CN101384730A - Methods and applications of molecular beacon imaging for infectious disease and cancer detection - Google Patents

Abstract

Molecular beacon for detecting an infection and/or expression or a mutation of a disease marker for diagnostics and pharmacogenomics. The molecular beacon is capable of hybridizing a disease-related RNA or DNA of a disease marker in a specimen obtained from a living subject, thereby emitting a signal detectable without a need for signal amplification. The disease marker includes a genetic sequence specific to a pathogen including a flu virus, a cancer cell marker, and a drug resistance-related genetic mutation marker for a drug resistant cancer and infectious pathogen. To detect a disease cell, a specimen containing one or more cells is obtained from a living subject, and fixed by an organic solvent. A molecular beacon is then added to the specimen, followed by staining nuclei of the cells in the specimen. The signal is detectable with a microscope, FACS scan, ELISA plate reader, Scanner, or any combinations thereof.

Description

The methods and applications that are used for the molecular beacon imaging of transmissible disease and cancer detection

The application is the pct international patent application of submitting on December 22nd, 2006, for the All Countries except that the U.S., the applicant is that the national corporation name is called Alvitae Pharmaceuticals (ALVitae Pharmaceuticals), and is United States citizen Augustine Lin and R.O.C. Taiwan citizen Pan-Chyr Yang and Cheng-Chung Chou for the applicant who specifies the U.S. only.

The cross reference of related application

The application is according to 35U.S.C. § 119 (e), require on December 23rd, 2005 submit to by Augustine Line, the U.S. Provisional Patent Application sequence number 60/753 of Pan-Chyr Yang and Cheng-Chung Chou application, 651, name is called " methods and applications that are used for the molecular beacon imaging of transmissible disease and cancer detection ", with the U.S. Provisional Patent Application sequence number of submitting on December 23rd, 2,005 60/753 by Augustine Line application, 960, name is called the right of priority of " methods and applications that are used to identify and confirm the molecular beacon imaging of genomic targets and drug screening ", and they are whole in this combination with theirs by reference.

The U.S. Patent application of pending trial relevant (proxy's application case numbering 16957-58761) when the application is called " methods and applications that are used to identify and confirm the molecular beacon imaging of genomic targets and drug screening " with the name of being applied for by Augustine Line.Above-mentioned indicated while co-pending application and the application submitted on same and have same transferee with the application.The disclosure of above-mentioned indicated while co-pending application is by referring in this combination.

Some reference that can comprise patent, patent application and various publications are cited in specification sheets of the present invention and discuss.Quoting and/or discussing of these reference that provided only is in order to illustrate specification sheets of the present invention rather than to admit that in these reference any one is invention described here " prior art ".

All reference of quoting in this manual and discussing are by with reference to these whole in conjunction with them, and identical by the degree that reference is cited individually as each reference.Hereinafter, with regard to symbol, " [n] " is illustrated in n the reference of quoting in this reference list.For example, [3] are illustrated in the 3rd reference of quoting in this reference list, that is, and and GiesendorfBAJ etc.Molecular beacon: a kind of novel method that is used for semi-automatic mutation analysis.ClinChem 1998；44:482-486。

Invention field

The present invention relates generally to the molecular beacon that detects disease markers, more especially detects the molecular beacon of the infection of disease markers and/or expression or sudden change and uses them that life entity is diagnosed method with pharmacogenomics.

Background of invention

At american cancer is the second largest cause of death.Nearly half man of the U.S. with may suffer from cancer more than 1/3rd woman in life at them slightly.Today, people up to a million are being with the cancer life or are suffering from cancer.An important factor that increases patient's survival rate is a diagnosing cancer as early as possible.More early find cancer and begin treatment, survival chance for many years is big more.The serum tumor marker that does not have the efficient diagnosis cancer now.For example in mammary cancer,, still have nearly 20% mammary cancer patient to be checked the art omission by the breast shadowgraph though check the mortality ratio that has reduced disease in early days with breast shadowgraph inspection art.In addition, among the unusual patient of breast shadowgraph sheet, only there is 10-20% tissue biopsy conclusive evidence to suffer from mammary cancer.Therefore, the novel method of exploitation early diagnosis of cancer is crucial to successfully treating and increasing patient's survival rate.The novel method of exploitation cancer cells early detection and definite cancer cells have very big hope to the reaction pair increase cancer patient survival rate of medicine.

As cancer to the mankind be threaten, transmissible disease also is a big cause of death, worldwide causes 1/4th to 1/3rd death.In following 20 years, the new transmissible disease that occurs and occur once again will form the global health threat that rises and make global safety complicated.The current outburst that started from the high pathogenic avian influenza in South East Asia in mid-term in 2003 is maximum and once the most serious in the record.Before current disease, have no precedent so many country in history and infect simultaneously, and cause so many bird death.The pathogenic agent H5N1 virus has proved very obstinate.WHO and other local expert believe whenever the world all more is widely current near another time is grippal than the last generation in last century nineteen sixty-eight, three prevailing disease were very popular now.CDC carries out strong measure and detects (domestic monitoring), diagnosis and the laboratory detection H5N1 propagation with birds flu-preventing A (H5N1) virus.Since the H5N1 bird flu in bird be widely current and the possible bird of bird flu H 5 N 1 infect to the people, press for a kind of early stage and responsive diagnostic method and detect bird flu and human influenza virus.

Lack effectively early stage pharmacogenomics detection and usually cause being difficult to treat many diseases that have life to threaten.A kind of commitment in lysis fast, accurately, special efficacy and affordable diagnosis and/or pharmacogenomics screening can provide improving the benefit that patient outcomes and doctor can't weigh to the decision-making of patient's optimal treatment.

Molecular beacon (MB) is to be used in not need the crossbred of separate probe-target from excess probe can detect the hybridization probe [15,16] that the complementary nucleotide target spot exists in the hybridization detection.Because this character, MB has been used for detecting RNAs[10,13 in viable cell], synthetic [6,16] of monitoring specificity Nucleotide and structure self-report oligonucleotide arrays [14] in sealed reactor.MB can be used for carrying out a pipe of the same race and detects the single nucleotide variations [3,7-9] in the identification of dna and detect pathogenic agent [12,17].

Though studies show that in the past that the existence with MB probe in detecting complementary nucleotide target was feasible method, in other thing, how this new technology development become problem for the simple method that can be widely used in fundamental research and clinical labororatory.

Therefore, need solve aforementioned open question in this area to overcome above-mentioned defective and deficiency.

Summary of the invention

In other thing, the present invention seeks to solve and uses molecular beacon particularly to detect the above-mentioned defective that exists in the current methods availalbe of transmissible disease cell and/or cancer cells as diagnostic reagent detection disease cell.

On the one hand, the present invention relates to detect and be used in the infection of the disease markers of life entity diagnosis and pharmacogenomics and/or the method for expression or sudden change.In one embodiment, present method comprises the sample of step a) acquisition from life entity, and wherein said sample contains one or more cells; B) organic solvent fixed sample; C) add molecular beacon to described sample; And d) observes the result of adding molecular beacon to detect infection and/or the expression or the sudden change of disease markers, the RNA of disease-related or DNA hybridization in the disease markers in wherein said molecular beacon and the one or more cell, thus emission does not need signal to amplify the signal that can detect.This method also comprises observes preceding at least one the nuclear step used in the one or more cells of dyeing of step.

The step of adding molecular beacon and observations is no more than 2 hours.

Coloration result can be with comprising that a kind of instrument in the dull and stereotyped reader of microscope, FACS scanning device, ELISA, scintillometer and any their combination detects.

Molecular beacon can detect the transmissible disease cell, and wherein said transmissible disease comprises the disease that influenza virus causes.Influenza virus comprises influenza virus A, and wherein influenza virus A comprises a kind of and any their combination in 16H and the 9N strain.Influenza virus can also be selected from the group that comprises that influenza virus A, influenza virus AH5, influenza virus AN1, influenza virus B and any their combination are formed.

Molecular beacon also can detect cancer cells, and wherein said cancer is selected from the group that comprises any cancer composition that takes place in lung cancer, liver cancer, cancer of the stomach, prostate cancer, mammary cancer, carcinoma of the pancreas, skin carcinoma, osteocarcinoma, uterus carcinoma, cervical cancer, the cancer of the brain, colorectal carcinoma, laryngocarcinoma and the animal.

Sudden change is the point mutation and/or the disappearance of disease markers, and wherein disease markers is the biology target spot of targeted therapy.The biology target spot is the product of transcribing of EGFR gene and/or it, and wherein the EGFR gene contains deletion mutantion in the EGFR tyrosine kinase domain.

In one embodiment, molecular beacon comprises the oligonucleotide probe of strand hair clip shape structure, and it contains to be selected from and comprises SEQ ID NOs:1-11 and any their nucleotide sequence of group of combination.In another embodiment, molecular beacon can be hybridized with the product of transcribing of EGFR.In another embodiment, molecular beacon can detect resistance cancer and/or multidrug resistant disease substance.

On the other hand, the present invention relates to from life entity, detect the method for cancer cells.In one embodiment, this method comprises step:

A) from life entity, obtain to contain the sample of one or more cells;

B) use the organic solvent fixed sample;

C) add molecular beacon to sample; With

D) observe the result added molecular beacon in sample, detecting cancer cells,

Wherein molecular beacon can be hybridized with relevant RNA of one or more intracellular cancer cells marker or DNA in the sample, thereby emission does not need signal to amplify the signal that can detect.This method also is included in observes nuclear step in the preceding one or more cells used in the dyeing sample of step.

Organic solvent is acetone, ethanol, methyl alcohol, formaldehyde, Paraformaldehyde 96, butanols and their any combination, and wherein the organic solvent of fixed sample is handled with Triton before adding molecular beacon.

Molecular beacon comprises the oligonucleotide probe of strand hair clip shape structure, and it contains and is selected from SEQ ID NOs:1-7 and any their nucleotide sequence of group of combination.

