CN101415842A - QTLs for mastitis resistance in cattle - Google Patents

Abstract

The invention relates to a method for determining mastitis resistance in bovine subjects, wherein mastitis resistance comprise resistance to both sub-clinical and clinical mastitis. In particular, the method of the invention involves identification of genetic markers and/or Quantitative Trait Locus (QTL) for the determination of mastitis resistance in a bovine subject. The determination of mastitis resistance involves resolution of the specific microsatellite status. Furthermore, the invention relates to a diagnostic kit for detection of genetic marker(s) associated with mastitis resistance. The method and kit of the present invention can be applied for selection of bovine subjects for breeding purposes. Thus, the invention provides a method of genetically selecting bovine subjects with mastitis resistance, thereby yielding cows less prone to mastitis.

Description

The QTL of garget resistance

Invention field

The present invention relates to determine to be tried the method for garget resistance, it comprises that detection is positioned at least one genetic marker on ox karyomit(e) BTA9 and the BTA11.And the present invention relates to it and is used to detect the diagnostic kit that exists or do not have at least one genetic marker relevant with the mastitis resistance.

Background of invention

Mastitis is owing to infect or the mammary gland of the cow that wound causes or the inflammation of breast.Mastitis is considered to the disease of important economically ox.

This disease can be caused by multiple reason.The major cause of mastitis is invaded mammary gland by microorganism through teat-end and is caused.

Mastitis can be clinical or subclinical, and subclinical infection is prior to clinical manifestation.Clinical mastitis (CM) can be passed through to observe red and mammary gland swelling is red and swollen breast and the vision-based detection of passing through the generation of curd pieces.In case find, milk and the drum of mastitis ox separated, so just can not influence total milk quality.

Subclinical mastitis is the mastitis type by the milk sample characterization of tests positive after high somatic number (SCS), normal body temperature or high fever, the cultivation.Therefore, the vision-based detection of swelling that subclinical mastitis can not be by breast or the milk by observing mammary gland or generation.Because this reason, the farmer does not have to shift the selection from the milk of the ox that suffers from subclinical mastitis.Yet with the ox ratio that does not have to infect, this is low-quality milk, and can therefore pollute remaining milk in the drum.

Mastitis can wherein be carried out the analysis that somatocyte (white corpuscle) exists to the milk sample from ox by detecting with somatic number (SCS).Somatocyte is the part of the natural immunology defense of ox, and when breast infection, cell count increases.Somatic number in the milk sample can be by rolling-ball viscosimeter and the indirect estimation of Coulter-counter (coulter counter).

Because mastitis causes milk and milk preparation quality and quantity to descend, therefore, mastitis causes the financial loss of farmer and milk industry.Therefore, the ability of hereditary basis of determining the garget resistance is to milk industry, not only daily milk production and but also feeding and management, selection have the mastitis resistance tried have huge Economic Importance aspect the ox.Heredity select to have raising the mastitis resistance tried ox, it can produce not that the method for the ox of easy infection mastitis can be expectation.

A method of the hereditary determinant of identification inherited character is with linkage disequilibrium (LD) collection of illustrative plates, it is intended to utilize historical recon and is presented in some livestock classes that comprise milk cow, compare with the mankind, it spreads over (people such as Farnir, 2000) in the very long karyomit(e) section.In case after the mapping, quantitative trait locus (QTL) can usefully be used for the auxiliary selection of mark.

Linkage disequilibrium

Linkage disequilibrium has reflected the recombination event that dates back history, and the use of the LD collection of illustrative plates in a plurality of families has increased the resolving power of collection of illustrative plates.When the haplotype of observing in the group was inconsistent with the haplotype frequency of the prediction of multiplying each other by the frequency with the single genetic marker in each haplotype, LD just existed.Aspect this, the term haplotype refers to be present in the closely linked genetic marker of the cover of one on the karyomit(e), and it tends to heredity together.Effective for the LD mapping, density of genetic markers need be compatible with the distance that the LD that gives in the grouping extends.In the LD research of in the milk cow population, carrying out with a lot of genetic markers (284 euchromosome microsatellite markers), show that LD spreads all over the karyomit(e) internal labeling of tens centimorgans people such as (, 2000) Farnir.Similarly, Georges, the position of the genetic marker that M (2000) report links to each other with the particular phenotype of livestock has the fiducial interval (being equivalent to may be 500-1000 gene) (George, M., 2000) of 20-30cM basically.In order to use the collection of illustrative plates in the specific purpose zone with high fiducial interval, the existence of linkage disequilibrium is taken into account.

In the present invention, the quantitative character site relevant with clinical mastitis and/or SCS identified on ox karyomit(e) BTA9, and provide and determine to be tried the whether method of anti-mastitis of ox.

Summary of the invention

The ox of being tried that can select to have the mastitis resistance of increase has important economic interests in cattle-raising, and has therefore avoided the financial loss relevant with the animal that suffers from mastitis.The present invention can detect the genetic predisposition of opposing breast virus.The invention provides based on the genetic marker relevant and/or chain, determine to be tried the method for the anti-mastitis of ox with the mastitis resistance.

Therefore; an aspect of of the present present invention relates to the method for determining to be tried the anti-mastitis of ox; it comprises that there is or does not exist at least one genetic marker in detection in from the sample that is tried ox; itself and at least one linkage of characters of indicating the mastitis resistance; wherein said at least one genetic marker be positioned on the ox karyomit(e) BTA9 both sides for and comprise the zone of polymorphic micro-satellite markers C6orf93 and inra084; and/or the both sides on the BTA11 for and comprise the zone of polymorphic micro-satellite markers HELMTT43 and BM3501, the existence of wherein said at least one genetic marker or do not exist and indicated the described mastitis resistance of being tried ox or its offspring.

Second aspect of the present invention relates to diagnostic kit, it is used for detecting being tried ox and has or do not exist at least one genetic marker relevant with the mastitis resistance, it comprises at least one oligonucleotide sequence and combination thereof, and wherein nucleotide sequence is selected from SEQ ID NO.:1 to any one sequence of SEQ ID NO.:192 and/or their combination arbitrarily.

Description of drawings

Fig. 1: about the genome scanning of the BTA9 of the red ox of Denmark (Danish Red) family mastitis resistance feature.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to position used in this analysis, with the karyomit(e) distance of Morgan (Morgan) expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Fig. 2: about the genome scanning of the BTA9 of Denmark red ox family somatic number feature.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Fig. 3: about the genome scanning of the BTA9 of the anti-mastitis feature of Finland Ai Er prefecture ox (Finnish ayrshire) family.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Fig. 4: about the genome scanning of the BTA9 of Finland Ai Er prefecture ox family somatic number feature.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Fig. 5 a and 5b: the genome scanning of spending the BTA9 of ox (Swedish Red and White) the anti-mastitis feature of family about Trawas Red in vain.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Fig. 6 a and 6b: the genome scanning of spending the BTA9 of ox family somatic number feature about Trawas Red in vain.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Fig. 7: about the genome scanning of the BTA9 of the anti-mastitis feature of Denmark He Ersitanniu (Danish Holstein) family.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Fig. 8: about the genome scanning of the BTA9 of Denmark He Ersitanniu family somatic number feature.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Fig. 9: the QTL curve of mastitis resistance trait, it has shown in the red ox of Denmark between mark BMS2819 and INRA144 the LDLA/LD peak at the 74.08cM place.The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 10: the QTL curve of somatic number proterties, it has shown in the red ox of Denmark between mark BMS2819 and INRA144 the LDLA peak at the 74.075cM place.The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 11: the QTL curve of mastitis resistance trait, it has shown the LDLA peak between the mark BM4208 and INRA144 in Finland's Ai Er prefecture kind.The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 12: the QTL curve of mastitis resistance trait, it has shown the LDLA/LD peak between mark BMS2819 and INRA144 in the red ox of bonded Finland Ai Er prefecture ox and Denmark.The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 13: the QTL curve of mastitis resistance trait, it has shown at Trawas Red spends in vain in the ox at the mark BMS2819 of 60-80cM and the LA peak between the INRA144.The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 14: Trawas Red is spent the QTL curve of ox in vain, and it has shown the LDLA peak between mark BMS2819 and the INRA084.The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 15: the QTL curve of mastitis resistance trait, it has shown at Finland Ai Er prefecture ox, the red ox of Denmark and Trawas Red spends mark BMS4208 in the binding analysis of ox and the LDLA/LA peak between the INRA144 in vain.The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 16: the QTL curve of Denmark He Ersitan garget resistance trait.The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 17: in the red ox of Denmark at the 74.08cM place to the haplotype effect of mastitis resistance.The haplotype effect is on the y axle, and the haplotype number is on the x axle.Beginning has a large amount of female haplotype groups, then is male haplotype.

Figure 18: in Finland Ai Er prefecture ox at the 74.08cM place to the haplotype effect of mastitis resistance.The haplotype effect is on the y axle, and the haplotype number is on the x axle.Beginning has a large amount of female haplotype groups, then is male haplotype.

Figure 19: in the red and Finland Ai Er prefecture ox of bonded Denmark in of the influence of 74.08cM place haplotype to the mastitis resistance.The haplotype effect is on the y axle, and the haplotype number is on the x axle.Beginning has a large amount of female haplotype groups, then is male haplotype.

Figure 20: spend in vain in the ox in of the influence of 74.08cM place haplotype to the mastitis resistance red and Finland Ai Er prefecture of bonded Denmark and Trawas Red.The haplotype effect is on the y axle, and the haplotype number is on the x axle.Beginning has a large amount of female haplotype groups, then is male haplotype.

Figure 21: the BTA11 genome scanning that relates to the clinical mastitis properties and characteristics of Finland Ai Er prefecture ox family.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Figure 22: the BTA11 genome scanning that relates to the somatic number properties and characteristics of Finland Ai Er prefecture ox family.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Figure 23: relate to the BTA11 genome scanning that Trawas Red is spent the clinical mastitis properties and characteristics of ox family in vain.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Figure 24: relate to the BTA11 genome scanning that Trawas Red is spent the somatic number properties and characteristics of ox family in vain.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Figure 25: relate to the BTA11 genome scanning that a red ox of Denmark, eight Finland Ai Er prefecture oxen and four Trawas Reds are spent the clinical mastitis properties and characteristics of ox family in vain.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Figure 26: relate to the BTA11 genome scanning that a red ox of Denmark, eight Finland Ai Er prefecture oxen and four Trawas Reds are spent the somatic number properties and characteristics of ox family in vain.Numeral refers to " domestic animal registrating number ".The X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the test statistic with the qtl analysis of F value expression.

Figure 27: show the QTL curve of the clinical mastitis proterties at ox LDLA/LD peak, Finland Ai Er prefecture, the X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 28: the QTL curve of the clinical mastitis proterties at the LDLA/LD peak of demonstration Finland Niu Zhongsi the mark haplotype in Ai Er prefecture, the X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 29: the QTL curve of the somatic number proterties of LA, LDLA and LD curve in the demonstration Finland Ai Er prefecture ox, the X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 30: the demonstration Trawas Red is spent the QTL curve of the somatic number proterties of LA in the ox, LDLA and LD curve in vain, and the X-axle is represented according to the karyomit(e) distance of position used in this analysis with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 31: shown the QTL curve of the clinical mastitis proterties of LA, LDLA and LD curve in the binding analysis of 14 families of the red cattle breeds in Northern Europe, the X-axle is represented according to the karyomit(e) distance of position used in this analysiss with the Morgan expression.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 32: shown that in the binding analysis of 14 families the X-axle is represented according to the karyomit(e) distance of position used in this analysiss with the Morgan expression from the QTL curve of the somatic number proterties of the QTL curves of three red oxen in Northern Europe.The Y-axle is represented the likelihood ratio test statistic of qtl analysis.

Figure 33: in Finland Ai Er prefecture ox at the 17.8cM place to 4 mark haplotype effects of clinical mastitis.The haplotype effect is on the y-axle, and the haplotype number is on the x axle.Beginning has a large amount of female haplotype groups, and male haplotype is arranged thereafter.

Detailed Description Of The Invention

The present invention relates to the genetic determination bunch of Mastitis resistance in the milk cow. The generation of mammitis, clinical and subclinical mammitis all relate to the heavy economic losses of milk industry. Therefore, identify those tested oxen with anti-mammitis genetic predisposition and have economic interests. Tested ox with such genetic predisposition is the carrier of anticipant character, and these proterties can be delivered to its offspring.

Term " tested ox " refers to the ox of any kind and should comprise cow and bull, that no matter grow up or newborn ox. This term represents the animal at non-concrete age. The example of tested ox is He Ersitan (Holstein) cattle breeds member. One preferred embodiment in, tested ox is that He Ersitanfulisiniu (Holstein-Friesian) plants group members. In another embodiment, tested ox is Holstein Swartbont ox kind group members. In another embodiment, tested ox is German Holstein Schwarzbunt ox kind group members. In another embodiment, tested ox is U.S. He Ersitanniu kind group members. In one embodiment, tested ox is red Bai Heersitan flower cattle breeds member. In another embodiment, tested ox is German Holstein Schwarzbunt ox kind group members. In one embodiment, tested ox is any family member, and it comprises He Ersitan cattle breeds member. One preferred embodiment in, tested ox is Denmark's red ox kind group members. Another preferred embodiment in, tested ox is Finland's Ai Er prefecture ox kind group members. In another embodiment, tested ox is that Trawas Red is spent ox kind group members in vain. In further embodiment, tested ox is Denmark He Ersitan kind group members. In another embodiment, tested ox is that Trawas Red is spent ox kind group members in vain. In another embodiment, tested ox is Northern Europe red ox kind group members.

In an embodiment of the invention, tested ox is selected from by Trawas Red and spends the group that ox, the red ox of Denmark, Finland Ai Er prefecture ox, the red ox of He Ersitanfulisiniu, Denmark He Ersitanniu and Northern Europe consist of in vain. In yet another embodiment of the present invention, tested ox is selected from by Finland Ai Er prefecture ox and Trawas Red and spends the group that ox consists of in vain. In yet another embodiment of the present invention, tested ox is selected from Finland Ai Er prefecture ox and Trawas Red and spends the group that ox consists of in vain.

In one embodiment, tried ox and be selected from the kind group shown in the table 1a.

