CN101403012A - Breeding method for sifting tight duck by detecting saltant duck gene - Google Patents
Breeding method for sifting tight duck by detecting saltant duck gene Download PDFInfo
- Publication number
- CN101403012A CN101403012A CNA2008102345330A CN200810234533A CN101403012A CN 101403012 A CN101403012 A CN 101403012A CN A2008102345330 A CNA2008102345330 A CN A2008102345330A CN 200810234533 A CN200810234533 A CN 200810234533A CN 101403012 A CN101403012 A CN 101403012A
- Authority
- CN
- China
- Prior art keywords
- duck
- adiponectin
- breeding
- ducks
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a breeding method for screening thin type ducks by detecting genes of mutant ducks, which is characterized by including the following steps: the design of PRC primers, primer design according to the Adiponectin genome of the duck; the extraction of the genomic DNA of the duck; the PRC amplification of a primer A of the genomic DNA of the duck; the PCR-SSCP analysis of the Adiponectin genotypes of the amplification products; the selection of needed breeding ducks according to the following characteristics of each genotype. Genetic marker assisted breeding selection can be carried out to the breeding ducks by utilizing the method, thus radically solving the problems in traditional genetic breeding, which are caused by the over-pursuit on the rate of growth of meat ducks, for example, meat ducks become higher in fat and worse in quality, excessive fat is deposited, the rate of conversion of feeding stuff is affected and the ratio of eggs to feeding stuff in the production of female ducks is comparatively low and the like.
Description
One, technical field
The invention belongs to biological technical field, relate in particular to a kind of by detecting the breeding method of mutant duck genescreen thin duck.
Two, background technology
Prior art: follow the phenomenal growth of world's poultry production, trade and consumption in recent years, production, trade and the consumption of aquatic bird meat such as duck and goose also increase comparatively fast.China is topmost in the world aquatic bird meat production and consumption state, and the shared world of the production and consumption of duck total amount is bigger, but that Chinese duck participates in the ratio of international trade is also lower.Yet, still on the low side from China's poultry breeding fraction of coverage, so the overall benefit that herding is produced is not high.Because to the too high pursuit of the meat duck speed of growth, the problem of bringing is that sebum, the abdomen fat content of meat duck is more and more higher, quality worse and worse, the deposition excess fat, influenced feed conversion rate, the egg duck produces and also exists the egg material than problem on the low side, and utilizes molecular genetics and marker assisted selection breeding method to combine, and provides best approach to solving top problem undoubtedly.Meat duck for China produces, and mainly is Beijing meat duck and the external cherry valley duck of introducing.And have good growth momentum as China the most characteristic Beijing meat duck and some egg meat dual-purpose type local variety.Adiponectin (Adiponectin, ADP) claim ACRP30, AdipoQ, apM1, GBP28 again, be that (1995) such as Scherer have at first discerned the special albumen of the mouse adipocyte factor with random sequencing cDNA library mode, because of itself and C1Q have very near homology, and relative molecular mass is 30 * 10
3So Da is called after lipocyte complement related protein (ACRP30).Discover that further Adiponectin is the cytokine of fatty tissue specific secretion, monomer whose only is present in the adipocyte, and monomer could be by secretion to the extracellular after having only the polymer of formation, the performance biologic activity.Adiponectin can influence the ability that body is handled carbohydrate and fat.Adiponectin is except directly acting on peripheral tissues, also improves glucose metabolism and loses weight by acting on brain, can enter celiolymph by circulation and act on neuronal cell.Adiponectin that these central authorities discharge can improve energy expenditure makes losing weight of mouse, and fat reduces, and is different from leptin and reaches and lose weight by reducing ingestion of food.GACRP30 is the protein hydrolysate of Adiponectin, belong to its spherical unit, pharmaceutical research finds that gACRP30 can regulate energy balance by the oxidation of plastosome stimulated muscle free fatty acids, and this may be the cause that beta-oxidation or oxidative phosphorylation approach relevant enzyme are expressed to be increased.The low amount of the mouse injection every day gACRP30 of high sugar, high fat diet can cause that blood sugar, free fatty acids and triglyceride level descend, mouse body weight under the constant situation of intake is reduced, but complete Adiponectin injection does not make significant difference to plasma F FA level and muscle fat acid oxidase.Adiponectin albumen is merged in single injection or spherical district fat joins the blood sugar concentration that albumen can significantly reduce diabetes rat.Discover that in liver complete Adiponectin suppresses the synthetic of liver starch synthase (G-6-Pase and phosphoenolpyruvate carboxykinase) on transcriptional level, suppress glycogenetic effect indirectly.Berg etc. studies show that, not affecting glucose absorption of Adiponectin, glycolysis-and glycogen resultant velocity, and this shows that the fast rise of Adiponectin level in the circulation can reduce glycogen output and not influence the periphery glucose absorption.Ma etc. (2002) are though find that Adiponectin knocks out the betaoxidation that has reduced FFA in mouse muscle and the liver, and high fat diet does not make significant difference to the blood sugar of mouse.Kubota etc. discover that the homozygote mouse blood fat that Adiponectin knocks out and the metabolism of blood sugar are normal.Blood plasma adiponectin concentration and total cholesterol, LDL-C and triglyceride levels are negative correlation, are proportionate with the HDL-C level.Tschritter also finds ND Adiponectin and triglyceride and free fatty acids all are negative correlation in different sexes on an empty stomach.Above result shows that Adiponectin plays crucial effect in regulation and control sugar, lipid metabolism, and then has influenced fatty deposits.Have not yet to see the polymorphic research report aspect domestic animal, poultry of Adiponectin gene mononucleotide.But the research of the function of Adiponectin aspect human obesity, disease is more, and genome scanning expression adiponectin is positioned at human 3q27, is the area of liability of diabetes.Usually could detect after need butchering for carcass proterties such as the sebum of duck, abdomen fat, by the Adiponectin gene genotype is detected diagnosis, just can know the ability of growing of duck in early days growing, very meaningful for the seed selection of duck.