Cancer cells is selected from the group that comprises any cancer that takes place in lung cancer, liver cancer, cancer of the stomach, prostate cancer, mammary cancer, carcinoma of the pancreas, skin carcinoma, osteocarcinoma, uterus carcinoma, cervical cancer, the cancer of the brain, colorectal carcinoma, laryngocarcinoma and the animal, and wherein cancer cells has shown at least one point mutation and/or disappearance in the specific marker thing of cancer cells.

Sample is a kind of in the cast-off cells in tissue slice, bioptic aspirated liquid (aspirate), blood and the body fluid.

On the other hand, the present invention relates to the method for the cell that the detection influenza virus infects from life entity.In one embodiment, this method comprises step: obtain sample from life entity, wherein said sample contains one or more cells; Use the organic solvent fixed sample; Add molecular beacon to sample; The cell that observations infects with influenza virus in the test sample, wherein RNA that molecular beacon can be relevant with the influenza virus marker at least one cell or DNA hybridization, thus emission does not need signal to amplify the signal that can detect.This method is used at least one nuclear step in the one or more cells of dyeing before also being included in and observing step.

In one embodiment, organic solvent is a kind of in acetone, ethanol, methyl alcohol, formaldehyde, Paraformaldehyde 96, butanols and any their combination, and wherein the organic solvent of fixed sample is handled with Triton before adding molecular beacon.

In one embodiment, molecular beacon comprises the oligonucleotide probe of strand hair clip shape structure, and it contains to be selected from and comprises SEQ ID NOs:8-11 and any their nucleotide sequence of group of combination.

In one embodiment, influenza virus comprises avian influenza virus, and wherein influenza virus is influenza virus A and influenza virus B.Influenza virus A comprises a kind of in 16H and the 9N strain, and any their combination.

In one embodiment, with adding to one of sample or implement present method simultaneously more than one probe.

On the other hand, the present invention relates to detect the infection of disease markers and/or expression or sudden change in life entity, to diagnose the method with pharmacogenomics.In one embodiment, this method comprises step:

Obtain sample from life entity, wherein sample contains one or more cells;

Use the organic solvent fixed sample;

Add molecular beacon to sample;

Infection and/or expression or the sudden change of the result of molecular beacon with the detection disease markers added in observation,

The wherein disease-related RNA of the disease markers in molecular beacon and the cell or DNA hybridization, thereby the signal that emission does not need signal to amplify can be detected, and the time of wherein adding molecular beacon and observations be no more than 2 hours.

In one embodiment, this method also is included in nuclear step in one or more cells of observing the preceding usefulness of step dyeing sample.

In one embodiment, organic solvent is a kind of in acetone, ethanol, methyl alcohol, formaldehyde, Paraformaldehyde 96, butanols and any their combination.

On the other hand, the present invention relates to comprise the molecular beacon of the oligonucleotide probe of strand hair clip shape structure, this probe contain with the disease cell in the nucleotide sequence of the disease-related RNA of disease markers and/or DNA hybridization, thereby emission does not need signal to amplify the signal that can detect.

In one embodiment, oligonucleotide probe contains the nucleotide sequence that is selected from the group that comprises SEQ ID NOs:1-11.

In another embodiment, oligonucleotide probe have can with the RNA of coding EGFR gene tyrosine kinase domain in the cancer cells and/or the nucleotide sequence of DNA hybridization.

In one embodiment, oligonucleotide probe be included in 5 ' end fluorophore and 3 ' end quencher, or 3 ' end fluorophore and 5 ' end quencher.

In one embodiment, the disease cell is one of cancer cells or transmissible disease cell.

In one embodiment, the disease cell is by influenza infection, and wherein influenza virus is influenza virus A or influenza virus B.In one embodiment, influenza virus A comprises a kind of in 16H and 9N strain and any their combination.

On the other hand, the present invention relates to be used for to detect the infection of life entity disease markers and/or expression or sudden change, comprise to diagnose the diagnostic kit with pharmacogenomics:

The molecular beacon that comprises the oligonucleotide probe of strand hair clip shape structure, this probe contain can with the nucleotide sequence of the disease-related RNA of disease markers in the disease cell and/or DNA hybridization, thereby emission does not need signal to amplify the signal that can detect; With

Specification sheets.

In one embodiment, oligonucleotide probe contain can with the RNA of coding EGFR gene tyrosine kinase domain in the cancer cells and/or the nucleotide sequence of DNA hybridization.

In one embodiment, oligonucleotide probe contains the nucleotide sequence that is selected from the group that comprises SEQ ID NOs:1-11.

In one embodiment, test kit comprises and surpasses an oligonucleotide probe that contains the nucleotide sequence that is selected from the group that comprises SEQ ID NOs:1-7.

In one embodiment, test kit comprises and surpasses an oligonucleotide probe that contains the nucleotide sequence that is selected from the group that comprises SEQ ID NOs:8-11.

The diagnosis of extremely therefrom observing the result diagnostic kit allows to carry out from the interpolation molecular beacon to sample is no more than two hours.This method provided by the invention has quick single stage method diagnosis transmissible disease cell and/or the cancer cells with hypersensitivity, and/or can the while detection specificity treat target spot or the sudden change of marker and the advantage of expression from biological sample.

These and other aspect will be clear and definite in preferred embodiment described below and the following drawings, though may under the spirit and scope of the new ideas that do not break away from this specification sheets it be changed and modify.

Description of drawings one or more embodiments of the present invention, and and the explanatory note book explained principle of the present invention together.In any possible place, the identical reference numbers of using in the accompanying drawing relates to the identical or analogous element in the embodiment.

The accompanying drawing summary

This patent or application documents contain at least one coloured accompanying drawing.Having this patent of coloured picture or the copy of the open book of patent application must expense be provided with payment as required by patent and trademark office.

Fig. 1 has shown the fluorescence that is used for detecting the molecule of cancer markers and cancer drug genome research target spot according to one embodiment of the invention designs.

Fig. 2 has shown according to the image of one embodiment of the invention with the point mutation of treatment target spot among ALV-1011 detection of lung cancer clone I and the II.

Fig. 3 has shown according to the image of one embodiment of the invention with second point mutation of treatment target spot among ALV-1022 detection of lung cancer clone I and the II.

Fig. 4 has shown according to the expression of one embodiment of the invention with " general " cancer markers among ALV-1033 detection of lung cancer clone I and the II.

Fig. 5 has shown according to the image of one embodiment of the invention with the point mutation of cancer markers in ALV-1044 and ALV-1055 detection carcinoma of the pancreas patient's the examination of living tissue.

Fig. 6 has shown according to one embodiment of the invention ALV-FluA, ALV-FluAH5, ALV-FluAN1 and the ALV-FluB molecule specificity with their target spots separately and has combined.

Fig. 7 has shown influenza virus A, influenza virus A H5 and the influenza virus A N1 that detects according to one embodiment of the invention in avian influenza.

Fig. 8 has shown influenza virus A and the influenza virus B that detects according to one embodiment of the invention in the human influenza virus infects.

Fig. 9 has shown according to the human influenza virus A of one embodiment of the invention rapid detection in 10-20 minute and influenza virus B infection.

Figure 10 has shown according to the facs analysis of one embodiment of the invention with ALV-FluA and ALV-FluB Molecular Detection human influenza virus A and influenza virus B infection.

Figure 11 has shown according to the fluorescent microscope analysis of one embodiment of the invention with ALV-FluA and ALV-FluB Molecular Detection human influenza virus A and influenza virus B infection.

Figure 12 has shown the target combination of ALV-FluA, ALV-FluB, ALV-FluAH5 and ALV-FluAN1 molecule.

Figure 13 has shown that the ALV-FluA that infects according to one embodiment of the invention human influenza virus A detects.

Figure 14 has shown that the ALV-FluB that infects according to one embodiment of the invention human influenza virus B detects.

Figure 15 has shown that the ALV-FluH5 that infects according to one embodiment of the invention human influenza virus H5 detects.

Figure 16 has shown that the ALV-FluAN1 that infects according to one embodiment of the invention avian influenza virus AN1 detects.

Figure 17 has shown that the ALV-FluA that infects according to one embodiment of the invention avian influenza virus A detects.

Figure 18 has shown the facs analysis that detects the back influenza infection according to one embodiment of the invention ALV-FluA.

Figure 19 has shown according to the RFU analysis of one embodiment of the invention with human influenza virus's infection of the dull and stereotyped reader of fluorescence.

Figure 20 has shown according to the influenza infection in one embodiment of the invention detection cell culture medium.

Figure 21 has shown according to the influenza infection among one embodiment of the invention detection patient.

Figure 22 has shown that the bird flu influenza virus A (H5N3) that detects in the Embryo Gallus domesticus cell according to one embodiment of the invention infects.

Figure 23 has shown that the bird flu influenza virus A (H6N1) that detects in the Embryo Gallus domesticus cell according to one embodiment of the invention infects.

Figure 24 has shown the point mutation according to treatment target spot among one embodiment of the invention detection of lung cancer clone I.

Figure 25 has shown the disappearance according to treatment target spot among one embodiment of the invention detection of lung cancer clone III.

Figure 26 has shown the sudden change that detects patient SMCLC according to one embodiment of the invention.

Figure 27 has shown influenza virus A and the influenza virus B type that is specific to influenza virus according to one embodiment of the invention, and the nucleotide sequence of influenza virus A H5 and influenza virus A N1 strain, it has shown the position of EGFR point mutation and disappearance, and wherein ALV EGFR MBs detects this position and carries out the cancer drug genome research.

Figure 28 has shown influenza virus A that is specific to influenza virus and the influenza virus B type that information biology is identified, and the sequence of influenza virus A H5 and influenza virus A N1 strain.