Table 1a ICRA (the international animal coding council) specified variety name and kind code

Kind kind code country variety name clause
	A Bangdangsiniu (Abondance) AB-
Tyrol ash ox (Tyrol Grey) AL 2.2
	Angus (Angus) AN 2.1
Bake ox (Aubrac) AU difficult to understand
	Ai Er prefecture ox (Ayrshire) AY 2.1
Belgium blue ox (Belgian Blue) BB
	(Blonde d ' is BD Aquitaine) for Blang moral-An Kuitanniu
Skin Mace beef cattle (Beefmaster) BM
	Mother-in-law sieve's Ford ox (Braford) BO
Brahman (Brahman) BR

Brangus (Brangus) BN
	Brown Swiss cattle (Brown Swiss) BS 2.1
Chianina (Chianina) CA
	Xia Luolainiu (Charolais) CH
Dexter cow (Dexter) DR
	Gallo dimension ox (Galloway) GA 2.2
Ge Enxiniu (Guernsey) GU
	Ge Erbuweiniu (Gelbvieh) GV
Country of origin Hereford ox (Hereford, homed) HH
	Acerous Hereford ox (Hereford, polled) HP
Highland cattle (Highland Cattle) HI
	He Ersitanniu HO 2.2
Ze Xiniu (Jersey) JE
	Limousin cow (Limousin) LM
Climing peace mushroom ox (Maine-Anjou) MA
	China ink auspicious grey ox (Murray-Grey) MG
Cover inferior ox (Montbeliard) MO of Baily
	Marchigiana MR
Normandie cow (Normandy) NO **
	The PI of Pi De Mongolia Ox (Piedmont) 2.2
Pinzgau PZ
	Europe red dairy bread (European Red Dairy [RE] * 2.1，2.2 Breed)
Rome Nola ox (Romagnola) RN
	The red ox RW that spends in vain of He Ersitan *** 2.2
Celarie ox (Salers) SL *
	Sheng Geludiniu (Santa Gertrudis) SG
South Devon (South Devon) SD
	Shorthorn (Shorthorn) [SH] * 2.2
Simmental (Simmental) SM 2.2
	Sha Xihuaniu (Sahiwal) SW
Ta Langtaiziniu (Tarentaise) TA
	Ox (Welsh Black) WB is deceived in Wales
Buffalo (CHINESE BUFFALO (Bubalis bubalis)) BF
	*The new variety code **The change of previous code is because the existing code in the French ***The WW that the U.S. is proposed

In one embodiment, being tried ox is to be selected from the kind group shown in the table 1b

Table 1b variety name

Country's variety nameEnglish name country title
	Angus comprises that Aberdeen Angus Canada Angus U.S. Angus Germany Angus Ai Er prefecture ox is included in the Ai Er prefecture ox of following country: Australian Canadian Colombia

Czech Republic Finland Kenya New Zealand Norway ( NRF) Russian South Africa Sweden ( SRB) and SAB Great Britain and America Zimbabwe Belgian Blue Niu Faguo: Blanc-bleu Belge Flanders: the Italian Razza Bruna of Witblauw Ras van Belgic Brown Swiss cattle Germany Braun bull (Braunvieh) France Blang ox (Brune) Spain Bruna Parda Alpina Serbia-Croatia Slovenacko belo Czech Hnedy Karpatsky Romania Shivitskaja Russia Bruna Bulgaria red dairy bread in Blgarska kafyava Europe comprises that Denmark red ox big belly Ge Luniu (Angeln) Trawas Red spends the ox Rosso Norvegian in vain and spend ox Estonia red ox Latvia brown ox Lithuania red ox Byelorussia red ox Poland red ox in lowland (Polish RedL owland) in vain

In one embodiment, being tried ox is to be selected from the kind group shown in the table 1c.

Table 1c variety name

Term " genetic marker " refers to the various nucleotide sequences (polymorphism) of DNA on the ox karyomit(e), and with an allelotrope and another differentiation.Various nucleotide sequences can be discerned by the known method of those skilled in the art of the present technique, for example by using as the specific oligonucleotides in amplification method and/or observing big or small difference.Yet various oligonucleotide sequences also can be by order-checking or restriction fragment length polymorphism analyzing and testing for example.Various nucleotide sequences can provide by disappearance, insertion, repetition and/or point mutation.

One type of genetic marker is microsatellite marker, and itself and quantitative trait locus are chain.Microsatellite marker refers to the short sequence of multiple after mutually.In short sequence, be Nucleotide for example, as two Nucleotide, three Nucleotide for example, as four Nucleotide, five Nucleotide for example, as six Nucleotide, seven Nucleotide for example, as eight Nucleotide, nine Nucleotide for example are as ten Nucleotide.Yet, change sometimes, and the multiple number can increase or reduce.(people 1997 such as Kappes can be found in the concrete definition of polymorphic micro-satellite markers and site in the USDA genetic map; Or by being connected to U.S. livestock raised for meat research centre http://www.marc.usda.gov/).

In addition, be understandable that the nucleotide sequence of genetic marker of the present invention and the mastitis resistance trait genetic linkage that is tried ox.Therefore, be appreciated that also the number of genetic marker can result from DNA zone (one or mores') nucleotide sequence, its both sides for and have a genetic marker according to method of the present invention.

Term " quantitative trait locus (QTL) " is the DNA zone of relevant with specific proterties (as plant height).Although need not to be gene itself, QTL is one section sequence of DNA, its be described proterties based gene close linkage.

Term " mastitis " for example is used in this application describe and characterizes by subclinical mastitis and the clinical mastitis that characterizes as high somatic number (SCS).

Term " mastitis resistance " and " anti-mastitis " are used interchangeably, and relate to the fact that some are tried ox susceptible mastitis unlike other is tried ox.When as carry out the analysis that some are tried ox in the present invention, when determining the genetic marker relevant, hint that the proterties of anti-mastitis can be by in the existence of being analyzed that is tried the chain genetic marker of the clinical mastitis of Niu Zhongyu and/or the generation of subclinical mastitis or do not exist and observe with the mastitis resistance.Be understandable that the mastitis resistance comprises resistance trait, its influence is tried ox or its offspring's udder health.Therefore, the mastitis resistance of bull shows on health by its female offspring.

The mastitis resistance is marked

Daughter to bull carries out mastitis resistance and SCC scoring.Somatic number (SCS) is defined as log ¹⁰The somatic number numerical value from milk record scheme that transforms (with 10, mean value 000/mL).Mean value is taken from the period of the back 10 to 180 that calves.With unisexuality shape BLUP (BLUP) animal model of ignoring family structure, the estimated breeding value (estimated breedingvalue) that calculates male son's proterties (EBV).These EBV use in QTL.The daughter who uses in individual proterties is registered as:

Clinical mastitis in the Denmark ox: the treatment case of the back clinical mastitis during-5 to 50 days of farrowing for the first time.

Clinical mastitis in Sweden and Finland ox: the treatment case of the back clinical mastitis during-7 to 150 days of farrowing for the first time.

SCS in the Denmark ox: the back average SCS during 10-180 days for the first time farrows.

SCS in the Sweden ox: the back average SCS during 10-150 days for the first time farrows.

SCS in the Finland ox: the back average SCS during 10-305 days for the first time farrows.

In an embodiment of the invention, method and test kit described herein relate to mastitis anti-inflammatory resistance.In yet another embodiment of the present invention, method and test kit described herein relate to clinical mastitis resistance.In another embodiment, method of the present invention and test kit relate to subclinical mastitis resistance, as detecting by somatic number.In another embodiment, method of the present invention and test kit relate generally to as detect by somatic number with the clinical mastitis resistance of subclinical mastitis resistance bonded.

Sample

The method according to this invention comprises analyzes the sample that is tried ox, and wherein said sample can be any suitable sample that can be provided for the ox genetic stocks in the described method.If desired, the ox genetic stocks can be as extraction thing (hair or nail), milk and/or the seminal fluid cut from blood sample, tissue sample (for example spleen, buccal smear), body surface, separation and purifying.Sample can be fresh or refrigerated.

Sequence polymorphism of the present invention comprises at least one nucleotide difference, as at least two nucleotide differences, as at least three nucleotide differences, as at least four nucleotide differences, as at least five nucleotide differences, as at least six nucleotide differences, as at least seven nucleotide differences, as at least eight nucleotide differences, as at least nine nucleotide differences, as at least 10 nucleotide differences.Described nucleotide difference comprises Nucleotide difference, disappearance and/or insertion or their any combination.

Granddaughter's design

Granddaughter design comprises analyzes data from the mark of DNA base to widely used ancestral male animal in the breeding and the son that produced offspring's ancestral male animal.The phenotypic data that uses with the dna marker data is from son's daughter.Such phenotypic data can be as the feature of giving milk, relate to the feature of farrowing, meat quality or disease.One group of daughter heredity from their fathers' a allelotrope, yet second group of daughter's heredity from other allelotrope of their fathers.From these two groups of data, can obtain the information whether specific chromosome segment carries one or more genes of the described proterties of influence by relatively.Can conclude whether QTL is present in this chromosome segment.

The prerequisite of carrying out granddaughter's design is to obtain detailed phenotypic data.In the present invention, such data have been obtainable (http://www.lr.dk/kvaeg/diverse/principles.pdf).

QTL is the abbreviated form of quantitative trait locus.The gene of giving the individual amount proterties can seem one or more genes by observation and be positioned at the chromosome segment of this chromosome segment, finds in indirect mode.

On the contrary, when some dna markers of the offspring of one or two parent and they had been determined, dna marker can directly be used to provide the information that entails one or more their offsprings' proterties from the parent.Mark can be used to calculate the chromosomal hereditary history that links to each other with dna marker.

Chromosomal region and mark

BTA is the abbreviation of ox euchromosome (Bos Taurus autosome).

One aspect of the present invention relates to the method for determining to be tried the garget resistance; it comprises the genetic marker that detection exists or do not exist at least one and at least one indication mastitis resistance trait to link to each other in from the described sample that is tried ox; wherein said at least one genetic marker be positioned on the ox karyomit(e) BTA9 both sides for and comprise the zone of polymorphic micro-satellite markers C6orf93 and inra084; and/or the both sides on the BTA11 for and comprise the zone of polymorphic micro-satellite markers HELMTT43 and BM3501, the existence of wherein said at least one genetic marker or do not exist and indicated the described mastitis resistance of being tried ox or its offspring.

Owing to the notion of linkage disequilibrium described herein, the present invention also relates to determine to be tried the mastitis resistance of ox, the wherein anti-mastitis linkage of characters of at least one genetic marker and ox.

In order to determine to be tried the mastitis resistance in the ox, be understandable that, can use genetic marker in the present invention greater than one.For example, at least one genetic marker can be the combination of two or more at least genetic markers, can increase accuracy like this, as at least three genetic markers, four genetic markers for example, as at least five genetic markers, six genetic markers for example, as at least seven genetic markers, eight genetic markers for example, as at least nine genetic markers, ten genetic markers for example.

Described at least one genetic marker can be positioned at least one ox karyomit(e), as two karyomit(e)s, as three karyomit(e)s, as four karyomit(e)s, as five karyomit(e)s and/or six karyomit(e)s.Described at least one genetic marker can be positioned on the ox karyomit(e) 9.Yet described at least one genetic marker can be the combination that is positioned at the mark on the coloured differently body.

Described at least one genetic marker can be selected from any single marking in the table shown here.

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA9.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA9 are and comprise mark C6orf93 and rgs17.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 69.35cM of ox karyomit(e) BTA9 to about 79.8cM (position used according to this analysis).The group that described at least one genetic marker selects the mark shown in the Free Surface 1d to form.

Table 1d

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			C6orf93 *	69.35	-
DIK4986	69.4	84.258
			mm12e6 *	69.45	84.258
PEX3 *	69.5	-

DEAD21	69.55	-
			BMS2251	71.3	86.58
EPM2A *	72.1
			BM7234	72.3	88.136
BM4208	73.9	90.69
			BMS2819	73.95	90.98
INRA144	74.2	90.98
			INRA084	74.5	90.98
rgs17 *	79.8	-

^*Expression BTA9 is not listed in mark on the MARC signature.

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA9.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of BTA9 on the ox karyomit(e) are and comprise mark C6orf93 and inra084.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 69.35cM of ox karyomit(e) BTA9 to about 74.5cM (position used according to this analysis).According to MARC mark collection of illustrative plates, the position of genetic marker inra084 is 90.98.The group that described at least one genetic marker selects the mark shown in the Free Surface 2 to form.

Table 2

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			C6orf93 *	69.35	-
DIK4986	69.4	84.258
			mm12e6 *	69.45	84.258
PEX3 *	69.5	-
			DEAD21	69.55	-
BMS2251	71.3	86.58
			EPM2A *	72.1
BM7234	72.3	88.136
			BM4208	73.9	90.69
BMS2819	73.95	90.98
			INRA144	74.2	90.98
INRA084	74.5	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA9 for and comprise the zone of mark bms2251 and inra 084.In an embodiment of the invention, described at least one genetic marker about 71.3cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 74.5cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 86.58cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 3 to form.

Table 3

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BMS2251	71.3	86.58
EPM2A *	72.1
			BM7234	723	88.136
BM4208	73.9	90.69
			BMS2819	73.95	90.98
INRA144	742	90.98
			INRA084	74.5	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA9 are and comprise mark bms 2251 and inra 144.In an embodiment of the invention, described at least one genetic marker about 71.3cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 74.2cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 86.58cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 4 to form.

Table 4

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BMS2251	71.3	86.58
EPM2A *	72.1
			BM7234	723	88.136
BM4208	73.9	90.69
			BMS2819	73.95	90.98
INRA144	74.2	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA9 are and comprise mark bm7234 and inra 084.In an embodiment of the invention, described at least one genetic marker about 72.3cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 74.5cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 88.136cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 5 to form.

Table 5

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BM7234	72.3	88.136
BM4208	73.9	90.69
			BMS2819	73.95	90.98
INRA144	742	90.98
			INRA084	74.5	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA9 for and comprise the zone of mark bm7234 and inra144.In an embodiment of the invention, described at least one genetic marker about 72.3cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 74.2cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 88.136cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 6 to form.

Table 6

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BM7234	723	88.136
BM4208	73.9	90.69
			BMS2819	73.95	90.98
INRA144	74.2	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA9 for and comprise the zone of mark bm7234 and bms2819.In an embodiment of the invention, described at least one genetic marker about 72.3cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 73.95cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 88.136cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 7 to form.

Table 7

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BM7234	72.3	88.136
BM4208	73.9	90.69
			BMS2819	73.95	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA9 are and comprise mark bm7234 and bm4208.In an embodiment of the invention, described at least one genetic marker about 72.3cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 73.9cM (position used according to this analysiss) with arrive the zone of about 90.69cM according to about 88.136cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 8 to form.

Table 8

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BM7234	72.3	88.136
BM4208	73.9	90.69

^*The mark of on the MARC signature, not listing of expression BTA9.

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA9 for and comprise the zone of mark bms2819 and inra144.In an embodiment of the invention, described at least one genetic marker about 73.95cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 74.2cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 90.98cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 9 to form.

Table 9

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BMS2819	73.95	90.98
INRA144	74.2	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA9 are and comprise mark bms2819 and inra084.In an embodiment of the invention, described at least one genetic marker about 73.95cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 74.5cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 90.98cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 10 to form.

Table 10

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BMS2819	73.95	90.98
INRA144	742	90.98
			INRA084	745	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA9.In one embodiment, described at least one genetic marker both sides of being positioned at BTA9 on the ox karyomit(e) for and comprise that mark shows the zone of bm4208 and inra144.In an embodiment of the invention, described at least one genetic marker about 73.9cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 74.2cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 90.69cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 11 to form.

Table 11

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BM4208	73.9	90.69
BMS2819	73.95	90.98
			INRA144	74.2	90.98
INRA084	74.5	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA9 for and comprise the zone of mark inra 144 and inra 084.In an embodiment of the invention, described at least one genetic marker about 74.2cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 74.5cM (position used according to this analysiss) with arrive the zone of about 90.98cM according to about 90.98cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 12 to form.

Table 12

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			INRA144	74.2	90.98
INRA084	74.5	90.98

^*The mark of on the MARC signature, not listing of expression BTA9.

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA9 for and comprise the zone of mark bms2251 and bm7234.In an embodiment of the invention, described at least one genetic marker about 71.3cM of being arranged in ox karyomit(e) BTA9 is to the zone of about 72.3cM (position used according to this analysiss) with arrive the zone of about 88.136cM according to about 86.58cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 13 to form.

