CN101381727B - Construction of human insulinogen C peptide high-yield strains - Google Patents
Construction of human insulinogen C peptide high-yield strains Download PDFInfo
- Publication number
- CN101381727B CN101381727B CN2008101672000A CN200810167200A CN101381727B CN 101381727 B CN101381727 B CN 101381727B CN 2008101672000 A CN2008101672000 A CN 2008101672000A CN 200810167200 A CN200810167200 A CN 200810167200A CN 101381727 B CN101381727 B CN 101381727B
- Authority
- CN
- China
- Prior art keywords
- peptide
- insulinogen
- human insulinogen
- human
- born
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a method for expressing human proinsulin C peptide by yeast pichia. The method comprises the following steps: firstly, human proinsulin C peptide genes are synthesized; secondly, the genes are recombined with yeast pichia expression vectors, and the recombinant expression vectors obtained are transferred into the yeast pichia; and thirdly, an engineering strain for expressing the human proinsulin C peptide in high-efficiency cells is obtained through screening of a large number of transformants.
Description
Technical field
The invention belongs to the recombinant polypeptide medicine production method in the field of medicaments.
Background technology
Human insulinogen C peptide is the connection peptides between A chain and the B chain among the proinsulin human, contains 31 amino acid, and the proinsulin human forms equimolar Regular Insulin and C peptide through enzymolysis.Regular Insulin is used for control of diabetes patient's blood sugar, and the C peptide once was considered to not have clinical value, the latest study proves that the C peptide can reduce diabetic subject's severe complication, as diabetic nephropathy, diabetic retinopathy and diabetic neuropathy.Adopt Regular Insulin and C peptide drug combination effectively controlling blood sugar and the generation that reduces diabetic complication.Because human insulinogen C peptide has huge therapeutic value and economic worth, various countries carry out its production technique and preclinical study energetically now, and the whole world does not also formally produce listing at present.
Human insulinogen C peptide is a kind of 31 little peptides of amino acid whose endogenous that contain, and it is available that the production human insulinogen C peptide mainly contains three operational paths: chemical synthesis, biological tissue extracted method, gene engineering research.Human insulinogen C peptide contains 31 amino acid, produces human insulinogen C peptide with chemical synthesis and exists the building-up reactions step many, and total recovery is low, and the drawback of the high and environmental pollution of price is arranged, thereby chemical synthesis is inadvisable.Though contain human insulinogen C peptide in people's the blood, content is atomic, extracts the C peptide from people's blood and can not be used for scale operation.
For the production of human insulinogen C peptide, effective and the most direct solution is utilized engineered method exactly, by the engineering strain of construction expression human insulinogen C peptide, adopts Production by Microorganism Fermentation.But because human insulinogen C peptide is a kind of little peptide, utilize genetically engineered to produce little peptide is a difficult problem always, main being embodied in: (1) is aspect fermentation expression, molecular weight causes expression amount low (comparing with the big protein of identical mole number) for a short time, in addition, molecular weight is little is also degraded by host cell easily, thereby causes the expression of polypeptides amount further to reduce; (2) aspect separation and purification, polypeptide is difficult to separation and purification, the protein that yield is big far below molecular weight; (3) aspect electrophoresis detection, the little easy diffusion of the molecular weight of little peptide is unfavorable for check and analysis with conventional protein electrophorese.In these three difficult problems, the analyzing and testing of little peptide can adopt chromatogram and polypeptide electrophoresis to remedy; The separation purifying technique of little peptide can be by the optimization of different purification process, and its yield generally can be controlled in 30-40%; And the difficulty maximum is the engineering strain that how to obtain the high expression level human insulinogen C peptide.
At present, the main mode that improves C peptide expression amount both at home and abroad is that the human insulinogen C peptide gene is carried out tandem expression.Its ultimate principle: because human insulinogen C peptide does not contain arginine and Methionin, earlier available these two kinds of basic aminoacidss will single copy the expression that is together in series of human insulinogen C peptide gene, carry out double digestion by highly purified trypsinase and protaminase then, remove the connection amino acid between the C peptide, discharge natural human insulinogen C peptide.The advantage of this method is the high expression engineering strain that can obtain the placed in-line fusion rotein of poly (individual) human insulinogen C peptide in intestinal bacteria or yeast, shortcoming is to need expensive double protein enzyme (trypsinase and protaminase) cutting, increase the step of separation and purification simultaneously and be subjected to the double protein enzyme to cut the influence of efficient, finally reduced the productive rate of human insulinogen C peptide.This method has been applied for patent by Creative Peptides Sweden AB (the open CN1268141 of Chinese patent application) and Shanghai New Drug Research ﹠ Development Center (the open CN1606570 of Chinese patent application) respectively separately.
