talk endlessly pyridine family medicine, diynenes, podophyllotoxin and differentiation inductor.

The useful especially member of these classifications comprises, for example, methotrexate, Rheumatrex, the dichloro methotrexate, 5 FU 5 fluorouracil, Ismipur, cytosine arabinoside, melphalan, leurosine, inrosidine, actinomycin, daunorubicin, Zorubicin, N-(5,5-two vinegar oxygen amyl groups) Zorubicin, the morpholino Zorubicin, 1-(2-chloroethyl)-1,2-two spermidine methylsulfonyl hydrazides, N8-ethanoyl spermidine, the aminopterin Rheumatrex, esperamicin, ametycin, Mitomycin A, actinomycin, bleomycin, carminomycin, aminopterin, tallysomycin, podophyllotoxin and podophyllotoxin derivative be etoposide or etoposide phosphoric acid salt for example, vinealeucoblastine(VLB), vincristine(VCR), desacetyl vinblastine amide, taxol, taxotere, vitamin A acid, butyric acid, N8-ethanoyl spermidine, camptothecine, calicheamicin, bryostatin, cephalostatins, ansamitocin, Sodium dibutyryl cAMP, maytansinoids is DM-1 for example, maytenin, maytansinol, N-demethyl-4,5-removes the epoxy group(ing) maytansinol, C-19-dechlorination maytansinol, C-20-hydroxyl maytansinol, C-20-de-methoxy maytansinol, the C-9-SH maytansinol, C-14-alkoxy methyl maytansinol, C-14-hydroxyl or acetyl-o-methyl maytansinol, C-15-hydroxyl/acetyl oxygen maytansinol, C-15-methoxyl group maytansinol, C-18-N-demethyl maytansinol and 4,5-deoxidation maytansinol, auristatins is auristatinE for example, M, PHE and PE; Dolostatins is dolostatin A for example, dolostatin B, dolostatin C, dolostatin D, dolostatin E, (20-epi and 11-epi), dolostatin G, dolostatin H, dolostatin I, dolostatin 1, dolostatin 2, dolostatin 3, dolostatin 4, dolostatin 5, dolostatin 6, dolostatin 7, dolostatin 8, dolostatin 9, dolostatin 10, deo-dolostatin10, dolostatin 11, dolostatin 12, dolostatin 13, dolostatin 14, dolostatin 15, dolostatin 16, dolostatin 17, with dolostatin 18; Cephalostatins is cephalostatin1 for example, cephalostatin 2, cephalostatin 3, cephalostatin 4, cephalostatin 5, cephalostatin6, cephalostatin 7,25 '-epi-cephalostatin 7,20-epi-cephalostatin 7, cephalostatin8, cephalostatin 9, cephalostatin 10, cephalostatin 11, cephalostatin 12, cephalostatin 13, cephalostatin 14, cephalostatin 15, cephalostatin 16, cephalostatin 17, cephalostatin 18, with cephalostatin 19.

Maytansinoids is a mitotic inhibitor, works by suppressing tubulin polymerization.Maytenin is separated (United States Patent (USP) 3,896,111) from East Africa shrub tingia Caulis Mayteni at first.Subsequently, it is found that certain micro-organisms also produces maytansinoids, for example maytansinol and C-3 maytansinol ester (United States Patent (USP) 4,151,042).In United States Patent (USP) 4,137,230; 4,248,870; 4,256,746; 4,260,608; 4,265,814; 4,294,757; 4,307,016; 4,308,268; 4,308,269; 4,309,428; 4,313,946; 4,315,929; 4317,821; 4,322,348; 4,331,598; 4,361,650; 4,364,866; 4,424,219; 4,450,254; 4,362,663; With 4,371, disclosed synthetic maytansinol and its derivative and analogue in 533, be incorporated herein by reference especially at this.

Maytenin and maytansinoids with specifically with tumor-cell antigen bonded antibody coupling.The immune conjugate and the therepic use thereof that comprise maytansinoids are for example disclosing among United States Patent (USP) 5,208,020,5,416,064 and the European patent EP 0425235B1, and it is disclosed in this and is incorporated herein by reference especially.Liu et al., Proc.Natl.Acad.Sci.USA 93:8618-8623 (1996) have described and have comprised the maytansinoid that is appointed as DM1, and this maytansinoid is connected with monoclonal antibody C242 at human colorectal cancer disease.Conjugate is found has the height cytotoxicity to the colon cancer cell of cultivating, and shows anti-tumor activity in the tumor growth test in vivo.Chari et al.Cancer Research52:127-131 (1992) has described immune conjugate, wherein maytansinoid is by disulfide linkage joint and murine antibody A7 coupling, this murine antibody A7 combines with antigen on the CCL188, perhaps maytansinoid is coupled to another mouse monoclonal antibody TA.1, and this antibody combines with the HER-2/neu oncogene.

Many linking groups known in the art are used to prepare antibody maytansinoid conjugate, comprise, for example, and at United States Patent (USP) 5,208,020 or EP patent 0425235B1, with disclosed in the Chari et al.CancerResearch 52:127-131 (1992).Linking group comprises disulphide group disclosed in above-mentioned patent, sulfide group, the group of acid labile, photosensitive group, to the group of peptase sensitivity or to the group of esterase sensitivity, preferred disulphide and sulfide group.

Can use various bifunctional protein coupling agents to prepare the conjugate of antibody and maytansinoid; N-succinimido-3-(2-pyridyl dimercapto) propionic salt (SPDP) for example; succinimido-4-(N-maleimide methyl) hexanaphthene-1-carboxylate salt; iminothiolane (IT); the dual-function derivative of imido-ester (for example dimethyl hexanedioyl polyurethane HCL); active ester (for example two succinimido suberates); aldehyde (for example glutaraldehyde); diazide (for example two-(p-azido benzoyl base) diamines); two diazo compound derivatives (for example two-(p-diazobenzene formyl radical)-quadrol); (for example toluene 2 for diisocyanate; the 6-diisocyanate); with two-active fluorine cpd (for example 1; 5-two fluoro-2, the 4-dinitrobenzene).Particularly preferred coupling agent comprises N-succinimido-3-(2-pyridyl dimercapto) propionic salt (SPDP) (Carlsson et al., Biochem.J.173:723-737[1978]) and N-succinimido-4-(2-pyridyl sulfydryl) valerate (SPP), so that disulfide linkage to be provided.

Depend on connection type, joint can be attached to each position of maytansinoid molecule.For example, utilize conventional coupling technology, can form ester bond with hydroxyl reaction.Reaction can occur in the C-3 position of hydroxyl, and C-14 modifies with methylol the position, C-15 position hydroxyl modified, and the C-20 position has hydroxyl.In a preferred embodiment, form connection in the C-3 position of maytansinol or maytansinol analogue

Calicheamicin

Another interested immune conjugate comprises the CD20 binding antibody that is coupled to one or more calicheamicin molecule.The calicheamicin family antibiotic can produce the double-stranded DNA fracture below picomole concentration.The conjugate of preparation calicheamicin family is referring to United States Patent (USP) 5,712,374,5,714,586,5,739,116,5,767285,5,770,701,5,770,710,5,773,001,5,877,296 (all belonging to American Cyanamid Company).The analog of the calicheamicin that can be used includes, but are not limited to, and γ 1 ^I, α 2 ^I, α 3 ^I, N-ethanoyl γ 1 ^I, PSAG and 2 ^I1 (Hinman et al.CancerResearch 53:3336-3342 (1993), Lode et al.Cancer Research 58:2925-2928 (1998) and the aforementioned United States Patent (USP) that belongs to American Cyanamid).Another antitumor drug that can be coupled to antibody is QFA, and it is an antifolate.Calicheamicin and QFA all have action site in the born of the same parents, and are not easy to cross plasma membrane.Therefore, the cellular uptake by antibody-mediated these medicaments that internalization caused strengthens their cytotoxic effect greatly.

Radio isotope

Antibody can comprise the height radioactive atom with the selective destruction tumour.Existing various radio isotope are used for production radioactivity link coupled anti-CD20 antibodies.Example comprises At ²¹¹, I ¹³¹, I ¹²⁵, Y ⁹⁰, Re ¹⁸⁶, Re ¹⁸⁸, Sm ¹⁵³, Bi ²¹², P ³², ^Pb212Radio isotope with Lu.When conjugate was used to diagnose, it can comprise radioactive atom and be used for scintillation method research, for example tc ^99mOr I ¹²³, or comprise spin label be used for nucleus magnetic resonance (NMR) imaging (have another name called magnetic resonance imaging MRI, mri), still iodo-123 for example, iodine-131, indium-111, fluoro-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.

Radioactivity or other mark can mix conjugate in a known way.For example, peptide can biosynthesizing maybe can utilize suitable amino acid precursor to synthesize via chemical amino acid is synthetic, and chemical amino acid synthesizes to relate to for example uses fluoro-19 to replace hydrogen.Mark is tc for example ^99mOr I ¹²³, Re ¹⁸⁶, Re ¹⁸⁸With In ¹¹¹Can adhere to by the cysteine residues in the peptide.Yttrium-90 can adhere to by lysine residue.IODOGEN method (Fraker et al (1978) Biochem.Biophys.Res.Commun.80:49-57) can be used for mixing iodo-123." Monoclonal Antibodies in Immunoscintigraphy " (Chatal, CRC Press1989) describes other method in detail.

Can use various bifunctional protein coupling agents to prepare the conjugate of antibody and cytotoxic agent; N-succinimido-3-(2-pyridyl dimercapto) propionic salt (SPDP) for example; succinimido-4-(N-maleimide methyl) hexanaphthene-1-carboxylate salt; iminothiolane (IT); the dual-function derivative of imido-ester (for example dimethyl hexanedioyl polyurethane HCL); active ester (for example two succinimido suberates); aldehyde (for example glutaraldehyde); diazide (for example two-(p-azido benzoyl base) diamines); two diazo compound derivatives (for example two-(p-diazobenzene formyl radical)-quadrol); (for example toluene 2 for diisocyanate; the 6-diisocyanate); with two-active fluorine cpd (for example 1; 5-two fluoro-2, the 4-dinitrobenzene).For example, can preparation ricin immunotoxin be described as Vitetta et al.Science 238:1098 (1987).The 1-isothiocyanic acid benzyl of carbon-14-mark-3-methyl divinyl-pentaacetic acid (MX-DTPA) is exemplary sequestrant, is used for the radioactive nuleus thuja acid is bonded to antibody.See WO94/11026.Joint can be " joint that can rupture ", to promote the release of cytotoxic drug in cell.For example, can use the joint of sour unsettled joint, peptase sensitivity, light activated joint, dimethyl joint or comprise joint (the Chari et al.Cancer Research 52:127-131 (1992) of disulphide; United States Patent (USP) 5,208,020).

The therepic use of CD20 binding antibody

CD20 binding antibody of the present invention can be used for treating multiple pernicious and nonmalignant disease, comprises autoimmune disease and associated conditions, with the positive cancer of CD20, comprises B cell lymphoma and leukemia.Stem cell in the marrow (B cell ancestors) lacks CD20 antigen, allows healthy B cell to regenerate after treatment, and return back to normal level within some months.

Autoimmune disease or autoimmunization associated conditions comprise sacroiliitis (rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis), psoriasis, and dermatitis comprises atopic dermatitis; Chronic autoimmunization urticaria, polymyositis/dermatomyositis, the toxic epidermal necrolysis, systemic scleroderma/sclerosis, with relevant the replying of inflammatory bowel disease (inflammatory bowel disease (IBD)) (Crobn ' the s disease, ulcerative colitis), respiratory distress syndrome, adult respiratory distress syndrome, meningitis, allergic rhinitis, encephalitis, uveitis, colitis, glomerulonephritis, the supersensitivity illness, eczema, asthma, illness that the T cellular infiltration is relevant and chronic inflammatory reaction, atherosclerosis, autoimmune myocarditis, leukocyte adhesion deficiency, systemic lupus erythematous (SLE), lupus (comprises the ephritis type, non-kidney type, dish-type, the alopecia type), the diabetes (juvenile onset diabetes) of juvenile outbreak, multiple sclerosis, allergic encephalitis, cytokine and the T cell mediated and the acute immune response relevant with delayed type allergy, pulmonary tuberculosis, sarcoidosis, granulomatosis comprises wegner's granulomatosis, granulopenia, vasculitis, aplastic anemia, the positive anaemia of Ku Musishi, wear cloth Er Shi anaemia, immune hemolytic anemia comprises autoimmune hemolytic anemia (AIHA), pernicious anemia, pure red cell underdevelopment (PRCA), blood coagulation factor VIII lacks, hemophilia A, the autoimmunity neutrophilic leukocyte reduces, pancytopenia, leukopenia, relate to the diapedetic disease of white corpuscle, the disorder of CNS inflammatory, multiple organ injury's syndromes, myasthenia gravis, the disease of immune complex mediation, anti-GBM disease, anti-phospholipid antibody syndromes, the supersensitivity neuritis, the Bechet disease, Castleman syndromes, the thorough syndrome of Gourde(G) Paasche, Lan-Yi Er Shi myasthenic syndrome, the Reynolds syndrome, this Jaeger logical sequence syndrome, Si-Yue two syndromes, solid organ transplantation repels and (comprises the pre-treatment to high-order reactive antibody titre, IgA is in tissue deposition, or the like), graft versus host disease (GVH disease) (GV _HD), pemphigus sample bleb, pemphigus is (all, comprise ordinary, foliate), autoimmune polyendocrine disease, the Lai Teershi disease (Reiter ' sdisease), stiff people's syndromes, giant cell arteritis, immune complex nephritis, IgA nephropathy, the neuropathy of IgM polyneuropathy or IgM mediation, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), the autoimmunity thrombopenia, the autoimmune disease of testis and ovary comprises autoimmunity orchitis and ovaritis, primary hypothyroidism, autoimmune endocrine comprises autoimmune thyroiditis, chronic thyroiditis (struma lymphomatosa), subacute thyroiditis, spontaneous thyroprivia, Addison's disease, Graves' disease, autoimmune polyadenous syndromes (or polyadenous incretopathy syndromes), type i diabetes is also referred to as insulin-dependent diabetes (IDDM) and Sheehan syndrome, autoimmune hepatitis, matter pneumonia (HIV) between lymphoglandula, bronchiolitis obliterans (Nonimplantation) and NSIP, Ge-Ba two syndromes, great vessels vasculitis (comprising polymyalgia rheumatica and giant cells (high iS-One) arteritis), medium blood vessel vasculitis (comprising mucocutaneous lymphnode syndrome and polyarteritis nodosa), ankylosing spondylitis, Bel's lattice Er Shi disease (IgA nephropathy), the glomerulonephritis of rapid progress, primary biliary cirrhosis, Celiac sprue (baregin enteropathy), cryoglobulinemia, ALS, coronary artery disease.