Table 13

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			BMS2251	71.3	86.58
EPM2A *	72.1
			BM7234	72.3	88.136

^*The mark of on the MARC signature, not listing of expression BTA9.

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA9 are and comprise mark EPM2A and bm7234.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 72.1cM of ox karyomit(e) BTA9 to about 72.3cM (position used according to this analysis), and concerning bm7234, according to the zone of about 88.136cM of MARC mark collection of illustrative plates.The group that described at least one genetic marker selects the mark shown in the Free Surface 14 to form.

Table 14

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			EPM2A *	72.1
BM7234	72.3	88.136

^*The mark of on the MARC signature, not listing of expression BTA9.

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA9.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA9 are and comprise mark inra144 and rgs17.In an embodiment of the invention, about 74.2cM that described at least one genetic marker is arranged in ox karyomit(e) BTA9 is to the zone of about 79.8cM (position used according to this analysis), and wherein the position according to the inra 144 of MARC mark collection of illustrative plates is 90.98cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 15 to form.

Table 15

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			INRA144	74.2	90.98
INRA084	74.5	90.98
			rgs17 *	79.8	-

^*The mark of on the MARC signature, not listing of expression BTA9.

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA9.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA9 are and comprise mark inra084 and rgs17.In an embodiment of the invention, about 74.5cM that described at least one genetic marker is arranged in ox karyomit(e) BTA9 is to the zone of about 79.8cM (position used according to this analysis), and wherein the position according to the inra084 of MARC mark collection of illustrative plates is the zone of 90.68cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 16 to form.

Table 16

Mark on the BTA9	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/
			INRA084	74.5	90.98
rgs17 *	79.8	-

^*The mark of on the MARC signature, not listing of expression BTA9.

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark HELMTT43 and BM3501.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 2.249cM of ox karyomit(e) BTA11 to about 97.223cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 17 to form.

Table 17

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			HELMTT43	0.0	2.249
ZAP70 *	54	-
			MAP4K4 *	10.5	-
IL18RA *	12.3	-
			MNB-40	16.0	19.440
AUP1 *	17.6	-
			BM716	17.9	19.440

DIK2653	18.1	20.135
			BMS2569	18.3	21.082
BMS2325	18.5	21.082
			BMS1953	18.8	21.537
DIK4637	19.4	22.527
			UMBTL103	21.8	23.829
BP38	22.6	24.617
			MNB-70	228	24.617
BM2818	26.5	30.009
			BM304	30.0	33.597
INRA177	32.5	35.098
			UMBTL20	327	34.802
RM96 *	38.0	-
			INRA131	43.6	47.289
BM7169	46.8	50.312
			BMS1716	50.2	54581
BM6445	55.1	61.570
			CD8B *	56.9	-
MB110	59.6	68.679
			MS2177	61.0	69.415
HELMTT44 *	61.2	-
			DIK5170	61.4	70.143
RM150	61.8	70.143
			TGLA58	63.1	73.136
TGLA340	65.8	75.208
			BM8118	67.2	77.063
BMS2047	68.8	78457
			BMS1048	69.5	81.065
BMS989	78.9	92.179
			BM3501	85.2	97.223

^*These marks are not listed on the MARC mark collection of illustrative plates of BTA11, but are identified by the inventor.It is applicable to all tables herein.

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark HELMTT43 and INRA177.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 2.249cM of ox karyomit(e) BTA11 to about 35.098cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 18 to form.

Table 18

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			HELMTT43	0.0	2.249
ZAP70 *	5.4	-
			MAP4K4 *	10.5	-
IL18RA *	12.3	-
			MNB-40	16.0	19.440
AUP1 *	17.6	-
			BM716	17.9	19.440
DIK2653	18.1	20.135
			BMS2569	18.3	21.082
BMS2325	18.5	21.082
			BMS1953	18.8	21.537
DIK4637	19.4	22.527
			UMBTL103	21.8	23829
BP38	22.6	24.617
			MNB-70	22.8	24.617
BM2818	26.5	30.009
			BM304	30.0	33.597
INRA177	325	35.098

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA11 for and comprise the zone of mark HELMTT43 and MNB-70.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 2.249cM of ox karyomit(e) BTA11 to about 24.617cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 19 to form.

Table 19

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			HELMTT43	0.0	2.249
ZAP70 *	5.4	-
			MAP4K4 *	10.5	-
IL18RA *	12.3	-
			MNB-40	16.0	19.440
AUP1 *	17.6	-
			BM716	17.9	19.440
DIK2653	18.1	20.135
			BMS2569	18.3	21.082
BMS2325	18.5	21.082
			BMS1953	18.8	21.537
DIK4637	19.4	22.527

UMBTL103	21.8	23.829
			BP38	22.6	24.617
MNB-70	22.8	24.617

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark MNB-40 and MNB-70.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 19.440cM of ox karyomit(e) BTA11 to about 24.617cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 20 to form.

Table 20

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			MNB-40	16.0	19.440
AUP1 *	17.6	-
			BM716	17.9	19.440
DIK2653	18.1	20.135
			BMS2569	18.3	21.082
BMS2325	18.5	21.082
			BMS1953	18.8	21.537
DIK4637	19.4	22.527
			UMBTL103	21.8	23.829
BP38	22.6	24.617
			MNB-70	22.8	24.617

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark BP38 and INRA131.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 24.617cM of ox karyomit(e) BTA11 to about 47.289cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 21 to form.

Table 21

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BP38	22.6	24.617
MNB-70	22.8	24.617
			BM2818	26.5	30.009
BM304	30.0	33.597
			INRA177	325	35.098
UMBTL20	32.7	34.802
			RM96 *	38.0	-
INRA131	43.6	47.289

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA11 for and comprise the zone of mark BM2818 and INRA177.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 30.009cM of ox karyomit(e) BTA11 to about 35.098cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 22 to form.

Table 22

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BM2818	26.5	30.009
BM304	30.0	33.597
			INRA177	32.5	35.098

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA11 for and comprise the zone of mark BMS1953 and BM2818.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 21.537cM of ox karyomit(e) BTA11 to about 30.009cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 23 to form.

Table 23

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BMS1953	18.8	21.537
DIK4637	19.4	22.527
			UMBTL103	21.8	23.829
BP38	22.6	24.617
			MNB-70	22.8	24.617
BM2818	26.5	30.009

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark HELMTT43 and ZAP70.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 2.249cM (according to MARC mark collection of illustrative plates) of ox karyomit(e) BTA11 to about 5.4cM (position used according to this analysis).The group that described at least one genetic marker selects the mark shown in the Free Surface 24 to form.

Table 24

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			HELMTT43	0.0	2.249
ZAP70 *	54	-

In another embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark ZAP70 and IL18RA.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 5.4cM of ox karyomit(e) BTA11 to about 12.3cM (position used according to this analysis).The group that described at least one genetic marker selects the mark shown in the Free Surface 25 to form.

Table 25

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			ZAP70 *	5.4	-
MAP4K4 *	10.5	-
			IL18RA *	12.3	-

In yet another embodiment of the present invention, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark INRA131 and BM6445.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 47.289cM of ox karyomit(e) BTA11 to about 61.570cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 26 to form.

Table 26

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			INRA131	43.6	47.289
BM7169	46.8	50.312
			BMS1716	50.2	54.581
BM6445	55.1	61.570

In yet another embodiment of the present invention, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark BM304 and BM7169.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 33.597cM of ox karyomit(e) BTA11 to about 50.312cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 27 to form.

Table 27

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BM304	30.0	33.597
INRA177	32.5	35.098

UMBTL20	32.7	34.802
			RM96 *	38.0	-
INRA131	43.6	47.289
			BM7169	46.8	50.312

In yet another embodiment of the present invention, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark BM7169 and DIK5170.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 50.312cM of ox karyomit(e) BTA11 to about 70.143cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 28 to form.

Table 28

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BM7169	46.8	50.312
BMS1716	50.2	54.581
			BM6445	55.1	61.570
CD8B *	56.9	-
			MB110	59.6	68.679
MS2177	61.0	69.415
			HELMTT44 *	61.2	-
DIK5170	61.4	70.143

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA11 for and comprise the zone of mark BM6445 and BMS1048.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 61.570cM of ox karyomit(e) BTA11 to about 81.065cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 29 to form.

Table 29

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BM6445	55.1	61.570
CD8B *	56.9	-
			MB110	59.6	68.679
MS2177	61.0	69.415
			HELMTT44 *	61.2	-
DIK5170	61.4	70.143
			RM150	61.8	70.143
TGLA58	63.1	73.136
			TGLA340	65.8	75.208

BM8118	67.2	77.063
			BMS2047	68.8	78.457
BMS1048	69.5	81.065

In further embodiment, the both sides that described at least one genetic marker is positioned at ox karyomit(e) BTA11 for and comprise the zone of mark MB110 and BMS2047.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 68.679cM of ox karyomit(e) BTA11 to about 78.457cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 30 to form.

Table 30

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			MB110	59.6	68.679
MS2177	61.0	69.415
			HELMTT44 *	61.2	-
DIK5170	61.4	70.143
			RM150	61.8	70.143
TGLA58	63.1	73.136
			TGLA340	65.8	75.208
BM8118	67.2	77.063
			BMS2047	68.8	78.457

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark IL18RA and BM2818.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 12.3cM (position used according to this analysis) of ox karyomit(e) BTA11 to about 30.009cM (according to MARC mark collection of illustrative plates).The group that described at least one genetic marker selects the mark shown in the Free Surface 31 to form.

Table 31

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			IL18RA *	12.3	-
MNB-40	16.0	19.440
			AUP1 *	17.6	-
BM716	17.9	19.440
			DIK2653	18.1	20.135
BMS2569	18.3	21.082
			BMS2325	18.5	21.082
BMS1953	18.8	21.537

DIK4637	19.4	22.527
			UMBTL103	21.8	23.829
BP38	22.6	24.617
			MNB-70	22.8	24.617
BM2818	26.5	30.009

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark BM2818 and BM7169.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 30.009cM of ox karyomit(e) BTA11 to about 50.312cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 32 to form.

Table 32

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			IL18RA *	12.3	-
BM2818	26.5	30.009
			BM304	30.0	33.597
INRA177	32.5	35.098
			UMBTL20	32.7	34.802
RM96 *	38.0	-
			INRA131	43.6	47.289
BM7169	46.8	50.312

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark MAP4K4 and BM2818.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 10.5cM (position used according to this analysis) of ox karyomit(e) BTA11 to about 30.009cM (according to MARC mark collection of illustrative plates).The group that described at least one genetic marker selects the mark shown in the Free Surface 33 to form.

Table 33

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			MAP4K4 *	10.5	-
IL18RA *	12.3	-
			MNB-40	16.0	19.440
AUP1 *	17.6	-
			BM716	17.9	19.440

DIK2653	18.1	20.135
			BMS2569	18.3	21.082
BMS2325	18.5	21.082
			BMS1953	18.8	21.537
DIK4637	19.4	22.527
			UMBTL103	21.8	23.829
BP38	22.6	24.617
			MNB-70	22.8	24.617
BM2818	26.5	30.009

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark IL18RA and UMBTL103.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 12.3cM (position used according to this analysis) of ox karyomit(e) BTA11 to about 23.829cM (according to MARC mark collection of illustrative plates).The group that described at least one genetic marker selects the mark shown in the Free Surface 34 to form.

Table 34

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			IL18RA *	12.3	-
MNB-40	16.0	19.440
			AUP1 *	17.6	-
BM716	17.9	19.440
			DIK2653	18.1	20.135
BMS2569	18.3	21.082
			BMS2325	18.5	21.082
BMS1953	18.8	21.537
			DIK4637	19.4	22.527
UMBTL103	21.8	23.829

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark MNB-40 and DIK2653.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 19.440cM of ox karyomit(e) BTA11 to about 20.135cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 35 to form.

Table 35

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			MNB-40	16.0	19.440
AUP1 *	17.6	-
			BM716	17.9	19.440
DIK2653	18.1	20.135

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark BM716 and DIK4637.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 19.440cM of ox karyomit(e) BTA11 to about 22.527cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 36 to form.

Table 36

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BM716	17.9	19.440
DIK2653	18.1	20.135
			BMS2569	18.3	21.082
BMS2325	18.5	21.082
			BMS1953	18.8	21.537
DIK4637	19.4	22.527

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark BM716 and BMS2569.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 19.440cM of ox karyomit(e) BTA11 to about 21.082cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 37 to form.

Table 37

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BM716	17.9	19.440
DIK2653	18.1	20.135
			BMS2569	18.3	21.082

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark BMS2325 and DIK4637.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 21.082cM of ox karyomit(e) BTA11 to about 22.527cM.The group that described at least one genetic marker selects the mark shown in the Free Surface 38 to form.

Table 38

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			BMS2325	18.5	21.082
BMS1953	18.8	21.537
			DIK4637	19.4	22.527

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark IL18RA and AUP1.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 12.3cM (position used according to this analysis) of ox karyomit(e) BTA11 to about 17.6cM (position used according to this analysis).The group that described at least one genetic marker selects the mark shown in the Free Surface 39 to form.

Table 39

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			IL18RA *	12.3	-
MNB-40	16.0	19.440
			AUP1 *	17.6	-

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark IL18RA and MNB-40.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 12.3cM (position used according to this analysis) of ox karyomit(e) BTA11 to about 19.440cM (according to MARC mark collection of illustrative plates).The group that described at least one genetic marker selects the mark shown in the Free Surface 40 to form.

Table 40

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			IL18RA *	12.3	-
MNB-40	16.0	19.440

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark MNB-40 and AUP1.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 19.440cM (according to MARC mark collection of illustrative plates) of ox karyomit(e) BTA11 to about 17.6cM (position used according to this analysis).The group that described at least one genetic marker selects the mark shown in the Free Surface 41 to form.

Table 41

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			MNB-40	16.0	19.440
AUP1 *	17.6	-

In yet another embodiment of the present invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that comprises mark IL18RA of ox karyomit(e) BTA11.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 12.3cM (position used according to this analysis) of ox karyomit(e) BTA11.Described at least one genetic marker is shown in table 42.

Table 42

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			IL18RA *	12.3	-

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that comprises mark MNB-40 of ox karyomit(e) BTA11.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 16.0cM (position used according to this analysis) of ox karyomit(e) BTA11.Described at least one genetic marker is shown in table 43.

Table 43

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			MNB-40	16.0	19.440

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that comprises mark AUP1 of ox karyomit(e) BTA11.In an embodiment of the invention, described at least one genetic marker is arranged in the zone of about 17.6cM (position used according to this analysis) of ox karyomit(e) BTA11.Described at least one genetic marker is shown in table 44.

Table 44

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			AUP1 *	17.6	-

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) BTA11 are and comprise mark DIK4637 and UMBTL103.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 22.527cM of ox karyomit(e) BTA11 to about 23.829cM (according to MARC mark collection of illustrative plates).The group that described at least one genetic marker selects the mark shown in the Free Surface 45 to form.

Table 45

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			DIK4637	19.4	22.527
UMBTL103	21.8	23.829

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that comprises mark DIK4637 of ox karyomit(e) BTA11.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 22.527cM (according to MARC mark collection of illustrative plates) of ox karyomit(e) BTA11.Described at least one genetic marker is shown in table 46.

