CN101379087B - Be used for the treatment of and conduct relevant disease and illness, the composition involving the antibody be combined with IL-22 and IL-22R and method to cytokine signaling - Google Patents

Abstract

Provide for the diagnosis and treatment of inflammation and autoimmune conditions, such as psoriatic composition and method.Providing the composition for regulating and controlling IL-23 or IL-22 intracellular signaling and method, comprising the antibody be combined with IL-22 and IL-22R.

Description

Be used for the treatment of and conduct relevant disease and illness, the composition involving the antibody be combined with IL-22 and IL-22R and method to cytokine signaling

Related application

This application claims the U.S. Provisional Application NO.60/741 submitted on December 2nd, 2005, the U.S. Provisional Application NO.60/822 that on August 16th, 640 and 2006 submits to, the rights and interests of 597, are incorporated in this by quoting completely by their disclosure.

Invention field

The present invention relates to and conduct the useful composition of the Diagnosis and Treat of relevant disease and illness and method for cytokine signaling.

Background of invention

Various diseases is relevant to inflammation with illness.Inflammation raises relevant process with inflammatory cell (such as, white corpuscle) to the site damaged or infect.Inflammation usually protects body to avoid infecting and damage.But, excessive or improperly inflammation can have injurious effects.Autoimmune conditions, such as, triggers the inflammation causing normal body tissue to destroy usually.Inflammation is also related with cancer.See, such as, Coussensetal. (2002) Nature420:860-867.Such as, relevant to inflammatory bowel (IBD) chronic inflammatory diseases and colorectal carcinoma occur to be correlated with consumingly.During inflammatory response, some inflammatory cell produces the factor promoting that blood vessel occurs, and reduces the anti-tumor activity of cytotoxic T cell, and the sudden change in inducing DNA, thus create the environment promoting tumor development.The same.

IL-23 is the cytokine of different dimerization, and it plays remarkable effect in autoimmunity/inflammatory conditions, particularly chronic inflammatory diseases.Such as, the research in mouse discloses, and IL-23 is for the experimental allergic encephalomyelitis (autoimmune inflammation of brain) of the model as multiple sclerosis; As the Collagen-Induced Arthritis of the model of rheumatoid arthritis; With delayed type hypersensitivity be required.IL-23 also works to maintain the colitis (a kind of form of IBD) set up.The transgene expression of IL-23 causes Systemic Inflammatory to reply, and the imbalance of IL-23 causes eczematous dermatoses (a kind of inflammatory skin disorders).IL-23 stimulates unique T cell colony (Th _iL-17cell), it induces the generation of IL-17 and pro-inflammatory cytokine then.For the summary of the effect of IL-23 in inflammation and autoimmunity, see, such as Hunter (2005) Nat.Rev.Immunol.5:521-531; Holscher (2005) Curr.Opin.Invest.Drugs6:489-495.IL-23 also show and reduces tumor-infiltrated by cytotoxic T cell and improve blood vessel generation, thus promotes tumor growth.Langowskietal.(2006)Nature442：461-465。

Summary of the invention

Provide for the useful composition of the Diagnosis and Treat of inflammatory conditions and autoimmune conditions (such as, psoriatic) and method.Further provide for the useful composition of regulation and control IL-23 or IL-22 intracellular signaling and method.There is provided herein these and other embodiments of the present invention.The present invention is based in part on illustrating of a kind of signal transduction path, and wherein IL-23 works via IL-22, its helper cell (Th cell) subset by induction discovery recently and Th _iL-17the IL-22 of pedigree expresses.

In one aspect, provide the antibody of specific binding IL-22, wherein said antibody is the antibody that (a) is produced by the hybridoma being selected from 3F11.3 (ATCC registration number PTA-7312), hybridoma 11H4.4 (ATCC registration number PTA-7315) and hybridoma 8E11.9 (ATCC registration number PTA-7319); The form of the Affinity maturation of the antibody of (b) (a); The Fab of the antibody of (c) (a) or (b); Or (d) (a), (b) or (c) the humanized form of antibody.

In yet another aspect, provide the antibody of specific binding IL-22R, wherein said antibody is the antibody that (a) is produced by the hybridoma being selected from 7E9 (ATCC registration number PTA-7313), hybridoma 8A12 (ATCC registration number PTA-7318) and hybridoma 8H11 (ATCC registration number PTA-7317); The form of the Affinity maturation of the antibody of (b) (a); The Fab of the antibody of (c) (a) or (b); Or (d) (a), (b) or (c) the humanized form of antibody.