CD20 is positive, and cancer is the cancer of the abnormality proliferation of those cells that are included in cell surface expression CD20.The positive B cell tumour of CD20 comprises the positive Hokdkin disease of CD20, comprises the dominant Hokdkin disease of lymphocyte (LPHD); Non_hodgkin lymphoma (NHL); FCC (FCC) lymphoma; Acute lymphoblastic leukemia (ALL); Lymphocytic leukemia (CLL); Hairy cell leukemia.Rudimentary/follicular non Hodgkin lymphoma (NHL) that non_hodgkin lymphoma comprises, small lymphocytic lymphoma (SLL), medium/folliculus NHL, medium diffusion NHL, senior immunoblastic (high grade immuoblastic) NHL, senior lymphoblastic NHL, senior little non-cleaved cell (high grade small non-cleaved cell) NHL, bulky disease NHL, the Plasmacytoid lymphocytic lymphoma, lymphoma mantle cell, lymphoma and Walden Si Telunshi macroglobulinemia that AIDS is relevant.Also relate to the treatment of these cancer returns.LPHD is a class Hokdkin disease, although with radiation or still often recurrence of tendency of chemotherapy treatment, it is characterized in that CD20 male malignant cell.CLL is one of leukemia of four kinds of main types.As the cancer that is called lymphocytic mature B cell, CLL shows as the carrying out property accumulation of cell in blood, marrow and Lymphoid tissue.

In concrete embodiment, humanization CD20 binding antibody and its functional fragment are used to treat non_hodgkin lymphoma (NHL), the dominant Hokdkin disease of lymphocyte (LPHD), small lymphocytic lymphoma (SLL), lymphocytic leukemia, rheumatoid arthritis and juvenile rheumatoid arthritis, systemic lupus erythematous (SLE) comprises lupus nephritis, wegner's disease, inflammatory bowel, idiopathic thrombocytopenic purpura (ITP), thrombotic thrombocytopenic purpura (TTP), the autoimmunity thrombopenia, multiple sclerosis, psoriasis, IgA nephropathy, the IgM polyneuropathy, myasthenia gravis, vasculitis, diabetes, Raynand's disease, this Jaeger logical sequence syndrome and glomerulonephritis.

It is right that humanization CD20 binding antibody or its functional fragment can be used on, and for example, in the single pharmaceutical treatment of the positive B cell of the rudimentary or folliculus CD20 of recurrence or refractory NHL, perhaps can unite the administration to patient with other medicines in multiple pharmacotherapy.

Painless lymphoma is a disease that slowly increases, can not cure, and wherein general patient was survived between six to ten years, experienced a plurality of remissions and recurrence period.In one embodiment, humanization CD20 binding antibody or its functional fragment are used to treat painless NHL.

The parameter of assessment oncotherapy effectiveness or achievement is known for the doctor that this appropriate disease is familiar with.Usually, skilled practitioners will attempt to reduce the S﹠S of this specified disease.Parameter can comprise that intermediate value time, paresthesia alleviateding time and the state of an illness that disease carries out are steady.

Below with reference to document description lymphoma and CLL, its diagnosis, treat and be used to measure the SMP that treatment is renderd a service.Canellos GP, Lister, TA, Sklar JL:The Lymphomas.W.B.Saunders Company, Philadelphia, 1998; Van Besien K and Cabanillas, F:Clinical Manifestations, Staging and Treatment of Non-Hodgkin ' s Lymphoma, the 70th chapter, pp 1293-1338 is at Hematology, Basic Principles and Practice, 3rd ed.Hoffman et al. (editors) .Churchill Livingstone, Philadelphia is in 2000; And Rai, Kand Patel, D:Chronic Lymphocytic Leukemia, the 72nd chapter, pp 1350-1362 is at Hematology, Basic Principles and Practice, 3rd ed.Hoffman et al. (editors) .Churchill Livingstone, Philadelphia, 2000.

Assessment treatment autoimmunization or autoimmunization relative disease render a service or the parameter of achievement for being known this skilled doctor in appropriate disease field.Usually, skilled practitioners will attempt to reduce the S﹠S of this specified disease.Below illustrate.

In one embodiment, antibody of the present invention is used for the treatment of rheumatoid arthritis.Rheumatoid arthritis is characterised in that multi-joint inflammation, cartilage loss and bone erosion, causes destruction of joint, and finally lowers function of joint.In addition, because RA is a general disease, it can organize for example lung, eye and marrow generation effect to other.RA can proceed routine work or life above among the patient in 10 years less than 50% trouble.

Antibody is treated use as first line among RA (promptly not using methotrexate (MTX) to treat) patient in early days, can be used as the single therapy drug use, perhaps uses with for example MTX or cyclophosphamide combined.Perhaps, antibody can use as the second line medicine in the patient of treatment DMARD and/or MTX refractory, can be used as the single therapy drug use, perhaps unites use with for example MTX.Humanization CD20 binding antibody prevention with control joint damage, delay structure deteriorate, useful in the pain that reduction is relevant with inflammation among the RA, and extremely seriously reduce S﹠S among the RA in moderate usually.Can be before the pharmacological agent that is used for the treatment of RA with other, afterwards or in the process with humanization CD20 Antybody therapy patient RA (combination therapy of face as follows).In one embodiment, previous once with antirheumatic treatment failure and/or to only treating with humanization CD20 binding antibody of the present invention with the hyporeactive patient of methotrexate for treatment with the effect of palliating a disease.In the embodiment of this treatment, patient is implemented 17 days treatment plan, wherein: only accept humanization CD20 binding antibody (at the 1st and the 15th day, 1g iv infusion); The CD20 binding antibody adds endoxan (at the 3rd and the 17th day, 750mg iv infusion); Perhaps the CD20 binding antibody adds methotrexate.

A method estimating RA treatment effectiveness is based on U.S. rheumatology institute (ACR) standard, and the per-cent that this canonical measure improves in joint tenderness and swelling is measured other content simultaneously.With do not use Antybody therapy (for example treatment before baseline) or compare with placebo treatment, patient RA can be by scoring, for example ACR20 (improving 20%).Estimate other approach that Antybody therapy renders a service and comprise the scoring of X line, for example SharpX line scoring, this scoring are used to for example bone erosion and the joint space scoring that narrows down of structure deteriorate.During treating or afterwards, also can health evaluating questionnaire [HAQ] scoring, AIMS scoring, SF36 be the basis, the prevention or the improvement of evaluation patient deformity.The ACR20 standard can be included in tenderness (pain) joint counting and go up improvement 20% with the swollen joint counting, adds that at least 3 are improved 20% in following 5 additional measurement standards:

With visual simulation yardstick (VAS) evaluating patient pain,

Patient is to the comprehensive assessment (VAS) of disease activity,

The doctor is to the comprehensive assessment (VAS) of disease activity

Patient by the health evaluating questionnaire to the self-assessment of deformity and

Acute phase reactant, CRP or ESR.

ACR50 and 70 defines similarly.Preferably, give the CD20 binding antibody of the present invention of patient's significant quantity, be ACR20 at least, ACR30 at least preferably, ACR50 at least more preferably, even ACR70 at least more preferably, preferably ACR75 and Geng Gao at least to reach scoring.

Psoriatic arthritis has unique and special radiograph feature.For psoriatic arthritis, the joint corrodes that narrow down also with the joint space can be with the Sharp assessment of keeping the score.Humanization CD20 binding antibody of the present invention can be used for preventing joint damage and reduces this disorderly disease S﹠S.

Another aspect of the invention is humanization CD20 binding antibody of the present invention, the method for treatment lupus or SLE by the patient treatment significant quantity of suffering from SLE.The SLEDAI scoring provides the numerical value of disease activity quantitative.SLEDAI is the weighted index of 24 known clinical and laboratory parameters relevant with disease activity, and numerical range is 0-103.See Bryan Gescuk ﹠amp; John Davis, " Noveltherapeutic agent for systemic lupus erythematosus " is at Current Opinion inRheumatology 2002, among the 14:515-521.Antibody at double-stranded DNA is considered to cause kidney sexflush (renal flares) and the performance of other lupus.Can monitor the kidney sexflush in time to the patient who carries out Antybody therapy, it is defined as significant, the reproducible increase of serum creatinine, urine protein or blood urine.Perhaps or in addition, can monitor the level of patient's antinuclear antibody and anti-dsDNA antibody.Treatment for SLE comprises high dosage reflunomide and/or endoxan (HDCC).

Spondyloarthropathy is one group of disease in joint, comprises ankylosing spondylitis, psoriatic arthritis and Ke Langshi disease (crohn ' s disease).The treatment achievement can be judged with patient and doctor's comprehensive assessment survey instrument that experience confirms.

Various medicines are used to treat psoriasis, treat directly relevant with disease severity.Have light-dutyer psoriasic patient and generally use topical therapeutic, for example topical steroids, anthraline, calcipotriene, Clobetasol and tazarotene, with the control illness, has then (methotrexate, retinoid, S-Neoral, PUVA and UVB) therapy of more possible using system of the psoriasic patient of moderate and severe.Also use tar (Tars).The shortcoming of these therapies is security consideration, consuming time or therapeutic process is not convenient.In addition, some requires expensive equipment and set private space under office environment.System's medicine can produce severe side effect, comprises hypertension, hyperlipidaemia, bone marrow depression, hepatic diseases, ephrosis and gastrointestinal upset.And, use light therapy can increase the sickness rate of skin carcinoma.Except that the inconvenience and discomfort relevant with using topical therapeutic, light therapy and systematic treating require constantly to make patient in treatment and between stopping to treat repeatedly, and owing to its side effect need be monitored lifelong irradiation dose.

Curing psoriasis is renderd a service by compare with the base state change of disease clinical sign and symptom of monitoring and is assessed, comprise doctor's comprehensive assessment (PGA) change with psoriasis area and severity index (PASI) mark, the psoriasis symptom assesses (PSA).Can measure patient's visual simulation grade (Visual analog scale) on whole therapeutic process reset cycle ground, the visual simulation grade is used to represent the gargalesthesia degree that particular point in time is experienced.

Infusion reaction or infusion related symptoms can take place in patient when infusion of therapeutic antibody first.These symptoms are variant aspect severity, and are reversible after medicine is got involved usually.These symptoms are including, but not limited to the heating of influenza sample, shiver with cold/tetanic, nauseating, urticaria, headache, bronchospasm, angioedema.Concerning methods for the treatment of diseases of the present invention, may need to make the infusion reaction to reach minimum.Therefore, another aspect of the present invention is by giving humanization CD20 the method for the treatment disease that binding antibody discloses, and wherein antibody is with using Rituxan

That treatment has reduction by comparison or do not have the cytotoxicity that depends on complement, and cause the minimizing of the symptom relevant with infusion.In one embodiment, humanization CD20 binding antibody is 2H7.v116.

Dosage

Depend on the factor relevant with prescribed dose that the indication that will treat and this area skilled practitioners are familiar with, antibody of the present invention will and make toxicity and side effect reduces to minimum doses by administration with effective treatment indication.For positive cancer of treatment CD20 or autoimmune disease, treat effective dosage at about 250mg/m ²To about 400mg/m ²Or 500mg/m ²In the scope, preferably about 250-375mg/m ²In one embodiment, dosage range is 275-375mg/m ²In an embodiment of the positive B cell tumour of treatment CD20, antibody is with 300-375mg/m ²The scope administration.Suffer from B cell lymphoma for example for the patient of non_hodgkin lymphoma for treatment, in specific embodiment, anti-CD20 antibodies of the present invention and Humanized anti-CD 20 antibody will be with 10mg/kg or 375mg/m ²Dosage gives human patients.For treatment NHL, dose regimen is to give the antibody compositions of dose in first week of treatment with 10mg/kg dosage, succeeded by two weekly intervals, gives the antibody of the same amount of dosage for the second time then.Usually, patient NHL accepted treatment once like this in 1 year, in case but lymphoma recurrence, treatment like this can be repeated.In another dose regimen, the patient who treats rudimentary NHL accepts a kind of humanization 2H7 of pattern, preferably v16 (375mg/m all around ²Add standard CHOP (endoxan, Zorubicin, vincristine(VCR) and prednisone) or CVP (endoxan, vincristine(VCR), prednisone) chemotherapy, its per three all administration, totally three cycles at the antibody that carries out three additional courses the 5th week subsequently weekly).

For the treatment rheumatoid arthritis, in one embodiment, the dosage range of humanized antibody is 125mg/m ²(being equivalent to every dose of about 200mg/) is to 600mg/m ², be divided into two doses, for example first dose of 200mg is administration in first day, succeeded by gave the second dosage 200mg at the 15th day.In different embodiments, dosage is every dose of 250mg/, 275mg, 300mg, 325mg, 350mg, 375mg, 400mg, 425mg, 450mg, 475mg, 500mg, 525mg, 550mg, 575mg, 600mg.

In treatment during disease, the doctor determined as skilled in this disease field, and CD20 binding antibody of the present invention can be for a long time or given patient off and on.

Intravenous infusion or subcutaneous administration can make that patient feels that adverse effect for example generates heat, shiver with cold, burning sensation, unable and headache.For relaxing or making such adverse effect reach minimum, patient can accept the initial modulation dosage (initial conditioning dose) of antibody, succeeded by therapeutic dose.Modulation dosage can be lower than therapeutic dose, makes its tolerate higher doses to regulate patient.

Route of administration

Give human patient according to currently known methods with the CD20 binding antibody, for example pass through intravenous administration, for example with pill (bolus) or by the continuous infusion in one period, through in subcutaneous, muscle, intraperitoneal, the meninges, in the intraarticular, synovial membrane, in the sheath or inhalation route, pass through intravenously or subcutaneous administration usually.