Table 46

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			DIK4637	19.4	22.527

In an embodiment of the invention, described at least one genetic marker is positioned on the ox karyomit(e) BTA11.In one embodiment, described at least one genetic marker is positioned at the zone that comprises mark UMBTL103 of ox karyomit(e) BTA11.In an embodiment of the invention, described at least one genetic marker is positioned at the zone of about 23.829cM (according to MARC mark collection of illustrative plates) of ox karyomit(e) BTA11.Described at least one genetic marker is shown in table 47.

Table 47

Mark on the BTA11	The position of using in the analysis (cM)	Relative position (cM) http://www.marc.usda.gov/genome/cattle/cattle.html
			UMBTL103	21.8	23.829

In yet another embodiment of the present invention, described at least one genetic marker is the combination of mark, and wherein any zone of BTA9 and mark combine with any zone and the mark of BTA11, and as above its place is stated.

Primer

Operable primer is presented in the table 50 according to the present invention.The specified primer of table 50 to can be separately or with table 50 listed or above primer to being used in combination.

The such primer or the design of probe are conspicuous to the molecular biology personnel with ordinary skill.Such primer is any suitable length as reaching 50 bases, reach 40 bases, more suitable reaching 30 bases, and is long as 8-25 or 8-15 base.Usually such primer comprises the complete complementary base sequence of corresponding wild type or varient site with described zone.Yet, if desired, can introduce one or above mispairing, as long as the recognition capability of oligonucleotide probe is not affected excessively.Primer/probe of the present invention can carry one or above mark, so that detect.

In one embodiment, the sequence that contains single nucleotide polymorphism that described primer and/or probe can hybridize to and/or amplified hybridization is described to the mark from here.

Primer nucleotide sequence of the present invention further comprises: (a) hybridize to any nucleotide sequence that comprises genetic marker sequence or its complementary sequence or RNA product under rigorous condition, as in 6 * sodium chloride/sodium citrate (SSC), hybridizing to filter membrane bonded DNA under about 45 ℃, then under about 50-65 ℃, in 0.2 * SSC/0.1% sodium lauryl sulphate (SDS) washing once or more than, or (b) under highly rigorous condition, for example in 6 * SSC, hybridizing under about 45 ℃ on the filter membrane bonded nucleic acid, then under about 68 ℃, in 0.1 * SSC/0.2% SDS the washing once or more than, or under conspicuous other hybridization conditions of those skilled in the art of the present technique, (see, as people such as Ausubel F.M., eds., 1989, Current Protocols in Molecular Biology, Vol.I, GreenPublishing Associaates, Inc. and John Wiley ﹠amp; Sons, Inc., New York, pp.6.3.1-6.36 and 2.10.3).Preferably, the nucleic acid molecule that hybridizes to above-mentioned (a) and nucleotide sequence (b) is the sequence that comprises the complement of genomic dna nucleic acid molecule, and it comprises genetic marker sequence or complementary sequence or its RNA product.

Nucleic acid molecule of the present invention is deoxy-oligonucleotide (" oligonucleotide "), and it hybridizes on the said nucleic acid molecule under highly rigorous or rigorous condition.Usually, the melting temperature(Tm) of the probe of length between 14 and 70 Nucleotide is calculated with following formula:

Tm (℃)=81.5+16.6 (log[monovalent cation (mole)])+0.41 (%G+C)-(500/N)

Wherein N is the length of probe.If hybridization is carried out in containing the solution of methane amide, so melting temperature(Tm) with equation Tm (℃)=81.5+16.6 (log[monovalent cation (mole)])+0.41 (%G+C)-(0.61% methane amide)-(500/N) calculating, wherein N is the length of probe.Usually, hybridization be lower than Tm (to the DNA-DNA hybrid) approximately 20-25 degree or be lower than under Tm (to the RNA-DNA hybrid) the 10-15 degree carry out.

The rigorous condition of exemplary height can refer to, as in the trisodium phosphate of 6 x SSC/0.05% (to the oligonucleotide of about 14 bases) under 37 ℃, (to the oligonucleotide of about 17 bases) under 48 ℃, (to the oligonucleotide of about 20 bases) under 55 ℃ and under 60 ℃ (to the oligonucleotide of about 23 bases) wash.

Therefore, the present invention further provides nucleotide primer or the probe that detects polymorphism of the present invention.Evaluation can be carried out with at least one nucleic acid primer or probe, as DNA, RNA primer or probe or nucleic acid analog such as peptide nucleic acid(PNA) (PNA) or locked nucleic acid (LNA).

According to an aspect of the present invention, provide allele specific oligonucleotide probe, it can detect the polymorphism in one or more positions in described zone.

Described allele specific oligonucleotide probe is 5-50 Nucleotide preferably, more preferably is about 5-35 Nucleotide, more preferably is about 5-30 Nucleotide, more preferably is at least 9 Nucleotide.

Chain determines

Whether be present in the genetic stocks in order to detect genetic marker, can utilize the known standard method of those skilled in the art, as using nucleic acid amplification.Whether genetic linkage is to the mastitis resistance trait in order to determine genetic marker, can utilize displacement test (Doerge and Churchill, 1996), perhaps can adopt Piepho method (Piepho, 2001).Doerge and Churchill (1996) have described the principle of displacement test fully, and Piepho has described Piepho method (2001) fully.Significance is chain to be present in the family that uses homing method to carry out analyzes, and uses the displacement test to obtain 10000 displacements (Doerge and Churchill, 1996).Be considered to be in significance evidence between genetic marker and mastitis resistance and the somatocyte counting proterties at the threshold values of 5% karyomit(e) conspicuous level.In addition, confirmed QTL in different male families.The family of striding that carries out with the component of variance method is analyzed and the multiple characters analysis, use the Piepho method to determine significance level (Piepho, 2001).Threshold values on the 5% karyomit(e) significance level is considered to be in the chain significance evidence between genetic marker and mastitis resistance and the somatocyte counting proterties.

Test kit

Another aspect of the present invention relates to diagnostic kit, it is used for detecting being tried ox and has or do not exist at least one genetic marker relevant with the mastitis resistance, it comprises at least one oligonucleotide sequence at least and their combination, wherein said nucleotide sequence be selected from SEQ ID NO:1 in the NO:192 any sequence and/or their any combination.

According to the present invention, the genotype of determining to be tried ox can be according to the analysis of DNA and/or RNA to set up the genetic determinant that those are tried the mastitis resistance of ox.An example is a genomic dna, and it can provide with standard DNA extracting method described herein.Described genomic dna can and use Oligonucleolide primers separation and the amplification of polymorphism mark zone corresponding to (complementation) with standard techniques such as polymerase chain reaction.The additional step that can comprise the purify DNA that amplified reaction is preceding.Therefore, the diagnostic kit that is used to set up mastitis resistance and somatic number feature comprises at least one oligonucleotide sequence that is selected from the sequence set shown in the table xx of independent packing and their combination arbitrarily.

Embodiment

Animal

Animal material is designed by granddaughter to be formed, it has 39 male parent families, its offspring tests son and adds up to 1513, and from four cow kinds, promptly the red ox of Denmark He Ersitanniu (DH) and Denmark (DR), Finland Ai Er prefecture ox (FA) and Trawas Red are spent ox (SRB) in vain.These 39 families are by D5H, 9DR, 11FA and the group composition of 14SRB ancestral male animal man.The son's of every ancestral male animal number is between 16 to 161, and the size of average family is 38.8.

The purifying of genomic dna

According to following scheme purified genomic dna from seminal fluid:

Thaw behind the seminal fluid tubule, cut with the two ends of a pair of scissors with pipe, with the transfer of content of tubule in 1.5ml eppendorf centrifuge tube.0.9%NaCl with 1ml washes tubule in centrifuge tube.Then centrifugal described centrifuge tube 5 minutes under 2000rpm is then removed supernatant liquor.This washing step repeats twice.

Follow damping fluid S (10mM Tris HCI pH8,100mM NaCl, 10mMEDTA pH8 with 300 μ l; 0,5% SDS), the 1M DTT of 20 μ l and 20 μ l PRONASE A (20mg/ml) (Boehringer) are added in the centrifuge tube.After the mixing, centrifuge tube slowly rotated be incubated overnight, then add the saturated NaCI of 180 μ l, vigorous agitation is 15 seconds then.Centrifugal described centrifuge tube is 15 minutes under 11000rpm.The supernatant liquor of 0.4ml is transferred in the centrifuge tube of 2ml and added 1ml 96% methyl alcohol, finish mixing by slow rotating centrifugal pipe.Then the centrifugal described centrifuge tube of 11000rpm 10 minutes.Remove supernatant liquor by outwelling liquid, with 70% ethanol (0.2ml) washing precipitation, and under 11000rpm centrifugal again 10 minutes.Outwell ethanol, drying precipitated and be resuspended in 0.5ml TE damping fluid) under 55 ℃, left standstill 30 minutes.

Amplification program

TEMPase (GeneChoice) polysaccharase and the reaction buffer I that use supplier (GeneChoice) to provide carry out the PCR reaction in the volume of 8 μ l.General each multiplex PCR comprises 5 different marks, 1 μ lDNA, 0.1 μ l TEMPase enzyme, 0.2mM dNTPs, 1.2mMMgCI2 and 0.3 each primer of μ M.

Described PCR mixture carries out initial sex change (to TEMPase) at 94 ℃ of following 15min.10 circulations then circulate sample under the condition of falling progressively, be that each circulating temperature reduces by 1 ℃ of (94 ℃ of sex change 30 ＂, 67 ℃ of annealing 45 ＂, 72 ℃ are extended 30 ＂), circulate (94 ℃ of sex change 30 ＂, 58 ℃ of annealing 45 ＂, 72 ℃ of extension 30 ＂) then under normal operation circulate sample 20, by 72 ℃ 30 ' loop ends PCR circulation, with the PCR machine programming with sample cooling forever under 4 ℃.

The nucleotides sequence that is used for the primer of certification mark is shown in table 50.Nucleotide sequence is listed from 5 ' end.

Table 50

The mark title	The forward primer reverse primer	SEQ ID NO.：
			BTA9：
BMS2151	F AACGGCTTTCACTTTCTTGC R CTGGGTGAACAAATGGGC	SEQ ID NO.：1 SEQ ID NO.：2
			ETH225	F GATCACCTTGCCACTATTTCCT R ACATGACAGCCAGCTGCTACT	SEQ ID NO.：3 SEQ ID NO.：4
BM2504	F CAGCTTTCCATCCCCTTTC R CTCCCATCCCAAACACAGAC	SEQ ID NO.：5 SEQ ID NO.：6
			DIK2892	F TTGACCCTGAAAGATGTCCA R CACGGTTTATCAGCTTGGGTA	SEQ ID NO.：7 SEQ ID NO.：8

DIK3002	F AAATGGAGGTAATGAAATAAAATA R CAAACCCATGGACTGTAACCT	SEQ ID NO.：9 SEQ ID NO.：10
			DIK3003	F ACTTTCAGTTTTGGGCTGAC R TGTCACTAGGTAAATTGGTG	SEQ ID NO.：11 SEQ ID NO.：12
RM216	F TTCTGCAATGTTGAGCTTCAAG R GATCTGAAAAAGAAATGAATAGA	SEQ ID NO.：13 SEQ ID NO.：14
			BMS817	F TGGGAAAGTTGGCAAATG R TTGTGATACCTGAAATGGTCAA	SEQ ID NO.：15 SEQ ID NO.：16
BMS555	F GGAAAGAGTAGGTGATICCCTG R ATTTAATTGTCATCCCAGGTGA	SEQ ID NO.：17 SEQ ID NO.：18
			lama4	F TTAAAGCAATTTAGGGAGCTTA R CTAGTATCTAAAATGAACAGAA	SEQ ID NO.：19 SEQ ID NO.：20
DIK 5142	F TGGGTAAGTGGGAAAGGATG R CTCAGCCAGGTTGTCCTCTC	SEQ ID NO.：21 SEQ ID NO.：22
			slc16a10	F CAGGTACACAGTAAAGACAGA R CTGCTTTGGGGGCACAGTCA	SEQ ID NO.：23 SEQ ID NO.：24
DIK4 268	F ATAAGGGTGCACTGGCAGAA R GCAGTCCAGGGGATTGTAAA	SEQ ID NO.：25 SEQ ID NO.：26
			DIK 4950	F AGTGCCTGGCAGGTATTGAA R CCTCGGTTTCCCAATCATTA	SEQ ID NO.：27 SEQ ID NO.：28
CSSM025	F GTAGTTATCAAAATAAGAATGCTT R TATGTTTTCCTTTTGGTTGAATAG	SEQ ID NO.：29 SEQ ID NO.：30
			DIK 2810	F TCTGAAACCTGGAGGAGGAG R GAAACTTCCACCACCCTCAA	SEQ ID NO.：31 SEQ ID NO.：32
DIK 5364	F CCTCTGAAACCCCAGACTTG R AAAAACCCAAAACAACACACAA	SEQ ID NO.：33 SEQ ID NO.：34
			DIK2741	F TCCCCAAATTCTGATGACTCT R TCAGCCCTTAAAACGTAAGCA	SEQ ID NO.：35 SEQ ID NO.：36
TGLA261	F TCAAATCTCATTCTCTCCAGAAGGC R CCAACTTATATTAGGCACAATGTCC	SEQ ID NO.：37 SEQ ID NO.：38
			ILSTS013	F CTTGATCCTTATAGAACTGG R ACACAAAATCAGATCAGTGG	SEQ ID NO.：39 SEQ ID NO.：40
UWCA9	F CCTTCTCTGAATTTTTGTTGAAAGC R GGACAGAAGTGAGTGACTGAGA	SEQ ID NO.：41 SEQ ID NO.：42
			BMS1148	F TTAAATGGGACCAGATAAATAGGA R AAATGAGAACCAGATAAGCCTAAA	SEQ ID NO.：43 SEQ ID NO.：44
DIK 4912	F AAGAAGTAGAGCGGGGGAAG R GAATGCCAAGCATCCCTTAC	SEQ ID NO.：45 SEQ ID NO.：46
			DIK 5130	F TTGCACTGATCTCTGCTAAAGTG R TCTCCCCACAACATCATTCA	SEQ ID NO.：47 SEQ ID NO.：48
DIK 2303	F GGAAAGACAAGAGGGTGCTG R TGTTGCAAAAAGCAAATTTCA	SEQ ID NO.：49 SEQ ID NO.：50
			DIK 4720	F CATGATATTTACCCTGTGTGTGC R GAGGAGCTGGAGGGCTAAAG	SEQ ID NO.：51 SEQ ID NO.：52
BM4204	F GGGTAGGAGCTTTTGTAGGTG	SEQ ID NO.：53