Summary of the invention
One of the object of the invention provides the method for high expression level human insulinogen C peptide in a kind of born of the same parents.
Another object of the present invention provides nucleic acid molecule, carrier and the host cell of relevant synthetic.
The present invention adopts engineered method, is host cell with the pichia spp, makes up the efficiently engineering strain of the interior expressing human Insulinogen C peptide of born of the same parents.
This project bacterium mainly is made of three parts: expression vector pPIC3K in the pichia spp host cell GS115, pichia spp born of the same parents, a kind of nucleic acid molecule of the human insulinogen C peptide of can encoding.All (USA), the nucleic acid molecule of the human insulinogen C peptide of can encoding is artificial design and synthetic with chemical method for Carlsbad, CA available from American I ntrogen Corporation for yeast host cell GS115 and yeast expression vector pPIC3K.
The principal feature of this project bacterium is as follows:
(1). host cell: the pichia spp host cell of selecting for use is GS115, but the GS115 high density fermentation, thereby be suitable for exogenous protein expression.
(2) expression vector: the Yeast expression carrier of selecting for use is pPIC3K, effectively expressing human Insulinogen C peptide in the born of the same parents.
(3). the nucleotide sequence of human insulinogen C peptide: according to the aminoacid sequence of human insulinogen C peptide, the nucleic acid molecule of artificial design and a kind of human insulinogen C peptide of encoding of chemosynthesis, its sequence is seen SEQ IDNO:1.
Researchist of the present invention has obtained the engineering strain of expressing human Insulinogen C peptide in the efficient born of the same parents according to engineering bacteria construction process of the present invention, and with its preservation on October 6 in 2008 to China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC), preserving number is No.2686, classification called after pichia pastoris (Pichia pastoris).
Experimental technique route of the present invention:
(1) goal gene is synthetic
According to the aminoacid sequence of human insulinogen C peptide, adopt the method for chemosynthesis, synthetic human insulinogen C peptide gene.Human insulinogen C peptide contains 31 amino acid, with the synthetic human insulinogen C peptide full-length gene order of chemical synthesis, and at the two ends of goal gene introducing restriction enzyme site.
(2) obtain the correct recombinant expression vector that makes up
Under the dna ligase effect, the human insulinogen C peptide gene of chemosynthesis is connected with expression vector pPIC3K, to connect product transformed into escherichia coli DH5 α competent cell, at last this competent cell be coated on the LB flat board that contains penbritin, obtain a large amount of single bacterium colonies.With PCR method preliminary screening positive colony, positive colony is carried out dna sequencing, thereby obtain to contain the recombinant expression vector of human insulinogen C peptide gene.
(3) above-mentioned recombinant vectors is imported yeast
Extract the line linearity processing of going forward side by side of this recombinant vectors, should import in the pichia spp by linearizing recombinant vectors, bacterium liquid is coated on the MD selective medium, obtained a large amount of transformants, and transformant is carried out PCR identify with electroporation.
(4) acquisition of superior strain
The transformant that above-mentioned (3) are obtained is coated on the dull and stereotyped enterprising row filter of the G418 that contains different concns.Utilize protein electrophorese to detect the expression amount of human insulinogen C peptide,, obtained the engineering strain of high expression level human insulinogen C peptide through screening on a large scale.Determine the cultivation and the abduction delivering condition of shake flask test simultaneously, comprised substratum, the culture temperature of possible optimum, kind and concentration, the abduction delivering time etc. of inorganic salt.Under the shake-flask culture condition, the expression level of recombinant insulinum primary C peptide reaches 100mg/L.