In one embodiment, humanization 2H7 antibody is through the intravenous infusion administration, with 0.9% sodium chloride solution as the infusion carrier.

Combination therapy

When the above-described B cell tumour of treatment, patient can with CD20 binding antibody of the present invention and one or more therapeutical agent for example chemotherapeutics one reinstate multiple medicines thing therapy and treated.The CD20 binding antibody can with chemotherapeutics simultaneously, sequential ground or alternately administration, or after not reacting, carry out combination therapy with other treatment.The standard chemical therapy of lymphoma treating comprises endoxan, cytosine arabinoside, melphalan, adds melphalan with mitoxantrone.CHOP is the modal chemotherapy of treatment non_hodgkin lymphoma.Below be the medicine that is used for the CHOP therapy: endoxan (trade(brand)name cytoxan, neosar); Zorubicin (adriamycin/hydroxyl adriamycin); Vincristine(VCR) (Oncovin); With Prednisolone Acetate (being sometimes referred to as Deltasone or Orasone).In a concrete embodiment, the one or more Combined Preparation in CD20 binding antibody and the following chemotherapeutics are to the patient who needs it: AC, vincristine(VCR) and Prednisolone Acetate.In specific embodiment, the patient who suffers from lymphoma (for example non_hodgkin lymphoma) is with anti-CD20 antibodies of the present invention and CHOP (endoxan, Zorubicin, vincristine(VCR) and prednisone) therapy combination therapy.In another embodiment, cancer patient can be treated with humanization CD20 binding antibody of the present invention and CVP (endoxan, vincristine(VCR) and prednisone) chemotherapy combined.In specific embodiment, the patient who suffers from the positive NHL of CD20 combines with CVP with humanization 2H7.v16 and treats.In the specific implementations of treatment CLL, the CD20 binding antibody with one or two the chemotherapy Combined Preparation that carries out in fludarabine and the endoxan.

In treatment above-described autoimmune disease or autoimmunization associated conditions, patient can be with the CD20 binding antibody of the present invention and second therapeutical agent, for example immunosuppressor, for example combination therapy in multiple medicines thing therapy.The CD20 binding antibody can with immunosuppressor simultaneously, sequential ground or alternately administration, or when not reacting and the other therapies coupling.Immunosuppressor can be with the identical or less dosed administration disclosed in the prior art.Preferred additional immunosuppressor will depend on many factors, comprise the kinds of Diseases of being treated and patient's medical history.

" immunosuppressor " that is used herein to additional treatment refers to suppress or shelter patient's immune material.Medicament like this will comprise that suppressing cytokine production, downward modulation or inhibition autoantigen expresses or shelter the antigenic material of MHC.The example of medicament like this comprises for example glucocorticosteroid of steroid, for example prednisone, methyl meticortelone, the pyrimidine that replaces with dexamethasone, 2-amino-6-aryl-5-(are seen United States Patent (USP) 4,665,077), imuran (or endoxan, if the side reaction of pair imuran is arranged); Bromocriptine; Glutaraldehyde (shelter MHC antigen, as United States Patent (USP) 4,120,649 descriptions); Answer antibody at MHC antigen and the segmental anti-spy of MHC; Cyclosporin A; Cytokine or cytokine receptor antagonist comprise anti-interferon gamma, β, or Alpha antibodies; The anti-tumor necrosis factor Alpha antibodies; Anti-tumor necrosis factor β antibody; Anti-interleukin-2 antibody and anti-IL-2 receptor antibody; Anti-L3T4 antibody; Allogenic antilymphocyte globulin (ALG); General T antibody, preferably anti-CD3 or anti-CD4/CD4a antibody; The soluble peptide (WO90/08187, open day 7/26/90) that comprises the LFA-3 binding domains; Streptokinase; TGF-β; Streptodornase; RNA or DNA from the host; FK506; RS-61443; Gusperimus; Rapamycin; TXi Baoshouti (United States Patent (USP) 5,114,721); TXi Baoshouti fragment (Offner et al., Science 251:430-432 (1991); WO 90/11294; With WO91/01133); With TXi Baoshouti antibody (EP 340,109) T10B9 for example.

In order to treat rheumatoid arthritis, patient can (alleviate the antirheumatic thing (for example methotrexate) of illness with any one or treat: the DMARDS in the following medicine of CD20 antibodies of the present invention more, NSAI or NSAID (nonsteroidal and-inflammatory drug), HUMIRA ^TM(adalimumab; Abbott Laboratories), ARAVA

(leflunomide), REMICADE (infliximab; CentocorInc.of Malvern, Pa), ENBREL (etanercept; Immunex, WA), cox 2 inhibitor.The DMARD that is generally used for RA is hydroxycloroquine, sulfasalazine, methotrexate, leflunomide, etanercept, infliximab, imuran, Beracilline, Gold (oral), Gold (muscle), MINOCYCLINE HCL, S-Neoral, SP immunosorption.Adalimumab (Adalimumab) is and TNF α bonded human monoclonal antibodies.Infliximab (Infliximab) is and TNF α bonded chimeric mAb.Etanercept (etanercept) is one " immunoadhesin " fusion rotein, comprises that the extracellular ligand bound fraction of people 75kD (p75) Tumor Necrosis Factor Receptors (TNFR) is connected to human IgG1's Fc part.For the conventional treatment of RA, referring to for example, " Guidelines For the management of rheumatoid arthritis ", arthritis﹠amp; Rheumatism 46 (2): 328-346 (in February, 2002).In a specific embodiment, patient RA treats with the antibody combined methotrexate of CD20 of the present invention (MTX).Exemplary MTX dosage is about 7.5-25mg/kg/ week.MTX can oral and subcutaneous administration.

For treatment ankylosing spondylitis, psoriatic arthritis with Ke Langshi sick for, patient can be with CD20 binding antibody of the present invention and for example Remicade

(infliximab; From Centocor Inc., Malvern, Pa.), ENBREL (etanercept; Immunex, WA) combination therapy.

Treatment for SLE comprises high dosage reflunomide and/or endoxan (HDCC).

For the treatment psoriasis, can give patient CD20 binding antibody in conjunction with topical therapeutic, for example topical steroids, anthraline, calcipotriene, Clobetasol and tazarotene, or fixed ammonia methopterin, retinoid, S-Neoral, PUVA and UVB treatment.In one embodiment, psoriasis human CD20 binding antibody subsequent treatment or handle with S-Neoral simultaneously.

Pharmaceutical preparation

The treatment preparation of CD20 binding antibody used according to the invention is by mixing antibody and optional pharmaceutically acceptable carrier, vehicle or the stablizer (Remington ' s Pharmaceutical Sciences 16th edition with required purity with the form of the freeze-dried preparation or the aqueous solution, Osol, A.Ed. (1980)) is used for storing and prepares.Acceptable carrier, vehicle, stablizer to the acceptor nontoxicity, and comprise for example phosphoric acid salt of buffer reagent, Citrate trianion, and other organic acid in used dosage and concentration; Antioxidant comprises xitix and methionine(Met); Sanitas (stearyl dimethyl benzyl ammonium chloride for example; Chlorination hexane diamine; Benzalkonium chloride, benzethonium chloride; Phenol, butanols or phenylcarbinol; Alkyl parabens such as methyl or propyl para-hydroxybenzoate; Pyrocatechol; Resorcinol; Hexalin; The 3-amylalcohol; And meta-cresol); Low molecular weight polypeptide (being less than about 10 residues); Protein such as serum albumin, gelatin or immunoglobulin (Ig); Hydrophilic polymer such as polyvinylpyrrolidone; Amino acid such as glycine, glutamine, l-asparagine, Histidine, arginine or Methionin; Monose, disaccharides and other steamed bun stuffed with sugar are drawn together glucose, seminose or dextrin; Sequestrant such as EDTA; Carbohydrate such as sucrose, N.F,USP MANNITOL, trehalose or sorbyl alcohol; Salify gegenion such as sodium; Metal composite (for example zinc-albumen composition) and/or nonionogenic tenside such as TWEEN ^TM, PLURONICS ^TMOr polyoxyethylene glycol (PEG).

Exemplary anti-CD20 antibodies preparation is described in WO98/56418, is incorporated herein by reference especially at this.Another kind of preparation was a liquid multiple doses preparation, comprises the polysorbate 20 of 40mg/mL anti-CD20 antibodies, 25mM acetate, 150mM trehalose, 0.9% phenylcarbinol, 0.02% pH5.0,2-8 ℃ of short storage life 2 years.Another interested anti-CD20 preparation comprises the 10mg/mL antibody that is dissolved in 9.0mg/mL sodium-chlor, 7.35mg/mL Trisodium citrate dihydrate, 0.7mg/mL polysorbate 80 and the sterile water for injection, pH6.5.Another aqueous pharmaceutical preparations comprises about pH4.8 to about pH5.5, preferably the polysorbate of 10-30mM sodium acetate, the about 0.01-0.1%v/v of content of pH5.5 is as the trehalose of tensio-active agent, the about 2-10%w/v of content and phenylcarbinol (U.S.6 as sanitas, 171,586).The freeze-dried preparation that is suitable for subcutaneous administration is described in WO97/04801.Freeze-dried preparation like this can be mixed with high protein concentration solution again with suitable diluent, but and the preparation subcutaneous administration of preparation again to this Mammals that will be treated.

A preparation of humanization 2H7 variant is a 12-14mg/mL antibody, is dissolved in 10mM Histidine, 6% sucrose, 0.02% polysorbate 20 pH5.8.

In a concrete embodiment, 2H7 variant and 2H7.v16 in particular are dissolved in 10mM Histidine sulfuric ester, 60mg/mL sucrose, 0.2mg/mL polysorbate 20 and the sterile water for injection form preparation of pH5.8 with 20mg/mL antibody.

Preparation this also can comprise specific adaptations disease required more than a kind of active compound, preferably those have not the compound to the complementary activity that has a negative impact each other.For example, may need further to provide cell toxicant medicament, chemotherapeutics, cytokine or immunosuppressor (medicament that for example acts on the T cell is S-Neoral for example, or acts in conjunction with the medicament of the antibody of T cell for example in conjunction with the medicament of LFA-1).The significant quantity of other medicament like this depends on antibody amount, disease or kind and the other factors discussed above disorderly or treatment that exists in the preparation.These usually with same dose and via route of administration described herein or before this employed dosage about 1-99% and use.

Activeconstituents also can be in colloid drug delivery system (for example liposome, albumin microsphere spherolite, microemulsion, nano particle and Nano capsule), perhaps in coarse emulsion, catch in microcapsule, described microcapsule are for example by condensation technique or interfacial polymerization preparation, for example, be Walocel MT 20.000PV or gelatin microcapsule and polyisobutene acid methyl esters microcapsule respectively.This technology is at Remington ' sPharmaceutical Sciences, 16th edition, and Oslo, A., Ed. discloses in (1980).

Can prepare sustained release preparation.The example of suitable sustained release preparation comprises the semipermeability matrix of the solid-state hydrophobic polymer that contains antagonist, and its mesostroma is the form with formed article, for example film or microcapsule.The example of sustained-release matrix comprises polyester, hydrogel (for example poly-(2-hydroxyethyl-methylacrylic acid) or poly-(vinyl alcohol)), polylactide (United States Patent (USP) 3,773,919), the multipolymer of L-L-glutamic acid and ethyl-L-L-glutamic acid, non-degradable ethylene-vinyl acetate, degradable poly lactic coglycolic acid LUPRONDEPOT for example ^TM(the Injectable microspheres grain of forming by poly lactic coglycolic acid and leuprorelin acetate), with poly--D-(-)-3-hydroxybutyric acid.

The preparation that is used for vivo medicine-feeding must be aseptic.This is by finishing at an easy rate via the sterile filtration membrane filtration.

Goods and test kit

Another embodiment of the present invention is a kind of goods, comprises treating for example useful material of non_hodgkin lymphoma of the positive cancer of autoimmune disease and associated conditions and CD20.Goods comprise container and label or package insert, and this label or package insert are on container or relevant with container.Suitable containers comprises, for example, and bottle, bottle, syringe or the like.Container may be to be formed by various materials, for example glass or plastics.Container holds treating this illness effective composition, and can have the aseptic hole (for example container can be have can be by the intravenous solution bag or the bottle of the stopper of subcutaneous injection needle penetration) that enters.At least a activator is a CD20 binding antibody of the present invention in the composition.Label or package insert indication said composition are used for the treatment of this particular disorder.Label or package insert will further comprise the indication with antibody compositions administration patient.

Package insert refers to be usually included in the indication in the commercial package of treatment product, and this indication comprises relevant indication, usage, dosage, administration, contraindication and/or about the information of the warning of using treatment product like this.In one embodiment, package insert indication said composition is used for the treatment of non_hodgkin lymphoma.

In addition, these goods can further comprise second container, and this container comprises pharmaceutically acceptable damping fluid, for example bacteriostatic water for injection (BWFI), phosphate buffered saline (PBS), ringer's solution and dextrose solution.It can further comprise from other materials commercial and the user perspective needs, comprise other damping fluid, thinner, filter, syringe needle and syringe.

Also be provided for the test kit of various uses, for example be used for B cell killing test, as the apoptosis test over against according to, be used for from cell purification or immunoprecipitation CD20.In order to separate and purifying CD20, test kit can comprise the anti-CD20 antibodies that is coupled to pearl (for example sepharose 4B).Test kit can be provided, and this test kit comprises and is used for externally, for example detects in ELISA or western blotting and the quantitative antibody of CD20.As goods, test kit comprises container, with on container or label relevant with container or package insert.Container holds the composition that comprises at least one anti-CD20 antibodies of the present invention.Can comprise extra container, this container comprises for example thinner and damping fluid, control antibodies.Label or package insert can provide the description to composition, and to expecting the indication of external or diagnostic uses.

Macaque CD20

The present invention also provides isolating nucleic acid, and this nucleic acid comprises the nucleotide sequence SEQ ID NO.:24 of macaque CD20 as shown in figure 19.In one embodiment, nucleic acid is cDNA.In one embodiment, the nucleic acid of coding monkey CD20 is arranged in and is used for the expression vector of expressing at host cell.The nucleotide sequence of SEQ ID NO.:24 in the expression vector may be operably coupled to expression control sequenc, for example promotor or promotor and enhanser.Expression control sequenc can be the native sequences of common and macaque CD20 gene-correlation, or to the allogenic sequence of this gene.Isolated polypeptide also is provided, and this polypeptide comprises amino-acid sequence [the SEQ ID NO.25 of macaque CD20; Figure 19 and 20], and the host cell that comprises macaque CD20 nucleic acid.In one aspect, host cell is an eukaryotic cell, for example Chinese hamster ovary celI.Also consider to comprise the fusion rotein of macaque CD20 aminoacid sequence or sequence fragment.