DESCRIPTION OF THE PREFERRED

Describe the present invention in the following embodiments more specifically, wherein these embodiment only are used for explanation, because a large amount of for a person skilled in the art modification and change are clearly.A plurality of embodiment of the present invention can be described in detail.Used " one ", " one " and " this " in this specification sheets and following claim implication comprise that unless plural number refers in the context and clearly indicate.In addition, used in this specification sheets and following claim " in " implication comprise that " in " and " on " is unless clearly indicate in the context.In addition, title and subtitle also can be used in the specification sheets helping reader, and to not influence of scope of the present invention.

Definition

In the concrete context that uses with each term, the term that uses in this specification sheets generally has its ordinary meaning in its this area in the context of the present invention.Be used to describe particular term of the present invention below or the other places of specification sheets extra guidance to provide a description the compositions and methods of the invention to the practitioner and how to make and use them is discussed.For convenience, particular term is highlighted, for example uses italic and/or quotation marks.The use that highlights is to the scope and the not influence of implication of term; No matter whether highlight, the scope of term is the same in same context with implication.Be to be understood that identical things can be with telling about above a kind of mode.Therefore, any one that optional literal and synonym can be used for that this paper discusses or a plurality of term, and without any special implication, no matter whether term is explained or discusses in this article.The synonym of particular term is provided.Other synon use is not got rid of in one or more synon explanations.Anywhere the use of example in this specification sheets comprises the example of any term that this paper discusses, and only limits the scope and the implication of the term of the present invention or any illustration by no means with explaining.Similarly, the present invention does not limit a plurality of embodiments of being given in this specification sheets.

As used herein " approximately " or " being similar to " generally be illustrated in the value of giving or scope 20% in, in preferred 10%, more preferably in 5%.The digital quantity of being given as non-special instruction deducibility this paper is proximate, means term " approximately " or " being similar to ".

As used herein " hybridization " and " complementation " relate between two Nucleotide accurately paired ability.For example, if on oligonucleotide a Nucleotide of specific position can with a Nucleotide hydrogen bonded of same position on a DNA or the RNA molecule, to be considered in that position be complementary or interfertile each other for this oligonucleotide and this DNA or RNA so.When each intramolecular q.s corresponding position when can be each other being occupied with the Nucleotide of hydrogen bonded, then this oligonucleotide and this DNA or RNA hybridization.The sequence that can understand antisense oligonucleotide in this area does not need 100% sequence that is complementary to the target nucleotide of its hybridization.Oligonucleotide is being meant under the condition that detects of specific hybridization, this oligonucleotide compound combines with target DNA or RNA molecule, and having enough complementary degree avoids antisense oligonucleotide and non-target sequence estimating non-specific binding under the specificity bonded condition, under the physiological condition that for example detects in vivo or treat, or under the condition of carrying out vitro detection.

In the context of the present invention, term " oligonucleotide " relates to the oligomer or the polymer of Yeast Nucleic Acid (RNA) or thymus nucleic acid (DNA) or its stand-in.This term includes, but are not limited to the oligonucleotide that nature produces and/or interior nucleic acid base (skeleton) connecting arm of synthetic nucleic acid base, sugar and covalency is formed.Because the avidity and/or the stability of enhanced in the presence of nuclease of for example enhanced cell picked-up of desirable character, enhanced and Nucleotide target, these modifications or replacement oligonucleotide are usually preferred than natural form.

Term " molecular beacon " or its acronym " MBs " are the single stranded oligonucleotide hybridization probes that forms loop-stem structure as used herein.Its ring contains the probe sequence with target complement sequence, and stem is formed by the complementary arms sequence annealing that is positioned at the probe sequence either side.It is terminal and a quencher thing is covalently attached to another arm end that fluorophor is covalently attached to an arm.When molecular beacon was free in solution, it did not send fluorescence.But, when it is hybridized with the nucleotide chain that contains target sequence, can obviously send fluorescence thereby its conformation changes.Probe was not dark when target did not exist because stem make fluorophor and non-quenching of fluorescence thing very near so that they share electronics momently and lost the ability that fluorophor sends fluorescence.When probe met with target molecule, it formed the probe-target hybrid longer and more stable than stem hybrid.When having stopped the stem hybrid, the stability of probe-target hybrid and length exists.Therefore, molecular beacon has carried out the spontaneous conformation reorganization that decomposition of stem hybrid and fluorophor and quencher thing are separated from each other, send fluorescence that makes.

Divide the period of the day from 11 p.m. to 1 a.m when MB meets with said target mrna, ring and part stem and said target mrna hybridization have caused the spontaneous conformational change that stem is separated.The quencher thing leaves fluorophor, causes the recovery of fluorescence.A major advantage of stem ring probe is that they can be than linear oligonucleotide probe with higher specific recognition target.Suitably the MBs of design can differentiate that difference is small as the different target of single Nucleotide is only arranged.The existing multiple application of MBs comprises that dna mutation detection, protein-DNA interaction, PCR monitor in real time, gene type and mRNA in the viable cell detect.

As used herein " transfection " relate to the process of Nucleotide of inserting to the host.The well-known many kinds of technology of those skilled in the art promote the Nucleotide transfection to protokaryon or eukaryote.These methods comprise many kinds of technology, for example for example still are not only calcium or magnesium salts with high salt concentration and handle cell, electric field, stain remover or liposome-mediated transfection, thereby make host cell become the competent cell that can absorb nucleic acid molecule.

Term " gene " or " genes " relate to the nucleotide sequence (comprise RNA and DNA) of genetic coding information with synthetic full-length RNA, full length protein or these full-length RNAs of arbitrary portion or full length protein as used herein.

Term " expression " or " expression " relate to from genetic transcription and obtain at least one subregion complementary RNA nucleic acid molecule two nucleotide chains with this gene as used herein.Term " expression " or " expression " also can relate to from described RNA nucleic acid molecule translation acquisition protein or a polypeptide or their part as used herein.

Term " pharmacogenomics " relates to the heritable variation of checking the gene show drug reaction and explores these variations and can be used to predict that patient is sound response, untoward reaction or the science that does not have the method for reaction fully to a medicine as used herein.

USMD ^TM, i.e. the abbreviation of " hypersensitization Molecular Detection " is the trade(brand)name of platform technology of the present invention.

Summary of the invention

The signal that an aspect of of the present present invention relates to use MB does not need the signal amplification to detect by direct interpolation MB to sample and acquisition detects the infection and the expression of disease markers or suddenlys change with diagnosis and pharmacogenomics.There is not product to work so fast on the market with susceptibility and degrees of specificity that the present invention reaches.In the art, molecular beacon amplifies use with signal.Molecular beacon provided by the invention and method can not need signal to amplify and detection signal.In addition, the present invention diagnoses institute time-consumingly to be no more than 2 hours, and the current standard molecule of the influenza that WHO recommends detects cost 6 hours.In addition, the MBs sequence that is used for cancer and influenza of the present invention is not also used, particularly the influenza sequence.

The invention provides the method that in sample cell, detects cancer and transmissible disease.Particularly this paper provides detection, discriminating or quantitative cancer markers sequence or the existence of virus signature thing sequence or the method for change in cell sample.

An aspect of of the present present invention relates to the expression that detects the disease specific marker that directly need not increase from tissue sample and changes and/or sudden change.This platform technology has sensitivity, special and detect the advantage of multiple disease-related marker simultaneously.The MB that will contain reagent of the present invention is transported to the change that can cause signal in the cell with disease-related.When detection reagent detected the variation of molecular marked compound of disease, for example abnormal expression or sudden change, disease cell (light tone) can be different from normal cell (dead color).Therefore, with the functional genome of this disruptive technology and development in recent years gain knowledge combine after, initial target is that development is used for: the 1) early detection of acute and chronic disease; 2) patient is carried out the pharmacogenomics screening to improve therapeutic efficiency; 3) patient's prognosis and treatment back process.This platform technology has fast, responsive, special and cost is low and effectively detect the advantage of disease-related marker.

An aspect of of the present present invention relates to the method for the infection that detects disease markers and/or expression or sudden change so that life entity is diagnosed and pharmacogenomics, wherein this method comprises: (a) obtain sample from life entity, wherein said sample contains one or more cells; (b) with the fixing described sample of organic solvent; (d) molecular beacon is joined in the sample; (c) observations is to detect infection and/or the expression or the sudden change of disease markers.

The sample that contains target cell can be the cast-off cells in tissue slice, bioptic aspirated liquid (aspirate), blood or the body fluid.Sample is fixed with organic solvent before adding MB.The organic solvent that is used for fixing sample comprises acetone, ethanol, methyl alcohol, formaldehyde, Paraformaldehyde 96, butanols and any their one of combination.In one embodiment, organic solvent fixed sample is handled with Triton before adding molecular beacon.

Randomly, before the result of molecular beacon had been added in observation, this method also can comprise with the step of dyestuff at least one nucleus dyeing of the one or more cells in the sample.The nucleus dyeing of cells in sample makes determines that the position of cell on slide glass is very easy to.

Added the result of molecular beacon available well known to a person skilled in the art suitable instrument comprise microscope, FACS scanning device, the dull and stereotyped reader of ELISA, scintillometer and arbitrarily their one of combination detect.In addition, the step cost of carrying out from the interpolation molecular beacon to observations is no more than 2 hours.

Another aspect of the present invention relates to the method that the cell with transmissible disease for example detects the cell of influenza infection that detects.Influenza virus comprises avian influenza virus, for example influenza virus A and influenza virus B.Influenza virus A can be 16H and 9N strain and their one of combination arbitrarily.For example, the cell that detects of method of the present invention can be by influenza virus A, influenza virus A H5, influenza virus A N1 and the influenza infection of their one of combination arbitrarily.

Another embodiment of the invention is to detect the method for cancer cells in containing the sample of one or more cells.Cancer cells can be lung cancer, liver cancer, cancer of the stomach, prostate cancer, mammary cancer, carcinoma of the pancreas, skin carcinoma, osteocarcinoma, uterus carcinoma, cervical cancer, the cancer of the brain or colorectal carcinoma.

Another embodiment of the invention is to detect the method for at least one point mutation in the specific marker thing of cancer cells and/or disappearance.

Another embodiment of the invention is to detect the sudden change of disease markers, both can be the method that point mutation also can be and/or lack.Disease markers comprises the biological target of targeted therapy.Biological target comprises the EGFR gene.

One embodiment of the invention are to detect the method for cancer cells marker in sample, and wherein the cancer cells marker contains at the EGFR tyrosine kinase domain and has deletion mutantion.

Another embodiment of the invention is a kind of method, in this method one or more probes is added in the cell sample.

Another aspect of the present invention provides the molecular beacon of the oligonucleotide probe of strand hair clip shape structure, and this probe contains to be selected from and comprises SEQ ID NOs:1-11 and any their nucleotide sequence of group of combination.Molecular beacon can with RNA or the DNA hybridization from the disease-related of the disease markers at least one cell of the sample of life entity, thereby emission does not need signal to amplify the signal that can detect.

One embodiment of the invention be contain can with the MB of the nucleotide sequence of coding RNA of general cancer markers and/or DNA hybridization.In one embodiment of the invention, molecule marker can be hybridized with the transcription product of EGFR.

Another embodiment of the invention be contain can with the MB of the nucleotide sequence of the RNA of the EGFR gene tyrosine kinase domain of coding in the cancer cells and/or DNA hybridization.This MB comprises the fluorophor of 5 ' end and the quencher thing of 3 ' end, or the quencher thing of the fluorophor of 3 ' end and 5 ' end.

Another embodiment of the invention is to detect the molecular beacon of resistance cancer and/or multidrug resistant disease substance.

Another aspect of the present invention is to detect the infection of disease markers and/or expression or sudden change life entity is diagnosed the diagnostic kit with pharmacogenomics, and wherein diagnostic kit contains molecular beacon of the present invention and specification sheets.In one embodiment, diagnostic kit comprises the MB that contains the nucleotide sequence that is selected from the group that comprises SEQ ID NOs:1-11.This detection method that specification sheets in this MB and the diagnostic kit is described makes and is no more than 2 hours from adding molecular beacon to sample to the diagnostic procedure cost of observing its result.

Description of drawings one or more embodiments of the present invention, and and the explanatory note book explained principle of the present invention together.Anyplace, be applied in the identical or analogous components that the identical reference numerals of using in the accompanying drawing is meant embodiment.

Embodiment

Provide below according to example instrument, device, method and their correlated results of embodiment of the present invention and not limit the scope of the invention.Note title or subtitle can be in order to help reader with in an embodiment, but should not limit the scope of the invention.In addition, this paper proposes and discloses some theory; But no matter to mistake, need not consider the particular theory or the scheme of any effect, these theories should not limit the scope of the invention by any way as long as the present invention puts into practice according to the present invention.

Embodiment 1

Molecular beacon-target DNA fluoroscopic examination: the following description of method that is used for measuring the combination (measuring the MB specificity) of molecular beacon and dna profiling:

Material comprises: Opti-MEM transfection solution (Invitrogen), Costar 96 hole blackboards (eBioscience catalog number (Cat.No.) 44-2504-21), 1.7mL Eppendorf pipe (Denville catalog number (Cat.No.) C-2170), Standard PC R pipe, molecular beacon (MWG-Biotech AG) and target DNA (MWG-Biotech AG).

Method is as follows:

(1) diluent molecules beacon and target DNA: based on the synthetic report of MWG oligomerization, according to specified " to the volume of 100pmol/ μ l " transfection solution amount diluent molecules beacon and target DNA.Vortex and rotation.Oligomerization solution and the lucifuge of telling same amount place-20 ℃ of refrigerators.

(2) preparation of fluoroscopic examination: with 1:10 dilution every kind of molecular beacon (1 μ l molecular beacon solution adds 9 μ l transfection solution).Use 1 μ l DNA, 2 μ l molecular beacon 1:10 diluents and 97 μ l transfection solution, to every kind of two parts of fluorescent mixture target DNA mixtures of molecular beacon preparation and control mixture.Lucifuge was hatched one hour for 37 ℃.

(3) detect and obtain the result.Every part of mixture is got in the hole of 95 μ l to 96 hole blackboards.The detection flat board is set: click " setup " at SpectraMAXGeminiXS (from Molecular Devices) luminoscope with below the use of SoftMAX Pro 4.3.1LS software.Setting is made as " Endpoint " and reads type is " Fluorescence (RFU ' s) ".Changing " Number of wavelengths " is 3, then according to following table:

Table 1: the wavelength of fluorescence and the fluoroscopic examination of MB-target DNA

The fluorescence title	Excitation wavelength	Emission wavelength
			Texas Red	590	615
FAM	488	515
			CY3	530	575

Enter " Sensitivity " and drag reading to 8.Enter " Wells to Read " and select you to want the hole of reading.Click " Read ".Enter " File " and " Import/Export ".On floppy disk, export the result with text.The result uses

Read from floppy disk.

Embodiment 2

As shown in table 2, the molecular beacon (MBs) that is used for detecting FluA, FluB, FluAH5 and FluAN1 is based on that specific dna sequence dna that information biology differentiates designed respectively.The formation of hairpin loop is designed to have 5 or 6 (time be 5) mostly individual base pair.The common method of preparation MB is open by people such as Peng (18).By the MWG Biotech of contractor that is positioned at North Carolina, Inc. synthesizes MBs then.5 ' end (or 3 ' end) fluorophor can be any fluorescence protein, and 3 ' end (or 5 ' end) quencher thing can be any quencher thing that can the corresponding fluorophor of cancellation.Figure 28 has shown the conserved sequence that is specific to influenza virus FluA and FluB type and FluAH5 and FluAN1 strain that information biology is differentiated.

As shown in table 3, the sequence specific of being differentiated by information biology is in influenza virus FluA and FluB type and FluAH5 and FluAN1 strain.

Table 2: molecular beacon and SEQ ID NOs

SEQ ID NO:	Nucleotide sequence	The oligomerization title
			8	5’CY3-CTGAGTCCCCTTTCTTGACCTCAG-3’BHQ2	ALVFLUAH5MB
9	5’FAM-CACACATGCACATTCAGACGTGTG-3’BHQI	ALVFLUAN1MB
			10	5’CY3-CGTGCTGCTGTTTGGAATTGCACG-3’BHQ2	ALVFLUAMB
11	5’FAM-CGTTCTGTCGTGCATTATAGGAACG-3’BHQ1	ALVFLUBMB

Black hole quencher fuel (Black Hole Quencher

Dyes)

Table 3: the sequence that is specific to influenza virus FluA and FluB type and FluAH5 and FluAN1 strain

SEQ ID NO:	Nucleotide sequence	Influenza virus type
			12	GCATACAAAATTGTCAAGAAAGGGGACTCA	Be specific to Flu A H5
13	AGAACTCAAGAGTCTGAATGTGCATGTGTA	Be specific to Flu A N1
			14	CTCAAAGGGAAATTCCAAACAGCAGCACAA	Be specific to Flu A
15	TGCTTTCCTATAATGCACGACAGAACAAAA	Be specific to Flu B

Embodiment 3

Transmissible disease detects: influenza test molecule of the present invention has shown with the specificity of target and has combined.Molecule for example ALV-Flu A, ALV-Flu A H5, ALV-Flu AN1 and ALV-Flu B is designed to detect specifically respectively Flu A, Flu A H5, Flu A N1 and Flu B.As shown in Figure 6, these molecules are with special the combining with its target separately of low-down background.

Embodiment 4

The method of influenza infection in the rapid detection cell cultures: material comprises: cell cultures slide 25 * 75 * 1mm (VWR catalog number (Cat.No.) 48312-400); Slide lid slide 22 * 50mm No 1 1/2 (VWR catalog number (Cat.No.) 48383194); Dako pen (catalog number (Cat.No.) S2002); Cell culture medium (RPMI-1640); Opti-MEM transfection solution (Invitrogen); 0.25% trypsinase EDTA solution (Invitrogen); Gel/Mount (Biomeda Corp. catalog number (Cat.No.) M01); Hoechst33342 (Cambrex, catalog number (Cat.No.) PA-3014); Triton X-100 (Merck); 100uM Opti-MEM storing solution with the molecular beacon reagent that is used for FluA, FluB, FluAH5 and FluAN1.

Method is as follows:

(1) fixed cell on slide glass: because acetone can dissolve black ink, therefore with pencil mark slide glass.Then with serum free medium flushing slide glass once and aseptic PBS flushing once.Then, slide glass was soaked 8-10 minute in 100% acetone of ice bath.Air dries slide glass.If slide glass does not use at once, place-80 ℃ of preservations.

(2) Triton handles: with the serum free medium flushing slide glass of ice bath once and the aseptic PBS flushing of ice bath once.Then in the PBS of 0.2%Triton solution solution 37 ℃ soaked 20 minutes and washed twice with the PBS of ice bath.

(3) add MB detection reagent of the present invention: on slide glass, draw a circle along the hole with the Dako pen.100uM Opti-MEM storing solution with molecular beacon reagent prepares suitable concentration, for example 300nM then.Adding 100 μ l (25-35ul is used for 8 hole slide glasss) MB reagent of the present invention then in the suitable circle, relaxes in 37 ℃ of incubators and placed 20 minutes to the cell slide glass.

(4) nucleus of staining cell: after hatching 20 minutes, remove the solution on the slide glass.In order to use fluorescence microscope, add Hoechst 33342 (PBS storing solution 1/1000 dilution of 10mg/ml) to each cell circle.In 37 ℃ of incubators, place and be no more than 2-4 minute.

(5) finish: from incubator, shift out slide glass.Aseptic PBS with ice bath washes slide glass twice then.Detect if be used for fluorescent microscope, add a slide glass gel/mount to each cell circle.On slide glass, place a cover glass.

(6) observations under fluorescent microscope (Olympus DP70):, open the fluorescence power supply in the microscope left side.On the microscope right side, open the microscope power supply.Place slide glass and use the DAPI spectral filter of Hoechst 33342 is aimed at cell at microscopically.In case aim at some cells, rotation is to seek suitable sign fluorescence between different luminescent lamps.When being ready to take a picture, before computer, also double-click " DPControllers " icon.Each luminescent lamp is used following the setting:

Table 4: detect data sheet

Molecular beacon	Fluorescence is provided with
		Texas Red	Rhodamine
CY3	Rhodamine
		FAM	FITC
(white light) White Light	DAPI

At first, the image on the computer is caught in click " Snap ".Click " Save as " then and preserve image on the computer to suitable folder.Under suitable luminescent lamp and DAPI, take a picture to guarantee that cell is present in the image to cell.After finishing, close fluorescence power supply, fluorescent microscope and computer.

Embodiment 5

In cell culture fluid, detect the clinical preceding experiment of influenza infection: briefly, the cell culture fluid of dog renal epithelial cell MDCK, the A of influenza virus infection or B hypotype are after two to three days, respectively with the molecular beacon dyeing that is specific to influenza virus A (ALV-FluA) and influenza virus B (ALV-FluB).After dyeing in 20 minutes was finished, the cell on the slide glass was analyzed with fluorescent microscope.As shown in figure 20, the cell that influenza virus A infects influenza virus A testing product ALV-FluA specific detection (red among the A figure), and the cell that influenza virus B infects detects (green among the C figure) with the product A LV-FluB that influenza virus B infects.

Embodiment 6

Detect the clinical study of influenza infection among the patient: in influenza in season in the winter of 2005-2006, under the cooperation according to the main university hospital of IRB guide and Asia, designed a clinical study and estimated the feasibility of using molecular beacon rapid detection influenza infection of the present invention.As standard program, the brush,throat of smearing patient is as the sample of collecting on the microslide.Independent swab sample is also collected and is used for virus culture and the RNA extraction that RT-PCR analyzes.Slide glass is with containing the ALV-FluA that is specific to influenza virus A and B respectively and the mixture of ALV-FluB, or is used for the molecular beacon influenza virus product detection of the corresponding contrast agents ALV-RanRed and the ALV-RanGreen of red and green fluorescence.The result who obtains from (blind pivotal) clinical study of blind axle is very successful, and it all is consistent above 90% that the result that the molecular beacon product detects obtains the result with RT-PCR.

Among the representative result as shown in figure 21, the patient of the influenza virus infection A that RT-PCR confirms detects with containing the ALV-FluA that is specific to influenza virus A and influenza virus B respectively and the product of ALV-FluB mix reagent.As shown in figure 21, patient's detection positive for influenza virus A infects (red among the figure A) influenza virus B infection is not positive (green among the figure B).Another is not detected negative by the patient of influenza infection with ALV-FluA (red among the figure D) and ALV-FluB (green among the figure E).Blue-fluorescence among figure C and the F is the staining cell nuclear of corresponding cell.

Embodiment 7

Developed the reagent that detects avian influenza.Develop the detection method of using the designed influenza virus detection molecules that is specific to FluA, FluAH5, FluAN1 and FluB and come to detect fast and sensitively Flu A (H5N1 and HH6N1) infection.In case infect, with the infected host of detection reagent rapid detection of the present invention.As shown in Figure 7, the host of avian influenza virus A (H6N1) infection differentiates respectively with molecular beacon ALV-FluA of the present invention (being used for FluA, redness) and ALV-FluAN1 (being used for N1, green).Equally, the host who infects avian influenza virus A (H5N3) differentiates respectively with molecular beacon ALV-FluA of the present invention (being used for FluA, redness) and ALV-FluA H5 (being used for FluA H5).

Embodiment 8

Exploitation can be used for detecting the detection reagent of people and avian influenza.Detection molecules ALV-FluA and ALV-FluB are specific to influenza virus A and B respectively.They can detect the human infection that influenza virus A and B strain cause.As shown in Figure 8, presentation of results ALV-FluA and ALV-FluB special detection FluA of difference and FluB virus infection.

Embodiment 9

Avian influenza virus H5 and N1 INFECTION IN DETECTION: except detection is used for the product A LV-FluA that avian influenza virus A infects, ALV-FluAH5 and ALV-FluAN1 product are specific to influenza virus A (H5) and influenza virus A (N1) strain respectively.At ALV-FluA, under ALV-FluAH5 and the ALV-FluAN1 combination of agents, the detection method of using these products should be the infection of special detection influenza virus A (H5N1).But, because the acquisition of human or animal's sample that influenza virus A (H5N1) infects is restricted and has the potential serious harm, the feasibility assessment that uses ALV-FluAH5 and ALV-FluAN1 to detect influenza virus A (H5) and influenza virus A (N1) infection carries out with the Embryo Gallus domesticus cell that influenza virus A (H5N3) and influenza virus A (H6N1) infect.The model that the cell that model that the cell that influenza virus A (H5N3) infects detects as influenza virus A (H5) and influenza virus A (H6N1) infect detects as influenza virus A (N1).The Embryo Gallus domesticus cell infects avian influenza virus A (H5N3) or avian influenza virus A (H6N1) under model system, the host cell of infection detects with molecular beacon product of the present invention.As shown in figure 22, the host cell that infects avian influenza virus A (H5N3) uses ALV-FluA (being used for influenza virus A, red among the figure A) and ALV-FluAH5 (being used for influenza virus A (H5), red among the figure B) to differentiate respectively.Equally, show, infect the host cell of avian influenza virus A (H6N1) and use molecular beacon of the present invention respectively that ALV-FluA (being used for influenza virus A, red among the figure D) and ALV-FluAN1 (being used for influenza virus A (N1), green among the figure F) differentiate as Figure 23.Blue-fluorescence is the staining cell nuclear in each corresponding cell culture fluid.

The principal character of hypersensitization Molecular Detection (USDM) platform technology comprises: the innovation of the quick and effective technology of (1) a kind of testing goal expression of gene and sudden change; (2) be suitable for the early detection of lysis and pharmacogenomics; (3) 10-20 minute final signal one step detection method of reading.

Molecular beacon product of the present invention is responsive for detecting avian influenza.The invention provides the detection molecules that is specific to FluA, FluB, FluA H5 and FluA N1.The molecule that detects the bird flu infection comprises: ALV-FluA-redness, ALV-FluB-green, ALV-FluAH5-redness and ALV-FluAN1-green.

The Hoechst 33342-DNA dyeing of cell is shown as blueness.These molecular beacon product designs of the present invention are for detecting influenza infection from several samples.The animal that can detect avian influenza virus comprises bird, chicken, duck, goose, dove, pig, people or the like.

Embodiment 10

Detection method of the present invention has turned out to be a Hi-Fi quick step detection method.The influenza infection detection based on MB according to one embodiment of the invention is a simple step detection method.All processes only spends 10-20 minute.As shown in Figure 9, this detection method background between 10 or 20 minutes when detecting people FluA or FluB virus infection is very low or do not have.

Embodiment 11

Use the detected result of molecular beacon of the present invention easily to handle.For example, the present invention is used for the available clinical apparatus measures commonly used of result that the detection method of influenza infection obtains.Except preceding showing the fluorescent microscope of using among the result, the also available fluorescent activation cell sorting of this detection method device (FACS), this is the white blood cell count(WBC) that a kind of conventional instrument that uses is measured hiv infected patient.Figure 10 shows that ALV-FluA and ALV-FluB detect the quantitative histogram commonly used of people FluA and FluB virus infection.FACS result is very consistent with the result that as shown in figure 11 use fluorescent microscope obtains.Other common method of reading detected result is also in evaluation procedure.

Detection molecules of the present invention has shown the rapid reaction to the endurance strain outburst.As in the cancer drug genome research, influenza virus detection molecules of the present invention can detect the sudden change that comprises point mutation and disappearance.If for example outburst of the avian influenza toxic bacterial strain of Tamilflu tolerance of medicine takes place, in case differentiated mutant nucleotide sequence, scope cycle time of the molecular designing of detection molecules of the present invention and product needed is 2-3 week.This is incommensurable with the detection method of developing based on antibody.

Detection molecules of the present invention can be extended to covering wide spectrum bird flu bacterial strain and comprise 16H and 9N strain; With quick identification to the response of Resistant strain outburst occurring.

Figure 13-19 has shown that detection molecules of the present invention: ALV-FluA detects people's FluA virus infection (Figure 13), ALV-FluB detects people's FluB virus infection (Figure 14), ALV-FluH5 detects people's FluH5 virus infection (Figure 15), ALV-FluAN1 detects fowl FluAN1 virus infection (Figure 16), ALV-FluA detects fowl FluA virus infection (Figure 17), ALV-FluA detects back facs analysis influenza infection (Figure 18), with the dull and stereotyped reader RFU analyst's influenza infection (Figure 19) of fluorescence.

Table 5: the simplicity of using clinical labororatory's instrument commonly used to read MBs signal of the present invention

	Measure	Speed	Cost	Clinical labororatory's popularization
					Microscope	Vision is unicellular qualitative	+++++	Low	Very universal
Flow cytometer	The unicellular qualitative overall percentage of vision	++	High	In AIDS, popularize
					The minitype plate reader	The total cell signal of light unit is quantitative	+++++	Low	Very universal

In a word, detection molecules of the present invention is to detect the high responsive reagent that influenza infection comprises that bird flu is infected.For example, ALV-FluA and ALV-FluB are to difference human influenza virus A and B hypotype sensitivity, and ALV-FluAH5 and ALV-FluAN1 are to detecting influenza virus A (H5) and influenza virus A (N1) avian influenza strain sensitivity.In addition, with the ALV-FluAH5 combination, ALV-FluAN1 and ALV-FluA have the potential of rapid detection influenza virus A (H5N1) strain.In addition, detection molecules of the present invention is a quick step detection method, and testing process only spends 10,20 or 30 minutes or still less.The analysis of detection signal can be read flexibly and simply.These detection molecules of the present invention have extend to detect the wide spectrum strains of influenza viruses comprise in 16H and the 9N family may killer strain possibility.

Embodiment 12

Cancer markers detects: table 6 has shown the molecular beacon that detects EGFR point mutation and disappearance and has detected the MB of positive control survival and negative control at random.The quencher thing of fluorophor and 3 ' (or 5 ') end of 5 ' (or 3 ') end can be any other fluorophor or quencher thing, as long as they can be by cancellation.For ALV-EGFR 101～105, their corresponding positions on the EGFR gene show in Figure 27.

Table 6: nucleotide sequence

SEQ ID NO:	Nucleotide sequence	The oligomer title
			1	5’RED-TCGCTGCTTTCGGAGATGTTTTGATAGCGA-3’BHQ1	AEGFR101
2	5’RED-TCGCTGCTTTCGGAGAATGTCTTGATAGCCGA-3’BHQ1	AEGFR102
			3	5’RED-TCGCTGGCTTTCGATTCCTTGATAGCGA-3’BHQ1	AEGFR103
4	5’CY3-CAGATTGGCCCGCCCAAAATCTG-3’BHQ1	AEGFR104
			5	5’FAM-TGCAGGCATGAGCTGCATGATGAGCTGCA-3’BHQ1	AEGFR105
6	5’CY3-CACGTCGACAAGCGACCGATACGTG-3’BHQ1	ARANDOMR01
			7	5’FAM-TGGTCCTTGAGAAAGGGCGACCA-3’BHQ1	ASURVIVINC01

Embodiment 13

Using molecular beacon reagent to carry out lung carcinoma cell detects: below be to be used to detect EGFR point mutation and/or disappearance to carry out the method for cancer drug genomics research.EGFR is the abbreviation of EGF-R ELISA, it be on cell surface, find with a kind of protein of Urogastron (EGF) bonded.

Material comprises: cell cultures slide glass 25 * 75 * 1mm (VWR catalog number (Cat.No.) 48312-400), Dako pen (catalog number (Cat.No.) S2002), cell culture medium (RPMI-1640), Opti-MEM transfection solution (Invitrogen), 0.25% trypsinase EDTA solution, Gel/Mount (Biomeda Corp. catalog number (Cat.No.) M01) and Hoechst33342.

Method is as follows:

Wash and wrap by slide glass (only when cell does not paste the hole, carrying out): in 70% ethanol, soaked slide glass 30 minutes under the room temperature.(the little slide glass in fluorescence antibody site a, end covers, 2 etching ringes, size 3 * 1 ', thickness 0.93-1.05mm ,～0.5Gross, gold sealing, catalog number (Cat.No.) #3032).From ethanol, shift out slide glass and air-dry.With aseptic (autoclaving) 1% gel (at H ₂Among the O) wrapped by a side of slide glass in 1 hour at room temperature.Remove gelating soln and air-dry slide glass.

In fixed cell strain on the slide glass: on slide glass, draw the position of two great circles (use the DAKO pen) with discriminate between cells strain placement.(Dako Pen, catalog number (Cat.No.) #S2002).The cell of rotation from the lung liquid sample that cancer patient is collected.Re-suspended cell to density is-106 cells/ml in serum-free cell culture medium.2 to 3 cell culture medium is dripped on the suitable slide glass.Slide glass is placed on the support with handled easily.Put into 37 ℃ and 2%CO2 incubator 2-4 hour or stick being placed on culturing room until most of cell.Wash slide glass 1 time with serum free medium, aseptic PBS flushing 1 time.In 100% acetone of ice bath, soaked dull and stereotyped 8-10 minute.Can dissolve black ink with pencil mark slide glass because of acetone.Air-dry slide glass.If slide glass does not use at once, preserve slide glass at-80 ℃.

Add MB reagent: wash slide glass 1 time with serum free medium, aseptic PBS flushing 1 time.The serum-free culture based sols for preparing proper concn from the 100uM storing solution of MB reagent on demand is as 200nM and 50nM.The MB reagent solution that in the suitable circle of cell slide glass, adds 100 μ l.Placed about 1 hour in 37 ℃ of incubators.

Cell dyeing: cultivate after 1 hour, wash slide glass 2 times with aseptic PBS.Add Hoechst 33342 (1/1000 diluent of the PBS storing solution of 10mg/ml) to each cell circle.Place in 37 ℃ of incubators and be no more than 2-3 minute.

Finish: from incubator, shift out slide glass.Wash slide glass 2 times with aseptic PBS.Add a slide glass gel/mount to each cell circle.Each circle is gone up and is placed a cover glass.(the little cover glass 22 * 55mm of VWR, numbering 11/2, VWR catalog number (Cat.No.) #48393 194).

Fluorescent microscope (Zeiss Axioplan 2) fluoroscopic examination down:, open the fluorescence power supply to microscope the right.On the microscope right side, open the microscope power supply.Connect the back side of black appliances line to the blue AxioCam HRc at microscope top.Under fluorescent microscope, place slide glass and locate cell with the white light spectral filter.In case locate some cells, just can switch different fluorescence and seek suitable sign fluorescence.When being ready to take pictures, to computer, double-click " AxioVision 4 " icon.On the side toolbar, open AxioCamHR Control.Each fluorescence is used following the setting: irradiation per-cent should be made as 80%.

Table 7: detect data sheet

Molecular beacon	Fluorescence is provided with	Irradiation time
			Texas Red	Rhodamine	486ms
CY3	Rhodamine	486ms
			FAM	FITC	1.1s
White light (White Light)	DAPI	5ms

Open the camera window on microscope right side.Click the photo site that " Live " watches slide glass on computers.Click " Snap " and catch picture on computers.Click " Export " and preserve picture on computers.Guarantee under suitable fluorescence and white light, to take a picture to guarantee that cell occurs in picture to cell.In case finish, guarantee to close fluorescent microscope.

Embodiment 14

Detect the EGFR sudden change in lung cancer: the patient of about 40% nonsmall-cell lung cancer (NSCLC) finds to have the specific mutant of EGF-R ELISA (EGFR) gene.The sudden change of EGFR and/or disappearance think that for example the clinical responsiveness of gefitinib (Irressa) and erlotinib (Tarceva) is relevant with tyrosine kinase inhibitor.These sudden changes have caused the increase of growth factor signal and to the susceptibility of inhibitor for treating.These sudden changes in the screening lung cancer can identify the patient that can have better response rate to targeted therapy.The exploitation of the novel method of the early screening of cancer patient is very important to successfully treating and increasing patient's survival rate.

To be exploitation and commercialization have direct influence based on the diagnosis of MB technology and pharmacogenomics product with the suddenly change reaction and the survival of cancer patient that targeting EGFR is treated of the EGFR of the result of treatment of the medicine that improves targeting EGFR-influence downstream signal transduction to the initial focus of cancer.Product of the present invention covers the EGFR sudden change that influences the reaction of EGFR targeted drug above 80% common discovery.

Embodiment 15

Human lung cancer cell line's EGFR sudden change detects: first product of the cancer drug genome research of design comes EGFR point mutation and/or the disappearance in the detection of lung cancer.The known clinical response with the patient who carries out the EGFR targeted therapy of the specific mutant of target marker is relevant.As shown in Figure 4, with the wild-type cell that does not have sudden change be I relatively, the result that preclinical test obtains has shown the point mutation (figure A) among the product detection of lung cancer clone I of the present invention.Product of the present invention has also detected the specificity disappearance of EGFR marker gene.As shown in Figure 5, not having the wild-type cell of disappearance with the target zone is that III compares, and product has detected the disappearance (figure A) among the lung cancer cell line III.

Embodiment 16

The EGFR of lung cancer patient sudden change detects: the cancer detection that the feasibility study of the EGFR sudden change of using product of the present invention to detect to collect the cancer cells that exists in patient's NSCLC Pleural fluid can be used to estimate product in the clinical application is carried out the possibility of EGFR target therapeutic agent genome research.Representative data among Fig. 6 shows that the cancer product has detected at the disappearance of collecting the EGFR Tyrosylprotein kinase zone in patient's NSCLC Pleural fluid cancer cells (redness, figure A).The patient who has shown EGFR point mutation feminine gender among the figure B.Blue-fluorescence is painted Pleural fluid cell nuclear.

In a word, to be used for the detection molecules of cancer drug genome research be (1) detection specificity sudden change simultaneously and express in the present invention; (2) from the treatment target or the marker of biological sample; (3) being designed for the cancer genome research and the early-stage cancer of expressing with the specific marker thing detects; (4) belong to the notion evidence formula explanation of the preclinical test that uses cancerous cell line.Spendable sample comprises the Pleural fluid of SMCLC lung cancer patient.

Embodiment 17

Cancer detection: an aspect of of the present present invention relates to exploitation and is specific to the molecule that detects cancer markers and pharmacogenomics target.A series of cancer detection molecular designing are used to detect the target of cancer markers expression and cancer drug genome research.As shown in Figure 1, ALV-1011 and ALV-1022 are designed for the lung-cancer medicament genome research.ALV-1033 is specific to the expression of a general cancer markers.ALV-1066 and ALV-1077 design is used for detecting the point mutation of the specific marker thing of carcinoma of the pancreas.

ALV-1011 and ALV-1022 design are used for detecting the single mutation and/or the disappearance of lung cancer-targeted marker.The known clinical response with the patient who treats of the specific mutant of this target marker is relevant.The result that preclinical test obtains shown in Fig. 2 and 3, has shown that the point mutation among the lung cancer cell line I can be compared with the clone III that does not have sudden change respectively with ALV-1011 and the complete detection of ALV-2022 (figure A).

The ALV-1033 design is used for detecting the expression that tumour generates early stage " general " cancer markers.Being expressed in of this " general " cancer markers is relevant with the prognosis of patient disease's process above discovery and its expression level in 80% the almost all kinds tumour.Being expressed in the healthy tissues of this " general " cancer markers can't detect usually.As shown in Figure 4, the expression of the specific marker thing among ALV-1033 detection of lung cancer clone I (height) and the II (low).

ALV-1033 is particularly useful in diagnosing mammary cancer and lung cancer.The application of ALV-1033 can be used for diagnosing other cancer markers, comprises colon and prostate cancer.

ALV-1044 and ALV-1055 are designed for the early detection of carcinoma of the pancreas.The sudden change of marker carcinoma of the pancreas just developed early stage.The point mutation of this marker is found in〉in 90% the carcinoma of the pancreas.The great majority of these sudden changes concentrate on the specificity position.Result among Fig. 5 has shown that ALV-1044 and ALV-1055 have detected their selectively targeted sudden change in the bioptic specificity cancer markers of three carcinoma of the pancreas individual patient.

The detection of the expression of kinds of tumors marker gene provides a kind of simultaneously and has differentiated and special and responsive method that the classification clinical sample for example strips off the cancer cells in the cell in aspirates, blood and the body fluid of tissue slice, fine needle biopsy.According to one embodiment of the invention, identified its expression one group gene relevant with metastases with product of the present invention and method.

In others, the invention discloses and use molecular beacon imaging to detect and/or differentiate the cell of life entity and the point mutation of the genetic expression of multiple cancer in the tissue and virus signature thing and/or change the method that exists, and its application.According to the present invention, molecular beacon is designed to during target disease specific marker sequence, produce corresponding fluorescent signal thereby the fluorophor of molecular beacon sends fluorescence when one of molecular beacon in one or more cells.Fluorescent signal does not need the signal amplification to detect.

According to the present invention, use MBs to detect the infection of disease markers and expression or sudden change and diagnose with pharmacogenomics and carry out to sample (cell sample) by directly adding MBs (reagent), do not need to carry out the signal amplification.Shown detection method based on the USMD technology be to the specific molecular target a kind of quick, special, responsive, easily use and spend low detection method.Diagnostic products that can commercial acquisition on the present invention and the current market relatively, for example RT-PCR and based on the detection method of immunity as describing among Fig. 8, has shown superiority of the present invention.

The comparison of table 8:ALVitae product and RT-PCR and immunodetection

Technology	RT-PCR	Immunodetection	ALVitae USMD
				The molecule target	DNA and/or RNA	Protein	RNA
Speed	Surpass 6 hours to a couple of days	30 minutes to a few hours	30 minutes
				Specificity	Very special	Special	Very special
Susceptibility	Need to amplify	Preferably include secondary antibodies	Do not need to amplify
				Use difficulty or ease	Multistep is rapid	One step is step at the most	One step
Reaction to medicament-resistant mutation	Very fast	Very slow	Very fast
				Single detects cost	High	In	Low

In others, the present invention has clinical and economic interests, is summarized as follows:

● responsive, special, easily use and spend a low quick step detection method: the detection based on USMD of influenza infection and cancer be a kind of fast and a simple step detection method.Be used for the current standard RT-PCR detection method comparison that influenza test and a couple of days are used for lung cancer EGFR detection above 6 hours with cost, whole process can only spend 30 minutes or still less finish.

● the simple process of detected result: do not need expensive instrument, the result who obtains based on the detection method of USMD detects with common instrument in clinical and the research laboratory.Except fluorescent microscope, the also available fluorescent activation cell sorting of result device (FACS), a kind of routine is used to monitor the instrument and the dull and stereotyped reader of fluorescence of the white blood cell count(WBC) of hiv infected patient, and this is a kind of standard instrument that immunofluorescence detects that is used for.

● exploitation is used for the multiple product of the infection detection of multiple strains of influenza viruses: as above open, the present invention has many advantages in detecting influenza virus A and B hypotype and influenza virus A (H5) and A (N1) strain.Under ALV-FluA, ALV-FluAH5 and ALV-FluAN1 combination, breaking out recently can be detected in the infectivity bird flu in South East Asia.The USMD platform technology can be applicable to other hypotype and other strain specificity influenza virus.

● to the rapid reaction of medicament-resistant mutation outburst: no matter cancer or influenza are infected, the present invention is used for detecting sudden change and comprises disappearance and point mutation.If the outburst of medicament-resistant mutation, for example avian influenza virus Tamiflu persister or resistance cancer occur, in case identify mutant nucleotide sequence, scope cycle time that is used for designing and make based on the product of USMD is 2-3 week.Be based on that time of detection of antibodies method exploitation can't compare the fast cycle time of identification product innovation.

● the application of early diagnosis detection and pharmacogenomics: the present invention is used for not only detecting the expression with the lysis marker gene that for example cancer is relevant with transmissible disease, also detects disappearance or the point mutation relevant with the pharmacogenomics of targeted therapy.Early diagnosis and pharmacogenomics all can be useful to the patient who begins effectively treatment early.

The above-mentioned explanation of example embodiment of the present invention only is used for illustration and illustration purpose rather than detailed or limit the invention to disclosed precise forms.Many modifications and change under above guidance are possible.

Selection and description embodiment are to explain that principle of the present invention and their practical application are so that those skilled in the art can use the multiple modification of the present invention and a plurality of embodiments to be applicable to the purposes of special requirement.The embodiment of Gai Bianing clearly belongs to the present invention and does not depart from its spirit and scope for a person skilled in the art.Therefore, scope of the present invention is by additional claim rather than above-mentioned specification sheets and example embodiment definition as described herein.

Reference

[1] Baselga J, Norton L.Focus on breast cancer.Cancer Cell2002; I (4): 319-322.[2] Belshe RB.The Origins of Pandemic Influenza-Lessons from the 1918 Virus.N EnglJ Med 2005; 353 (21): 2209-2211.

[3] Giesendorf BAJ et al.Molecular beacons:a new approach for semi-automatedmutation analysis.Clin Chem1998; 44:482-486.

[4] Hall IP.Pharmacogenetics, pharmacogenomics and airway disease.RespiratoryResearch 2002; 3:10.

[5] Hanahan D ₅Weinberg RA.The Hallmarks of Cancer.Cell 2000; 100 (1); 57-70.

[6] Leone G, van Schijndel H, van Gemen B ₅Kramer FR, Schoen CD.Molecularbeacon probes combined with amplification by NASBA enable homogeneous, real-timedetection of RNA.Nucleic Acids Res1998; 26:2150-2155.

[7] Marras SAE, Kramer FR, Tyagi S.Multiplex detection of single-nucleotidevariations using molecular beacons.Genet Anal 1999; 14:151-156.

[8] Kostrikis LG, Tyagi S, Mhlanga MM, Ho DD, Kramer FR.Spectral genotyping ofhuman alleles.Science 1998; 279:1228-1229.

[9] Kost rikis LG et al.A chemokine receptor CCR2 allele delays HIV-I diseaseprogression and is associated with a CCR5 promoter mutation.Nat Med is 1998; 4:350-353.

[10] Matsuo, T.In situ visualization of messenger RNA for basic fibroblast growthfactor in living cells.Biochim Biophys Acta 1998; 1379:178-184.

[11] Minamoto T, Mai M, Ronai Z.K-ras mutation:early detection in moleculardiagnosis and risk assessment of colorectal, pancreas, and lung cancers-a review.Cancer Detect Prev 2000; 24 (1): 1-12.

[12] Piatek AS et al.Molecular beacon sequence analysis for detecting drugresistance in Mycobacterium tuberculosis.Nat Biotechnol is 1998; 16:359-363.

[13] Sokol DL, Zhang X, Lu P, Gewirtz AM.Real time detection of DNA-RNAhybridization in living cells.Proc Natl Acad Sci USA 1998; 95:11538-1 1543.

[14] Steemers FJ, Ferguson JA, Walt DR.Screening unlabeled DNA targets withrandomly ordered fiber-optic gene arrays.Nat Biotechnol 2000; 18:91-94.

[15]Tyagi S，Kramer FR.Molecular beacons:probes that fluoresce uponhybridization.Nat.Biotechnol 196；14；303-308。

[16] Tyagi S, Bratu DP, Kramer FR.Multicolor molecular beacons for allelediscrimination.Nat.Biotechnol 1998; 16:49-53.

[17] Vet JAM et al.Multiplex detection of four pathogenic retroviruses using molecularbeacons.Proc Natl Acad Sci USA is 1999; 96:6394-6399.

[18] Xiang-Hong Peng, Ze-Hong Cao, Jin-Tang Xia, Grant W.Carlson, Melinda M.Lewis, William C.Wood, and Lily Yang.Cabcer Res2005; 65:(5), 1909-1917.

Sequence table

＜110〉Alvitae Pharmaceuticals

＜120〉be used for the methods and applications of the molecular beacon imaging of transmissible disease and cancer detection

<130>MMM 16957-58759

<140>PCT/US2006/048853

<141>2006-12-22

<150>US 60/753,960

<151>2005-12-23

<150>US 60/753,651

<151>2005-12-23

<160>17

<210>1

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects the EGFR disappearance

<400>1

<210>2

<211>31

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects the EGFR disappearance

<400>2

<210>3

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects the EGFR disappearance

<400>3

<210>4

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects the EGFR sudden change

<400>4

<210>5

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects the EGFR sudden change

<400>5

<210>6

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide is with comparing

<400>6

<210>7

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects the survival expression

<400>7

<210>8

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects H5 influenza virus and infection thereof

<400>8

<210>9

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects N1 influenza virus and infection thereof

<400>9

<210>10

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects influenza virus A and infection thereof

<400>10

<210>11

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects influenza virus B and infection thereof

<400>11

<210>12

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be specific to the probe type of influenza virus A H5 conserved sequence

<400>12

<210>13

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be specific to the probe type of influenza virus A N1 conserved sequence

<400>13

<210>14

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be specific to the probe type of influenza virus A conserved sequence

<400>14

<210>15

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be specific to the probe type of influenza virus B conserved sequence

<400>15

<210>16

<211>5370

<212>DNA

＜213〉artificial sequence

<220>

＜223〉arrive the employed EGFR sequence of corresponding sudden change and disappearance position in the ALV-EGFR Molecular Detection.

<400>16

<210>17

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉single stranded oligonucleotide detects the survival expression

<400>17

Claims (55)

1. detect the infection of disease markers and/or expression or sudden change life entity is diagnosed the method with pharmacogenomics, comprise following steps:

A) obtain sample from described life entity, wherein said sample contains one or more cells;

B) with the fixing described sample of organic solvent;

C) molecular beacon is joined in the described sample; With

D) infection and/or expression or the sudden change of the result of molecular beacon with the detection disease markers added in observation,

The disease-related RNA of the disease markers in wherein said molecular beacon and the one or more cell or DNA hybridization do not get final product detected signal thereby emission does not need signal to amplify.

2. method according to claim 1 also is included in and with dyestuff at least one nucleus in one or more cells is carried out painted step before the described observation step.

3. method according to claim 1, the time of wherein implementing the step of described interpolation molecular beacon and observations is no more than 2 hours.

4. method according to claim 1, wherein painted result is with comprising microscope, FACS scanner, the dull and stereotyped reader of ELISA, scintillometer and a kind of instrument detecting in their combination arbitrarily.

5. method according to claim 1, wherein said molecular beacons detection transmissible disease cell.

6. method according to claim 5, wherein said transmissible disease comprises the influenza virus disease.

7. method according to claim 6, wherein said influenza virus comprises influenza virus A.

8. method according to claim 7, wherein said influenza virus A comprise a kind of in 16H or the 9N strain and their any combination.

9. method according to claim 6, wherein said influenza virus are selected from and comprise influenza virus A, influenza virus A H5, influenza virus A N1, influenza virus B and any their group of combination.

10. method according to claim 1, wherein said molecular beacons detection cancer cells.

11. method according to claim 10, wherein said cancer are selected from the group that comprises lung cancer, liver cancer, cancer of the stomach, prostate cancer, mammary cancer, carcinoma of the pancreas, skin carcinoma, osteocarcinoma, uterus carcinoma, cervical cancer, the cancer of the brain, colorectal carcinoma, laryngocarcinoma and any cancer that produces in animal body.

12. method according to claim 1, wherein said sudden change are the point mutation and/or the disappearance of disease markers.

13. method according to claim 1, wherein said disease markers are the biological target of targeted therapy.

14. method according to claim 13, wherein said biological target are epidermal growth factor receptor gene and/or its transcription product.

15. method according to claim 14, wherein said epidermal growth factor receptor gene comprises the deletion mutantion of epidermal growth factor recipient tyrosine kinase structural domain.

16. method according to claim 1, wherein said molecular beacon contain the oligonucleotide probe of strand hair clip shape structure, described probe contains to be selected from and comprises SEQ ID NOs:1-11 and any their nucleotide sequence of group of combination.

17. the method for the cancer cells in the detection life entity comprises following steps:

A) from life entity, obtain to contain the sample of one or more cells;

B) with the fixing described sample of organic solvent;

C) molecular beacon is added in the described sample; With

D) observe the result added molecular beacon detecting the cancer cells in the described sample,

RNA that cancer cells marker in wherein said molecular beacon and the sample in one or more cells is relevant or DNA hybridization, thus emission does not need signal to amplify the signal that can detect.

18. method according to claim 17 also is included in and with dyestuff the nucleus in the one or more cells in the sample is carried out painted step before the described observation step.

19. method according to claim 17, wherein said organic solvent are a kind of in acetone, ethanol, methyl alcohol, formaldehyde, Paraformaldehyde 96, butanols and any their combination.

20. method according to claim 17, wherein said organic solvent fixed sample is handled with Triton before the described molecular beacon of described interpolation.

21. method according to claim 17, wherein said molecular beacon comprise the oligonucleotide probe of strand hair clip shape structure, described probe contains to be selected from and comprises SEQ ID NOs:1-7 and any their nucleotide sequence of group of combination.

22. method according to claim 17, wherein said cancer cells are selected from the group that comprises lung cancer, liver cancer, cancer of the stomach, prostate cancer, mammary cancer, carcinoma of the pancreas, skin carcinoma, osteocarcinoma, uterus carcinoma, cervical cancer, the cancer of the brain, colorectal carcinoma, laryngocarcinoma and any cancer that produces in animal body.

23. method according to claim 17, wherein said cancer cells have shown at least one point mutation and/or disappearance in the specific marker thing of cancer cells.

24. method according to claim 17, wherein said sample are a kind of in the cell of stripping off in tissue slice, bioptic aspirated liquid, blood and the body fluid.

25. the method for the cell of influenza infection in the detection life entity comprises following steps:

A) obtain sample from described life entity, wherein said sample contains one or more cells;

B) with the fixing described sample of organic solvent;

C) molecular beacon is joined in the described sample;

D) observations to be detecting the cell of the influenza infection in the described sample,

RNA that wherein said molecular beacon is relevant with influenza virus marker at least one cell or DNA hybridization, thus emission does not need signal to amplify the signal that can detect.

26. method according to claim 25 also is included in and with dyestuff at least one nucleus in one or more cells is carried out painted step before the described observation step.

27. method according to claim 25, wherein said organic solvent are a kind of in acetone, ethanol, methyl alcohol, formaldehyde, Paraformaldehyde 96, butanols and any their combination.

28. method according to claim 25, wherein said organic solvent fixed sample is handled with Triton before adding described molecular beacon.

29. method according to claim 25, wherein said molecular beacon contain the oligonucleotide probe of strand hair clip shape structure, described probe contains to be selected from and comprises SEQ ID NOs:8-11 and any their nucleotide sequence of group of combination.

30. method according to claim 25, wherein said influenza virus comprises avian influenza virus.

31. method according to claim 25, wherein said influenza virus are influenza virus A or influenza virus B.

32. method according to claim 31, wherein said influenza virus A comprise a kind of in 16H and the 9N strain and their any combination.

33. method according to claim 25, one of them or the probe above add in the described sample simultaneously.

34. detect the infection of disease markers and/or expression or sudden change life entity is diagnosed the method with pharmacogenomics, comprise following steps:

A) obtain sample from described life entity, wherein said sample contains one or more cells;

B) with the fixing described sample of organic solvent;

C) molecular beacon is added in the described sample;

D) infection and/or expression or the sudden change of the result of molecular beacon with the detection disease markers added in observation,

The RNA of the disease-related of disease markers or DNA hybridization in wherein said molecular beacon and the cell, thus emission does not need signal to amplify the signal that can detect.

35. method according to claim 34 also is included in and with dyestuff the nucleus in one or more cells in the sample is carried out painted step before the described observation step.

36. method according to claim 34, the time of wherein adding molecular beacon and the described result of observation is no more than 2 hours.

37. method according to claim 34, wherein said organic solvent are a kind of in acetone, ethanol, methyl alcohol, formaldehyde, Paraformaldehyde 96, butanols and any their combination.

38. molecular beacon, described molecular beacon comprises the oligonucleotide probe of strand hair clip shape structure, described probe contain with the disease cell in the disease-related RNA of disease markers and/or the nucleotide sequence of DNA hybridization, thereby emission does not need signal to amplify the signal that can detect.

39. according to the described molecular beacon of claim 38, wherein said oligonucleotide probe contains the nucleotide sequence that is selected from the group that comprises SEQID NOs:1-11.

40. according to the described molecular beacon of claim 38, wherein said oligonucleotide probe have can with the RNA of coding epidermal growth factor receptor gene tyrosine kinase domain in the cancer cells and/or the nucleotide sequence of DNA hybridization.

41. according to the described molecular beacon of claim 38, wherein said oligonucleotide probe comprises the fluorophor of 5 ' end and the quencher thing of 3 ' end, or the quencher thing of the fluorophor of 3 ' end and 5 ' end.

42. according to the described molecular beacon of claim 38, wherein said disease cell is a kind of in cancer cells or the transmissible disease cell.

43. according to the described molecular beacon of claim 38, wherein said disease cell infection influenza virus.

44. according to the described molecular beacon of claim 38, wherein said influenza virus is influenza virus A or influenza virus B.

45. according to the described molecular beacon of claim 44, wherein said influenza virus A comprises a kind of and any their combination in 16H and the 9N strain.

46. according to the described molecular beacon of claim 38, wherein said disease cell is a cancer cells.

47. detect the infection of disease markers and/or expression or sudden change life entity is diagnosed the diagnostic kit with pharmacogenomics, comprise:

A) the described molecular beacon of claim 38; With

B) specification sheets.

48. according to the described diagnostic kit of claim 47, wherein said oligonucleotide probe contain can with the RNA of coding epidermal growth factor receptor gene tyrosine kinase domain in the cancer cells and/or the nucleotide sequence of DNA hybridization.

49. according to the described diagnostic kit of claim 47, wherein said oligonucleotide probe contains the nucleotide sequence that is selected from the group that comprises SEQ ID NOs:1-11.

50. according to the described diagnostic kit of claim 47, wherein said test kit comprises and surpasses one oligonucleotide probe, described probe contains the nucleotide sequence that is selected from the group that comprises SEQ ID NOs:1-7.

51. according to the described diagnostic kit of claim 47, wherein said test kit comprises and surpasses one oligonucleotide probe, described probe contains the nucleotide sequence that is selected from the group that comprises SEQ ID NOs:8-11.

52., wherein be no more than 2 hours from described molecular beacon being added to the sample to the time of the diagnostic procedure of therefrom observing the result and being carried out according to the described diagnostic kit of claim 47.

53. according to the described molecular beacon of claim 38, wherein said oligonucleotide probe contain can with the nucleotide sequence of coding RNA of general cancer markers and/or DNA hybridization.

54. method according to claim 1, wherein said molecular beacon can be hybridized with the transcription product of EGF-R ELISA.

55. method according to claim 1, wherein said molecular beacon can detect resistance cancer and/or multidrug resistant disease substance.

Images