(2) set up the lab scale zymotechnique of high-density and high expression level.On cultivation of shaking bottle and abduction delivering condition basis, Yeast engineering bacteria is cultivated at 5L Minifors (Switzerland INFORS company) automatic fermenter, parameters such as the dissolved oxygen amount in the fermenting process, pH value, temperature, mixing speed are measured and controlled, optimize and quantized parameters such as pH value, dissolved oxygen amount, stirring velocity, Yeast engineering bacteria obtains high density fermentation, and human insulinogen C peptide obtains stability and high efficiency and expresses.
The present invention adopts engineered method to produce human insulinogen C peptide, can scale operation, and with low cost.
Description of drawings
Fig. 1 is the nucleic acid electrophoresis figure that contains the PCR product of human insulinogen C peptide genetic engineering bacterium, from left to right:
Track-M: be nucleic acid molecular weight standard Lamda DNA/HindIII;
Track-engineering bacteria: the engineering strain that contains human insulinogen C peptide is done template, the PCR product and the chromosomal special product of host bacterial of the recombinant vectors of human insulinogen C peptide occur.
Fig. 2 is the SDS-PAGE electrophorogram that contains the human insulinogen C peptide genetic engineering bacterium, from left to right:
Track 1: the broken sample of engineering bacteria has the human insulinogen C peptide band near 3KDa;
Track M: protein molecular weight standard from top to bottom, is respectively 2.5KDa, 6.5KDa, 10KDa, 16KDa.
Embodiment
The experimental implementation of the present invention's design and the prescription main reference of related reagent: pichia spp operational manual (the Pichia expression Kit Instruction Manual, Introgen Corporation, Carlsbad, CA, USA), molecular cloning experiment guide (third edition, Huang Peitang translation, and the specification sheets of reagent producer Science Press).
The medium component that the present invention relates generally to following (unless otherwise indicated being massfraction):
LB substratum: peptone 1%, yeast extract 0.5%, sodium-chlor 0.5%;
Seed culture medium (YPD): peptone 2%, yeast extract 1%, glucose 2%; The agar powder of adding 1.5% in the solid medium.
Growth medium (BMGY): yeast nitrogen base 1.34%, vitamin H (4 * 10
-5) %, peptone 2%, yeast extract 1%, 0.1mol/L phosphate buffered saline buffer pH6.0,1% glycerine;
Inducing culture (BMMY): yeast nitrogen base 1.34%, vitamin H (4 * 10
-5) %, peptone 2%, yeast extract 1%, 0.1mol/L phosphate buffered saline buffer pH6.0,1% (v/v) methyl alcohol;
Example 1 contains the building process of the recombinant expression vector of human insulinogen C peptide
The chemosynthesis of human insulinogen C peptide gene: according to the aminoacid sequence (SEQID NO:2) of human insulinogen C peptide, synthetic two complementary nucleotide sequences.
The nucleotide sequence of forward contains following sequence (5 ' → 3 '): gaggccgaagattta cag gtaggacaagttgagttgggaggaggcccaggggcaggctcgctacagcccttggc cttggaaggctcactgcag;
Reverse nucleotide sequence contains following sequence (5 ' → 3 '):
ctgcagtgagccttccaaggccaagggctgtagcgagcctgcccctgggcctcctcccaactcaacttgtcctacctgtaaatcttcggcctc。
5 of forward and reverse nucleotide sequence ' end has all designed restriction enzyme EcoR I.
Two complementary nucleotide sequences promptly obtain the human insulinogen C peptide gene by annealing.After above-mentioned nucleic acid product and expression vector pPIC3K cut with EcoR I enzyme respectively, connect with dna ligase, and transformed into escherichia coli DH5 α, in containing the LB substratum of penbritin, cultivate, the screening transformant identifies that by order-checking acquisition contains the recombinant expression vector of the correct connection of human insulinogen C peptide gene at last.
Extract above-mentioned recombinant expression vector, after cutting with Sal I enzyme, enzyme is cut product transformed yeast recipient bacterium GS115, coats on the MD flat board.Cultivate after 48 hours, certain transformant cell is coated on the YPD-G418 flat board, the G418 concentration gradient is 0.25mg/mL, 0.50mg/mL, 0.75mg/mL, 1.0mg/mL, 1.5mg/mL, 2.0mg/mL, 4.0mg/mL, cultivate at 30 ° of C, grow G418 resistance bacterium colony after 2-5 days.This resistance bacterium colony is carried out DNA with PCR method identify, the primer universal sequencing primer thing AOX1 of pPIC3K, the result is as shown in Figure 1.