EXPERIMENTAL EXAMPLE

Embodiment 1

The humanization of the anti-CD20 mouse monoclonal antibody of 2H7

The humanization of mouse-anti people CD20 antibody 2H7 (be also referred to as m2H7 here, m refers to mouse) carries out in a series of site-directed mutagenesis steps.The chimeric 2H7 of mouse 2H7 antibody variable region sequence and mouse V and people C is described, sees for example United States Patent (USP) 5,846,818 and 6,204,023.By mouse 2H7 amino acid sequences (is disclosed in U.S.5,846, in 818) with sequence (the Kabat etal. of known antibodies, sequences of proteins of immunological interest, Ed.5.Public Health Service, National Institutes of Health, Bethesda, MD (1991)) compare, and the CDR residue of discriminating 2H7.(Kabat et al. above) defines the CDR zone of light and heavy chain, and is shown in Figure 1A and Figure 1B respectively based on the high sex change of sequence.Utilize synthetic oligonucleotide (table 1), with site-directed mutagenesis (Kunkel, Proc.Natl.Acad.Sci.82:488-492 (1985)) with all six mouse 2H7CDR zones introduce be included in comprise on the plasmid pVX4 corresponding to consensus sequence V κ I, V _HIII (V _Lκ subgroup I, V _HSubgroup III) complete human Fab's framework (Fig. 2).

Phagemid pVX4 (Fig. 2) is used to mutagenesis and is used for the expression of F (ab) s intestinal bacteria.PVX4 is the basis with derivative, the phagemid pb0720 of pb0475 (Cunningham et al., Science 243:1330-1336 (1989)), comprises a dna fragmentation, the humanized total κ subgroup I light chain (V of this fragment coding _Lκ I-C _L) and humanized total subgroup III heavy chain V _HIII-C _H1 anti-IFN-α (interferon-' alpha ') antibody.PVX4 also has alkaline phosphatase promoter and Shine-Dalgamo sequence, and both all derive from the plasmid pAK2 based on pUC119 (Carter et al., Proc.Natl.Acad.Sci.USA 89:4285 (1992)) that described before another.Coding F (ab) light with heavy chain DNA between the unique Spel restriction site of introducing.Anti-IFN-α heavy with light chain in preceding 23 amino acid are StII secretory signal sequence (Chang et al., Gene 55:189-196 (1987)).

For the CDR exchange pattern (CDR-swap version) that makes up 2H7 (2H7.v2), carry out site-directed mutagenesis comprising on the pVX4 template of deoxyuridine; Six CDR of all of anti-IFN-α change mouse 2H7CDR into.Resulting molecule be called humanized 2H72 type (2H7.v2) or 2H7's " CDR exchanges pattern "; It has the m2H7CDR residue that has joint owner FR residue shown in Figure 1A and the 1B.Humanized 2H7.v2 is used to further humanization.

Table 1 shows the oligonucleotide sequence that is used to generate each mouse 2H7 (m2H7) CDR in heavy chain and the light chain.For example, the CDR-H1 oligonucleotide is used to regeneration m2H7 heavy chain CDR1.CDR-H1, CDR-H2 and CDR-H3 refer to heavy chain CDR1, CDR2 and CDR3 respectively; Similarly, CDR-L1, CDR-L2 and CDR-L3 refer to each among the light chain CDR.Replacement among the CDR-H2 is with two oligonucleotide, and CDR-H2A and CDR-H2B carry out in two steps.

Table 1 is used for the CDR exchange of mouse 2H7CDR is built into the oligonucleotide of people's framework of pVX4.The residue underscore that is being changed by each oligonucleotide.

Replace	Oligonucleotide sequence
		CDR-H1	C TAC ACC TTC ACG AGC TAT AAC ATG CAC TGGGTC CG(SEQ ID NO.27)
CDR-H2A	G ATT AAT CCT GAC AAC GGC GAC ACG AGC TATAAC CAG AAG TTC AAG GGC CG(SEQ ID NO.28)
		CDR-H2B	GAA TGG GTT GCA GCG ATC TAT CCT GGC AACGGC GAC AC(SEQ ID NO.29)
CDR-H3	AT TAT TGT GCT CGA GTG GTC TAC TAT AGC AAC AGC TAC TGG TAC TTC GAC GTC TGG GGT CAA GGA(SEQ ID NO.30)
		CDR-L1	C TGC ACA GCC AGC TCT TCT GTC AGC TAT ATG

	CAT TG(SEQ ID NO.31)
		CDR-L2	AA CTA CTG ATT TAC GCT CCA TCG AAC CTC GCGTCT GGA GTC C(SEQ ID NO.32)
CDR-L3	TAT TAC TGT CAA CAG TGG AGC TTC AAT CCG CCC ACATTT GGA CAG(SEQ ID NO.33)

For comparing, use synthetic oligonucleotide, (Kunkel, above) the chimeric 2H7 Fab of construction expression (comprises mouse V via site-directed mutagenesis with humanized construction _LAnd V _HStructural domain and people C _LWith C _H1Structural domain) plasmid is to introduce 2H7.v2 with mouse framework residue.Resulting plasmid construction thing sequence is shown in Fig. 3, and this construction is used to express the chimeric Fab that is called 2H7.v6.8.Each coding strand of Fab has as top for described 23 the amino acid whose StII secretory signal sequences of pVX4 (Fig. 2).

Based on mouse 2H7 framework residue and people V κ I, V _HIII has framework (Figure 1A and 1B) and previous humanized antibody (Carter et al., the sequence of Proc.Natl.Acad.Sci.USA 89:4285-4289 (1992)) carrying out is relatively introduced 2H7.v2 Fab construction by site-directed mutagenesis with several framework sudden changes.These sudden changes cause the total framework residue of some people to change over those residues of finding in mouse 2H7 framework, and described change takes place in the site that those may influence CDR configuration or antigen contact.Pattern 3 comprises V _H(R71V, N73K), pattern 4 comprises V _H(R71V), pattern 5 comprises V _H(R71V, N73K) and V _L(L46P), pattern 6 comprises V _H(R71V, N73K) and V _L(L46P, L47W).

As following humanization and chimeric Fab pattern at expression in escherichia coli and purifying m2H7 antibody.Plasmid is transformed into e. coli strains XL-1 Blue, and (Stratagene, San Diego CA) are used to prepare double-stranded DNA and single stranded DNA.For each variant, and use dideoxyribonucleoside acid system (Sequenase,, U.S.Biochemical Corp.) light and heavy chain are checked order fully.Plasmid is transformed into derivative, the e. coli strains 16C9 of MM294, is laid on the LB plate that contains 5 μ g/ml Pyocianils, selects to be used for the single bacterium colony of protein expression.Single colony growth was cultivated for 37 ℃ on 5ml LB-100 μ g/ml Pyocianil in 5-8 hour.The 5ml culture is added in the 500ml AP5-100 μ g/ml Pyocianil, and allows shaking in the bottle 37C growth 16 hours at 4L band baffle.The AP5 substratum comprises: 1.5g glucose, 11.0 Hycase SF, 0.6g yeast extract (certified), the anhydrous MgSO of 0.19g ₄, 1.07gNH4Cl, 3.73gKCl, 1.2gNaCl, 120ml 1M trolamine, pH 7.4, add water to 1L, then by 0.1 μ MSealkeen strainer sterile filtration.

By in 1L centrifugal bottle (Nalgene) at the 3000xg centrifugal cell harvesting, and remove supernatant liquor.After freezing 1 hour, the precipitation piller is resuspended in the cold 10mM MES-10mMEDTA of 25ml, pH 5.0 (buffer A).Add 250 μ l0.1M PMSF (Sigma) with the hydrolysis of arrestin matter, and add (Sigma) storage liquid of 3.5ml 10mg/ml egg albumen N,O-Diacetylmuramidase (hen egg white lysozyme), to help the bacteria cell wall dissolving.After shaking 1 hour gently on ice, sample is 40, centrifugal 15 minutes of 000xg.Supernatant liquor adds to volume 50ml with buffer A, and application of sample is to using on the buffer A equilibrated 2ml DEAE post.Then effluent (flow-through) is gone up sample to using buffer A equilibrated G albumen-agarose CL-4B (Pharmacia) post (0.5ml column volume).Pillar is washed with the 10ml buffer A, goes into 1.25ml 1MTris with 3ml 0.3M glycine pH 3.0 wash-outs, among the pH 8.0.Use Centricon-30 (Amicon) that PBS is gone in F (ab) buffer exchange then, and be concentrated into whole volume 0.5ml.The SDS-PAGE gel of all F (ab) all carries out electrophoresis to guarantee purity, and the molecular weight of each variant confirms with electrospray mass spectrometry.

Based on the ELISA of cell in conjunction with test in (as described below), comprise that the Fab of chimeric 2H7 Fab is difficult to detection with combining of CD20.Therefore, 2H7 Fab pattern is become total length IgG1 antibody by reformatting (reformatted), to test and further mutagenesis.

By V with chimeric 2H7 (v6.8) Fab _LWith V _HThe pRK carrier that is used for mammalian cell expression (Gorman etal., DNA Prot.Eng.Tech.2:3 (1990)) that structural domain and humanization Fab pattern 2 had extremely before been described to pattern 6 subclones, the plasmid of construction expression total length IgG.In brief, each Fab construction digests with excision V with EcoRV and BlpI _LThe EcoRV/BlpI site (Fig. 4) that fragment, this fragment are cloned into plasmid pDR1 is used for complete light chain (V _L-C _LStructural domain) expression.In addition, each Fab construction digests with excision V with PvuII and ApaI _HThe PvuII/ApaI site (Fig. 5) that fragment, this fragment are cloned into plasmid pDR2 is used for complete heavy chain (V _H-CH ₁-hinge-CH ₂-CH ₃Structural domain) expression.For each IgG variant, go into the human embryonic kidney cell line 293 (Graham et al., J.Gen.Virol., 36:59-74, (1977)) who transforms with adenovirus by the plasmid that will express light chain and the plasmid co-transfection of expressing heavy chain, carry out transient transfection.In brief, divide bottle in the day before yesterday of transfection with 293 cells, and be laid on the substratum that contains serum.Second day, add double-stranded DNA, succeeded by pAdVAntage with the calcium phosphate precipitation preparation ^TM(WI), cell is 37 ℃ of overnight incubation for Promega, Madison for DNA.Cell is cultivated in serum free medium, results after 4 days.From the culture supernatants antibody purification, 10mM sodium succinate, 140mM NaCl are gone in buffer exchange then with a-protein-agarose CL-4B, pH6.0, and concentrated with Centricon-10 (Amicon).Measure protein concn with quantitative amino acid analysis.

Test in order to measure antigenic relative binding affinity, develop the ELISA that based on cell CD20.With the female WIL2-S cell of people's category-B lymph (ATCC CRL 8885, American TypeCulture Collection, Rockville MD) is being supplemented with 2mM L-glutaminate, 20mMHEPES, among the RPMI 1640 of pH 7.2 and 10% heat-inactivated foetal calf serum, at moistening 5%CO ₂Grow in the incubator.Cell is washed with the PBS (analysis buffer) that contains 1%FBS, with 250-300,000 cells/well be inoculated on the 96 hole circle base plates (Nunc, Roskilde, Denmark).In plate, add the reference liquid (IgG that the 2H7v6.8 of 15.6-1000ng/ml is chimeric) of the twice serial dilution that is dissolved in analysis buffer and the sample (2.7-2000ng/ml) of three times of serial dilutions.Flat board is embedded in the ice, hatched 45 minutes.In order to remove not binding antibody, Xiang Kongzhong adds the 0.1mL analysis buffer.Flat board is centrifugal, remove supernatant.Cell is washed twice with the 0.2mL analysis buffer again.(Jackson ImmunoResearch, Grove PA), detect and dull and stereotyped bonded antibody by add the anti-people Fc of peroxidase link coupled goat antibody in flat board.After hatching 45 minutes, wash cell as mentioned previously.Add in the plate tmb substrate (3,3 ', 5,5 '-tetramethyl benzidine; Kirkegaard ﹠amp; Perry Laboratories, Gaithersburg, MD).Add 1M phosphoric acid with stopped reaction.With four parametrical nonlinearity regression curve fit procedure (KaleidaGraph, Synergy software, Reading, PA) match titration curve.Measure specific absorption (the settle the standard respective concentration of thing of mid point-OD) of titration curve mid point.Measure each variant then in the pairing concentration of this mid point OD, standard substance concentration is removed by the concentration of each variant.Therefore institute's value is the ratio of the combination of each variant with respect to standard.Relative affinity (equivalent concentration) the experiment between standard deviation be generally+/-10%.

As shown in table 2, to compare with chimeric 2H7 (v.6.8), the combination of CDR exchange variant (CDR-swapvariant) (v.2) is extremely reduced.Yet pattern 3 to 6 shows in conjunction with improving.In order to measure the minimal number that binding affinity is returned to the required sudden change of binding affinity of chimeric 2H7, make up extra sudden change and sudden change combination by site-directed mutagenesis, to generate variant 7 to 17, as indicated in the table 2.Especially, these comprise V _HSudden change A49G, F67A, I69L, N73K and L78A; With V _LSudden change M4L, M33I and F71Y.Pattern 16 shows best relative binding affinity with 17, in 2 times of scopes of chimeric pattern, does not have significant difference (s.d.=+/-10%) between the pattern 16 and 17.In order to make the sudden change minimum number, therefore select pattern 16 to be used for extra sign as the humanization form, this pattern only has 4 sudden changes (table 3) that become mouse framework residue by people's framework residue.

Table 2. uses the ELISA based on cell, and the relative binding affinity of humanized 2H7 IgG variant and CD20 is compared with the relative binding affinity of chimeric 2H7 and CD20.Relatively in conjunction with representing in conjunction with required variant concentration with the concentration ratio equivalent of chimeric 2H7; Therefore ratio＜1 indication to the variant avidity a little less than.Standard deviation average out to+/-10% during relative affinity is measured.Framework in the variable domains replaces system, and (Kabat et al. is above) with respect to CDR-exchange pattern according to the numbering system of Kabat.