Three, summary of the invention
Technical problem: the present invention is directed to above-mentioned technological gap, provide a kind of by detecting the breeding method of mutant duck genescreen thin duck.Can be by the Adiponectin gene genotype be detected by this method, just can know the ability of growing of duck in early days growing, could detect after butchering and need not wait.
Technical scheme: a kind of by detecting the breeding method of mutant duck genescreen thin duck, step is:
The a.PCR primer design: the Adiponectin genom sequence according to duck designs following primer
Primer?A：DuadpF?5′-ACGAGCAGAACCACTACGAC-3′
DuadpR?5′-CTGAGGTGCAGCAAGACAGA-3′
B. the extraction of duck genomic dna;
C. the duck genomic dna carries out pcr amplification with primer A;
D. amplified production carries out PCR-SSCP and analyzes the Adiponectin genotype, judges it whether is a kind of in the following genotype:
AA ACGAGCAGAACCACTACGACACCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGATGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
BB ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
CC ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCGTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCCACAAGAAGGACAAGGCCGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
AB ACGAGCAGAACCACTACGACA/GCCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGAT/CGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
AC ACGAGCAGAACCACTACGACA/GCCAGCACCGGCAAGTTCCTCTGCAGCA/GTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGAT/CGTCAAGGTCAGCCTCT/CACAAGAAGGACAAGGCT/CGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
BC ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCA/GTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCT/CACAAGAAGGACAAGGCT/CGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
AB, AC, BC are heterozygous, and two chains are respectively from two karyomit(e)s, and wherein chain is the base on the slash, and another is the base under the slash, the two kinds of bases in these positions all exist simultaneously.
E. select the kind duck of needs according to each genotypic following characteristic: sebum rate, abdomen fat weigh and abdomen fat rate mean value size puts in order is BC＞BB＞AA＞AC＞CC＞AB.
The method of the extraction of above-mentioned duck genomic dna is: the fresh blood of getting duckling to be measured, adding can reach the antithrombotics of anticoagulation amount, the fowl lysate that adds 30 times of blood volume again, described fowl lysate is pH8.010mM TrisCl, the mixed solution of pH8.0 0.1M EDTA and concentration 0.5% (m/v) SDS, adding Proteinase K final concentration to the mixture system then is 100-200 μ g/ml, mixing digestion no longer includes the heavy-gravity agglomerate in solution under 55 ℃ of conditions, solution is cooled to room temperature, add equal-volume phenol, put upside down centrifuge tube repeatedly, mix formation emulsion until two-phase, get supernatant after room temperature is centrifugal, use equal-volume phenol/chloroform/primary isoamyl alcohol mixed solution again, each centrifugal extracting of chloroform 1 time, phenol in the described mixed solution, chloroform, the volume ratio of primary isoamyl alcohol is 24: 23: 1, get the 3M that the extract supernatant liquor adds 1/10 supernatant liquor volume, the dehydrated alcohol deposit D NA of pH5.2 NaAc and 2 times of supernatant liquor volumes, DNA chosen be put in the 1.5ml centrifuge tube, with concentration is that 70% (v/v) ethanol washes twice, will be dissolved in after the DNA drying in an amount of TE damping fluid or the sterilization distilled water.
Above-mentioned pcr amplification reaction step is: the pcr amplification reaction system is 5U/ μ L rTaq polysaccharase 0.15 μ L, and 2.5 μ L do not contain Mg
2+10 * PCR Buffer, 2.5mmol/L dNTP 2 μ L, 25mmol/LMgCl
21.5 μ L, each 1 μ L of the upstream and downstream primer of 10pmol/L, 50-100ng/ μ L dna profiling 1 μ L adds sterile purified water and makes system to 25 μ L, and the PCR program is 95 ℃ of sex change 5min; Then at 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s carry out 35 circulations; 72 ℃ are extended 10min; 4 ℃ of preservations.