The result shows: human insulinogen C peptide is transformed among the yeast recipient bacterium GS115.
Example 2 shakes a bottle expressing human Insulinogen C peptide situation
Select a single bacterium colony from solid plate, be inoculated into the 250mL that 25mL BMGY is housed and shake in the bottle, 30 ° of C, 220rpm, incubated overnight is to OD
600=4.
Above-mentioned 25mL nutrient solution is inoculated among the 1LBMGY, continues to be expanded to cell concentration OD
600=6.
5000rpm, the centrifugal 5min of room temperature, results thalline.With fresh aseptic BMMY suspension thalline, to bacterium liquid OD
600=1.0,30 ° of C, 220rpm abduction delivering human insulinogen C peptide.Every the 24h sampling, and replenish 100% methyl alcohol to final concentration 1.5%.Inducing culture 120h finishes, centrifugal results thalline.With thalline by the protein electrophorese analysis, the result as shown in Figure 2, the result shows: human insulinogen C peptide obtains to express in pichia spp.
Shake-flask culture, analyst's Insulinogen C peptide expression.By a large amount of screening transformants, obtain the engineering strain of high expression level human insulinogen C peptide.The shaking bottle expression amount and can reach more than the 200mg/L of the human insulinogen C peptide engineering strain that the present invention obtains.
Example 3 fermentation expression human insulinogen C peptide situations
Select a single bacterium colony from solid plate, be inoculated into the 250mL that 25mL BMGY is housed and shake in the bottle, 30 ° of C, 220rpm, incubated overnight is to OD
600=4.
Above-mentioned 25mL nutrient solution is inoculated among the 250mL BMGY, continues to be expanded to cell concentration OD
600=6, nutrient solution is inoculated in the 2L BSM fermention medium, adjust pH=4.0-7.5, temperature is at 28 ° of C, DO=40%, rotating speed 500rpm is after cultivation for some time, DO is raised to more than 100% rapidly, show that glycerine is exhausted in the substratum, beginning slowly adds 50% glycerine, glycerine flow acceleration 30mL/h, and keep DO more than 35%, glycerine prolongation 4h.
The methanol induction stage: after stopping to replenish glycerine, DO is raised to rapidly more than 100%, and after hungry for some time, beginning slowly replenishes methyl alcohol, and methyl alcohol flow acceleration 3-7mL/h along with the DO value rises, can accelerate the methyl alcohol flow acceleration.If the DO value is lower than 35%, stop to add methyl alcohol, treat that the DO value continues to be raised to 35%, just replenish methyl alcohol.Every 4h, get the content that thalline detects human insulinogen C peptide, fermentation continues 96h, results fermentation thalline.In whole fermentation process, the DO value should be controlled at 20%-40%.The yeast wet thallus reaches more than the 300g/L, and the content of C peptide reaches more than the 1000mg/L.
SEQUENCE?LISTING
＜110〉Xizang Jinke Technology Co., Ltd.
BJ University of Aeronautics ﹠ Astronautics
Tibet Autonomous Region characteristic husbandry engineering and technological research development centre
＜120〉structure of human insulinogen C peptide high-yield strains
＜130〉there is not the files reference number
<160>2
<170>PatentIn?version3.3
<210>1
<211>93
<212>DNA
<213>Artificial
<220>
＜223〉coding human insulinogen C peptide
<220>
<221>CDS
<222>(1)..(93)
<400>1
<210>2
<211>31
<212>PRT
<213>Artificial
<220>
<223>Synthetic?Construct
<400>2
Claims (6)
- One kind can the expressing human Insulinogen C peptide nucleic acid molecule, its sequence is SEQ ID N0:1.
- 2. the recombinant vectors of expressing human Insulinogen C peptide in the energy born of the same parents, it is characterized by: the expression vector of selecting for use is expression vector pPIC3K in the pichia spp born of the same parents, the nucleic acid molecule formation recombinant vectors of the described human insulinogen C peptide of pPIC3K and claim 1.
- 3. the Pichi strain of expressing human Insulinogen C peptide in the efficient born of the same parents of energy, it contains the described recombinant vectors of claim 2.