The 2H7 pattern	Heavy chain (V H) replace	Light chain (V L) replace	Combination relatively
				6.8	(mosaic)	(mosaic)	-1-
2	(CDR exchange)	(CDR exchange)	0.01
				3	R71V，N73K	(CDR exchange)	0.21
4	R71V	(CDR exchange)	0.21
				5	R71V，N73K	L46P	0.50
6	R71V，N73K	L46P，L47W	0.58
				7	R71V	L46P	0.33
8	R71V，L78A	L46P	0.19
				9	R71V，F67A	L46P	0.07
10	R71V，F67A，I69L	L46P	0.12
				11	R71V，F67A，78A	L46P	0.19
12	R71V	L46P，M4L	0.32
				13	R71V	L46P，M33I	0.31
14	R71V	L46P，F71Y	0.25
				15	R71V	L46P，M4L，M33I	0.26
16	R71V，N73K，49G	L46P	0.65
				17	R71V，N73K，49G	L46P，L47W	0.67

Table 3 is used for making up sudden change V in humanization 2H7 pattern 16 (2H7.v16) _H(A49G, R71V, N73K) and V _L(L46P) oligonucleotide sequence.The indicated aminoacid replacement of codon coding of band underscore.For V _H(R71V, N73K) and V _L(L46P), oligonucleotide shows with sense strand, because these are used to mutagenesis on the Fab template, and for V _H(A49G), oligonucleotide shows with antisense strand, because this chain is used with pRK (IgG heavy chain) template.The protein sequence of pattern 16 is shown in Fig. 6 and Fig. 7.

Replace	Oligonucleotide sequence
		V H(R71V，N73K)	GT TTC ACT ATA AGT GTC GAC AAG TCC AAAAAC ACA TT(SEQ ID NO.34)
V H(A49G)	GCCAGGATAGATGGCGCCAACCCATTCCAGGCC(SEQ ID NO.35)
		V L(L46P)	AAGCTCCGAAACCACTGATTTACGCT(SEQ IDNO.36)

Embodiment 2

The antigen of 2H7 is in conjunction with determinant (paratope)

In 2H7.v16 or 2H7.v17, carry out L-Ala and replace (Cunningham ﹠amp; Wells, Science244:1081-1085 (1989) with indivedual side chains of check antibody with effect during CD20 combines.In 293 cells from pDR1 and pDR2 vector expression IgG variant, purifying, and as the relative binding affinity of above-mentioned analysis.Several places L-Ala replaces and causes that relative bonded with CD20 significantly reduces (table 4) on the WIL-2S cell.

Table 4 utilizes L-Ala replacement that the ELISA (WIL2-S cell) based on cell the measures effect to the CDR zone of humanization 2H7.v16.Combination is represented in conjunction with required variant concentration with 2H7.v16 parent's concentration ratio equivalent relatively, so ratio＜1 indication variant has more weak avidity; Ratio〉1 the indication variant have than high affinity.Standard deviation average out to+/-10% during relative affinity is measured.Framework in the variable domains replaces system, and (Kabat et al. is above) with respect to 2H7.v16 according to the numbering system of Kabat.The meaning of NBD is not have detectable combination.Two numerals in the pattern 45 come from separately independently experiment.

Embodiment 3

The addition mutation of 2H7CDR intra-zone

The replacement of extra residue and the combination that is accredited as the replacement that is important CDR position by L-Ala scanning have also been tested.Several variant combinations, particularly v.96, as if than v.16 combination is tightr.

Table 5 uses the sudden change combination of ELISA (WIL2-S cell) measurement in the CDR zone of humanization 2H7.v16 and the effect of non-L-Ala replacement based on cell.Relative combination to CD20 is represented in conjunction with required variant concentration with 2H7.v16 parent's concentration ratio equivalent, so ratio＜1 indication variant has more weak avidity; Ratio〉1 the indication variant have than high affinity.Standard deviation average out to+/-10% during relative affinity is measured.Framework in the variable domains replaces system, and (Kabat et al. is above) with respect to 2H7.v16 according to the numbering system of Kabat.

Embodiment 4

Replace site mutation at the framework humanization

The replacement of additional residue is also tested in the 2H7.v16 background in the frame position that changes during humanization.Especially, at V _L(P46) and V _HThe interchangeable framework that carries out in (G49, V71 is with K73) neither also not existing in the total framework of people in mouse 2H7 parent replaces.

These replace and cause the extremely change (table 6) of son of relative bonded usually, and there are some handinesies in indication in the framework residue of these positions.

The relative combination of table 6 in (WIL2-S) based on cell that framework replaces tests.Use sudden change to show the IgG variant with respect to the 2H7.v16 background.Combination is represented in conjunction with required variant concentration with the chimeric concentration ratio equivalent of 2H7.v6.8 relatively, so ratio＜1 indication variant has more weak avidity; Ratio〉1 the indication variant have than high affinity.Standard deviation average out to+/-10% during relative affinity is measured.Framework in the variable domains replaces system, and (Kabat et al. is above) with respect to 2H7.v16's according to the numbering system of Kabat.

( ^*) compare the variant that thing is analyzed with 2H7.v16 as standard; Relative correction value is to chimeric value.

( ^*) compare the variant that thing is analyzed with 2H7.v16 as standard; Relative correction value is to chimeric value.

Embodiment 5

Humanization 2H7 variant with enhanced effector function

Because the cytotoxicity (ADCC) of the cell that cytotoxicity (CDC) that 2H7 can rely on by complement and antibody rely on mediates B cytolysis, we manage to produce CDC with improvement and the variant of the active humanization 2H7.v16 of ADCC.Some residue sudden change in the Fc zone of other antibody also is described (Idusogie et al., J.Immunol.166:2571-2575 (2001)), is used for improving CDC by strengthening with combining of complement component Clq.Some sudden change that is used to improve ADCC also is described (Shields et al., J.Biol.Chem.276:6591-6604 (2001); Presta et al., Biochem.Soc.Trans.30:487-490 (2002)), described improvement is by strengthening combining and reduce IgG and reaching with combining of inhibition Fc γ acceptor of IgG and excitability Fc γ acceptor.Especially, three kinds of sudden changes have been had the CDC and the ADCC activity of improvement by discriminating: (Idusogie et al., above (2001) as described; Shields et al., above), S298A/E333A/K334A (is also referred to as triple alanine mutation bodies or variant here; The numbering in Fc zone is according to the EU numbering system; Kabat et al., above).

For CDC and the ADCC activity that strengthens 2H7, make up triple alanine mutation bodies of 2H7Fc.S298A/E333A/K334A has also produced the humanization variant of Anti-HER 2 4d5 with sudden change, is called 4D5Fc110 (promptly anti-p185HER2 IgG1 (S298A/E333A/K334A); Shields et al., above).The plasmid p4D5Fc110 of encoding antibody 4D5Fc110 (Shields et al., above) with ApaI and HindIII digestion, the Fc fragment connects into (comprising sudden change S298A/E333A/K334A) the ApaI/HindIII site of 2H7 heavy chain carrier pDR2-v16, produces pDR2-v31.The aminoacid sequence of the complete heavy chain of 31 types is shown in Fig. 8.Light chain is identical with the light chain of v16.

Though the Fc region constant district of IgG1 antibody is conservative relatively in specific species, (summary is seen Lefranc and Lefranc still allelic variation, in " The human IgG subclasses:molecular analysis of structure; function; and regulation ", pp.43-78, F.Shakib (ed.), Pergammon Press, Oxford (1990)).

The replacement in table 7Fc zone influences the CD20 bonded.Measured with relative being combined in (WIL2-S) test that replacement is carried out to framework of CD20 based on cell.Fc sudden change (*) EU numbering (Kabat above) is indicated, and with respect to the 2H7.v16 parent.V.31 the combination of three L-Ala changes is known as " Fc110 " in the Fc zone.Use sudden change to show the IgG variant with respect to the 2H7.v16 background.Relatively in conjunction with representing in conjunction with required variant concentration with the chimeric concentration ratio equivalent of 2H7.v6.8; Therefore the avidity of ratio＜1 indication variant a little less than.Standard deviation average out to+/-10% during relative affinity is measured.

The 2H7 pattern	Fc replaces	Combination relatively
			6.8	-	-1-
16	-	0.65
			31	S298A，E333A，K334A	0.62

Embodiment 6

Stability enhanced humanization 2H7 variant

In order to develop therapeutic protein, need be chosen in the suitable preparation damping fluid, in oxidation, take off amine or other and can influence in the process of quality product and keep stable variant.In 2H7.v16, several residues are accredited as instable may the source: V _L(M32) and V _H(M34, N100).Therefore, sudden change is introduced into these sites, is used for comparing with v16.

The 2H7 variant that table 8. is designed to have enhanced stability and/or effector function in based on (WIL2-S) test of cell to the relative combination of CD20.Use sudden change to show the IgG variant with respect to the 2H7.v16 background.Relatively in conjunction with representing in conjunction with required variant concentration with the chimeric concentration ratio equivalent of 2H7.v6.8; Therefore the avidity of ratio＜1 indication variant a little less than.Standard deviation average out to+/-10% during relative affinity is measured.The variable domains framework replaces with respect to 2H7.v16, and according to the numbering system of Kabat, the Fc sudden change ( ^*) (Kabat et al. above) indicates with the EU numbering.( ^*) with the variant that 2H7.v16 measures, compare thing as standard; Relative correction value is to chimeric value.

Based on the previous sudden change of reporting (Idusogie et al. (2000); Idusogie et al. (2001); Shields et al. (2001)), additional Fc sudden change and stability or avidity enhanced abrupt junction altogether, to change or the reinforcing effect subfunction.These changes comprise S298, E333A, the K334A described in the embodiment; K322A is to reduce the CDC activity; D265A is to reduce the ADCC activity; K326A or K326W are to strengthen the CDC activity; And E356D/M358L, with the special-shaped effect that changes (allotypic change) in test Fc zone.These sudden changes all do not cause the noticeable change of CD20 binding affinity.

( ^*) measure the variant of thing as a comparison with 2H7.v16

Associated value is proofreaied and correct to chimeric value relatively

For the influence of stable testing sudden change to protein degradation rate, 2H7.v16 and 2H7.v73 are formulated in 10mM Histidine, 6% sucrose, 0.02% polysorbate 20 with 12-14mg/mL, among the pH5.8, hatch 16 days at 40 ℃.The sample of being hatched then with ion exchange chromatography analyze the electric charge variant change, analyze polymerization with fracture, by testing the relative combination of (WIL2-S) analysis of experiments with size exclusion chromatography based on cell.

Result (Fig. 9) shows that compare with 2H7v.16,2H7v.73 has higher stability, and this is to detect by losing of main peak fraction in the ion exchange chromatography under the condition that increases stability.On polymerization, fracture or binding affinity, do not see significant difference.

Embodiment 7

Antibody and CD20 bonded Scatchard analyze the 2H7 IgG that uses labelled with radioisotope and measure 2H7 IgG variant and WIL2-S cell bonded balance dissociation constant (Kd) on the WIL2-S cell.The IgG variant produces in Chinese hamster ovary celI.

(in all experiments all from Genentech, S.San Francisco, CA) and mouse 2H7 (BD PharMingen, SanDiego, CA) be used to and the humanization variant relatively.Mouse 2H7 antibody also can obtain from other source, and for example eBioscience and Calbiochem are (all at San Diego, CA), Accurate Chemical﹠amp; Scientific Corp. (Westbury, NY), Ancell (Bayport, MN), with Vinci-Biochem (Vinci, Italy).All dilutions all the binding analysis damping fluid (the DMEM substratum, comprise 1% bovine serum albumin, 25mM HEPES pH 7.2, with 0.01% sodium azide) in carry out.With concentration is 0.8nM's ¹²⁵I-2H7.v16 (with the milk peroxidase iodate) aliquots containig (0.025mL) is dispensed in the hole of 96 hole microanalysis plates at the bottom of the V-arrangement, adds the serial dilution thing (0.05mL) of cold antibody, and mixes.Add WIL2-S cell (60,000 cells among the 0.025mL) then.The sealing plank was at room temperature hatched 24 hours, then 3, and centrifugal 15 minutes of 500RPM.The sucking-off supernatant liquor is washed cell precipitation group and centrifugal then.Inhale once more and remove supernatant liquor, the little group of cell is dissolved among the 1N NaOH, and is transferred to and is used for the γ counting in the pipe.Use Ligand program (McPherson, Comput.ProgramsBiomed.17:107-114 (1983)) that data are carried out Scatchard and analyze (Munson and Rodbard, Anal.Biochem.107:220-239 (1980)).As shown in table 9, the result shows that the CD20 binding affinity of humanization 2H7 variant is similar to mouse 2H7, binding affinity is similar to

Based on combination shown in the top table 7, expection 2H7.v31 will have and v.16 very similar K _d

Table 9 is analyzed the balance binding affinity of the 2H7 variant that obtains from Scatchard

Antibody variants	K d(nM)	n
			Rituxan	0.99±0.49	3
2H7 (mouse)	1.23±0.29	3
			2H7.v16	0.84±0.37	4
2H7.v73	1.22±0.39	4

2H7.v75

1.09±0.17

4

Embodiment 8

The cytotoxicity (CDC) that complement relies on is analyzed

Basically as described (Idusogie et al., J.Immunol.164:4178-4184 (2000); Idusogie et al., J.Immunol.166:2571-2575 (001)), analyze the dissolved ability that 2H7 IgG variant mediation WIL2-S cell complement relies on, this cell is a B clone of expressing the lymphocytoblast sample (limphoblastoid) of CD20.Antibody is the 1:3 serial dilution from the 0.1mg/mL stock solution.To comprising 0.05mL normal people's complement (Quidel, San Diego, CA) the 0.05mL aliquots containig of each dilution of adding in the 96 hole tissue culturing plates of solution.50, the 000 WIL2-S cells that in this mixture, add the 0.05mL volume.37 ℃ hatch 2 hours after, (Accumed International, Westlake OH), continued to hatch 18 hours at 37 ℃ again to add 0.05mL Alamar blue solution.To take away on the lid slave plate, plank was shaking under room temperature 15 minutes on the orbital shaker.Use 530nm exciter filter and 590nm emission spectral filter to read relative fluorescence unit (RFU).Use KaleidaGraph software, by RFU being fitted to the function calculation EC of the concentration of each antibody ₅₀

Result's (table 10) shows that humanization 2H7 antibody causes the wonderful improvement of CDC, and relative efficiency v.73 is similar to

V.75 than

Go out 3 times by force, v.16 than

Weak 3 times.