	R GCCATCACCCTTCTCTTATATG	SEQ ID NO.：54
			DIK 4926	F ATGACTCCTGGAGCAGAACC R GAAGAGTAAGCTGTATTTTTCATGC	SEQ ID NO.：55 SEQ ID NO.：56
BMS1909	F ACTTGTTAGGAGGGCTATTGTTAA R CCACATACACCACCAACATTAA	SEQ ID NO.：57 SEQ ID NO.：58
			BMS1290	F TTGGCACTTACTACCTCATATGTT R TTTTCTGGATGTTGAGCCTATT	SEQ ID NO.：59 SEQ ID NO.：60
TGLA73	F GAGAATCACCTAGAGAGGCA R CTTTCTCTTTAAATTCTATATGGT	SEQ ID NO.：61 SEQ ID NO.：62
			BMS2753	F TCAAAAAGTTGGACATGACTGA R AGGTTTTCAAATGAGAGACTTTTC	SEQ ID NO.：63 SEQ ID NO.：64
TNF	F GGAGGGTGTGCTTGAAAGAG R GCTGGCGTTCTCTCTCGTAT	SEQ ID NO.：65 SEQ ID NO.：66
			BMS1724	F GACTTGCCCCAATCCTACTG R ATTTCAGGTTTGTTGGTTCCC	SEQ ID NO.：67 SEQ ID NO.：68
DIK2145	F TGGTGCTCTGGGAACATAGAC R ATCACAGTGGCCTGAACACA	SEQ ID NO.：69 SEQ ID NO.：70
			BM7209	F TTTTCTGCTCATGCTTCAGTG R GCAGGCTATAGTCCATGACATC	SEQ ID NO.：71 SEQ ID NO.：72
SLU2	F GGGTTCTGTTTGCTTTTCTTC R CTAGCACTGGCAGGTAGATTCT	SEQ ID NO.：73 SEQ ID NO.：74
			C6orf93	F CTCGGTGATGTTTTTGCTGA R CGCCCCAGCTCTTTCTAGTT	SEQ ID NO.：75 SEQ ID NO.：76
DIK4986	F GGGATGAACATTGAGGGTTG R CATGATCAAGATGGGGGAAG	SEQ ID NO.：77 SEQ ID NO.：78
			Mm12e6	F CAAGACAGGTGTTTCAATCT R ATCGACTCTGGGGGATGATGT	SEQ ID NO.：79 SEQ ID NO.：80
PEX3	F TTTTGCGAGTCCAGTTAAACA R GGAAAAGCCAGAGCAAAATG	SEQ ID NO.：81 SEQ ID NO.：82
			DEAOC1	F TTCCTAGGCCTGTGCTCATT R TGGACCAGGCATAAGGATTT	SEQ ID NO.：83 SEQ ID NO.：84
BMS2251	F AACGGCTTTCACTTTCTTGC R CTGGGTGAACAAATGGGC	SEQ ID NO.：85 SEQ ID NO.：86
			EPM2A	F GCGGCCGCGTTGAGAG R TTCCACTTTATGATGAGCAGGTTC	SEQ ID NO.：87 SEQ ID NO.：88
BM7234	F TTCACTGATTGTCATTCCCTAGA R TAAGCAAATAAATGGTGCTAGTCA	SEQ ID NO.：89 SEQ ID NO.：90
			BM4208	F TCAGTACACTGGCCACCATG R CACTGCATGCTTTTCCAAAC	SEQ ID NO.：91 SEQ ID NO.：92
BMS2819	F GCTCACAGGTTCTGAGGACTC R AACTTGAAGAAGGAATGCTGAG	SEQ ID NO.：93 SEQ ID NO.：94
			INRA144	F TCGGTGTGGGAGGTGACTACAT R TGCTGGTGGGCTCCGTCACC	SEQ ID NO.：95 SEQ ID NO.：96
INRA084	F CTAAAGCTTTCCTCCATCTC R CCTGGTGATGTTTGGATGTC	SEQ ID NO.：97 SEQ ID NO.：98

rgs17	F CATGAAACACAAACATAAATGGGA R GGGACCAAAAATACATCACAGTA	SEQ ID NO.：99 SEQ ID NO.：100
			ESR1	F GCTGCTGGAGATGCTGGAT R TGATTCACGTCCTCTGGAGGT	SEQ ID NO.：101 SEQ ID NO.：102
BMS2295	F GCTCTGGTGACCCAGGTG R CTGGCAGGAGATGAGAGGAG	SEQ ID NO.：103 SEQ ID NO.：104
			BM3215	F TGCATCAACTAAGCCACACTG R TTACTCGCTGGTTTTCTGGG	SEQ ID NO.：105 SEQ ID NO.：106
bvil203	F CGAGTTCGAGGCCATGTGAA R CGGAGCAGGGAGAGGGT	SEQ ID NO.：107 SEQ ID NO.：108
			Aridlb	F CTGTTCTATTCCCTATACTG R ATTATCATGCATACACTTTGA	SEQ ID NO.：109 SEQ ID NO.：110
Pig	F CAGGGTGACAGCGGCGGGCC R GAAGTACCGAGTTTATTTTCAACAAAT	SEQ ID NO.：111 SEQ ID NO.：112
			tgfsnp123	F CAAGACCGGCCTGAGCTACAAGAG R GTGCGGTGGATGAGTGGGGACAG	SEQ ID NO.：113 SEQ ID NO.：114
BMS1943	F ATCAGTCGTTCCCAGAATGTC R TTGATATCCTCTCTGTCAAGCC	SEQ ID NO.：115 SEQ ID NO.：116
			BMS1967	F GGGCAGATGTGAGTAATTTICC R AACTGAGCTGTATGGTGGACG	SEQ ID NO.：117 SEQ ID NO.：118
BTA11：
			HELMTT43	F GGTTACAGTCCATGAGTTTGCAAAG R ACAGAGGTGGGGTAGACTTTT	SEQ ID NO.：119 SEQ ID NO.：120
ZAP70	F GGAGCTACGGAGTCACCATGT R GTAGGTCCAGCAATCGCTCAT	SEQ ID NO.：121 SEQ ID NO.：122
			MAP4K4	F CAAAGAGTGGGTCTCAACATGAATC R GGGCTGGGCCTGCTC	SEQ ID NO.：123 SEQ ID NO.：124
IL18RA	F CAGAAGTCTTGCCTGGGAAGTC R CCGTGTCTGCCTCTTGTGA	SEQ ID NO.：125 SEQ ID NO.：126
			MNB-40	F CAGCCTCCTTCATACTCCTTCT R GGGGAAGGGAGCAGATTGTA	SEQ ID NO.：127 SEQ ID NO.：128
AUP1	F CCCTGTCCTGACGTCTGTTT R CACAACCAAGGGAAAAGGAA	SEQ ID NO.：129 SEQ ID NO.：130
			BM716	F AGTACTTGGCTTGCTTIGCTC R TTAAATTTCCATCTCACCCTGG	SEQ ID NO.：131 SEQ ID NO.：132
DIK2653	F ATGGCCGTCCATTCAGATAC R CCTCCCTGTGGTTTATGGAA	SEQ ID NO.：133 SEQ ID NO.：134
			BMS2569	F AGAGAGGCCAAAGCTGGG R TTTCCTTGGGCTTCAGGAG	SEQ ID NO.：135 SEQ ID NO.：136
BMS2325	F TCCATCTTGCAGAAGTGTGC R AGGGCCAGGAATGCTAGTG	SEQ ID NO.：137 SEQ ID NO.：138
			BMS1953	F TGCTGTAGGAGAAAATAAAGCAG R TTTGCTGAGAGGACTTTGAGA	SEQ ID NO.：139 SEQ ID NO.：140
DIK4637	F TGTGCTCTAAAGCTTGACCTG R TCAGCTGGTTGAGGGTTCTC	SEQ ID NO.：141 SEQ ID NO.：142

UMBTL103	F TCTCCTTCATAGCTGGCATCT R TTGGATGGCATCACTGACTTG	SEQ ID NO.：143 SEQ ID NO.：144
			BP38	F CCAAATGATGGTTCAAGTTTG R GCTCATGATAAAGGGAATTCAG	SEQ ID NO.：145 SEQ ID NO.：146
MNB-70	F TAATGAGCAGACCCACACAG R ACCATTGGCTCTCCTAGGTC	SEQ ID NO.：147 SEQ ID NO.：148
			BM2818	F TTCTGTGGTTGAAGAGTGTTCC R CAATGGCTAAGAGGTCCAGTG	SEQ ID NO.：149 SEQ ID NO.：150
BM304	F CTGGTGTTCCTTTCATATCAACC R GGCACGTACTAACCTGTAAAACC	SEQ ID NO.：151 SEQ ID NO.：152
			INRA177	F TCCAAAAGTTTCGTGACATATTG R CACCAGGCTTCTCTGTTGAA	SEQ ID NO.：153 SEQ ID NO.：154
UMBTL20	F TTCCATGTCACAGATAGCCTC R ACATTATCACAAGACACCAGC	SEQ ID NO.：155 SEQ ID NO.：156
			RM96	F TCGCAAAAAGTTGGACAAGACT R TTAGCAGGGTGCCTGACACTT	SEQ ID NO.：137 SEQ ID NO.：158
INRA131	F GGTAAAATCCTGCAAAACACAG R TGACTGTATAGACTGAAGCAAC	SEQ ID NO.：159 SEQ ID NO.：160
			BM7169	F TGGTATGTAGTTACAGCAGCCC R CCATTGAAACAGACATGAATGC	SEQ ID NO：161 SEQ ID NO.：162
BMS1716	F GTGGGTTGGAGAGGTACAAG R AGAAATGGCCTTGAGAAAGAG	SEQ ID NO.：163 SEQ ID NO.：164
			BM6445	F GTGTCTGTCAAAAGATGAATGG R GACAACTGCTTCTCGTTGGG	SEQ ID NO.：165 SEQ ID NO.：166
CD8B	F GAAGTTGACTGTGCATGGAAATCC R GGCAGGCTTCACATTTTGGA	SEQ ID NO.：167 SEQ ID NO.：168
			MB110	F ACACATACACACACACGCACA R TGGCTGCTCAAAAAATAGCA	SEQ ID NO.：169 SEQ ID NO.：170
MS2177	F TTTGAAGGAGTAAGCACTCTGT R CAGACACAACTGAAGCAACTC	SEQ ID NO.：171 SEQ ID NO.：172
			HELMTT44	F CACTTAGCCACCTGAAATAGAT R AGCAACTGCCACTTCACTTC	SEQ ID NO.：173 SEQ ID NO.：174
DIK5170	F TTTGGACTTGCCAAACCTC R TCAGAGCAACAGAACTAATAAGA	SEQ ID NO.：175 SEQ ID NO.：176
			RM150	F GAACAGTGGTTACCTGTCTGTC R CTGCCTAACCTTCCTGGCGTC	SEQ ID NO.：177 SEQ ID NO.：178
TGLA58	F TTCTACTCTCCAGCCTCCTCC R GTTGGCTCCAAGAGCAAGTC	SEQ ID NO.：179 SEQ ID NO.：180
			TGLA340	F CAGGCCTTCACCAACAGTTCACTGA R GATTCCACAGTGCCAGACCCAAGCC	SEQ ID NO.：181 SEQ ID NO.：182
BM8118	F TCCTACTTTTGCATTCCAGTCC R ACCACTAAAGTCAAAGAAGCCG	SEQ ID NO.：183 SEQ ID NO.：184
			BMS2047	F ACTATGGACATTTGGGGCAG R AGTAGGTGGAGATCAAGGATGC	SEQ ID NO.：185 SEQ ID NO.：186
BMS1048	F GTTTGATACTATGTCCCTTTGTGTG	SEQ ID NO.：187

	R GAGTAGCTGCCCCTGTTCTC	SEQ ID NO.：188
			BMS989	F TTTGAGAACTTTTGTTTCTGAGC R TTATTTTGCTTTTCTGATTTTGTG	SEQ ID NO.：189 SEQ ID NO.：190
BM3501	F CCAACGGGTTAAAAGCACTG R TTCCTGTTCCTTCCTCATCTG	SEQ ID NO.：191 SEQ ID NO.：192

Mark and collection of illustrative plates

Concerning the BTA9 of this research, select 45 microsatellite markers from website, livestock raised for meat research centre (www.marc.usda.gov/genome/genome.html).Because BTA9 and HSA6q are directly to homology, so select the gene of 28 announcements and EST (Ctgf, Vip, Vil2, Rgs17, Ros1, Slc16a10, Oprm, igf2r, Esr1, Deadc1, Pex3, C6orf93, Ifngr1, Shprh, Epm2a, AK094944, AK094379, Utrn, Tnf, plg, arid1b, lama4, hivep2, C6orf055, CITED2, RP1-172K10, AIG1 and GRM) to be used for SNPs and the screening of little satellite along HSA6q.Be to have determined 8 new microsatellite markers of evaluation in this research and the genotype of 29 SNP also, to make the fine and close collection of illustrative plates of BTA9 by linkage analysis the whole family.

In this research, from 37 marks altogether of the linkage map of BTA11, select 30 microsatellite markers from website, livestock raised for meat research centre (http://www.marc.usda.gov/genome/cattle/cattle.html).

Radiation hybridization (RH) panel information

From the special primer of ox sequences Design, so that gene and the little satellite that comprises the little satellite of MARC are mapped.Along karyomit(e) 9, on ox RH panel, used more than 120 mark altogether.65 genes and 34 little satellites have shown amplification successful on ox DNA and have had the band of suitable size and not amplification on hamster.Their typings are on 3000 radiant panel Roslin/Cambridge ox RH panels (Williamsetal.2002).In the cumulative volume position is RH cell line dna, each primer of 0.5 μ M, the dNTPs of 200 μ M, the MgCl of 3mM that 20 μ l contain 25ng ₂With carry out pcr amplification in the Taq polysaccharase (BIOLine) of 0.5U.Reaction conditions falls progressively, begin be 94 ℃ 3 minutes, then be that ℃ fall progressively 30 seconds, every circulation of 93 ℃ of 40 round-robin 30 seconds, 65-45 reduced by 0.5 ℃ and 72 ℃ 1 minute, last extension step be 72 ℃ 5 minutes.Electrophoresis PCR reactant: the PCR product of 10 μ l be loaded on the microgel of ethidium bromide staining (2.5% agarose) go up and by two independently the viewer to the existence of amplicon or there is not score.When between from the multiple type or between the score of different observers serious deviation being arranged, repeat PCR reaction and gel electrophoresis.When the result of several hybridization still blurs, discard marker.

By using RHMAPPER at mark people such as (, 1998) Soderlund, the mark with being finalized in the past on ox WGRH panel carries out 2 linkage analysises, mark is assigned on the ox karyomit(e) people such as (, 2002) Williams.Then make up RH figure with the described Carthegene software of people such as Williams (2002) (Schiex., 2002).On ox karyomit(e) 9, we have the information of the radiation hybrid map that contains 150 marks.

Estimate flag sequence and map distance with CRIMAP 2.4 softwares people such as (, 1990) Green.In order to make up our linkage map, we at first place the microsatellite marker mark in proper order according to MARC figure, and the BUILD option that then moves CRIMAP is to place remaining mark, and new little satellite and SNP mark have been inserted in has the position of high likelihood.

MARC (www.marc.usda.gov/genome/genome.html), Ensembl (http://www.ensembl.org/Bos_taurus/index.html) and radiation hybridization (RH) information are taken into account, to rethink the placement of mark.The final linkage map according to the QTL collection of illustrative plates of BTA9 of the present invention that uses comprises 59 marks that table 51 is listed.

The final linkage map according to the QTL collection of illustrative plates of BTA11 of the present invention that uses comprises 37 marks that table 52 is listed.

Following form has shown the mark that is used for relevant QTL.About any Additional Information of mark can http://www.marc.usda.gov/ ', http://www.ensembl.org/Bos_taurus/index.html and ' the middle acquisition of http://www.ncbi.nih.govl '.

Table 51

Mark on the BTA9	The position of using in the analysis (cM)	Relative position: (cM) http://www.marc.usda.gov/
			BMS2151
	0	4.892
			ETH225	7.4	12.754
BM2504	25.3	30.92
			DIK2892	25.35	30.92
DIK3002	32.7	36.542
			DIK3003	32.75	36.542
RM216	32.8	37.087
			BMS817	36.6	42.489
BMS555	37.4	43.818
			lama4 *	37.6	-
DIK 5142	37.75	43.818
			slc16a10 *	37.78	-

DIK4 268	37.81	45.152
			DIK 4950	37.84	45.152
CSSM025	37.87	45.739
			DIK 2810	37.9	45.739
DIK 5364	38.2	45.739
			DIK 2741	39.75	49.659
TGLA261	39.8	49.659
			ILSTS013 *	39.85	-
UWCA9	39.9	49.996
			BMS1148	39.95	50.923
DIK 4912	42.45	51.855
			DIK 5130	42.5	52.296
DIK 2303	42.55	52.352
			DIK 4720	43.3	53.966
BM4204	45.1	55.414
			DIK4926	47.6	57.088
BMS1909	49.8	59.516
			BMS1290	53.8	64.935
TGLA73	63.3	77.554
			BMS2753	65.4	79.249
TNF *	65.45	-
			BMS1724	67.15	80.265
DIK 2145	67.2	80.265
			BM7209	67.6	81.569
SLU2	68.8	-
			C6orf93 *	69.35	-
DIK 4986	69.4	84.258
			Mm12e6 *	69.45	84.258
PEX3 *	69.5	-
			DEAOC1	69.5	-
BMS2251	71.3	86.58
			EPM2A *	72.1	-
BM7234	72.3	88.136
			BM4208	73.9	90.69
BMS2819	73.95	90.98
			INRA144	74.2	90.98
INRA084	74.5	90.98
			rgs17 *	79.8	-
ESR1 *	79.85	-
			BMS2295	82.2	98.646
BM3215	83.2	101.647
			bvi1203 *	86.5	-
Aridlb *	86.6	-
			Pig *	89.4	-

tgfsnp123 *	89.45	-
			BMS1943	92.5	103.708
BMS1967	97.7	109.287

^*These marks are not listed on the MARC of BTA9 signature.

Table 52

Mark on the BTA11	The position of using in the analysis (cM)	Relative position: (cM) http://www.marc.usda.gov/
			HELMTT43	0.0	2.249
ZAP70 *	5.4	-
			MAP4K4 *	10.5	-
IL18RA *	12.3	-
			MNB-40	16.0	19.440
AUP1 *	17.6	-
			BM716	17.9	19.440
DIK2653	18.1	20.135
			BMS2569	18.3	21.082
BMS2325	18.5	21.082
			BMS1953	18.8	21.537
DIK4637	19.4	22.527
			UMBTL103	21.8	23.829
BP38	22.6	24.617
			MNB-70	22.8	24.617
BM2818	26.5	30.009
			BM304	30.0	33.597
INRA177	32.5	35.098
			UMBTL20	32.7	34.802
RM96 *	38.0	-
			INRA131	43.6	47.289
BM7169	46.8	50.312
			BMS1716	50.2	54.581
BM6445	55.1	61.570
			CD8B *	56.9	-
MB110	59.6	68.679
			MS2177	61.0	69.415
HELMTT44 *	61.2	-
			DIK5170	61.4	70.143
RM150	61.8	70.143
			TGLA58	63.1	73.136
TGLA340	65.8	75.208
			BM8118	67.2	77.063
BMS2047	68.8	78457
			BMS1048	69.5	81.065
BMS989	78.9	92.179
			BM3501	85.2	97.223

^*These marks are not listed on the MARC of BTA11 signature.

Phenotypic data

Mastitis resistance and SCS marking to the daughter of bull.With unisexuality shape BLUP (BLUP) animal model, ignore the estimated breeding value (EBV) that family structure calculates son's proterties.These EBV are used for qtl analysis.The described daughter's registration that is used for single proterties is:

Clinical mastitis in the Denmark ox: in the clinical mastitis case of preceding 5 days to back 50 days chronotherapies that calve for the first time.

Clinical mastitis in Sweden and the Finland ox: preceding 7 days that calve for the first time clinical mastitis cases to the treatment of back 150 day time.

SCS in the Denmark ox: at the average SCS of 10-180 days time of back that calves for the first time.

SCS in the Sweden ox: at the average SCS of 10-150 days time of back that calves for the first time.

SCS in the Finland ox: at the average SCS of 10-305 days time of back that calves for the first time.

Embodiment 1

BTA9

Statistical study

Some following statistical methods are used to determine genetic marker relevant with mastitis and mastitis resistance thus or that link to each other.

Qtl analysis

By chromosomal region that the genetic marker of family is finalized the design, linkage analysis (LA) is used to identify QTL, and disease or character value in described chromosomal region and the pedigree are relevant, and it is than probability expectation height.Such desmic region more may contain the cause and effect genetic variant.Use the series model analytical data.At first, at family's inner analysis all proterties are used the single proterties model of multiple spot homing method.With the karyomit(e) that has remarkable effect in the component of variance methods analyst family, to confirm to stride the QTL that finds in the family and the sign of QTL.

Regression analysis

Estimate group's gene frequency of mark with the EM algorithm.Suppose that subsequently gene frequency is known, and do not have error.Determine the stage of male poultry based on the labeling pattern of filial generation.Suppose that subsequently this stage is known, and do not have error.Use from the karyomit(e) use during underlined information of same the mapping function (Haldane, 1919) of Haldane to calculate the separation probability of each figure spectral position.Phenotype is revert on the separation probability.Calculate significance threshold values (Churchill and Doerge, 1994) with the displacement test.

The component of variance method

With component of variance (VC) based method carry out whole family family linkage analysis (

Deng the people, 2003).With among the LA of VC, blood relationship same (IBD) probability between the QTL allelotrope between any two person's of foundation haplotypes (Hs and Hm) is assumed that zero, does not promptly set up person's haplotype and be incoherent people 2002 such as () Meuwissen.The haplotype of male animal haplotype and son's paternal inheritance is used to calculate succession from the male parent of male animal or the maternal allelic probability of QTL people 2004 such as () Freyer, and calculates IBD matrix people such as (, 1995) Wang with recursive algorithm.At the mid-point computation IBD matrix along chromosomal each matrix classification, it is used in subsequently the component of variance method of estimation.Total additive genetic variance mark that QTL explains is estimated as 2 σ ² _h/ (2 σ ² _h+ σ ² _u), σ wherein ² _hAnd σ ² _uCorrespond respectively to the component of variance relevant with the additivity multigentic effect with the haplotype effect.

The analysis of variance component.The single qtl analysis of single traits.

Each proterties linkage analysis separate analysis.Full model can be expressed as:

y＝X _β+Zu+Wq+e， (1)

Wherein y is the vector of n EBV, X is the known design matrix, β is the vector of the fixed effect of the unknown, it only means this in this case, Z relates to individual matrix, and u is the vector of additivity multigentic effect, and W relates to the known matrix of each individual record additivity QTL effect unknown with it, q is the vector of the individual additivity QTL effect of the unknown, and e is the residue vector.Stochastic variable u, q and e are assumed that multivariate normal distribution and separate (people 2003 such as Lund).

The many qtl analysis of multiple characters

Carry out the multiple characters analysis.Model (1) can extend to multiple characters QTL model, as according to people such as Lund, and 2003 described models (2).

With the following n that has _qThe linear mixed model of QTL is with the proterties modeling.

$y=\mathrm{\μ}+\mathrm{Za}+\underset{i=1}{\overset{n_q}{\mathrm{\Σ}}}{\mathrm{Wh}}_i+e,---\left(2\right)$

Wherein y is a vector of observing n son's t characteristics record, and μ is the vector of all proterties mean numbers, and Z is to be connected each son's the observed value and the known matrix of its polygene and QTL effect with W, and a is the vector of male animal and son's thereof multigentic effect, h _iBe that e is the vector of residue to the male animal of i ' th QTL and son's QTL haploidy effect thereof.Stochastic variable a, h _iBe assumed that multivariate normal distribution (MVN) and uncorrelated mutually with e.Specifically, a is MVN

h _iBe MVN

With e be MVN

Matrix G, K and E comprise because the variance and covariance of the proterties that multigentic effect, QTL effect and residual effect cause.Symbol

Represent the Kronecker product.A is the additive relation matrix, and it describes the covariance structure in the multigentic effect, IBD _iBe blood relationship same (IBD) matrix, its description comprises that I is a unit matrix to the covariance structure in the effect of i ' th QTL.

Chain and the linkage disequilibrium analysis of bonded

In the chain and linkage disequilibrium of bonded is analyzed, the IBD probability between the QTL of any two person's of foundation haplotypes allelotrope with Meuwissen and the described method calculating of Goddard (2001).This method is based on coalescent theory (Hudson, 1985), estimates that two haplotypes are the probability of IBD under the situation at the state consistency (IBS) of both sides mark under the QTL condition of inferring.In brief, be based on around the similarity of allelic mark haplotype at the probability of the IBD of QTL, described allelotrope is around described position: promptly near the identical marker allele hint of many (non-) this position is at the IBD probability of the height (low) of figure spectral position.Actual IBD probability level is subjected to the effectively influence of group's big or small Ne.Suppose that haplotype has total marker allele, calculate before the several generations at contemporary base and base coalescent probability between generation arbitrarily, Tg (Hudson, 1985).Be not easy to estimate Tg and Ne from observed data.Modeling effort shows the selection relative insensitivity (Meuwissen and Goddard, 2000) of the estimation of QTL position to Ne and Tg.Therefore, our use value Tg=100 and Ne=100.Consider to calculate the IBD probability with 10 mark windows.We also use the IBD probability of 4 mark windows calculating in zone, LDLA peak, and whether 4 marks are enough to reproduce the peak of having identified by 10 mark haplotypes to detect.The person's of foundation haplotype is divided into the different group of function.We use (1-IBD _Ij) as range observation, and with the average chain generation rooted tree shape figure of hierarchical clustering algorithm, the genetic affinity of its representative between all person's of foundation haplotypes.From the downward scanning tree of root, cutting goes branch up to node, and all so coalescent haplotypes have range observation (1-IBD _Ij)＜Tc.The group is defined as gathering into the haplotype group of common node.Haplotype in the group is assumed that and carries identical QTL allelotrope (IBD probability=1.0), and carries different QTL allelotrope from different groups' haplotype, and therefore is considered to independently (IBD probability=0).Therefore, be unit matrix corresponding to the top of the IBD matrix of linkage disequilibrium information corresponding to the different person's of foundation haplotypes.Set up lower section corresponding to the IBD matrix of son's parental generation haplotype linkage information people such as (, 1995) Wang with recursive algorithm.Mid-point computation IBD matrix between each mark zone, and use it in subsequently the component of variance estimation routine.

Parameter estirmation

With average information constraint maximum likelihood algorithm estimation variance component people such as (, 1997) Jensen.Maximize the constraint likelihood about the component of variance relevant with stochastic effect in the model.On one group of specific position maximization constraint likelihood sequence produced the QTL position constraint likelihood curve (

Deng the people, 2003).At mid point estimated parameter along chromosomal each labeled bracketing.

Significance level

Calculate the remarkable threshold values of the analysis of variance component with fast method, with the general threshold level (Piepho, 2001) of calculation control genomic level type i error.The test of hypothesis that QTL is existed is based on the asymptotically distributed of likelihood ratio test (LRT) statistic, LRT=-21n (L _Simplify-L _Entirely), L wherein _SimplifyAnd L _EntirelyIt is respectively the likelihood of the maximum under simplifying model and full model.Simplifying model is always got rid of the chromosomal QTL effect of being analyzed.This method is substituting of replacement procedure, is applicable to complicated situation.It need be from degree of freedom (the df) (df=H along the LRT of chromosomal each supposition QTL position, chromosome number, LRT _EntirelyThe number-H of parameter _SimplifyThe number of parameter) and the I type specific inaccuracy of karyomit(e) level.It is significant that the significance level of 5% karyomit(e) level is considered to.

BTA9 result

In table 53, provide result to the regression analysis of BTA9.Fig. 1 to 8 has provided the QTL figure of regression analysis.The component of variance method is used to stride the QTL of family's qtl analysis.Fig. 9 to 16 is presented at based on LD, the LDLA of QTL in the method for component of variance and LD curve.Figure 17 to 20 shows the haploidy effect.

The red ox of Denmark

It is isolating in two families of DR kind that the QTL that shows CM and SCS is analyzed in family's internal regression.The QTL of two proterties is not positioned at identical interval.Striding in family's linkage analysis of use VC method, the QTL effect is inapparent.Analyze with LDLA and LD, observe the high 74.08cM of QTL peak between mark BMS2819 and INRA144.Peak LRT (13.6) in LD analyzes is than peak LRT (8.51) height of observing in bonded LDLA analyzes.This QTL has explained additive genetic variance and the phenotypic variance of 44% and 22% CM respectively.Under default situations, 10 mark haplotypes (5 each sides that is marked at assumed position) are used to the IBD probability of estimated position.We are 2 each sides that is marked at assumed position with 4 mark haplotypes also, and have observed the similar LDLA/LD peak in these 4 mark haplotypes (BM4208-BMS2819-INRA144-INRA084).Also observed the LDLA of SCS in conjunction with the peak in these 4 labeled bracketings in this kind.Have IBD probability 0.90 or above dam haplotype by cluster to together.DR has 305 person's of foundation haplotypes before cluster, reduces to 54 groups after the cluster.Five groups have the frequency greater than 5%, and maximum group has 10% frequency, five male animal haplotypes also by cluster in the group of maximum.Estimated the haplotype effect of the haplotype that receives to these 54 haplotypes with from male animal.Identified and the related haplotype of high and low mastitis resistance.

Finland Ai Er prefecture ox

When carrying out family's internal regression analysis in Finland Ai Er prefecture ox family, the QTL that discovery influences CM and SCS is isolating.The QTL of CM is positioned at 58 to 79cM interval.The QTL that influences SCS is between 32 to 44cM, and peak LRT statistic is at 37cM.The LDLA that observes the CMQTL on the LA curve in conjunction with the peak in mark BM4208-BMS2819-INRA144.Also observe the LD peak of CM in identical zone.Observe the LDLA peak of SCs at the 38cM between mark DIK2810 and DIK5364 on the LA curve.Explained the population variance of 4% among the CM at the QTL of 74cM, this QTL shows the not influence to the SCS among the FA.Explained the population variance of 18% among the SCS at the QTL of 38cM, it has very little effect to CM.At the highest LDLA peak of CM, promptly between the intermediate zone between mark BM4208 and BMS2819 in, when the cluster probability that uses 0.90,442 person's of foundation haplotypes are classified among 38 groups.There are 9 to have the group who is higher than 5% frequency.Maximum group has 14% frequency.Identified and high and the relevant haplotype of low mastitis resistance.

Trawas Red is spent ox in vain

Be similar to DR and FA ox, when carrying out the family internal regression and analyze, also observe on the QTL that influences CM and SCS spends ox in vain at Trawas Red the BTA9 and separate.The QTL of CM and SCS is positioned at identical interval.In striding the LA of family analysis, CM QTL is significant (P＜0.01).In striding the LA of family analysis, SCS QTL is inapparent.The peak LRT of SCS is at 73cM.Striding during the LA of family analyzes, the peaked test statistic of CM QTL is at 67.4cM, wherein the QTL interval 59 and 81cM between.Although the LRT statistic is a highly significant,, in the LA curve, do not observe the LDLA peak to this QTL in the SRB ox in striding the LA of family analysis.LRT statistic position, peak in LA analyzes, the QTL variance is 25% of a CM proterties population variance.LDLA peak to the CM QTL of DR and FA kind falls within the observed LA curve of SRB.Although CM is not observed the LDLA peak in the SRB data, the cluster among some SRB is arranged between the mark zone, the peak position among DR and the FA is between described mark zone.For example, between the intermediate zone between BM4208-BMS2819 in, wherein the highest LDLA peak position is in FA, and in closing on interval DR peak (BMS2819-INRA144), 400 37 and 48 groups that always do not set up in person's haplotype of SRB arranged respectively.

Denmark He Ersitanniu

In family's internal regression was analyzed, the QTL that influences CM and SCS also was isolating in the Denmark He Ersitanniu that shows.Striding in the LA of the family analysis of carrying out with the VC method, CM QTL is significant (P＜0.01).Though in the LV curve, observe little LDLA peak, the QTL among the DH do not observed compellent LD peak.In LA to the highest LRT statistic of CM QTL at 42.9cM, the LRT statistic is 10.6, and QTL is interval distributes very greatly, is stretched over 51cM from 29.The little LD peak of CM QTL is with consistent at the LD peak that 74cM observes in DR and FA group.SCC QTL has the peaked test statistic at 48.7cM, has 44 and the 58cM interval.The part population variance of being explained by the QTL that occupies the climax in LA separately is respectively to 27 and 17% of CM and SCS.At 73.35cM, it is the zone at the high LD peak of observing DR to the highest LD peak of CM.Do not observe the LD peak of SCS at DH.

Stride variety analysis

LA, LDLA analyze with LD and show that the QTL that influences CM separates with the about 74cM place in the cogroup at one in the kind.Therefore, stride the kind qtl analysis in conjunction with the data of the whole different varietiess in the research.That strides the kind qtl analysis the results are shown in table 20,21 and 22.When carrying out the kind inner analysis, in DR and the FA ox to during the LDLA peak position of CM QTL is between the mark zone that closes on.When analyzing the binding data of DR and FA, observe the LDLA peak of CM high in the labeled bracketing (BMS2819-INRA144), and it is also consistent with the LD peak.The binding analysis of FA and SRB data does not provide the LDLA peak in any higher LA curve, yet, observe the LD peak between the same mark zone of 74cM.Also having provided in same area in conjunction with the analysis of the data of DR, FA and SRB is higher LDLA peak on the LA of BM4208-BMS2819-INRA144.The LD peak is also in identical position, and this has verified the higher LDLA peak on LA.The Conjoint Analysis of DR and FA is presented at the high LDLA of the SCS QTL peak of the 38cM between mark DIK2810 and the DIK5364.In the binding analysis of FA and SRB, also observed LDLA peak to the same position of SCS QTL.Yet when DR, FA and SRB analyzed together, this LDLA peak disappeared.

Multiple characters is analyzed

SCS is the indication trait of mastitis resistance.What expect is that the many genes relevant with CM also exert an influence to SCS.Therefore, whether the multiple characters analysis of carrying out CM and SCS has the multiple-effect effect to described two proterties to check BTA9 to go up isolating QTL, and perhaps whether they are chain QTL.Shown in the same tag interval the i.e. LDLA peak of CM between BMS2819 and INRA144 and SCS though the unisexuality shape LDLA of DR data analyzes, the binding analysis of 2 proterties has provided the LDLA peak at the 69.1cM place between mark SLU2 and the C6orf93.In the kind inner analysis, FA, SR do not show the LDLA peak of the model with the QTL that influences CM and SCS.Yet, when three kind DR, FA and SRB in conjunction with and during with 2 proterties model analysiss, between the mark zone, observe LDLA peak among INRA144 and the INRA084 with LRT statistic 19.7.

Haplotype analysis

Above-mentioned QTL fine Structure Mapping result has pointed out that in 4 mark zones the QTL to CM in the BM4208-BMS2819-INRA144-INRA084 separates.Therefore the person's of foundation haplotype cluster and the haplotype effect of the mid point between mark BMS2819 and INRA144 have been studied.This research is carried out in kind, also carries out between whole three kind DR, FA and SRB, because these three their origins of kind are relevant.Identified and high and the low relevant haplotype of mastitis resistance.

Table 53 uses the family's linkage analysis that returns interval analysis

Table 54.

The whole family family linkage analysis (LA) that carries out with the component of variance method gathers

Table 55.

The linkage disequilibrium that user's difference component method is carried out and linkage analysis (LDLA) gather

Table 56.

The whole family family linkage disequilibrium (LD) that user's difference component method is carried out gathers

Embodiment 2

BTA11

Statistical study

Some following statistical methods are used to determine genetic marker relevant with mastitis and mastitis resistance thus or that link to each other.

Qtl analysis

By chromosomal region that the genetic marker of family is finalized the design, linkage analysis (LA) is used to identify QTL, and disease or character value in described chromosomal region and the pedigree are relevant, and it is than probability expectation height.Such desmic region more may contain the cause and effect genetic variant.Use the series model analytical data.Three complementarity methods have been used: (i) family half sibs analysis (Haley and Knott, 1992) by carrying out with GDQTL software (B.Guldbrandsten, 2005 personal communication) based on regressive method; The (ii) bonded linkage disequilibrium linkage analysis (LDLA) of striding family's linkage analysis and (iii) carrying out that carries out with the component of variance method with the component of variance method.Each family is with the single analysis of GDQTL, with the QTL separate condition of each proterties of determining male animal.Permutation test (n=10,000) is used to the significance level (Churchill and Doerge, 1994) of the karyomit(e) level of definite each male animal.Next step be to use based on the method for component of variance carry out stride family's linkage analysis (

Deng the people, 2003), it is in conjunction with from the data set to the isolating family of QTL, and no matter proterties and QTL position.Calculate threshold values with the method that Piepho (2001) proposes.The 3rd step was that bonded LDLA analyzes people such as (, 2003) Lund, and it comprises all separation and unseparated family.Analyze multiple characters and many QTL model to separate multi-purpose QTL from chain QTL.When the same area of the BTA11 in more than one kind is observed the QTL separation, carry out LDLA in conjunction with full species data and analyze.

The component of variance method

With component of variance (VC) based method carry out whole family family linkage analysis (

Deng the people, 2003).With among the LA of VC, blood relationship same (IBD) probability between the QTL allelotrope of any two person's of foundation haplotypes (Hs and Hm) is assumed that zero, does not promptly set up person's haplotype and be incoherent people 2002 such as () Meuwissen.The haplotype of male animal haplotype and son's paternal inheritance is used to calculate succession from the male parent of male animal or the maternal allelic probability of QTL people 2004 such as () Freyer, and calculates IBD matrix people such as (, 1995) Wang with recursive algorithm.At the mid-point computation IBD matrix along chromosomal each matrix classification, it is used in subsequently the component of variance method of estimation.Total additive genetic variance of being explained by QTL partly is estimated as 2 σ ² _h/ (2 σ ² _h+ σ ² _u) σ wherein ² _hAnd σ ² _uCorrespond respectively to the component of variance relevant with the additivity multigentic effect with the haplotype effect.

The single qtl analysis of analysis of variance component single traits.

Each proterties linkage analysis separate analysis.Full model can be expressed as:

y＝X _β+Zu+Wq+e， (1)

Wherein y is the vector of n EBV, X is the known design matrix, β is the vector of the fixed effect of the unknown, it only means this in this case, Z relates to individual matrix, and u is the vector of additivity multigentic effect, and W relates to the known matrix of the record of each individuality additivity QTL effect unknown with it, q is the vector of the additivity QTL effect of individual the unknown, and e is the residue vector.Stochastic variable u, q and e are assumed that multivariate normal distribution and separate (people 2003 such as Lund).

The many qtl analysis of multiple characters

Carry out the multiple characters analysis.Model (1) can extend to multiple characters QTL model, as according to people such as Lund, and 2003 described models (2).

With the following n that has _qThe linear mixed model of QTL is with the proterties modeling.

$y=\mathrm{\μ}+\mathrm{Za}+\underset{i=1}{\overset{n_q}{\mathrm{\Σ}}}{\mathrm{Wh}}_i+e,---\left(2\right)$

Wherein y is n son's of t characteristics record the vector of observation, and μ is the vector of all proterties mean numbers, and Z is to be connected each son's the observed value and the known matrix of its polygene and QTL effect with W, and a is the vector of male animal and son's thereof multigentic effect, h _iBe male animal and son's thereof the haploidy effect to i ' th QTL, e is the vector of residue.Stochastic variable a, h _iBe considered to multivariate normal distribution (MVN) and uncorrelated mutually with e.Specifically, a is MVN

h _iBe MVN

With e be MVN

Matrix G, K and E comprise the variance and covariance in the proterties, and described proterties is owing to multigentic effect, QTL effect and residual effect cause.Symbol

Represent the Kronecker product.A is the additive relation matrix, and it describes the covariance structure in the multigentic effect, IBD _iBe blood relationship same (IBD) matrix, it is described the covariance structure in the effect of i ' th QTL, and I is a unit matrix.

Regression analysis

Estimate group's gene frequency of mark with the EM algorithm.Suppose that subsequently gene frequency is known, and do not have error.Determine the male animal stage based on the labeling pattern of filial generation.Suppose that subsequently this stage is known, and do not have error.Use from the karyomit(e) use during underlined information of same the mapping function (Haldane, 1919) of Haldane to calculate the separation probability of each figure spectral position.Phenotype is revert on the separation probability.Calculate significance threshold values (Churchill and Doerge, 1994) with the displacement test.

Parameter estirmation

With average information constraint maximum likelihood algorithm estimation variance component people such as (, 1997) Jensen.Maximize the constraint likelihood about the component of variance relevant with stochastic effect in the model.On a group particular location maximization constraint likelihood sequence produced the QTL position constraint likelihood curve (

Deng the people, 2003).At mid point estimated parameter along chromosomal each labeled bracketing.Total additive genetic variance mark that QTL explains is estimated as 2 σ ² _h/ (2 σ ² _h+ σ ² _u), σ wherein ² _hAnd σ ² _uCorrespond respectively to the component of variance relevant with the additivity multigentic effect with the haplotype effect.

The IBD probability estimate

Linkage analysis: the IBD probability between the QTL allelotrope of any two person's of foundation haplotypes (Hs and Hm) is assumed that zero, does not promptly set up person's haplotype and be incoherent people 2002 such as () Meuwissen.The haplotype of male animal haplotype and son's paternal inheritance is used to calculate male parent or the maternal QTL allelic probability of succession from male animal, and calculates IBD matrix people such as (, 1995) Wang with recursive algorithm.Along the interval IBD matrix that calculates of chromosomal every 2cM, it is used in subsequently the component of variance method of estimation.

Chain and the linkage disequilibrium analysis of bonded

In the chain and linkage disequilibrium of bonded is analyzed, the IBD probability between the QTL of any two person's of foundation haplotypes allelotrope with Meuwissen and the described method calculating of Goddard (2001).This method is based on coalescent theory (Hudson, 1985), under the QTL condition of inferring, estimates two probability that haplotype is IBD under the situation of the state consistency (IBS) of both sides mark.In brief, be based on the basis of the similarity of allelic mark haplotype at the probability of the IBD of QTL, described allelotrope is around the position: promptly near the identical marker allele hint of many (non-) this position is at the IBD probability of the height (low) of figure spectral position.Actual IBD probability level is subjected to the effectively influence of group's big or small Ne.Suppose that haplotype has total marker allele, calculate before the several generations at contemporary base and base coalescent probability between generation arbitrarily, Tg (Hudson, 1985).Be not easy to estimate Tg and Ne from observed data.Modeling effort shows the selection relative insensitivity (Meuwissen and Goddard, 2000) of the estimation of QTL position to Ne and Tg.Therefore, our use value Tg=100 and Ne=100.Consider to calculate the IBD probability with 10 mark windows.We also use different mark windows for example 6 marks, 4 marks etc. calculate IBD probability in zone, LDLA peak, with detect still less mark whether to be enough to explain the QTL variance that detects by 10 mark haplotypes.The person's of foundation haplotype is divided into different groups.We use (1-IBD _Ij) as range observation, and with the average chain generation rooted tree shape figure of hierarchical clustering algorithm, the genetic affinity of its representative between all person's of foundation haplotypes.From the downward scanning tree of root, cutting goes branch up to node, and all so coalescent haplotypes have range observation (1-IBD _Ij)＜Tc.The group is defined as the haplotype group that gathers into common node.Haplotype in the group is considered to carrying identical QTL allelotrope (IBD probability=1.0), and carries different QTL allelotrope from the haplotype of distinct group, and therefore is considered to independently (IBD probability=0).Therefore, be unit matrix corresponding to the top of the IBD matrix of linkage disequilibrium information corresponding to the different person's of foundation haplotypes.Set up lower section corresponding to the IBD matrix of son's parent haplotype linkage information people such as (, 1995) Wang with recursive algorithm.Calculate the IBD matrix in the interval of each mark mid point, and use it in subsequently the component of variance estimation routine.

Significance level

Calculate the significance threshold values of the analysis of variance component with fast method, with the general threshold level (Piepho, 2001) of calculation control genomic level type i error.The test of hypothesis that has QTL is based on the asymptotically distributed basis of likelihood ratio test (LRT) statistic LRT=-21n (L _Simplify-L _Entirely), L wherein _SimplifyAnd L _EntirelyIt is respectively the likelihood of the maximum under simplifying model and full model.Simplifying model is always got rid of the chromosomal QTL effect of being analyzed.This method is substituting of replacement procedure, is applicable to complicated situation.It need be from degree of freedom (the df) (df=H along the chromosomal LRT that respectively supposes the QTL position, chromosome number, LRT _EntirelyThe number-H of parameter _SimplifyThe number of parameter) and the I type specific inaccuracy of karyomit(e) level.It is significant that the significance level of 5% karyomit(e) level is considered to.

BTA11 result

Table 57 has shown the result from the regression analysis of BTA11.Adopt the LA analytical results of component of variance method to be shown in the table 58; LDLA the results are shown in the table 59, and the LD analytical results is shown in the table 60.Figure 21 (FA), Figure 23 (SRB) and Figure 25 (in conjunction with red) show the QTL curve of the regression analysis that clinical mastitis proterties is carried out; Figure 22 (FA), Figure 24 (SRB) and Figure 26 (in conjunction with red) show the QTL curve to the somatic number proterties.The component of variance method is used to detect the QTL that strides family's qtl analysis.The QTL curve that obtains in the method for using LA, the LDLA of clinical mastitis and LD based on component of variance is shown in Figure 27 (FA), Figure 28 (having the FA to the 4 mark windows of IBD) and Figure 31 (in conjunction with red).LA, the LDLA of proterties SCS and the QTL curve in the LD analysis are shown among Figure 29 (FA), Figure 30 (SRB) and Figure 32 (in conjunction with red).Jumpbogroup is shown in Figure 33 to the influence at clinical mastitis proterties the highest LDLA peak in having the Finland Ai Er prefecture ox of 4 mark haplotypes.

Finland Ai Er prefecture ox

The analysis to all eight Finland Ai Er prefecture oxen (FA) family half sibses of BTA11 of adopting that regression analysis carries out obtains at significant 2 QTL of 5% level.The QTL that influences clinical mastitis is positioned at 11.3cM, and the QTL that influences somatic number is positioned at 64.1cM.A family is significant to mastitis QTL, and other two families reach remarkable threshold values.QTL interval in these three families is an eclipsed, although extend huge zone.Two Finland Ai Er prefecture oxen are significant to SCS QTL, the location gap 6cM of QTL in these two families.The family's linkage analysis of striding that adopts the component of variance method to carry out has the highest likelihood ratio test statistic (LRT) 5.74 at 14.2cM.When carrying out, has tangible QTL peak at 16.8cM, its LRT=11.82 between mark MNB-40 and AUP1 in conjunction with linkage disequilibrium and linkage analysis (LDLA).Although the 20.6cM of the highest LRT between mark DIK4637 and UMBTL103 to the LD of clinical mastitis analyzes also has the evidence of LD (LRT=3.18) between MNB-40 and AUP1.The clinical mastitis variance of being explained by the QTL at the highest LDLA peak of part is 15% of a population variance.10 mark windows are used to estimate the IBD probability under default situations.Repeating LDLA with 4 mark windows (Figure 28) analyzes.17.8cM between mark AUP1 and BM716 observes tangible QTL peak (LRT=9.7).This interval between this 4 mark is 2.1cM.Two Finland Ai Er prefecture ox male animal families are isolating to the SCS QTL in zone 55 to 70cM.In the multiple regression analysis that comprises all FA families, most probable QTL position is 64.1cM.LA analysis with component of variance has the highest LRT (6.6) at 62.8cM.The QTL interval is very wide.Owing in this zone, do not observe LD, can not dwindle the QTL interval so LDLA analyzes.Multiple-effect QTL model, promptly influencing clinical mastitis proterties on the BTA11 and the QTL of SCS does not have polymerization.Two its clinical mastitis QTL of chain QTL model are positioned at 14.2cM, and SCS QTL is positioned at 61.6cM ， And and has LRT16.62.Therefore, can draw 2QTL is isolating on BTA11, and each influences a proterties.

Trawas Red is spent ox in vain

Striding Trawas Red spends the multiple spot regression analysis of ox (SRB) family in vain show that the QTL influence SCS is that the most probable position of isolating and QTL is 61.2cM on BTA11.Concerning QTL, two families are significant.The position of QTL in these two families is at a distance of 20cM (59.8 and 40.4cM).When in SRB, striding family's linkage analysis, be very big to the QTL interval of SCS with the component of variance method.LDLA analyzes the QTL interval is diminished, because lack enough LD in the QTL interval.Whether operation 2-QTL model is influential at 30 two chain QTL to the SCS between the 70cM zone to detect.The QTL at 61.2cM that influences SCS is a fixed, and scans this zone to observe the QTL that another influences SCS.Yet, do not find to influence the demonstration of second QTL of SCS in this zone.This QTL does not have the multiple-effect effect to the mastitis resistance of SRB ox.

Stride variety analysis

Trawas Red is spent cattle breeds and Ai Er prefecture, Northern Europe cattle breeds be closely related (Holmberg and Andersson-Eklund, 2004) in vain.Observing at the QTL that influences SCS on the BTA11 is isolating on FA (62.8cM) and SRB (61.4cM).Therefore, be used for QTL fine Structure Mapping on the BTA11 in conjunction with data from these two kinds.The QTL that observes the clinical mastitis on the BTA11 of a Denmark red ox (DR) family separates at 66.9cM at the QTL of 56.0cM and SCS.The red ox of Denmark is also historical relevant with FA and SRB.Therefore, 13 FA and SRB family are included in the Conjoint Analysis that DR family is used to carry out BTA11.The clinical mastitis proterties of carrying out with component of variance is striden family's linkage analysis and is had the highest LRT (4.72) at 14.2cM.Uniting red ox data analysis is that concerning QTL, they do not separate at the near-end of BTA11 owing to comprise SRB and DR family than the reason that FA inner analysis has lower LA peak.The LDLA peak of red ox binding data is at 16.8cM (LRT=10.1).Though the highest demonstration at the LD of 18.2cM is arranged in red ox data, has LD between mark MNB-40 and AUP1, to have the demonstration at the highest LDLA peak (LRT=3.8).

The QTL that influences SCS in the data analysis in conjunction with red ox has big interval (20cM).LRT in the linkage analysis that carries out with component of variance is 14.6 at the 62.4cM place.The highest LDLA peak is the 61.4cM between mark MS2177 and HELMTT44.LDLA analyzes and analyzes the reason with lower LRT than LA is owing to lack LD in SCS QTL interval.Though in the family and stride family's linkage analysis (returning and adopt component of variance) and have the isolating intensive of SCS QTL to show that dwindling of QTL position is impossible, because the shortage LD QTL interval at BTA11.

The estimation of haplotype effect

Analyze with the LDLA of 4 mark windows clinical mastitis QTL is positioned at 17.8cM between mark AUP1 and the BM716.The Conjoint Analysis of FA, SRB and a DR family shows will be from Finland Ai Er prefecture ox at the QTL of this position information spinner.Therefore, the group and the influence thereof of the mid point between mark AUP1 and BM716 only on Finland Ai Er prefecture ox, have been studied.340 person's of foundation haplotypes are gathered into 63 groups in this position.Have eight to have frequency and be higher than 5% group, and maximum group have 9.7% frequency.The standard deviation that group who comprises two ancestral male animal haplotypes with 32 haplotypes has-0.13 phenotype is estimated effect.

The QTL that the QTL fine Structure Mapping of clinical mastitis proterties and SCS being carried out at BTA11 has confirmed to influence clinical mastitis in Finland Ai Er prefecture ox, be isolating and a QTL influencing SCS to spend in vain in the ox at Finland Ai Er prefecture ox and Trawas Red be all isolating.LDLA analyzes the interval of clinical mastitis fine Structure Mapping to 2.1cM.The QTL that influences the SCS on the BTA11 can not be by fine Structure Mapping, the linkage disequilibrium in the QTL interval.

Haplotype analysis

Above-mentioned QTL fine Structure Mapping result has pointed out that the QTL to CM in 4 mark zone MNB-40-AUP1-BM716-DIK2653 separates.Therefore the mid point between mark AUP1 and BM716 has been studied the person's of foundation haplotype cluster and haplotype effect.Above-mentioned QTL fine Structure Mapping result has pointed out that also the QTL of the SCS in 4 mark zone BM304-INRA177-UMBTL20-RM96INRA177 separates.Therefore, the mid point between mark INRA177 and UMBTL20 has been studied the person's of foundation haplotype cluster and haplotype effect respectively.

This carries out in FA.Identified and the high and relevant haplotype of low mastitis resistance, seen Table 61 and table 62.

Table 57 adopts the family's linkage analysis that returns interval analysis

^*(the 1-[p value])=karyomit(e) conspicuous level

Family's linkage analysis (LA) result that strides that table 58. adopts the component of variance method to carry out gathers

Linkage disequilibrium and linkage analysis (LDLA) result that table 59. adopts the component of variance method to carry out gather

Family's linkage disequilibrium (LD) analytical results of striding that table 60. adopts the component of variance method to carry out gathers

Table 61.BTA11,17.8cM (the 6th interval), CM, FA

Allelotrope/allelotrope is in conjunction with (the public effect of ancestral in the mark person of foundation haplotype

MNB-40-AUP1-BM716-DIK2653) sum of haplotype poultry allelotrope number

294/296/300/304-10-171-238 33 1 -0.0695

294/298/302/304-10-175-238 32 2 +0.0792

292/294-30-167-244 30 2 -0.1275

292/304-30-173-238 28 2 +0.0357

290/302-10-167-240 23 1 +0.0916

290/294/298/300/302 20 1 -0.0310

298/300-30-167-256 19 1 -0.0431

Table 62.BTA11,32.65cM (the 19th interval), SCS, FA-4 mark haplotype

Allelotrope/allelotrope is in conjunction with (ancestral's effect in the mark person of foundation haplotype

BM304-INRA177-UMBTL20-RM96) total male animal equipotential base of haplotype

The number factor

105/109/115/123-99-224-130/124 82 2 -0.1401

105/109/115/123-93-228-124/134 35 2 -0.0189

105/123-93-220-124/134 33 3 +0.1658

109/115/123-93-236-124/130 31 1 +0.0939

123-101-238-124 24 1 -0.0900

105/123-97-236-120/124/130 19 2 -0.0458

Claims (80)

1. determine to be tried the method for garget resistance; it comprises the described genetic marker of being tried there is or do not exist at least one in the ox sample and indicating at least one linkage of characters of mastitis resistance of detection; the both sides that wherein said at least one genetic marker is positioned at ox karyomit(e) BTA9 for and comprise the zone of polymorphic micro-satellite markers C6orf93 and inra084; and/or the both sides of BTA11 for and comprise the zone of polymorphic micro-satellite markers HELMTT43 and BM3501, the existence of wherein said at least one genetic marker or do not exist and indicated the described mastitis resistance of being tried ox or its offspring.

2. according to the method that is used to determine to be tried the garget resistance of claim 1; it comprises that detection is tried the genetic marker that there is or does not exist at least one in the ox sample and indicates at least one linkage of characters of mastitis resistance; the both sides that wherein said at least one genetic marker is positioned at ox karyomit(e) BTA9 for and comprise the zone of polymorphic micro-satellite markers C6orf93 and inra084, the existence of wherein said at least one genetic marker or do not exist and indicated the described mastitis resistance of being tried ox or its offspring.

3. according to the process of claim 1 wherein that the mastitis resistance trait of at least one genetic marker and ox is chain.

According to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker C6orf93 and inra084.

According to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker bms2251 and inra084.

According to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker bm7234 and inra144.

According to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker bms2819 and inra144.

According to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker bms2251 and inra144.

According to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker bms2819 and inra084.

According to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker bm7234 and bms2819.

11. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker bm7234 and bm4208.

12. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker inra144 and rgs17.

13. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker inra144 and inra084.

14. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA9 for and comprise the zone of genetic marker inra084 and rgs17.

15. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker bm4208 and inra144.

16. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker bm7234 and inra084.

17. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker EPM2A and bm7234.

18. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker bms2251 and bm7234.

19. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker C6orf93.

20. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker DIK4986.

21. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker mm12e6.

22. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker PEX3.

23. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker DEAD21.

24. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker BMS2251.

25. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker EPM2A.

26. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker BM7234.

27. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker BM4208.

28. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker BMS2819.

29. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker INRA144.

30. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker INRA084.

31. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker rgs17.

32. according to the process of claim 1 wherein that at least one genetic marker is the combination of genetic marker.

33. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone of the 69.35cM of BTA9 to 74.5cM.

34. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone of the 71.3cM of BTA9 to 74.5cM.

35. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone of the 72.3cM of BTA9 to 74.5cM.

36. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone of the 73.95cM of BTA9 to 74.5cM.

37. according to the method for claim 19, the primer of the microsatellite marker C6orf93 that wherein increases is to being SEQ ID NO.:75 and SEQ ID NO.:76.

38. according to the method for claim 22, the primer of the microsatellite marker PEX3 that wherein increases is to being SEQ ID NO.:81 and SEQ ID NO.:82.

39. according to the method for claim 25, the primer of the microsatellite marker EPM2A that wherein increases is to being SEQ ID NO.:87 and SEQ ID NO.:88.

40. according to the method for claim 31, the primer of the microsatellite marker rgs17 that wherein increases is to being SEQ ID NO.:99 and SEQ ID NO.:100.

41. the method for determining to be tried the garget resistance according to claim 1, wherein at least one genetic marker is positioned at the zone that the both sides of ox karyomit(e) 11 are and comprise polymorphic micro-satellite markers HELMTT43 and BM3501, wherein at least one genetic marker and mastitis resistance are chain, described method comprises that detection exists or do not exist at least one and the genetic marker of at least one linkage of characters of indication mastitis resistance from the genetic stocks that is tried ox, wherein exists described at least one genetic marker to show and shows the mastitis resistance and/or produce the offspring who shows the mastitis resistance.

42. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker HELMTT43 and INRA177.

43. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker HELMTT43 and MNB-70.

44. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker MNB-40 and MNB-70.

45. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker BP38 and INRA131.

46. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker BM2818 and INRA177.

47. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker BMS1953 and BM2818.

48. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker HELMTT43 and ZAP70.

49. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker ZAP70 and IL18RA.

50. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker INRA131 and BM6445.

51. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker BM304 and BM7169.

52. according to the process of claim 1 wherein both sides that at least one genetic marker is positioned at BTA11 for and comprise the zone of genetic marker BM7169 and DIK5170.

53. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker BM6445 and BMS1048.

54. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker MB110 and BMS2047.

55. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker IL18RA and BM2818.

56. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker BM2818 and BM7169.

57. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker BMS2325 and DIK4637.

58. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker IL18RA and AUP1.

59. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone that both sides are and comprise genetic marker DIK4637 and UMBTL103.

60. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker IL18RA.

61. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker MNB-40.

62. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker UAP1.

63. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker DIK4637.

64. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker UMBTL103.

65. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker INRA177.

66. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker UMBTL20.

67. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker BM716.

68. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker DIK2653.

69. according to the process of claim 1 wherein that at least one genetic marker is microsatellite marker BM2818.

70. according to the process of claim 1 wherein that at least one genetic marker is the combination of genetic marker.

71. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone of the 2.249cM of BTA11 to 97.223cM.

72. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone of the 2.249cM of BTA11 to 35.098cM.

73. according to the process of claim 1 wherein that at least one genetic marker is positioned at the zone of the 19.440cM of BTA11 to 23.829cM.

74. according to the method for claim 60, the primer of the microsatellite marker IL18RA that wherein increases is to being SEQ ID NO.:125 and SEQ ID NO.:126.

75. according to the method for claim 61, the primer of the microsatellite marker MNB-40 that wherein increases is to being SEQ ID NO.:127 and SEQ ID NO.:128.

76. according to the method for claim 63, the primer of the microsatellite marker DIK4637 that wherein increases is to being SEQ ID NO.:141 and SEQ ID NO.:142.

77. according to the method for claim 64, the primer of the microsatellite marker UMBTL103 that wherein increases is to being SEQ ID NO.:143 and SEQ ID NO.:144.

78. according to the process of claim 1 wherein at least one genetic marker and the gene linkage that causes mastitis.

79. select to be used for the method for being tried ox of breeding objective, described method comprises by the method in the claim 1 determines udder health characteristics.

80. be used for detecting the diagnostic kit that is tried the ox existence or do not have at least one genetic marker relevant with the mastitis resistance, it comprises the combination of at least one oligonucleotide sequence and they, wherein oligonucleotide sequence be selected from SEQ ID NO.:1 in the SEQ ID NO.:192 any one sequence and/or their any combination.

Images