- 4. Pichi strain as claimed in claim 3 is characterized in that the pichia spp host cell of selecting for use is GS115.
- 5. efficient Pichi strain of expressing human Insulinogen C peptide in the born of the same parents, its deposit number is CGMCC No.2686.
- 6. the method for the interior expressing human Insulinogen C peptide of born of the same parents is characterized in that adopting expressing in arbitrary Pichi strain born of the same parents among the claim 3-5 obtaining.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101672000A CN101381727B (en) | 2008-10-08 | 2008-10-08 | Construction of human insulinogen C peptide high-yield strains |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101672000A CN101381727B (en) | 2008-10-08 | 2008-10-08 | Construction of human insulinogen C peptide high-yield strains |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101381727A CN101381727A (en) | 2009-03-11 |
| CN101381727B true CN101381727B (en) | 2011-06-08 |
Family
ID=40461780
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101672000A Active CN101381727B (en) | 2008-10-08 | 2008-10-08 | Construction of human insulinogen C peptide high-yield strains |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101381727B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1329922A (en) * | 2001-05-18 | 2002-01-09 | 中国科学院上海生物化学研究所 | Join of C peptide and insulin for treating diabetes complication and C peptide-specific antibody |
-
2008
- 2008-10-08 CN CN2008101672000A patent/CN101381727B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1329922A (en) * | 2001-05-18 | 2002-01-09 | 中国科学院上海生物化学研究所 | Join of C peptide and insulin for treating diabetes complication and C peptide-specific antibody |
Non-Patent Citations (1)
| Title |
|---|
| CN 1329922 A,说明书第6页第5-19行. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101381727A (en) | 2009-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114853881B (en) | Recombinant humanized fusion collagen and efficient hydroxylation method and application thereof | |
| CN106554410A (en) | A kind of recombination human source collagen and its encoding gene and preparation method | |
| CN106676086B (en) | A kind of the zytase xyn-LVK and its gene of thermal stability improvement | |
| CN112251392A (en) | Genetic engineering strain for producing ergothioneine and application thereof | |
| CN102839165A (en) | Gene mutation type recombined protease K and industrialized production method thereof | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| CN109321586A (en) | Recombinant Aspergillus niger Glucose Oxidase optimization gene and its expression vector and application | |
| CN109295067A (en) | A kind of the moral paddy insulin precursor-gene and its expression of codon optimization | |
| CN101665798B (en) | Method for preparing recombinant human serum albumin and interferon alpha fusion protein | |
| CN102796201B (en) | Erythropoietin mimetic peptide (EMP)-human serum albumin (HSA) fusion protein and preparation method thereof | |
| CN101525387A (en) | Recombined long-acting glucagons peptide analogue and preparation method thereof | |
| CN106337054A (en) | Method for preparing high activity recombinant porcine epidermal growth factor | |
| CN101381727B (en) | Construction of human insulinogen C peptide high-yield strains | |
| CN110257312B (en) | Recombinant gene engineering bacterium and application thereof in producing vanillin by fermentation | |
| CN103012578B (en) | Recombinant porcine interleukin 2, and encoding gene and expression method thereof | |
| CN102898514A (en) | Recombinant human nerve growth factor deletion mutant, its preparation method and application | |
| CN110396533A (en) | The preparation method of coli strain, screening technique, recombination engineering expression recombinant protein with phage resistance | |
| CN102485890B (en) | With Pichia sp. excreting and expressing recombinant human protein disulfide isomerase | |
| CN101818165A (en) | Method for constructing anti-lean oxygen high-density fermentation L-Phe engineering plasmid by utilizing vgb genes | |
| CN102898512B (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN101942422A (en) | Genes of D-lactic dehydrogenase from serratia marcescens and research of cloning and expressing recombinant strains and recombinant enzymes | |
| CN102911960A (en) | Feedback inhibition weakening method for producing glutathione by bacterial strains | |
| CN102168057B (en) | Engineering bacteria expressing active peptides and method of preparing mixed polypeptide | |
| CN106478792A (en) | A kind of three PEPC ec Md3js, preparation method and application | |
| CN101544692A (en) | Rousettus leschenaulti leptin and its cDNA sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |