CN101401933B - Uses of FGFR2IIIc cell lateral segment in preparing medicament for preventing and treating spontaneous pulmonary fibrosis - Google Patents

Abstract

The invention discloses application of FGFR2IIIc extracellular section in the preparation of medicaments for preventing and treating idiopathic pulmonary fibrosis. The FGFR2IIIc can be combined with FGF2 to reduce the effective concentration of the FGFR2IIIc so as to inhibit the process of fibrosis. The FGFR2IIIc in the invention is used in the preparation of the medicaments for preventing and/or treating the idiopathic pulmonary fibrosis, and has better prevention and treatment efficacies. The FGFR2IIIc extracellular section is generally used in the form of pharmaceutical composition which contains the FGFR2IIIc extracellular section and pharmaceutically acceptable auxiliary materials; and the dosage of the FGFR2IIIc extracellular section can be determined according to the state of an illness and the treatment time, and generally the injection administration is 250 to 300 micrograms each time for 1 to 2 times a day. The pharmaceutical composition in the invention can be made into two dosage forms of freeze-dried powder injection solution and injection liquid which are used through intravenous injection.

Description

The application of FGFR2IIIc extracellular fragment in preparation prevention, treatment idiopathic pulmonary fibrosis medicine

Technical field

The invention belongs to genetically engineered drug field, be specifically related to the application of FGFR2IIIc extracellular fragment in preparation prevention, treatment idiopathic pulmonary fibrosis medicine.

Background technology

Idiopathic pulmonary fibrosis (idiopath ic pulmonary fibro sis, IPF) refer to a kind of chronic inflammation interstitial lung disease agnogenio and taking plain edition interstitial pneumonia (UIP) as characteristic pathological change, main pathology shows as Diffuse alveolar inflammation, the disorder of alveolar unit structure and pulmonary fibrosis.Primary disease clinically more shows as carrying out property dyspnea with zest dry cough, and two lungs are heard and velcro rale, often have drumstick finger (toe), and chest x-ray shows two netted shades of lung diffusivity, and pulmonary function is restrictive ventilatory disorder.The state of an illness is generally carried out sexual development, finally because respiratory failure causes death.

Epidemiologic data demonstration, IPF sickness rate is continuous ascendant trend, because pathogenesis is unclear, case fatality rate is high, there is no so far definite effectively Therapeutic Method, therefore, actively finding new Therapeutic Method has become and has improved IPF patient's prognosis, improve survival rate in the urgent need to.

Increasing evidence shows: it is impaired abnormal with reparation that the pathological change of IPF comes from alveolar epithelium.Widely distributed fibroblast kitchen range is the main position of injuring and repairing.Alveolar epithelial cells damage can cause fibroblast propagation and to myofibroblast Phenotype Transition.It has been generally acknowledged that myofibroblast can impel wound contraction, soft tissue retraction, and the cytokine profiles that can produce and secrete collagen and comprise fibrosis is as cytokine TGF – β, FGF2 etc.Active fibroblast/myofibroblast can make ECM generation increase, and causes ECM over-deposit and alveolar structure to destroy, and finally causes pulmonary fibrosis and impaired lung function.In addition, myofibroblast also can be induced alveolar epithelial cells death, has pathological changes, suppresses effective re-epithelialization thereby maintain alveolar epithelium.Therefore in alveolar epithelium injury repairing process anti-fiber-reactive and cause balance final decision between fiber-reactive pulmonary fibrosis whether occur.

Fibroblast growth factor (Fibroblast growth factors FGFs) is the Heparin-binding polypeptide of one group of homology, and its family comprises 23 members.FGFs has biologic activity widely, for example regulating cell propagation, migration and differentiation in fetal development, the cytokine TGF – β that evidence suggests fibrosis works by secreting a large amount of FGF2, and the activity that suppresses FGF2 can effectively suppress Fibrotic generation.