Above-mentioned single strand conformation polymorphism check and analysis step is: 4 μ L PCR products and 5 μ L Loading buffer mix, 98 ℃ of sex change 10min, ice bath 5min again, be the non-denaturing polyacrylamide gel of 12% (m/v) at last with concentration, 10V/cm, under the 12h condition after the electrophoretic analysis silver dye colour developing, described Loading buffer[97% (v/v) deionized formamide, 0.025% (m/v) tetrabromophenol sulfonphthalein, 0.025% (m/v) dimethylbenzene green grass or young crops, 10mmol/L disodium ethylene diamine tetraacetate (pH8.0), 2% (v/v) glycerine], described non-denaturing polyacrylamide gel is acrylamide monomer: N, and the mass ratio of N '-methylene diacrylamide is 29: 1.
Above-mentioned silver staining method is: electrophoresis takes off gel after finishing, and places concentration to be respectively the Glacial acetic acid of 10% (v/v) ethanol and 0.5% (v/v), and the water-bath oscillator slowly shakes up fixedly 15-20min; Ethanol on the deionized water flush away gel; With concentration is the AgNO of 0.1-0.2% (m/v)
3Dyeing 20min; Unnecessary staining fluid on the deionized water flush away gel; Be respectively the formaldehyde mixed solution colour developing of NaOH, the 0.4-0.5% (m/v) of 3% (m/v) with concentration, about 10-30min outwells colour developing liquid; Deionized water is preserved after washing unnecessary colour developing liquid off.
Beneficial effect: the breeding method of duck of the present invention is a kind of Adiponectin gene mononucleotide polymorphism method that accurately, simply, rapidly, directly detects, utilize this method to carry out the genetic marker assisted selection to kind of duck, thereby can fundamentally solve in the traditional genetic breeding because to the too high pursuit of the meat duck speed of growth, the problem of bringing, lipid content as the meat duck is more and more higher, quality worse and worse, the deposition excess fat, influenced feed conversion rate, the egg duck produces and also to exist the egg material than on the low side etc.Because, no matter be the also breeding of egg duck of meat duck, sebum rate, abdomen fat rate are very important selection indexs, and directly can not realize its mensuration, the polymorphism mark of the duck fatty character Adiponectin gene that we invent, can be used as the selective marker of fatty character in the breeding of meat duck, reach the purpose that reduces lipid content to a certain extent.Present method just can be finished the seed selection work of the fatty deposits ability that reduces colony as long as detect genotype.Detection method is simple, genotype is judged easily, therefore has promotional value.
Four, description of drawings
Fig. 1 is the sscp analysis of primer A to different varieties duck amplified fragments
(find 6 kinds of genotype after testing altogether, be respectively AA type, BB type, CC type, AB type, AC type and BC type, shown the banding pattern of range gene type among the figure);
Fig. 2 is that primer A amplification of nucleotide acid sequence compares between different genotype.
(by the PCR product of homozygous AA type, BB type and CC type being reclaimed the back order-checking, having compared the sequence difference between 3 kinds of genotype, "-" expression identical sequence)
Five, embodiment
Embodiment 1:
The first step: PCR primer design
It is as follows to have designed 1 pair of primer according to this laboratory clone's duck Adiponectin genom sequence:
Primer?A：DuadpF?5′-ACGAGCAGAACCACTACGAC-3′
DuadpR?5′-CTGAGGTGCAGCAAGACAGA-3′
Second step: the extraction of duck genomic dna, get 20 μ l fresh bloods, add the anti-freezing of ACD antithrombotics, add 600 μ l fowl lysates, described fowl lysate is the mixed solution of pH8.0 10mM TrisCl, pH8.0 0.1M EDTA and concentration 0.5% (m/v) SDS, adding Proteinase K to final concentration is 100-200 μ g/ml, 55 ℃ of digestion of mixing, 6～10hr no longer includes the heavy-gravity agglomerate in solution, solution is cooled to room temperature, add equal-volume phenol, put upside down centrifuge tube repeatedly, mix forming emulsion, 12 until two-phase, 000rpm, the centrifugal 10min of room temperature.Get supernatant, use equal-volume phenol/chloroform/primary isoamyl alcohol mixed solution, each centrifugal extracting of chloroform 1 time again, the volume ratio of phenol, chloroform, primary isoamyl alcohol is 24: 23: 1 in the described mixed solution.Get the NaAc that extract supernatant (water) adds 1/10 supernatant liquor volume (3M, pH5.2) and the dehydrated alcohol deposit D NA of 2 times of supernatant liquor volumes.DNA chosen being put in the 1.5ml centrifuge tube, is that 70% (v/v) ethanol is washed twice with concentration.(attention can not be too dried) after the DNA drying is dissolved in an amount of TE or the sterilization distilled water.