Table 10 is compared the CDC activity of 2H7 antibody with Rituxan.Numeral〉1 expression CDC activity is not so good as

By force, numeral＜1 expression specific activity

Stronger.Except that those of short duration generations with (*) indication, antibody produces the CHO system of self stabilization.

Embodiment 9

The cytotoxicity (ADCC) that antibody relies on is analyzed

Basically as described (Shields et al., J.Biol.Chem.276:6591-6604 (2001)), utilize serum lactic dehydrogenase (LDH) reading, analyze the ability of 2H7IgG variant mediation natural killer cell (NK cell) dissolving WIL2-S cell, this cell is a lymphoblastoid B clone of expressing CD20.The blood of the 100mL heparinization of the personal 100mL PBS dilution of NK cell preparation, it has been (isotyped) normal people donor of Fc γ RIII (having another name called CD16) (Koene et al., blood 90:1109-111409-1114 (1997)) isotype certainly that this blood obtains.In this experiment, the NK cell comes from the people's donor (F158/V158) to the CD16 heterozygosis.(ICNBiochemical, Aurora carry out layering on Ohio) to the blood of dilution, at 2000RPM centrifugal 20 minutes at 15mL lymphocyte separating medium.White corpuscle on the interlayer separation surface is allocated in 4 clean 50mL pipes, is full of the RPMI substratum that contains 15% foetal calf serum in the pipe.Pipe centrifugal 5 minutes at 1400RPM, abandoning supernatant.The little group of cell is resuspended in the MACS damping fluid (0.5%BSA, 2mM EDTA), and (NK cellular segregation test kit is 130-046-502) according to schedule of operation (Miltenyi the Biotech) purifying of producer with globule for the NK cell.The NK cell is diluted to 2 x 10 in the MACS damping fluid ⁶Cells/ml.

(F12/DMEM 50:50 does not have glycine, 1mM HEPES pH of buffer 7.2, penicillin/streptomycin (100 units/mL will to analyze substratum; Gibco), glutamine is with 1% heat-inactivated foetal calf serum) in the antibody serial dilution add at the bottom of 96 hole circles in the tissue culturing plate.The WIL2-S cell is diluted to concentration 4 x 10 in analysis buffer ⁵/ mL.WIL2-S cell (the every hole of 0.05mL) mixes with dilution antibody in 96 orifice plates, at room temperature hatches 30 minutes, allows antibody combine (opsonization) with CD20.

By in every hole, adding 0.1mLNK cell starting ADCC reaction.In control wells, add 2%Triton X-100.Plank was hatched 4 hours at 37 ℃.(Indianapolis Indiana) measures according to producer's indication the lactic dehydrogenase enzyme level that discharges for test kit #1644793, Roche Diagnostics with cytotoxicity (LDH) detection kit.Every hole adds 0.1mL LDH developer, mixes subsequently 10 seconds.Plank covers with aluminium foil then, hatches under the room temperature in the dark 15 minutes.Read the 490nm optical density(OD) then, and remove, calculate dissolving per-cent by the total LDH that is recorded in the control cells.Dissolving is plotted as the function of antibody concentration, and four parametric line matches (KaleidaGraph) are used to judge EC ₅₀Concentration.

The result shows, humanization 2H7 antibody is active aspect ADCC, v.31 with v.75 relative potency ratio High 20 times, v.16 than

Strong 5 times, v.73 than

Almost 4 times of height.

Table 11 is compared with 2H7.v16 based on the n experiment, and 2H7 antibody is to the ADCC activity of WIL2-S cell.(numerical value〉1 expression renders a service lowlyer than 2H7.v16, and numerical value＜1 expression is renderd a service stronger.)

Carry out extra ADCC and analyze, with the 2H7 combinatory variants with

Relatively.Result's demonstration of these analyses, with Relatively, the ADCC of 2H7.v114 and 2H7.v115 renders a service to improve and surpasses 10 times (table 12).

Table 12 is tested based on n, with

Compare, 2H7 antibody is to the ADCC activity of WIL2-S cell.(numerical value〉1 expression ratio

Render a service lowlyer, numerical value＜1 expression is renderd a service stronger.)

Embodiment 10

The vivo effect of 2H7 variant in the macaque pilot research

The 2H7 variant that test transient transfection Chinese hamster ovary celI is produced in normal male macaque (Macaca fascicularis) is to evaluate its activity in vivo.Other anti-CD20 antibodies, for example C2B8 (

Shown and had the ability (Reff et al., Blood83:435-445 (1994)) of in normal primate, subduing the B cell.In a research, compare humanization 2H7 variant.In a parallel study, in macaque, also tested Below in five dosage groups, every group is used four monkeys: (1) carrier, (2) 0.05mg/kg hu2H7.v16, (3) 10mg/kg hu2H7.v16, (4) 0.05mg/kg hu2H7.v31 and (5) 10mg/kg hu2H7.v31.Antibody is with 0,0.2 or 20mg/mL concentration intravenous administration, and two doses altogether, potion was at first day of research, and another agent was at the 8th day.Be appointed as the 1st day, and be appointed as the-1 day the day before yesterday in first day of administration; (for two animals in every group) was appointed as the 11st day recover first day.The-19 ,-12,1 days (before the administration), and after the administration first time, collected blood sample on the the 6th, 24,72 hour.Get extra sample the 8th day (before the administration), the 10th day (before killing every group of two animals) with the 36th and 37 day (for recovering animal).

Measure periphery B cell concn with the FACS method, this method counting CD3-/CD40+ cell.By in the monkey sample, obtaining the percentage of CD3-CD40+B cell in total lymphocyte as Xiamenization (gating) strategy.The mark lymphocyte population is with defined range 1 (R1) on forward scatter/lateral scattering point diagram.Use the incident among the R1, show the fluorescence intensity point diagram of CD40 and CD3 mark.Fluorescently-labeled isotype (isotype) contrast is used to judge CD40 and CD3 positive cut-out point separately.

The result indicates 2H7.v16 and 2H7.v31 to produce complete periphery B cell reduction and to cut down (Figure 11) at 0.05mg/kg dosage generating unit branch periphery B cell at 10mg/kg dosage.The degree that time course and the B cell that measures during first 72 hours of administration are cut down is similar between two kinds of antibody.The subsequent analysis that recovers animal is shown with the animal of using the 2H7.v16 administration by comparison, time length that those animals demonstration B cells of handling with 2H7.v31 are cut down are longer.Especially, in the recovery animal of handling with 10mg/kg2H7.v16, the B cellular-restoring of certain the time display substance (substantial) of B cell between taking a sample in the 10th day and the 36th day.Yet in the recovery animal of handling with 10mg/kg2H7.v31, B cell certain time between the 36th day and the 67th day just shows recovery (Figure 11).This hint is compared with 2H7.v16, and the time length that 2H7.v31 cuts down fully grew about one month.

In macaque research, low or high dosage is not observed toxicity, and total pathology (gross pathology) also are normal.In other research, after the two all i.v. of being separated by in these monkeys were administered twice, v16 was up to the maximum dose level (100mg/kgx2=1200mg/m that is assessed ²X2) still by well tolerable.

In macaque with 2H7.v16 with

More resulting data suggest, CDC is active to reduce 5 times for rendeing a service not disadvantageous effect.Has strong ADCC activity but the active antibody that reduces of CDC may have better security feature than having the strong active antibody of CDC aspect the reaction pouring into first.

Embodiment 11

2H7 variant antibody with Fucose defective of enhanced effector function

Normal CHO and HEK293 cell add to the IgG oligosaccharides to high level (97-98%) with Fucose.From the IgG of serum also is the height fucosylation.

DP12 and Lec13 are used to produce the antibody of this research, and DP12 is (DHFR-) Chinese hamster ovary celI system with no Tetrahydrofolate dehydrogenase defective of fucosylation ability, and Lec13 is the clone of protein fucosylation defective.Chinese hamster ovary celI is that Pro-Lec13.6a (Lec13) obtains to teach from the Pamela Stanley of Alberta einstein medical college of university of yeshiva.Parent system is Pro-(proline(Pro) auxotroph) and Gat-(glycine, adenosine, thymidine auxotroph).CHO-DP12 clone is the derivative (ATCC#CCL-61) of CHO-K1 clone, and the latter is the Tetrahydrofolate dehydrogenase defective, and the demand of Regular Insulin is reduced.(Qiagen, Valencia CA) use the cDNA transfectional cell series to use the Superfect method.Use tetracycline dihydrochloride (Calbiochem, San Diego, CA) in growth medium, select to express the Lec13 cell of the antibody of transfection in 10 μ g/ml concentration, described growth medium contains: the MEM α substratum (GIBCO-BRL with L-glutaminate, ribonucleoside and deoxyribonucleotide, Gaithersburg, MD), be supplemented with 10% deactivation FBS (GIBCO), 10mMHEPES, with 1X penicillin/streptomycin (GIBCO).Select Chinese hamster ovary celI in the Ham ' s F12 growth medium similarly in comprising of no GHT: no glycine, NaHCO is arranged ₃, be supplemented with low dextrose DMEM (GIBCO), 10mM HEPES, 2mM L-glutaminate, the 1X GHT (glycine, xanthoglobulin, thymidine) and 1X penicillin/streptomycin of 5%FBS.

Within two to three weeks, form bacterium colony, mix and be used to increase and protein expression.Cell aggregate is at first with 3 x 10 ⁶The concentration inoculation of cell/10 centimetre plate is used for the short run protein expression.In case cell grows to the full plate of 90-95%, just be transferred in the serum free medium, and after 3-5 days the collecting cell supernatant liquor, test is with the estimation protein expression level in Fc IgG and complete IgG ELISA.Lec13 and Chinese hamster ovary celI are produced the day before yesterday of substratum with about 8 x 10 being transferred to PS24 ⁶Cell/15 centimetre plate inoculation, described PS24 production culture medium supplemented has 10mg/L recombinant human insulin and 1mg/L trace element.

Lec13 cell and DP12 cell are produced in the substratum at serum-free and were kept 3-5 days.Collect supernatant liquor, in the 150ml tapered tube, make it clarification to remove cell and fragment by centrifugation.Add proteinase inhibitor PMSF and Trypsin inhibitor,Trasylol (Sigma, St.Louis, MO), use MWCO30 strainer (Amicon, Beverly, MA) 5 times of concentrated supernatants on the cell that stirs use G protein chromatographic method (Amersham Pharmacia Biotech then, Piscataway, NJ)) purifying supernatant liquor immediately.All proteins all utilizes Centripriep-30 thickener (Amicon) buffer exchange to go into phosphate buffered saline (PBS) (PBS), and analyzes with the SDS-polyacrylamide gel electrophoresis.Utilize A280 to measure protein concn, and utilize the amino acid composition analysis checking.

Use the carrier transfection CHO cell of expressing humanization 2H7v16,2H7v.31, and select as described.2H7v.16 antibody remains with wild-type Fc zone, and v.31 (see top embodiment 5, table 7) 3 amino acid change (S298A, E333A, K334A) in the Fc zone, cause the high affinity (Shields et al.J.Biol.Chem.276 (9): 6591-6604 (2001)) to Fc γ RIIIa acceptor.Transfection and select after, isolate the single colony of cell, and evaluating protein matter expression level, the cell that output is the highest carries out methotrexate and selects to select those plasmid copy numbers to be amplified and the therefore cell of production higher level antibody.Make cell growth, be transferred in the serum free medium 7 days, collect substratum then, be loaded on the A albumen post, with standard technique wash-out antibody.Use the Elisa that measures complete antibody to measure the final concn of antibody.Use Centripriep-30 thickener (Amicon) that all proteins buffer exchange is gone into phosphate buffered saline (PBS) (PBS) and used the analysis of SDS-polyacrylamide gel electrophoresis.

The auxiliary mastrix-assisted laser desorption ionization time of flight of matrix (MALDI-TOF) mass spectroscopy of the oligosaccharides that l-asparagine connects: use Papac et al., Glycobiology 8, and the program of 445-454 (1998) discharges the oligosaccharides that N-connects from recombinant glycoprotein.In brief, 96 pore areas have the titer plate of PVDF lining (Millipore, Bedford MA) with 100 μ l methyl alcohol conditionings, make this methyl alcohol penetrate PDVF film by apply vacuum on Millipore multi-screen vacuum manifold.The pvdf membrane of nursing one's health is washed with 3X250 μ l.Between all washing steps, the hole is drained fully by applying vacuum gently to manifold.Wash film with reduction and carboxymethylation damping fluid (RCM), described damping fluid comprises 6M Guanidinium hydrochloride, 360mM Tris, 2mM EDTA, pH 8.6.(50 μ g) adds in each hole with the glycoprotein sample, applies vacuum once more gently and makes it see through pvdf membrane, and the hole is washed with the RCM damping fluid of 2 X, 50 μ l.Reduced the sample that is immobilized in 1 hour by in every hole, adding 50 μ l 0.1M dithiothreitol (DTT) (DTT) solution and titer plate being hatched at 37 ℃.Remove DTT with vacuum, the hole is washed with 4 x, 250 μ l.Come the carboxymethylation cysteine residues by 0.1M iodoacetic acid (IAA) solution that adds 50 μ l, the fresh preparation in 1MNaOH of described iodoacetic acid solution, and be diluted to 0.1M with the RCM damping fluid.Finished carboxymethylation in 30 minutes by at room temperature hatching in the dark.Apply vacuum to remove IAA solution to plank, the hole purifies washing with 4x250 μ l.1%PVP360 by adding 100 μ l (polyvinylpyrrolidine 360,000MW) (Sigma) solution and at room temperature hatch 1 hour sealing pvdf membrane.Remove PVP-360 solution by applying vacuum gently, the hole is washed with 4x250 μ l.(MA) digestion solution (25 units of 25 μ l in 10mM Tris acetate/ml solution, pH 8.4) is added in every hole PNGase F for New England Biolabs, Beverly, and digestion was carried out 3 hours at 37 ℃.After the digestion, in sample transfer to the 500 μ l Eppendorf tube, add the 1.5M acetic acid solution of 2.5 μ l in each sample.Acidified sample incubated at room 3 hours to convert oligosaccharides to OH-form from glycosylamine.Before the MALDI-TOF mass spectroscopy, the oligosaccharides that is discharged is with the slurry packing reaction tubes of going into to compress (US Biochemical, Cleveland, the Zeo-karb of 0.7ml bed OH) (with the AG50W-X8 resin of hydrogen form) (Bio-Rad, Hercules, CA) desalination.

In order to carry out the MALDI-TOF mass spectroscopy of sample in positive mode (positive mode), with the oligosaccharides (0.5 μ l aliquots containig) of desalination with 2 of 0.5 μ l, 5 protocatechuic acid matrix (sDHB) go up sample to stainless steel target (stainless target), described 2,5 protocatechuic acid matrix are passed through 2mg2, and 5 protocatechuic acids dissolve with the 5-methoxyslicylicacid that is dissolved in the 0.1mg among 1ml ethanol/1mM sodium-chlor 1:1 (v/v) and prepare.The vacuum-drying of sample/substrate mixture.In order to analyze with losing side formula (negative mode), oligosaccharides (0.5 μ l aliquots containig) and 0.5 μ l 2 ' that the N-of desalination is connected, 4 ', 6 '-trihydroxy-phenyl methyl ketone matrix (THAP) goes up sample together to the stainless steel target, described 2 ', 4 ', 6 '-trihydroxy-phenyl methyl ketone prepares in 1:3 (v/v) acetonitrile/13.3mM ammonium citrate damping fluid.Vacuum-drying sample/substrate mixture allowed it absorb airborne moisture before analyzing then.The oligosaccharides that is discharged is analyzed with MALDI-TOF on PerSeptiveBioSystems Voyager-mass spectrograph.Mass spectrograph is arranged (linear configuration) and is utilized delay extraction (delayedextraction) to operate with wire with positivity or negativity mode at 20kV.Use 1300 laser power and obtain data to improve signal to noise ratio in data summation mode (240 scanning).Instrument is with the mixture calibration of standard oligosaccharides, and before mass distribution with 19 Savitsky-Golay algorithms with the data cunning (smoothed) that flattens.Utilize Caesar 7.0 data analysis software bags (SciBridge software) to obtain the integration of mass-spectrometric data.

The cell toxicity test that natural killer (NK) cell antibody relies on

Carry out the ADCC test as described in Example 9.The ratio of NK cell and target cell (WIL2-S) is 4:1, and test was carried out 4 hours, measures toxicity as the test of lactose desaturase is used in the front.Before adding the NK cell, nursed one's health target cell 30 minutes with indicated antibody enriched material.Employed Antibody from Genentech (S.San Francisco, CA).Figure 12 shows the result of representational ADCC test.

The result shows that the antibody of low fucosylation more effectively mediates NK cellular targets cell killing than complete fucosylated antibody.Low fucosylation antibody 2H7v.31 kills and wounds the most effective the mediation target cell.This antibody is effective under low concentration, and can kill and wound than the target cell of other antibody-mediated more height ratio under higher concentration.Antibody activity is as follows: Lec13 deutero-2H7v31〉Lec13 deutero-2H7v16〉Dp12 deutero-2H7v31〉Dp12 deutero-2H7v16〉or=Rituxan.Additional proteins and sugared change.The sugar on the natural IgG among the IgG that produces with CHO that produces of Lec13 relatively, being presented at does not have the difference that can obviously discover on the galactosylation degree, thus this result can be fully owing to the existence or the shortage of Fucose.

Embodiment 12

Fucose defective 2H7 variant antibody with enhanced ADCC in the body

Present embodiment has been described the III at expressing human CD16[FcR] and the mouse of people CD20 in, the humanization 2H7 variant of the Fucose defective that Lec13 produces comprise v.16 with v.31 with the normal fucosylation that in DP12, produces compare ADCC activity in the body with antibody-like.

HuCD20Tg ⁺HuCD16Tg ⁺MCD16 ^-/-The generation of mouse

(Invitrogen, Carlsbad CA) produce people CD20 transgenic mice from people CD20 BAC DNA.The facs analysis of expressing based on people CD20 screens mouse.HuCD20Tg ⁺Mouse then with huCD16Tg ⁺MCD16 ^-/-Mouse hybridization is to generate huCD20Tg ⁺HuCD16Tg ⁺MCD16 ^-/-Mouse.

Interior therapeutic

Through peritoneal injection with each 2H7 variant of 10 to 100 μ g or

HuCD20Tg is given in administration ⁺HuCD16Tg ⁺MCD16 ^-/-Mouse.Negative control animals is given in the antibody administration in a similar manner of the isotype coupling of equivalent.

The mouse lymphocyte preparation

From whole blood, spleen, lymphoglandula, prepare according to the standard program described in " Current Protocolsin Immunology; John Coligan, Ada Kruisbeek, David Margulies edits; EthanShevach and Warren Strober, 1994 " with the mouse lymphocyte of marrow.

Facs analysis

Wash 500,000 cells, be resuspended in the FACS damping fluid of 100 μ l, this damping fluid is the phosphate buffered saline (PBS) that contains 1%BSA, comprises dyeing or the control antibodies of 5 μ l.All antibody that dye comprise the isotype contrast, all available from PharMingen, and San Diego, CA.By using Dye with the anti-human IgG1's second antibody of FITC-link coupled, evaluator CD20 expresses.(Becton Dickinson Immunocytometry Systems, San Jose CA) carries out facs analysis to use FACScan and Cell Quest.All lymphocytes are determined with preceding and sidelight scattering, and all bone-marrow-derived lymphocytes are determined with the expression of the B220 on the cell surface.

After injection first every day in week and after this weekly by analyzing periphery B cell counting and by spleen, lymphoglandula and marrow being carried out facs analysis hCD20+B cell, assess the B cell and cut down and recover.The serum level of the 2H7 variant antibody that monitoring is injected.

The result of this in vivo test has further confirmed results of in vitro studies, and promptly the 2H7 variant of Fucose defective is compared with antibody-like with wild-type (aspect fucosylation) glycosylation and had the active and more B cell reduction of higher ADCC.

Embodiment 13

The programmed cell death activity

Comprise

Having shown when being crosslinked by second antibody or by chemical process at interior anti-CD20 antibodies can external evoked apoptosis (Shan et al., Blood9:1644-1652 (1998); Byrd et al., Blood 99:1038-43 (2002); Pederson et al., Blood99:1314-19 (2002)).When by chemically crosslinked, mouse 2H7 dipolymer is induced the apoptosis (Ghetie et al., Proc Natl Acad Sci USA 94:7509-14 (1997)) of Daudi cell.The crosslinked also inducing cell of mouse 2H7 antibody and second antibody program death (Shan et al., 1998).These activity are considered to be on the physiology relevant, because various mechanism can cause in the body crosslinked with cell surface CD20 bonded anti-CD20 antibodies.

Utilize second cross-linking antibody in the dead test of cell in vitro program, to compare RhuMAb2H7.v16[humanization 2H7v16; RhuMAb represents the recombinant human monoclonal antibody] with

Express CD20 human B lymphocyte clone Ramos cell (CRL-1596, ATCC, Manassas, VA) be used to measure anti-CD-20 monoclonal antibody rhuMAb2H7.v16 and Rituximab with respect to negative control antibodies Trastuzumab (

Genentech, South San Francisco, the CA) ability of inducing cell program death, the ability of described inducing cell program death by annexin (Annexin) V dyeing and the iodine third ingot dyestuff repel (

The apoptosis assay kit, Molecular Probes, Seattle WA) measures.(Biosource International, Camarillo is CA) and in the RPMI-1640 substratum of 2mM L-glutaminate (Gibco) comprising 10% foetal calf serum for the Ramos cell cultures.Before the analysis, cell washes twice in fresh culture, is adjusted to cell concn 2 X 10 then ⁶Every milliliter.Cell (150 μ L) is added to 96 hole analysis plates (BectonDickinson, Palo Alto, CA) in, plank comprises the contrast IgG1 that pre-determines quantity, rhuMAb 2H7.v16 or Rituximab and the anti-people Fc of F (the ab) ' 2 goat (PierceBiotechnology of 150 μ L, Rockford, IL).Final IgG concentration is 100,10,1.0,0.1,0.01 and 0.001nM, and the anti-people Fc of F (ab) ' 2 goat antibody concentration is configured to the twice of each sample antibody concentration.Each dilution all is arranged in triplicate.37 ℃ hatch 24 hours after, cell washes twice with PBS, dyes with annexin V and iodine third ingot according to producer suggestion then.The dyeing pattern of Ramos cell is used the FACscan flow cytometer, and (Becton Dickinson, San Jose CA) by the flow cytometry analysis, collect data in 10 seconds time.Use Cellquest Pro software (BectonDickinson) that data are reduced.Two dyeing are positive the Ramos cell for the dyeing of (1) annexin V, (2) annexin V and iodine third ingot, and the number of the undyed viable cell of (3) counting, and (Synergy software, Reading PA) draw to utilize KaleidaGraph software.

When comparing with the crosslinked and same irrelevant IgG1 control antibodies of anti-people Fc, rhuMAb 2H7.v16 and Rituximab both induce the apoptosis (Figure 13-15) of Ramos cell.The apoptosis activity of rhuMAb 2H7 is lower than Rituximab slightly.When the concentration of crosslinked rhuMAb 2H7, Rituximab and contrast IgG1 antibody is 10nM, the ratio of the painted cell of annexin V is respectively 18.5%, 16.5%, 2.5%, the ratio of double labeling cells is 29%, 38% and 16%, and the viable cell number of per 10 seconds countings is 5200,3100 and 8600.

These vitro datas show that apoptosis is the possible mechanism that the B cell is cut down in the body.With crosslinked may the generation in the body of cell surface CD20 bonded rhuMAb 2H7 or Rituximab by the lip-deep Fc γ of immune effector cell R.

Embodiment 14

Suppress in the body of tumor growth

Assessment rhuMAb 2H7.v16 suppresses the ability of lymphoma cell line Raji human B cell (ATCC CCL86) growth in Balb/c naked (athymia) mouse.Raji cell expressing CD20, and reported and can in nude mice, grow, metastatic disease produced; The tumor growth quilt Suppress (Clynes et al., Nature Medicine 6,443-446 (2000)).56 all big Balb/c nude mices of 8-10 are divided into 7 groups (A-G), and every group comprises 8 mouse.At the 0th day, every mouse was accepted 5 x 10 in side of body portion ⁶The subcutaneous injection of Raji B lymphoma cell.Since the 0th day, every mouse was accepted the negative contrast solution (PBS of 100 μ l; Phosphate buffered saline),

Or 2H7.v16.Dosage depends on body weight, by administration in the tail cava vein.A group mouse is accepted PBS.B-D group is respectively with 5.0mg/kg, 0.5mg/kg, accept with 0.05mg/kg

The group E-G respectively with 5.0mg/kg, 0.5mg/kg, with 0.05mg/kg accept 2H7 v.16.Injection repeats weekly, totally 6 weeks.During treating, weekly, observe the existence that tumour can be touched in every injected in mice position, if exist then measure gross tumor volume and registration.Doing last inspection (after not treating in two weeks at interval) the 8th week.

The result of this research show rhuMAb 2H7.v16 with

In suppressing nude mice in the growth of subcutaneous Raji cell tumour all effectively (Figure 16-18).Since the 4th week in the PBS control group, observing tumor growth.Yet, in 8 time length in week of this research, using Or do not observe tumor growth in the group of 2H7.v16 with 5mg/kg or 0.5mg/kg processing.In low dosage 0.05mg/kg treatment group, animal of 2H7 group and

Observe tumour (Figure 18) in the animal of group.

Embodiment 15

The clone of macaque CD20 and antibodies

After the cDNA of coding CD20 is separated in macaque spleen cDNA library, measure macaque (Macacafascicularis) CD20 dna sequence dna.CDNA synthesizes the SUPERSCRIPT with plasmid clone ^TM(Carlsbad CA) is used to make up the library after the change to pUC pUC a little for catalog number (Cat.No.) 18248-013, Invitrogen.Use restriction site XhoI and NotI that the cDNA library is connected into the pRK5E carrier.From spleen separate tissue mRNA ((California Regional Research Primate Center, Davis, CA).Be designed for the primer of the cDNA of amplification coding CD20 based on the non-coding sequence of people CD20.N-terminal zone primer 5 '-AGTTTTGAGAGCAAAATG-3 ' (SEQ ID NO.37) and C-terminal zone primer 5 '-AAGCTATGAACACTAATG-3 ' (SEQ ID NO.38) is used to the cDNA by polymerase chain reaction (PCR) clones coding macaque CD20.(Gibco, Rockville MD) carry out the PCR reaction according to producer's suggestion to use Platinum Taq DNAPolymerase High Fidelity.PCR product subclone is gone into

Carrier (Invitrogen), and be transformed into the blue intestinal bacteria of XL-1 (Stratagene.La Jolla, CA).From single clone, separate and comprise the plasmid DNA that is connected with the PCR product, and order-checking.

The aminoacid sequence of macaque CD20 is shown in Figure 19.Figure 20 shows the comparison of macaque and people CD20.Macaque CD20 and people CD20 have 97.3% similarity, and 8 place's differences are arranged.Extracellular domain comprises a change at V157A, and all the other 7 residues can or be striden diaphragm area and find at tenuigenin.

Dissecting needle also substitutes the ability of FITC link coupled mouse 2H7 in conjunction with the macaque cell of expressing CD20 to the antibodies of anti-humen CD 20.(California Regional Research PrimateCenter, Davis CA) get blood and add heparin sodium for 20 milliliters, and directly are transported to strong Tai Ke company from two macaques.On the same day, compile blood sample, by adding phosphate buffered saline (PBS) the 1:1 dilution of 40ml.The dilute blood layering of 20ml is laid on 50ml tapered tube (catalog number (Cat.No.) 352098, Falcon, Franklin Lakes, NJ) the 4x20ml Ficoll-Paque in ^TM(Sweden), (Dupont, Newtown CT) go up with the 1300rpm room temperature centrifugal 30 minutes to Plus at Sorval 7 whizzers for Amersham Biosciences, Uppsala.Isolate the PBMC layer, in PBS, wash.Red corpuscle cracking in 0.2%NaCl solution returns to etc. with isopyknic 1.6%NaCl solution and to ooze, with 1000RPM centrifugal 10 minutes.The PBMC piller be resuspended in the RPMI1640 that comprises 5% foetal calf serum (FBS) (Gibco, Rockville, MD) in, be dispensed into 10cm tissue culture ware 1 hour at 37 ℃.NA B and T cell colony are removed with sucking-off, centrifugal and counting.Recovery obtains 2.4 x 10 altogether ⁷Cell.Again the PBMC of Xuan Fuing is dispensed into 20 12 x 75mm culture tubes (catalog number (Cat.No.) 352053, Falcon), every pipe comprises 1 x 10 ⁶Cell, volume 0.25ml.Pipe is divided into four groups, every group five pipe.Every group add substratum (RPMI1640,5%FBS), the contrast human IgG1 antibody of titer,

2H7.v16 or 2H7.v31, the final concentration of each antibody is 30,10,3.3 and 1.1nM.In addition, every pipe also add 20 μ l fluorescein isothiocyanate (FITC) link coupled anti-humen CD 20 (catalog number (Cat.No.) 555622, BD Biosciences, SanDiego, CA).Cell mixing was hatched 1 hour on ice gently, washed twice in cold PBS then.(Coulter, Miami FL) go up the analysis of cells padding, derive and draw geometric mean (KaleidaGraph at antibody concentration at Epic XL-MCL ^TM, Synergy Software, Reading, PA).

Data presentation among Figure 21, v.16 2H7 substitutes combining of FITC-mouse 2H7 and macaque cell with 2H7 is v.31 competitive.In addition,

Also substitute the combination of FITC-mouse 2H7, therefore prove 2H7 with

Both are incorporated into the overlapping epi-position on the CD20.In addition, data presentation, 2H7 is v.16, v.31 2H7 have similar IC with Rituxan ₅₀Value drops in the 4-6nM scope.

Embodiment 16

RhuMAb 2H7 (2H7.v16) studied in moderate to the I/II phase in the severe rheumatoid arthritis

The process summary

Suffering from moderate to the individuality of severe rheumatoid arthritis, described individuality is accepted the methotrexate of consistent dose simultaneously, at random, placebo, multicenter (multicenter), blind I/II phase is carried out in the security of the PRO70769 (rhuMAb 2H7) of the dosage that raises gradually study.

Purpose

The main purpose of this research is evaluation in security and the tolerance of the PRO70769 (rhuMAb 2H7) that suffers from intravenously (IV) dosage that moderate increases to severe rheumatoid arthritis (RA) individuality gradually.

Research and design

This be one at random, placebo, polycentric, blind, I/II phase, investigator and experimenter's double-blind study, research is increased the PRO70769 of dosage and MTX gradually and is united in the security of moderate to the severe RA individuality.Research comprises that dosage increases the phase and the second phase gradually, wherein has the individuality of greater amt to add in the second phase.The sponsor keeps not participating in to treatment plan.

The experimenter that can add treatment: suffer from moderate to severe RA, suffer a kind of to five kinds of antirheumatic or biotechnological formulation treatment failures, not good with the clinical response of MTX treatment at present with mitigation symptoms effect.

Before the research beginning, the experimenter will accept at least 12 weeks of MTX in the 10-25mg scope weekly, and accepts at least 4 weeks of consistent dose, accepts the research medicine (PRO70769 or placebo) of its initial dose then.The experimenter also can accept the oral cortin (the most nearly every day 10mg or equivalent prednisone) of consistent dose and the on-steroidal AID (NSAID) of consistent dose.According to the cumulative plan of following dosage (referring to Figure 22), the experimenter will accept twice intravenous infusion of PRO70769 or placebo at the 1st and the 15th day with prescribed dose.

According to specific criteria, and after data of safety being checked, and after after last experimenter of each group accepts for the second time infusion, acute toxicity having been carried out assessment in 72 hours, carry out dose escalating by the internal security data check council.The dose escalating after date, other 40 experimenters (32 accept medicine with 8 accept placebo) will be gone into each dosage of following dosage level by random assignment: 2 x 50mg, 2 x 200mg, 2 x 500mg and 2 x 1000mg, if this dosage level has been proved to be in the phase and can have tolerated at dose escalating.About 205 experimenters will add this research.

Obtain B cell counting and registration.In 48 all trackings phases when being outside 6 months effectiveness appraisal phase, utilize flow cytometry to estimate the B cell counting.The B cell cut down the toxicity will can not be considered to dose limitation (dose-limiting toxicity, DLC), but the expection pharmacodynamic result of PRO70769 treatment.

In an optionally inferior research, will obtain serum blood and RNA analysis and urine sample from the experimenter at each time point.These samples can be used to the identification of organism mark, and these biomarkers may have the indication effect to PRO70769 treatment responsiveness to the experimenter of severe RA to suffering from moderate.

Result's measurement

The main outcome measurement of this research is security and a tolerance of suffering from moderate PRO70769 to the experimenter of severe RA.

The research treatment

Population of subjects will be accepted twice intravenous infusion of PRO70769 or equivalent placebo according to following upgrading plan with prescribed dose at the 1st and the 15th day:

-10mg PRO70769 or equivalent placebo: 4 experimenters accept active medicine, accept contrast for 1

-50mg PRO70769 or equivalent placebo: 8 experimenters accept active medicine, accept contrast for 2

-200mg PRO70769 or equivalent placebo: 8 experimenters accept active medicine, accept contrast for 2

-500mg PRO70769 or equivalent placebo: 8 experimenters accept active medicine, accept contrast for 2

-1000mg PRO70769 or equivalent placebo: 8 experimenters accept active medicine, accept contrast for 2

Render a service

The effectiveness of PRO70769 will be by the ACR response measurement.Experimenter's percentage of obtaining ACR20, ACR50 and ACR70 reaction will gather by treatment group, and each group generates 95% fiducial interval.The component of these reactions with and will be gathered by treatment and visit from the variation of baseline.

Conclusion

Above digital proof prepare humanization CD20 binding antibody, the particularly success of humanization 2H7 antibody variants, described antibody keeps even strengthens its biological characteristics.Humanization 2H7 antibody of the present invention is effectively in the B of primate cell killing to combine with CD20 with avidity like mouse donor and the chimeric 2H7 antibody class, causes the B cell to be cut down.Some variant is compared with the chimeric anti-CD20 antibodies that is used for the treatment of NHL at present and is demonstrated enhanced ADCC, helps using in the patient treatment antibody than low dosage.In addition, although for having the chimeric antibody of mouse FR residue, need be to be enough to obtaining the dosed administration of complete B cell reduction to eliminate antibody response at it, humanized antibody of the present invention can be obtaining the dosed administration that B cell is partially or completely cut down, and required by the various durations administration according to this specified disease and patient.In addition, these antibody demonstrate the stability in solution.These character of humanization 2H7 antibody make them can be used as ideal immunotherapy medicament in positive cancer of CD20 and autoimmune disease; These antibody expections are that tool is not immunogenic in human patients, or will be at least than mouse or inosculating antibody CD20 antibody mediated immunity originality are little completely.

Reference

The reference of being quoted comprises patent, disclosed application and other publication in this application, is hereby incorporated by.

Except as otherwise noted, enforcement of the present invention will be used molecular biological traditional method in the scope of this area or the like.Such technology is fully explained in the literature.Referring to, for example:

Molecular Cloning:A Laboratory Manual, (J.Sambrook et al., Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y., 1989); Current Protocols in Molecular Biology(F.Ausubel et al., eds., 1987 updated); Essential Molecular Biology(T.Brown ed., IRL Press 1991); Gene Expression Technology(Goeddeled., Academic Press 1991); Methods for Cloning and Analysis of Eukaryotic Genes(A.Bothwell et al.eds., Bartlett Publ.1990); Gene Transfer and Expression(M.Kriegler, Stockton Press 1990); Recombinant DNA Methodology II(R.Wu et al.eds., Academic Press 1995); PCR: A Practical Approach(M.McPherson et al., IRL Press at Oxford University Press 1991); Oligonucleotide Synthesis(M.Gait ed., 1984); Cell Culture for Biochemists(R.Adams ed., Elsevier Science Publishers 1990); Gene Transfer Vectors for Mammalian Cells(J.Miller ﹠amp; M.Calos eds., 1987); Mammalian Cell Biotechnology(M.Butlered., 1991); Animal Cell Culture(J.Pollard et al.eds., Humana Press 1990); Culture of Animal Cells, 2 ^NdEd. (R.Freshney et al.eds., Alan R.Liss 1987); Flow Cytometry and Sorting(M.Melamed et al.eds., Wiley-Liss 1990); Theseries Methods in Enzymology(Academic Press, Inc.); Wirth M.and Hauser H. (1993); Immunochemistry in Practice, 3rd edition, A.Johnstone ﹠amp; R.Thorpe, Blackwell Science, Cambridge, MA, 1996; Techniques in Immunocytochemistry, (G.Bullock ﹠amp; P Petrusz eds., Academic Press 1982,1983,1985,1989); Handbook of Experimental Immunology, (D.Weir ﹠amp; C.Blackwell, eds.); Current Protocols in Immunology(J.Coligan et al.eds.1991); Immunoassay(E.P.Diamandis ﹠amp; T.K.Christopoulos, eds., Academic Press, Inc., 1996); Goding (1986) Monoclonal Antibodies:Principles and Practice(2d ed) Academic Press, New York; Ed Harlow and David Lane, Antibodies A laboratory Manual, ColdSpring Harbor Laboratory, Cold Spring Harbor, New York, 1988; Antibody Engineering, 2 ^NdEdition (C.Borrebaeck, ed., Oxford University Press, 1995); With the series Annual Review of Immunology; The series Advances in Immunology.

Sequence table

＜110〉Genentech Inc (Genentech, Inc.).

＜120〉immunoglobulin variants and uses thereof

<130>P1990R3C1

<140>US 11/147,780

<141>2005-06-07

<150>US 60/434,115

<151>2002-12-16

<150>US 60/526,163

<151>2003-12-01

<150>PCT/US03/40426

<151>2003-12-16

<160>53

<210>1

<211>107

<212>PRT

＜213〉mouse (Mus musculus)

<400>1

<210>2

<211>107

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>2

<210>3

<211>108

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>3

<210>4

<211>10

<212>PRT

＜213〉mouse (Mus musculus)

<400>4

<210>5

<211>7

<212>PRT

＜213〉mouse (Mus musculus)

<400>5

<210>6

<211>9

<212>PRT

＜213〉mouse (Mus musculus)

<400>6

<210>7

<211>122

<212>PRT

＜213〉mouse (Mus musculus)

<400>7

<210>8

<211>122

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>8

<210>9

<211>119

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>9

<210>10

<211>10

<212>PRT

＜213〉mouse (Mus musculus)

<400>10

<210>11

<211>17

<212>PRT

＜213〉mouse (Mus musculus)

<400>11

<210>12

<211>13

<212>PRT

＜213〉mouse (Mus musculus)

<400>12

<210>13

<211>5679

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>13

<210>14

<211>241

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>14

<210>15

<211>248

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>15

<210>16

<211>5678

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is chimeric

<400>16

<210>17

<211>236

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is chimeric

<400>17

<210>18

<211>253

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is chimeric

<400>18

<210>19

<211>5391

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>19

<210>20

<211>6135

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>20

<210>21

<211>232

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>21

<210>22

<211>471

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>22

<210>23

<211>471

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>23

<210>24

<211>891

<212>DNA

<213>Macaca fascicularis

<400>24

<210>25

<211>297

<212>PRT

<213>Macaca fascicularis

<400>25

<210>26

<211>297

<212>PRT

<213>Homo sapiens

<400>26

<210>27

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>27

<210>28

<211>51

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>28

<210>29

<211>38

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>29

<210>30

<211>65

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>30

<210>31

<211>36

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>31

<210>32

<211>42

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>32

<210>33

<211>45

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>33

<210>34

<211>37

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>34

<210>35

<211>33

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>35

<210>36

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>36

<210>37

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>37

<210>38

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>38

<210>39

<211>452

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>39

<210>40

<211>213

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>40

<210>41

<211>452

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>41

<210>42

<211>452

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>42

<210>43

<211>213

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>43

<210>44

<211>452

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>44

<210>45

<211>213

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>45

<210>46

<211>452

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>46

<210>47

<211>213

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>47

<210>48

<211>452

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>48

<210>49

<211>452

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>49

<210>50

<211>452

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>50

<210>51

<211>122

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>51

<210>52

<211>107

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>52

<210>53

<211>107

<212>PRT

＜213〉artificial sequence

<220>

＜223〉this sequence is a synthetic

<400>53

Claims (10)

1. One kind with people CD20 bonded humanized antibody or its Fab, wherein antibody is that effectively this antibody is at variable region of heavy chain (V to cutting down primate B cell in the body _H) comprise CDR3 sequence and people's heavy chain subgroup III (V at least from the SEQ ID NO.12 of anti-humen CD 20 antibody _HIII) people basically has framework (FR) residue.
2. 2. isolating nucleic acid, each antibody in its aforementioned claim of encoding.
3. 3. expression vector, each antibody in its aforementioned claim of encoding.
4. 4. host cell, it comprises the nucleic acid of claim 2.
5. 5. the method for the antibody of production claim 1 comprises the cell of the antibody of cultivating production claim 4, and reclaim antibody from cell culture.
6. 6. composition comprises the antibody and the carrier of claim 1.
7. 7. goods comprise a kind of container and the composition that is included in wherein, and wherein said composition comprises the antibody of claim 1.
8. 8. induce the method for apoptosis in the inherent B cell of a body, comprise the B cell is contacted with antibody in the claim 1, thereby kill the B cell.
9. 9. positive method for cancer of treatment CD20 comprises the humanization CD20 binding antibody in the claim 1 of the patient significant quantity of suffering from this cancer.
10. 10. method for the treatment of autoimmune disease comprises in the aforementioned claim of the patient significant quantity of suffering from this autoimmune disease any one humanization CD20 binding antibody.

Images