Fibroblast growth factor acceptor (Fibroblast growth factor receptorsFGFRs) belongs to tyrosine kinase receptor family, they are at specific spatial-temporal expression, be one of check point important on FGF signal path, the disorder of FGFR normal function can cause the generation of human diseases.The present invention is at published invention (application number: 200710029286.6) on basis,, with the high efficient expression FGFR2 of inclusion body form it is carried out after certain change renaturation by escherichia coli, obtain the activated FGFR2IIIc product of tool.FGFR2IIIc extracellular fragment can with FGF ligand binding, but therefore the tyrosine kinase activity in born of the same parents and can not conducted signal for want of plays the effect that suppresses FGF excessive signal, thereby can significantly suppress the fibrosis of lung.

Not yet there is at present the report that utilizes the extracellular fragment of fibroblast growth factor acceptor to prevent and/or treat idiopathic pulmonary fibrosis.

Summary of the invention

The object of the invention is to for the deficiencies in the prior art, provide FGFR2IIIc extracellular fragment to prevent and/or treat the application in idiopathic pulmonary fibrosis medicine in preparation.

The preparation method of described FGFR2IIIc extracellular fragment, comprises the steps:

(1) the full gene of the overlapping extension of genes of interest FGFR2IIIc is synthetic;

(2) structure of FGFR2IIIc point mutation type;

(3) with Nde I and BamH I double digestion FGFR2IIIc gene and carrier, connect and build recombinant vector, transform Host Strains, build FGFR2IIIc genetic engineering bacterium;

(4) cultivate FGFR2IIIc genetic engineering bacterium, separate, clean, dissolve inclusion body and obtain solubilization of inclusion bodies liquid;

(5) purification inclusion body;

(6) renaturation;

(7) after ultrafiltration, lyophilizing, obtain solubility FGFR2IIIc extracellular fragment;

Wherein the full gene of overlapping extension of the described genes of interest FGFR2IIIc of step (1) synthesizes according to FGF receptor wild type extracellular fragment truncated-type aminoacid sequence, be respectively the primer of sequence shown in sequence table NO:1～NO:8 according to four pairs of e. coli codon Preference principle designs, first with primers F 1, R1 is template amplification each other, then using the product of first round amplification as template, F2, R2 carries out second as primer and takes turns amplification, take turns amplified production as template taking second, F3, R3 carries out third round amplification as primer, taking third round amplified production as template, F4, R4 carries out fourth round amplification as primer,

Renaturation described in step (6) is for adopting gel chromatography, and the renaturation solution that wherein used consists of: 10-100mmol/L HEPES+0.5-10mmol/L EDTA+10-1000mmol/LNaCl+10-50mmol/L CYSTINE, pH6～8.5.

FGFR2IIIc extracellular fragment of the present invention has obvious therapeutical effect to idiopathic pulmonary fibrosis, also has obvious preventive effect, and form that can pharmaceutical composition is used, and this compositions contains FGFR2IIIc extracellular fragment and pharmaceutically acceptable auxiliaries; Pharmaceutically acceptable auxiliaries is the general various adjuvants of pharmaceutical field.

The main dosage form of aforementioned pharmaceutical compositions comprises lyophilized injectable powder and injection liquor, conventionally with intravenous injection administration.

When the dosage form of aforementioned pharmaceutical compositions is lyophilized injectable powder, this pharmaceutical composition is the sterilization composition form of solid, said composition can also contain adjuvant (or excipient) except FGFR2IIIc extracellular fragment, as mannitol, dextran, gelatin hydrolysate, sodium citrate, mannitic acid etc.This sterilization composition is dissolved in sterilized water for injection or other injection sterile medium in use, intravenous injection.

When aforementioned pharmaceutical compositions is injection liquor, this pharmaceutical composition is aqueous solution form, direct intravenous injection when use.Said composition can also contain additive except FGFR2IIIc extracellular fragment, as mannitol, sodium chloride, glucose etc.