The 3rd step: pcr amplification, this PCR reaction system is a part of the present invention, is the optimization PCR method that detects duck Adiponectin gene mononucleotide polymorphism, reactions steps is as follows:
The pcr amplification reaction system be 0.15 μ L rTaq polysaccharase (5U/ μ L, Takara Tokyo, Japan), 2.5 μ L10PCR Buffer (without Mg
2+), 2 μ L dNTP (2.5mmol/L each), 1.5 μ L MgCl
2(25mmol/L), each 1 μ L (10pmol/L) of upstream and downstream primer, 1 μ L (50-100ng/ μ L) dna profiling adds sterile purified water to 25 μ L.The PCR program is 95 ℃ of sex change 5min; Then at 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s carry out 35 circulations; 72 ℃ are extended 10min; 4 ℃ of preservations.
The 4th step: sscp analysis, 4 μ L PCR products and 5 μ L Loading buffer[97% (v/v) deionized formamides, 0.025% (m/v) tetrabromophenol sulfonphthalein, 0.025% (m/v) dimethylbenzene green grass or young crops, 10mmol/L disodium ethylene diamine tetraacetate (pH8.0), 2% (v/v) glycerine], be that (Acr: Bis=29: silver dyes colour developing to 12% (m/v) non-denaturing polyacrylamide gel after the 1) electrophoretic analysis (10V/cm, 12h) through concentration.
The 5th step: carry out PCR-SSCP with primer A and analyze whether the Adiponectin gene is following genotype:
AA ACGAGCAGAACCACTACGACACCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGATGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
BB ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
CC ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCGTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCCACAAGAAGGACAAGGCCGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
AB-A ACGAGCAGAACCACTACGACACCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGATGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
AB-B ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
AC-A ACGAGCAGAACCACTACGACACCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGATGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
AC-C ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCGTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCCACAAGAAGGACAAGGCCGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
BC-B ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
BC-C ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCGTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCCACAAGAAGGACAAGGCCGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG
The 6th step: according to the kind duck of each genotypic following characteristic selection needs,
Sebum rate mean value size puts in order and is BC＞BB＞AA＞AC＞CC＞AB, wherein BC and AC, CC, AB type significant difference; Abdomen fat weighs and abdomen fat rate mean value size puts in order is BC＞BB＞AA＞AC＞CC＞AB, abdomen fat double recipe face BC and AC, CC, AB type, BB and AB type significant difference, abdomen fat rate aspect BC and AC, CC, AB type, BB and CC, AB type significant difference.
Embodiment 2:
1, utilize aforesaid method to find duck Adiponectin gene mononucleotide polymorphism.
Adopt primer A to carry out PCR-SSCP and analyze, we find 6 kinds of genotype (Fig. 1).Finding to have in this fragment 5 Nucleotide that sudden change has taken place, is respectively G → A (430), A → G (457), C → T (507), T → C (523), T → C (540), and these sudden changes have caused the Adiponectin coding region to present polymorphism.It is identical that sequencing result finds that BB and GenBank upload sequence, is defined as wild-type, and other is defined as mutant (Fig. 2).
2, found relation between Adiponectin gene mononucleotide polymorphism and production performance
The relation of proterties such as we are heavy to the Adiponectin single nucleotide polymorphism found and live-weight, carcass, half clean thorax weight, liver weight, sebum weight, sebum rate, abdomen fat weight, abdomen fat rate has been carried out the least square variance analysis.Find that cherry valley duck sebum rate in 12 age in week, abdomen fat weigh, abdomen fat rate is remarkable at the different genotype differences, sebum rate mean value size puts in order and is BC＞BB＞AA＞AC＞CC＞AB, wherein BC and AC, CC, AB type significant difference; Abdomen fat weighs and abdomen fat rate mean value size puts in order is BC＞BB＞AA＞AC＞CC＞AB, abdomen fat double recipe face BC and AC, CC, AB type, BB and AB type significant difference, abdomen fat rate aspect BC and AC, CC, AB type, BB and CC, AB type significant difference.
6 kinds of genotype of table cherry valley duck are being butchered the multiple comparisons of aspect of performance
Annotate: butchering performance data in the table is mean+SD.The different person's significant differences of same column letter, identical person's difference is not remarkable.
No matter be the breeding of meat duck, egg duck or dual-purpose type duck, fatty deposits is very important selection index, and directly can not realize its mensuration, the polymorphism mark of the duck fatty character Adiponectin gene that we invent, can be used as the selective marker of fatty character in the breeding of meat duck, reach the purpose that reduces lipid content to a certain extent.Present method just can be finished and reduce the sedimentary breeding work of adipopexis as long as detect genotype.Detection method is simple, genotype is judged easily, therefore has promotional value.