Compared with prior art, advantage of the present invention is: TGF β is most important cytokine in fibrotic processes, promote fibrosis by discharging FGF2, and FGFR2IIIc can be in conjunction with FGF2, reduce its valid density, thereby inhibition progression of fibrosis, therefore the present invention, by FGFR2IIIc for the preparation of preventing and/or treating idiopathic pulmonary fibrosis medicine, can play good prevention, therapeutical effect.

Brief description of the drawings

Fig. 1 is the matched group Electronic Speculum figure that three groups of alveolars are scorching and pulmonary fibrosis degree (HE dyeing × 200) compares;

Fig. 2 is the model group Electronic Speculum figure that three groups of alveolars are scorching and pulmonary fibrosis degree (HE dyeing × 200) compares;

Fig. 3 is the treatment group Electronic Speculum figure that three groups of alveolars are scorching and pulmonary fibrosis degree (HE dyeing × 200) compares.

Detailed description of the invention

The invention will be further described by the following examples.

Embodiment 1 prepares FGFR2IIIc extracellular fragment dry powder pin

FGFR2IIIc extracellular fragment (producing according to the patent 200710029286.6) 300mg that gets filtration sterilization, adds 7.5 grams of mannitol, regulates pH to neutral, inject water to 500 milliliters, aseptic filtration, in 1000 ampoules of subpackage, lyophilization under aseptic condition, to obtain final product.

Embodiment 2 prepares FGFR2IIIc extracellular fragment injection

Get the water-soluble 300mg of FGFR2IIIc extracellular fragment of filtration sterilization, regulate pH to neutral, inject water to 500ml, add sodium chloride adjusting etc. and ooze, aseptic filtration, in 1000 ampoules of subpackage, to obtain final product.

The effect of embodiment 3FGFR2IIIc extracellular fragment to mice idiopathic pulmonary fibrosis

1, experimental technique

Select female C57BL/6 mice, in 6-8 week, body weight 20-25g, with after 2% pentobarbital sodium 40mg/kg intraperitoneal injection anesthetized mice, by sterile working's principle, cuts skin at mice cervical region center place, expose trachea.Pass through trachea below with curved sharp ophthalmology pincers, slightly lift trachea, model group and treatment group are to Injecting Bleomycin after Retaining BLM(50mg/kg in trachea) 50ul, matched group injects isopyknic normal saline, sets up mouse pulmonary fibrosis model.

Inject after bleomycin, then to the air 2～3 times that injects 0.2ml in trachea, so that medicine is evenly distributed in pulmonary.Skin suture after injection, local iodine fluorine sterilization is protected from infection, and mice is upright, and rotation makes medicine be evenly distributed in lung as far as possible.

Model is set up and is risen for second day, and treatment group mice intraperitoneal every day injection FGFR2IIIc extracellular fragment albumen (50 micrograms/only).Matched group and model group are injected isopyknic normal saline.Set up latter the 21st day at model, process respectively each group of mice.With after 2% pentobarbital sodium 40mg/kg intraperitoneal injection anesthetized mice, cut open breast and take out pulmonary.

2, alveolitis, the judgement of pulmonary fibrosis degree

Left lung paraffin section carries out hematoxylin-eosin staining (HE) and Masson dyes, and (Masson dyeing is at acid fuchsin, orange, under 3 kinds of particular dye combineds effect of viride nitens, make collagen fiber dye green, muscle fiber is dyed redness, erythrocyte dyes that saffron one is special dyes), change optical microphotograph Microscopic observation lung tissue disease is of science.The method evaluation lung tissue alveolitis and lung fibrosis degree (the Szapiel S V that provide by Szapiel etc., Elson N A, Fulmer JD, et al.Bleomycin-induced interstitial pulmonary disease in the nude athymicmouse.Am Rev Respir Dis, 1979,120 (4): 893-899.).

Alveolitis is divided into level Four: 1. 0 grade: without alveolitis; 2. I level: alveolar septum is because of inflammatory cell infiltration broadening, and pathological changes is limited to, range L EssT.LTssT.LT20%, alveolar structure is complete; 3. II level: its area of getting involved accounts for 20%～50% of full lung; 4. III level: Diffuse alveolar inflammation, its area >50% that gets involved, even visible alveolar space inner cell and the hemorrhage consolidation causing.

Pulmonary fibrosis is also divided into level Four: 1. 0 grade: without fibrosis; 2. I level: range L EssT.LTssT.LT20%, involves pulmonary parenchyma under pleura and pleura, and alveolar structure gets muddled; 3. II level: extent of disease accounts for full lung 20%～50%, pulmonary fibrosis starts to extend from pleura, but still belongs to local; 4. III level: dispersivity pulmonary fibrosis, scope >50%, fuse damaged with extensive pulmonary parenchyma structure disturbance.

3, statistical procedures

Adopt SPSS12.0 software, data with (x ± s) represent, ranked data are converted into measurement data, 0 grade is 0 point, I level is 1 point, II level is 2 points, III level is 3 points.Between 3 groups, carry out one factor analysis of variance, carry out the comparison between different groups with LSD, SNK method, P<0.05 is that difference has statistical significance.

LSD and SNK method are the methods comparing between two between multi-group data conventional in statistics.

4, experiment grouping

Female C57BL/6 mice, is divided into matched group at random, model group and treatment group, 10 every group.

5, experimental result

From Fig. 1,2,3 and table 1, matched group alveolarization is good, and alveolar septum is thin, and alveolar is secondary every more, and alveolar number is more; Model group loses that normal lung tissue's structure, structure disturbance, alveolar septum broaden, alveolar is secondary every obvious minimizing, and alveolar quantity reduces, and visible intra-alveolar hemorrhage, oozes out; Treatment group alveolar septum compared with model group attenuation, Interstitial cell reduce, fibrosis obviously alleviates but alveolar is secondary few every number, alveolar space is honeycomb sample and changes, alveolar quantity reduces compared with matched group.

6, experiment conclusion

TGF β is most important cytokine in fibrotic processes, promotes fibrosis by discharging FGF2.FGFR2IIIc can be in conjunction with FGF2, reduces its valid density, thereby suppresses progression of fibrosis, plays good therapeutical effect.

Three groups of alveolar inflammation of table 1, pulmonary fibrosis degree scoring (x ± s) compare

In above-mentioned table 1, ^*p<0.05, ^*p<0.01vs matched group; ^▲p<0.01vs model group.

Claims (3)

1. The application of 1.FGFR2IIIc extracellular fragment in preparation prevention, treatment idiopathic pulmonary fibrosis medicine;

   Described FGFR2IIIc extracellular fragment is the fragment of preparing as follows:

   (1) the full gene of the overlapping extension of genes of interest FGFR2IIIc is synthetic;

   (2) structure of FGFR2IIIc point mutation type;

   (3) with Nde I and BamH I double digestion FGFR2IIIc gene and carrier, connect and build recombinant vector, transform Host Strains, build FGFR2IIIc genetic engineering bacterium;

   (4) cultivate FGFR2IIIc genetic engineering bacterium, separate, clean, dissolve inclusion body and obtain solubilization of inclusion bodies liquid;

   (5) purification inclusion body;

   (6) renaturation;

   (7) after ultrafiltration, lyophilizing, obtain solubility FGFR2IIIc extracellular fragment;

   Wherein the full gene of overlapping extension of the described genes of interest FGFR2IIIc of step (1) synthesizes according to FGF receptor wild type extracellular fragment truncated-type aminoacid sequence, according to four pairs of primers of e. coli codon Preference principle design, first with primers F 1, R1 template amplification each other, then using the product of first round amplification as template, F2, R2 carry out second as primer and take turns amplification, take turns amplified production as template taking second, F3, R3 carry out third round amplification as primer, taking third round amplified production as template, F4, R4 carry out fourth round amplification as primer;

   Primers F 1 is:

   5'-GGAAAATGAATATGGTTCTATTAATCATACCTATCATCTGGATGTTGTGGAACGTTCGCCTCATCGTCCGATTCTGCAGGCAGGTCTGCCGGCAAATGCGTCTACC-3'；

   Primer R1 is:

   5'-TTTTTTTCAACATGTTTAATCCACTGAATATGCGGCTGCGCATCGCTATAAACTTTACAAACAAATTCAACATCACCACCAACAACGGTAGACGCATTTGCCGGCA-3'；

   Primers F 2 is:

   5'-GGTGGTTATAAAGTTCGTAATCAGCATTGGAGCCTGATTATGGAAAGCGTTGTTCCGTCTGATAAAGGTAATTATACCTGTGTGGTGGAAAATGAATATGGTTCTA-3'；

   Primer R2 is:

   5'-CTTCAATTTCTTTATCGGTGGTATTAACACCCGCCGCTTTCAGAACTTTCAGATACGGCAGACCATCCGGACCATATTTGCTACCATTTTTTTCAACATGTTTAAT-3'；

   Primers F 3 is:

   5’-AATTTCGTTGTCCGGCGGGTGGTAATCCGATGCCGACCATGCGTTGGCTGAAAAATGGTAAAGAATTTAAACAGGAACATCGTATTGGTGGTTATAAAGTTCGTAA-3'；

   Primer R3 is:

   5’-AGAATGAAAAGAAATACCAATAGAATTACCCGCCAGACAGGTATATTCACCCGCATCTTCAAAGGTAACATTACGAATATACAGAACTTCAATTTCTTTATCGGTG-3'；

   Primers F 4 is:

   5’-GGAATTC AAACGTGCGCCGTATTGGACCAATACCGAAAAAATGGAAAAACGTCTGCATGCAGTTCCGGCAGCAAATACCGTGAAATTTCGTTGTCCGGCGGGT-3'；

   Primer R4 is:

   5’-CG CGTCATTATTCCAGATAATCCGGAGACGCGGTAATTTCTTTTTCACGACCAGGTGCCGGCAGAACGGTCAGCCACGCAGAATGAAAAGAAATACCAA-3'；

   Described in step (2), the structure of FGFR2IIIc point mutation type is specific as follows: the genes of interest FGFR2IIIc that step (1) obtains, by step (3) operation, obtains wild type positive plasmid; Taking primers F 4 and mutant primer M252+253_R as amplimer, wild type positive plasmid is template, carries out PCR, obtains system 1 product; Taking mutant primer M252+253_F and primer R4 as amplimer, wild type positive plasmid is template, carries out PCR, obtains system 2 products; System 1 product and system 2 product equal-volumes are mixed, use primers F 4 and primer R4 amplification, obtain FGFR2IIIc point mutation type product;

   Mutant primer M252+253_F is: 5 '-TGGAACGTTGGCGTCATCGTCCGA-3 ';

   Mutant primer M252+253_R is: 5 '-TCGGACGATGACGCCAACGTTCCA-3 '

   Renaturation described in step (6) is for adopting gel chromatography, and the renaturation solution that wherein used consists of: 10-100mmol/L HEPES+0.5-10mmol/L EDTA+10-1000mmol/L NaCl+10-50mmol/LL-cystine, pH6～8.5.
2. 2. application according to claim 1, is characterized in that: the dosage form of described FGFR2IIIc extracellular fragment in the time of preparation prevention, treatment idiopathic pulmonary fibrosis medicine is lyophilized injectable powder or injection liquor.
3. 3. application according to claim 1 and 2, the injecting pathway that it is characterized in that described medicine is intravenous injection.