The duck that present embodiment is selected to have CC type gene carries out breeding for kind of a duck.This duck has the low characteristics of abdomen fat rate.
Adiponectin gene of mutant duck of the present invention and the contrast of the nucleotide sequence of the Adiponectin gene in the GenBank gene pool are as follows:
The single nucleotide polymorphism of Adiponectin gene coding region
AA type ATGAGGGACTCAGCAGGCTTCCTCCTTTGCTCACTGCTGCTGGTGGCCCCCCATTG CACAGAGGTGGCCGCCCAGGATCC 80
The BB type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 80
The CC type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 80
AA type CCAGCCCGACCCCAAGACACCGTGCGCCAACTGGATGGGAGGAGCACCCGGCTACC CCGGTCACAACGGGCTCCCCGGCA 160
The BB type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 160
The CC type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 160
AA type GGGACGGGAAAGATGGAAAAGATGGACTAAAGGGAGAGAAAGGAGAGCAAGGTTTG CAAGGCTCCAAAGGGGACCAAGGC 240
The BB type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 240
The CC type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 240
AA type GCCATGGGAAGCGCAGGGCCAGAGGGGCCAAGAGGCTTTCCAGGACAGCCAGGGCT GAAGGGAGACAAGGGTGAAGGGGC 320
The BB type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 320
The CC type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 320
AA type CTATGTTTACCGCTCCGCCTTCAGCGTGGGGCTGACGGAGCGAGCCCCCCACCCCA ACGTCCCCATCCGCTTCAGCAAGA 400
The BB type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 400
The CC type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 400
AA type TCTTCTACAACGAGCAGAACCACTACGACACCAGCACCGGCAAGTTCCTCTGCAGC ATCCCCGGCACCTACTACTTCGCC 480
The BB type ... ... ... ... ... ..G..........................A....................... 480
The CC type ... ... ... ... ... ..G..........................G....................... 480
AA type TACCACCTGACGGTGTACATGTCAGATGTCAAGGTCAGCCTCTACAAGAAGGACAA GGCTGTCATCTTCACCTACGACCA 560
The BB type ... ... ... ... ..C...............T................T.................... 568
The CC type ... ... ... ... ..C...............C................C.................... 560
AA type GTTCCAGACCAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAGCT CAGGGGATGAGGTCTGGCTCCAGG 640
The BB type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 640
The CC type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 640
AA type TCTACGGGGAGGGGGAAAACAACGGTGTCTACGCTGACAACATCAACGATTCCACT TTCATGGGCTTCCTCCTGTACCCA 720
The BB type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 720
The CC type ... ... ... ... ... ... ... ... ... ... ... ... ... .. 720
AA type GACATGGATTTCCATTAG 738
The BB type ... ... ... 738
The CC type ... ... ... 738
Sequence table
＜110〉Changshu Institute of Technology
＜120〉a kind of by detecting the breeding method of mutant duck genescreen thin duck
<160>11
<210>1
<211>20
<212>DNA
<222>(1)...(20)
<400>1
ACGAGCAGAACCACTACGAC
<210>2
<211>20
<212>DNA
<222>(1)...(20)
<400>2
CTGAGGTGCAGCAAGACAGA
<210>3
<211>205
<212>DNA
<222>(1)...(205)
<400>3
1 ACGAGCAGAA?CCACTACGAC?ACCAGCACCG?GCAAGTTCCT?CTGCAGCATC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGATGT?CAAGGTCAGC?CTCTACAAGA
121 AGGACAAGGC?TGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
<210>4
<211>205
<212>DNA
<222>(1)...(205)
<400>4
1 ACGAGCAGAA?CCACTACGAC?GCCAGCACCG?GCAAGTTCCT?CTGCAGCATC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGACGT?CAAGGTCAGC?CTCTACAAGA
121 AGGACAAGGC?TGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
<210>5
<211>205
<212>DNA
<222>(1)...(205)
<400>5
1 ACGAGCAGAA?CCACTACGAC?GCCAGCACCG?GCAAGTTCCT?CTGCAGCGTC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGACGT?CAAGGTCAGC?CTCCACAAGA
121 AGGACAAGGC?CGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
<210>6
<211>205
<212>DNA
<222>(1)...(205)
<400>6
1 ACGAGCAGAA?CCACTACGAC?ACCAGCACCG?GCAAGTTCCT?CTGCAGCATC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGATGT?CAAGGTCAGC?CTCTACAAGA
121 AGGACAAGGC?TGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
<210>7
<211>205
<212>DNA
<222>(1)...(205)
<400>7
1 ACGAGCAGAA?CCACTACGAC?GCCAGCACCG?GCAAGTTCCT?CTGCAGCATC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGACGT?CAAGGTCAGC?CTCTACAAGA
121 AGGACAAGGC?TGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
<210>8
<211>205
<212>DNA
<222>(1)...(205)
<400>8
1 ACGAGCAGAA?CCACTACGAC?ACCAGCACCG?GCAAGTTCCT?CTGCAGCATC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGATGT?CAAGGTCAGC?CTCTACAAGA
121 AGGACAAGGC?TGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
<210>9
<211>205
<212>DNA
<222>(1)...(205)
<400>9
1 ACGAGCAGAA?CCACTACGAC?GCCAGCACCG?GCAAGTTCCT?CTGCAGCGTC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGACGT?CAAGGTCAGC?CTCCACAAGA
121 AGGACAAGGC?CGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
<210>10
<211>205
<212>DNA
<222>(1)...(205)
<400>10
1 ACGAGCAGAA?CCACTACGAC?GCCAGCACCG?GCAAGTTCCT?CTGCAGCATC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGACGT?CAAGGTCAGC?CTCTACAAGA
121 AGGACAAGGC?TGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
<210>11
<211>205
<212>DNA
<222>(1)...(205)
<400>11
1 ACGAGCAGAA?CCACTACGAC?GCCAGCACCG?GCAAGTTCCT?CTGCAGCGTC?CCCGGCACCT
61 ACTACTTCGC?CTACCACCTG?ACGGTGTACA?TGTCAGACGT?CAAGGTCAGC?CTCCACAAGA
121 AGGACAAGGC?CGTCATCTTC?ACCTACGACC?AGTTCCAGAC?CAACAACATC?GACCAGGCGA
181 GCGGCTCTGT?CTTGCTGCAC?CTCAG
Claims (5)
1. one kind by detecting the breeding method of mutant duck genescreen thin duck, it is characterized in that step is:
The a.PCR primer design: the Adiponectin genom sequence according to duck designs following primer
Primer?A：DuadpF 5′-ACGAGCAGAACCACTACGAC-3′
DuadpR 5′-CTGAGGTGCAGCAAGACAGA-3′
B. the extraction of duck genomic dna;
C. the duck genomic dna carries out pcr amplification with primer A;
D. amplified production carries out PCR-SSCP and analyzes the Adiponectin genotype, judges it whether is a kind of in the following genotype:
AA ACGAGCAGAACCACTACGACACCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGATGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG；
BB ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG；
CC ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCGTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCCACAAGAAGGACAAGGCCGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG；
AB ACGAGCAGAACCACTACGACA/GCCAGCACCGGCAAGTTCCTCTGCAGCATCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGAT/CGTCAAGGTCAGCCTCTACAAGAAGGACAAGGCTGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG；
AC ACGAGCAGAACCACTACGACA/GCCAGCACCGGCAAGTTCCTCTGCAGCA/GTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGAT/CGTCAAGGTCAGCCTCT/CACAAGAAGGACAAGGCT/CGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG；
BC ACGAGCAGAACCACTACGACGCCAGCACCGGCAAGTTCCTCTGCAGCA/GTCCCCGGCACCTACTACTTCGCCTACCACCTG
ACGGTGTACATGTCAGACGTCAAGGTCAGCCTCT/CACAAGAAGGACAAGGCT/CGTCATCTTCACCTACGACCAGTTCCAGAC
CAACAACATCGACCAGGCGAGCGGCTCTGTCTTGCTGCACCTCAG；
E. select the kind duck of needs according to each genotypic following characteristic: sebum rate, abdomen fat weigh and abdomen fat rate mean value size puts in order is BC＞BB＞AA＞AC＞CC＞AB.
2. according to claim 1 by detecting the breeding method of mutant duck genescreen thin duck, the method that it is characterized in that the extraction of described duck genomic dna is: the fresh blood of getting duckling to be measured, adding can reach the antithrombotics of anticoagulation amount, the fowl lysate that adds 30 times of blood volume again, described fowl lysate is pH8.0 10mM TrisCl, the mixed solution of pH8.0 0.1M EDTA and concentration 0.5% (m/v) SDS, adding Proteinase K final concentration to the mixture system then is 100-200 μ g/ml, mixing digestion no longer includes the heavy-gravity agglomerate in solution under 55 ℃ of conditions, solution is cooled to room temperature, add equal-volume phenol, put upside down centrifuge tube repeatedly, mix formation emulsion until two-phase, get supernatant after room temperature is centrifugal, use equal-volume phenol/chloroform/primary isoamyl alcohol mixed solution again, each centrifugal extracting of chloroform 1 time, phenol in the described mixed solution, chloroform, the volume ratio of primary isoamyl alcohol is 24: 23: 1, get the 3M that the extract supernatant liquor adds 1/10 supernatant liquor volume, the dehydrated alcohol deposit D NA of pH5.2 NaAc and 2 times of supernatant liquor volumes, DNA chosen be put in the 1.5ml centrifuge tube, with concentration is that 70% (v/v) ethanol washes twice, will be dissolved in after the DNA drying in an amount of TE damping fluid or the sterilization distilled water.
3. according to claim 1 by detecting the breeding method of mutant duck genescreen thin duck, it is characterized in that described pcr amplification reaction step is: the pcr amplification reaction system is 5U/ μ L rTaq polysaccharase 0.15 μ L, and 2.5 μ L do not contain Mg
2+10 * PCR Buffer, 2.5mmol/L dNTP2 μ L, 25mmol/L MgCl
21.5 μ L, each 1 μ L of the upstream and downstream primer of 10pmol/L, 50-100ng/ μ L dna profiling 1 μ L adds sterile purified water and makes system to 25 μ L, and the PCR program is 95 ℃ of sex change 5min; Then at 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s carry out 35 circulations; 72 ℃ are extended 10min; 4 ℃ of preservations.
4. according to claim 1 by detecting the breeding method of mutant duck genescreen thin duck, it is characterized in that described single strand conformation polymorphism check and analysis step is: 4 μ L PCR products and 5 μ L Loading buffer mix, 98 ℃ of sex change 10min, ice bath 5min again, be the non-denaturing polyacrylamide gel of 12% (m/v) at last with concentration, 10V/cm, under the 12h condition after the electrophoretic analysis silver dye colour developing, described Loading buffer consists of 97% (v/v) deionized formamide, 0.025% (m/v) tetrabromophenol sulfonphthalein, 0.025% (m/v) dimethylbenzene green grass or young crops, the 10mmol/L disodium ethylene diamine tetraacetate, 2% (m/v) glycerine, described non-denaturing polyacrylamide gel is acrylamide monomer: N, and the mass ratio of N '-methylene diacrylamide is 29: 1.
5. according to claim 4 by detecting the breeding method of mutant duck genescreen thin duck, it is characterized in that described silver staining method is: electrophoresis takes off gel after finishing, place concentration to be respectively the Glacial acetic acid of 10% (v/v) ethanol and 0.5% (v/v), the water-bath oscillator slowly shakes up fixedly 15-20min; Ethanol on the deionized water flush away gel; With concentration is the AgNO of 0.1-0.2% (m/v)
3Dyeing 20min; Unnecessary staining fluid on the deionized water flush away gel; Be respectively the formaldehyde mixed solution colour developing of NaOH, the 0.4-0.5% (m/v) of 3% (m/v) with concentration, about 10-30min outwells colour developing liquid; Deionized water is preserved after washing unnecessary colour developing liquid off.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102345330A CN101403012A (en) | 2008-11-21 | 2008-11-21 | Breeding method for sifting tight duck by detecting saltant duck gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008102345330A CN101403012A (en) | 2008-11-21 | 2008-11-21 | Breeding method for sifting tight duck by detecting saltant duck gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101403012A true CN101403012A (en) | 2009-04-08 |
Family
ID=40537171
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008102345330A Pending CN101403012A (en) | 2008-11-21 | 2008-11-21 | Breeding method for sifting tight duck by detecting saltant duck gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101403012A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899516A (en) * | 2010-07-23 | 2010-12-01 | 李宁 | Method for detecting body size traits among duck groups and kit |
| CN101935655A (en) * | 2010-10-14 | 2011-01-05 | 扬州大学 | Molecule detection kit for beef tenderness selection |
| CN102277420A (en) * | 2011-05-06 | 2011-12-14 | 安徽省农业科学院畜牧兽医研究所 | Breeding method of duck |
| CN107130023A (en) * | 2017-05-09 | 2017-09-05 | 石河子大学 | The genetic marker related to laying hen egg quality characteristics and its application |
| CN108085398A (en) * | 2017-12-28 | 2018-05-29 | 安徽农业大学 | A kind of molecular labeling and its application based on apm 1 gene ADP identification duck reproductive traits |
| CN108165639A (en) * | 2018-03-12 | 2018-06-15 | 中国农业科学院北京畜牧兽医研究所 | A kind of and the relevant molecular labeling of fleshy duck fodder transformation efficiency character and its application |
| CN111513022A (en) * | 2020-05-08 | 2020-08-11 | 武汉市农业科学院 | Breeding method of small-body meat ducks with low skin fat rate |
-
2008
- 2008-11-21 CN CNA2008102345330A patent/CN101403012A/en active Pending
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899516A (en) * | 2010-07-23 | 2010-12-01 | 李宁 | Method for detecting body size traits among duck groups and kit |
| CN101899516B (en) * | 2010-07-23 | 2012-11-14 | 李宁 | Method for detecting body size traits among duck groups and kit |
| CN101935655A (en) * | 2010-10-14 | 2011-01-05 | 扬州大学 | Molecule detection kit for beef tenderness selection |
| CN101935655B (en) * | 2010-10-14 | 2011-12-07 | 扬州大学 | Molecule detection kit for beef tenderness selection |
| CN102277420A (en) * | 2011-05-06 | 2011-12-14 | 安徽省农业科学院畜牧兽医研究所 | Breeding method of duck |
| CN107130023A (en) * | 2017-05-09 | 2017-09-05 | 石河子大学 | The genetic marker related to laying hen egg quality characteristics and its application |
| CN108085398A (en) * | 2017-12-28 | 2018-05-29 | 安徽农业大学 | A kind of molecular labeling and its application based on apm 1 gene ADP identification duck reproductive traits |
| CN108085398B (en) * | 2017-12-28 | 2020-05-08 | 安徽农业大学 | Molecular marker for identifying duck breeding traits based on adiponectin gene ADP and application thereof |
| CN108165639A (en) * | 2018-03-12 | 2018-06-15 | 中国农业科学院北京畜牧兽医研究所 | A kind of and the relevant molecular labeling of fleshy duck fodder transformation efficiency character and its application |
| CN108165639B (en) * | 2018-03-12 | 2019-01-01 | 中国农业科学院北京畜牧兽医研究所 | One kind molecular labeling relevant to fleshy duck fodder transformation efficiency character and its application |
| CN111513022A (en) * | 2020-05-08 | 2020-08-11 | 武汉市农业科学院 | Breeding method of small-body meat ducks with low skin fat rate |
| CN111513022B (en) * | 2020-05-08 | 2021-11-12 | 武汉市农业科学院 | Breeding method of small-body meat ducks with low skin fat rate |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101403012A (en) | Breeding method for sifting tight duck by detecting saltant duck gene | |
| Goetz et al. | A genetic basis for the phenotypic differentiation between siscowet and lean lake trout (Salvelinus namaycush) | |
| CN104250646B (en) | A kind of molecular labeling relevant to pig feed transformation efficiency proterties and detection method and application | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| US11879160B2 (en) | Molecular marker for identifying trait of efficiency of duck feed utilization based on neuropeptide gene NPY, method and use thereof | |
| CN107988379B (en) | Genetic marker related to Tibetan sheep plateau hypoxia adaptability and application thereof | |
| Aali et al. | Polymorphism in the SCD gene is associated with meat quality and fatty acid composition in Iranian fat-and thin-tailed sheep breeds | |
| Suzuki et al. | Characterization of growth, fat deposition, and lipid metabolism-related gene expression in lean and obese meat-type chickens | |
| Özcan Gökçek et al. | Associations between genetic variants of the insulin-like growth factor I (IGF-I) gene and growth traits in European sea bass (Dicentrarchus labrax, L.) | |
| CN105063021A (en) | SNP molecular marker associated with pig fat deposition, and applications thereof | |
| CN110423825B (en) | Poultry egg yield molecular marker and application thereof | |
| CN102653757B (en) | SNP molecular marker easy to domesticate artificial feed mandarin fish related gene | |
| Kileh-Wais et al. | Detection of QTL controlling metabolism, meat quality, and liver quality traits of the overfed interspecific hybrid mule duck | |
| CN104480212B (en) | The detection method in cattle PLIN2 gene mononucleotide polymorphism site and detection kit | |
| CN101899527B (en) | Molecular marking method of A-FABP gene predicted Qinchuan cattle meat quality | |
| CN101603086B (en) | Molecular marking method for indicating and identifying chicken abdominal fat weight by using ACC alpha gene | |
| CN103243155B (en) | The method for quick in cattle CIDEC gene mononucleotide polymorphism site and application | |
| CN104593363A (en) | Excellent slaughter trait molecular genetic marker of broiler chicken and application of excellent slaughter trait molecular genetic marker | |
| CN104357548B (en) | A kind of molecule labelling method indicating the general premunition of sheep | |
| CN1769487A (en) | Molecule marking method for foreshowing and identifying chicken abdomen fat content by IGFBP2 gene | |
| CN103911375B (en) | The molecular marker relevant to beef cattle Meat Quality and application thereof | |
| CN103114088A (en) | Sepiella maindroni microsatellite sites and application thereof | |
| CN103305506B (en) | SNP (single nucleotide polymorphism) molecular mark related to domesticating property of mandarin fish | |
| Zhao et al. | Hepatic lipolysis in broiler chickens with different fat deposition during embryonic development | |
| CN115181805A (en) | Molecular marker related to yellow degree of leg skin of yellow-feathered broilers and application of molecular marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090408 |