In yet another aspect, provide the method for the treatment of autoimmune conditions, wherein said autoimmune conditions is not sacroiliitis, and described method comprises the medicinal proportional preparation comprising the antagonist of IL-22 to administration significant quantity.In such embodiment, described IL-22 antagonist is the antibody of specific binding IL-22.In one embodiment, the antibody of described specific binding IL-22 is the antibody that (a) is produced by the hybridoma being selected from 3F11.3 (ATCC registration number PTA-7312), hybridoma 11H4.4 (ATCC registration number PTA-7315) and hybridoma 8E11.9 (ATCC registration number PTA-7319); The form of the Affinity maturation of the antibody of (b) (a); The Fab of the antibody of (c) (a) or (b); Or (d) (a), (b) or (c) the humanized form of antibody.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22R.In such embodiment, the antibody of described specific binding IL-22R is the antibody that (a) is produced by the hybridoma being selected from 7E9 (ATCC registration number PTA-7313), hybridoma 8A12 (ATCC registration number PTA-7318) and hybridoma 8H11 (ATCC registration number PTA-7317); The form of the Affinity maturation of the antibody of (b) (a); The Fab of the antibody of (c) (a) or (b); Or (d) (a), (b) or (c) the humanized form of antibody.In one embodiment, described IL-22 antagonist is IL-22BP.In one embodiment, described autoimmune conditions is inflammatory bowel.In one embodiment, described autoimmune conditions is psoriatic.In one embodiment, described method comprises further uses at least one antibody, and described antibody is selected from the antibody of the antibody of specific binding IL20Ra, the antibody of specific binding IL20Rb and specific binding IL-22R.In one embodiment, described method comprises further uses at least one antibody, and described antibody is selected from the antibody of the antibody of specific binding IL-22, the antibody of specific binding IL20Ra and specific binding IL20Rb.

In yet another aspect, provide the method for the treatment of inflammation, wherein said inflammation is not arthritic inflammation, and described method comprises the medicinal proportional preparation comprising the antagonist of IL-22 to administration significant quantity.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22.In such embodiment, the antibody of described specific binding IL-22 is the antibody that (a) is produced by the hybridoma being selected from 3F11.3 (ATCC registration number PTA-7312), hybridoma 11H4.4 (ATCC registration number PTA-7315) and hybridoma 8E11.9 (ATCC registration number PTA-7319); The form of the Affinity maturation of the antibody of (b) (a); The Fab of the antibody of (c) (a) or (b); Or (d) (a), (b) or (c) the humanized form of antibody.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22R.In such embodiment, the antibody of described specific binding IL-22R is the antibody that (a) is produced by the hybridoma being selected from 7E9 (ATCC registration number PTA-7313), hybridoma 8A12 (ATCC registration number PTA-7318) and hybridoma 8H11 (ATCC registration number PTA-7317); The form of the Affinity maturation of the antibody of (b) (a); The Fab of the antibody of (c) (a) or (b); Or (d) (a), (b) or (c) the humanized form of antibody.In one embodiment, described IL-22 antagonist is IL-22BP.In one embodiment, described inflammation is autoimmune inflammation.In one embodiment, described inflammation is skin inflammation.In one embodiment, described inflammation is chronic inflammatory diseases.

In yet another aspect, provide the method for Tumor suppression development, described method comprises the medicinal proportional preparation comprising the antagonist of IL-22 to administration significant quantity.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22.In such embodiment, the antibody of described specific binding IL-22 is the antibody that (a) is produced by the hybridoma being selected from 3F11.3 (ATCC registration number PTA-7312), hybridoma 11H4.4 (ATCC registration number PTA-7315) and hybridoma 8E11.9 (ATCC registration number PTA-7319); The form of the Affinity maturation of the antibody of (b) (a); The Fab of the antibody of (c) (a) or (b); Or (d) (a), (b) or (c) the humanized form of antibody.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22R.In such embodiment, the antibody of described specific binding IL-22R is the antibody that (a) is produced by the hybridoma being selected from 7E9 (ATCC registration number PTA-7313), hybridoma 8A12 (ATCC registration number PTA-7318) and hybridoma 8H11 (ATCC registration number PTA-7317); The form of the Affinity maturation of the antibody of (b) (a); The Fab of the antibody of (c) (a) or (b); Or (d) (a), (b) or (c) the humanized form of antibody.In one embodiment, described IL-22 antagonist is IL-22BP.

In yet another aspect, provide the method for the signal transduction path of IL-23 mediation in stimulating organism system, described method comprises provides IL-22 agonist to described biology system.In one embodiment, described IL-22 agonist is IL-22.In yet another aspect, provide the method for the signal transduction path suppressing IL-23 mediation in biology system, described method comprises provides IL-22 antagonist to described biology system.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22R.

In yet another aspect, stimulation Th is provided _iL-17the method of cell function, described method comprises makes Th _iL-17cell is exposed to IL-22 agonist.In one embodiment, described IL-22 agonist is IL-22.In yet another aspect, suppression Th is provided _iL-17the method of cell function, described method comprises makes Th _iL-17cell is exposed to IL-22 antagonist.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22.In one embodiment, described IL-22 antagonist is the antibody of specific binding IL-22R.

Accompanying drawing is sketched

Fig. 1 shows the nucleotide sequence (SEQIDNO:1) of the cDNA of the natural mankind IL-22 that encodes.

Fig. 2 shows the aminoacid sequence (SEQIDNO:2) of the encoding sequence derived from SEQIDNO:1 shown in Fig. 1.

Fig. 3 shows the aminoacid sequence (SEQIDNO:3) of natural mankind IL-22R.

Fig. 4 shows the aminoacid sequence (SEQIDNO:4) of natural mankind IL-22BP.

Fig. 5 is as described in Example 1, the list of all IL-22 antibody produced and their corresponding properties.Cell inner dyeing is abbreviated as IC.

Fig. 6 shows as described in Example 2, and anti-IL-22 antibody can block STAT3 activation.

Fig. 7 shows as embodiment 3 describes, and the anti-IL-22 antibody of three species specificity blocks mankind IL-22 with dosage-dependent manner.

Fig. 8 shows as embodiment 4 describes, and the anti-IL-22 antibody of three species specificity can block mouse IL-22 with dosage-dependent manner.

Fig. 9 such as embodiment 5 describes, the calculating of the avidity of anti-IL-22 antibody on human class IL-22.

Figure 10 shows as embodiment 6 describes, the cell inner expression of anti-IL-22 antibody test IL-22.

Figure 11 shows as embodiment 6 describes, and uses the anti-IL-22 antibody of tape label thing to FACS dyeing in the cell of IL-22.

Figure 12 shows as embodiment 7 describes, the expression of IL-22 in mouse Th1 cell measured by 5 ' nuclease assays.

Figure 13 shows as embodiment 8 describes, the expression of IL-22 in mouse gamma delta T cells measured by 5 ' nuclease assays.

Figure 14 shows as embodiment 9 describes, the expression of IL-22 in the human T cells of activation measured by microarray analysis.

Figure 15 shows as embodiment 10 describes, by the expression level of IL-22 in T cell of FACS.

Figure 16 shows as embodiment 11 describes, the test of anti-IL-22R antibody on 293 cells of expressing IL-22R.

Figure 17 shows as embodiment 12 describes, and anti-IL-22R antibody can block the expression of the IL-22 induction of STAT3 reporter construct.

Figure 18 shows as embodiment 13 describes, the expression of IL-22R and IL-10R2 on primary culture keratinocytes.

Figure 19 shows as embodiment 14 describes, and IL-22 induces thickening of human epidermal.

Figure 20 shows as embodiment 14 describes, and IL-22 induces keratinocyte turnover mark CK16 to express.

Figure 21 shows as embodiment 14 describes, and causes the induction expressed at the gene psoriasin (psoriasin) of psoriatic camber expression with IL-22 handler skins.

Figure 22 shows as embodiment 15 describes, and improves the expression of several gene, comprise psoriasin with IL-22 process keratinocyte.

Figure 23 shows as embodiment 14 describes, and expresses by reducing psoriasin by anti-IL-22 and anti-IL-22R antibody treatment.

Figure 24 shows as embodiment 14 describes, and thickens by reducing epidermis by anti-IL-22 and anti-IL-22R antibody treatment.

Figure 25 shows as embodiment 14 describes, and thickens by reducing epidermis by anti-IL-22 and anti-IL-22R antibody treatment.

Figure 26 shows as embodiment 16 describes, and the epidermis that IL-23 and IL-12 induction has different histologic characteristicses thickens.

Figure 27 shows as embodiment 17 and 18 describes, and IL-23 induces the expression of IL-22, and in IL-22 inductor, skin inflammation and epidermis thicken.

Figure 28 shows as embodiment 17 describes, IL-12 and IL-23 induces the expression of different cytokine set.

Figure 29 shows as embodiment 20 describes, and reduces the spinous layer of epidermis plumpness (acanthosis) of IL-23 induction in body with the process of anti-IL-22 monoclonal antibody significantly.

Figure 30 shows as embodiment 20 describes, for destroying the strategy of IL-22 gene in mouse and confirming IL-22 expression at IL-22 ^-/-non-existent evidence in mouse.

Figure 31 shows as embodiment 20 describes, and in IL-22 deficient mice, the acanthosis of IL-23 induction has been considerably reduced.

Figure 32 shows as embodiment 20 describes, and the acanthosis that IL-22 defect is induced for IL-12 does not affect.

Figure 33 shows as embodiment 21 describes, and the lymphocyte that IL-23 induction activates from multiple IL-23 produces IL-22.

Figure 34 shows as embodiment 22 describes, and IL-22 is from Th _iL-17the new effector cell factor of pedigree.

Figure 35 shows as embodiment 22 describes, IL-22 with IL-17 is by identical Th pedigree (Th _iL-17) produce.

Figure 36 shows as embodiment 22 describes, and when the activation of Naive T cells, IL-23 stimulates IL-22 to produce.

Figure 37 shows as embodiment 23 describes, and IL-19, IL-20, IL-22 and IL-24 induce epidermis to thicken.

Figure 38 shows as embodiment 23 describes, the quantification of the spinous layer of epidermis plumpness of IL-19, IL-20, IL-22 and IL-24 induction.

Figure 39 shows as embodiment 24 describes, and the component of the acceptor of IL-19, IL-20 and IL-22 is expressed on Human keratinocytes.

Figure 40 shows as embodiment 24 describes, and the blocking antibody for the receptor components of IL-19, IL-20 and IL-22 reduces psoriasin expresses.

Figure 41 shows when used in combination, and the psoriasin that the antibody for IL20Ra and IL-22R blocks IL-20 induction is effectively expressed.

Detailed Description Of The Invention

I. define

Term " IL-22 polypeptide " or " IL-22 " refer to various interleukin-22 polypeptide (being also called " interleukin-22 part " or " IL-22L " in this area).Native sequences IL-22 polypeptide and variant (having further definition in this article) thereof contained in this term.IL-22 polypeptide described herein can be separated from multiple source, the tissue of such as people or other source, or can by restructuring or synthetic method preparation.Natural IL-22 can from any species, (" mIL-22 ") of such as mouse or (" hIL-22 ") of people.

Term " IL-22R polypeptide " or " IL-22R " refer to the polypeptide fraction of interleukin-22 acceptor heterodimer or interleukin-2 0 acceptor heterodimer.Native sequences IL-22R polypeptide and variant (having further definition in this article) thereof contained in this term.IL-22R polypeptide described herein can be separated from multiple source, the tissue of such as people or other source, or can by restructuring or synthetic method preparation.Natural IL-22R can from any species, (" mIL-22R ") of such as mouse or (" hIL-22R ") of people.Native sequences IL-22R polypeptide is also called in this area " IL-22R1 " and " IL22RA ".

" native sequences IL-22 polypeptide " or " native sequences IL-22R polypeptide " refers to and the polypeptide comprising same acid sequence derived from natural corresponding IL-22 or IL-22R polypeptide.This type of native sequences IL-22 or IL-22R polypeptide can be separated from nature, or can be generated by restructuring or synthesizing mean.Specific IL-22 or the IL-22R polypeptide (such as lacking the IL-22 of its associated signal peptide) of naturally occurring brachymemma or secreted form clearly contained in this term, the natural of this polypeptide exists variant form (such as alternative splice forms) and naturally there is allelic variant.In the various embodiments of the present invention, native sequences IL-22 presently disclosed or IL-22R polypeptide are natural sequence polypeptide that is ripe or total length.Fig. 2 and Fig. 3 respectively illustrates exemplary total length human il-22 and IL-22R.Shown in code pattern 2, the nucleic acid of polypeptide is shown in Fig. 1.Initial sum terminator codon is in the figure with runic and underscore display.Although the methionine residues that IL-22 and the IL-22R peptide sequence disclosed in accompanying drawing is shown as to be appointed as the 1st amino acids herein starts, to expect and possible, other methionine residues being arranged in figure the 1st amino acids upstream or downstream can be adopted as the starting amino acid residue of IL-22 or IL-22R polypeptide.

" IL-22 variant ", " IL-22R variant ", " IL-22 Variant polypeptides " or " IL-22R Variant polypeptides " mean to have defined active IL-22 or the IL-22R polypeptide at least about 80% amino acid sequence identity above with total length native sequences IL-22 or IL-22R peptide sequence.Usually, IL-22 or IL-22R polypeptide variants and total length or amino acid sequence identity that the native sequences IL-22 of maturation or IL-22R peptide sequence will have at least about 80%, or at least about the amino acid sequence identity of 81%, or at least about the amino acid sequence identity of 82%, or at least about the amino acid sequence identity of 83%, or at least about the amino acid sequence identity of 84%, or at least about the amino acid sequence identity of 85%, or at least about the amino acid sequence identity of 86%, or at least about the amino acid sequence identity of 87%, or at least about the amino acid sequence identity of 88%, or at least about the amino acid sequence identity of 89%, or at least about the amino acid sequence identity of 90%, or at least about the amino acid sequence identity of 91%, or at least about the amino acid sequence identity of 92%, or at least about the amino acid sequence identity of 93%, or at least about the amino acid sequence identity of 94%, or at least about the amino acid sequence identity of 95%, or at least about the amino acid sequence identity of 96%, or at least about the amino acid sequence identity of 97%, or at least about the amino acid sequence identity of 98%, with or at least about 99% amino acid sequence identity.

Be defined as contrast sequence about " per-cent (%) amino acid sequence identity " of identified IL-22 or IL-22R peptide sequence herein and introduce breach where necessary with after obtaining largest percentage sequence iden, and not by any conservative substitute be considered as sequence iden a part of time, the percentage of amino-acid residue identical with the amino-acid residue in specific IL-22 or IL-22R peptide sequence in candidate sequence.For the contrast measuring percent amino acid sequence identity object can be carried out by the various ways within the scope of art technology, such as use the available computer software of the public, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software.Those skilled in the art can determine the suitable parameter for measuring contrast, comprise any algorithm needed for institute's comparative sequences total length acquisition maximum contrast.Aminoacid sequence is compared, given aminoacid sequence A relative to (to), with (with) or for (against) given aminoacid sequence B % amino acid sequence identity (or can be expressed as have or comprise relative to, with or for the given aminoacid sequence A of a certain % amino acid sequence identity of given aminoacid sequence B) calculate as follows:

Mark X/Y takes advantage of 100

Wherein X is the total number of atnino acid of identical match by sequence alignment programme's scoring in A and B of this program contrasts, and wherein Y is the total amino acid residues in B.Can understand, if the length of the length of aminoacid sequence A and aminoacid sequence B is unequal, then A will be not equal to the % amino acid sequence identity of B relative to A relative to the % amino acid sequence identity of B.As making the example calculating % amino acid sequence identity in this way, table 2 and 3 demonstrates the % amino acid sequence identity how calculating the aminoacid sequence that is assigned as " comparison protein " relative to the aminoacid sequence being assigned as " IL-22 or IL-22R ", wherein " IL-22 or IL-22R " represents the aminoacid sequence of IL-22 or IL-22R polypeptide interested, " comparison protein " represents the aminoacid sequence of the polypeptide that " IL-22 or IL-22R " interested polypeptide compares for it, and " X ", " Y " and " Z " represent different aminoacids residue separately.

Table 2

IL-22 or IL-22RXXXXXXXXXXXXXXX (length=15 amino acid)

Comparison protein XXXXXYYYYYYY (length=12 amino acid)

% amino acid sequence identity=the number of the amino-acid residue of identical match (between the two peptide species sequences) divided by (sum of the amino-acid residue of IL-22 or IL-22R polypeptide)=5 divided by 15=33.3%

Table 3

IL-22 or IL-22RXXXXXXXXXX (length=10 amino acid)

Comparison protein XXXXXYYYYYYZZYZ (length=15 amino acid)

% amino acid sequence identity=the number of the amino-acid residue of identical match (between the two peptide species sequences) divided by (sum of the amino-acid residue of IL-22 or IL-22R polypeptide)=5 divided by 10=50%

Term " IL-19 " refers to, from any vertebrate origin, comprise Mammals, such as any natural IL-19 of primates (such as people and monkey) and rodents (such as Mouse and rat), except as otherwise noted.Any form IL-19 that in " total length ", unprocessed IL-19 and cell, processing produces contained in this term.This term is also contained the natural of IL-19 and be there is variant, such as splice variant, allelic variant, and other isoform (isoform).Natural IL-19 fragment or the variant of at least one biologic activity maintaining IL-19 also contained in this term.

Term " IL-20 " refers to, from any vertebrate origin, comprise Mammals, such as any natural IL-20 of primates (such as people and monkey) and rodents (such as Mouse and rat), except as otherwise noted.Any form IL-20 that in " total length ", unprocessed IL-20 and cell, processing produces contained in this term.This term is also contained the natural of IL-20 and be there is variant, such as splice variant, allelic variant, and other isoform (isoform).Natural IL-20 fragment or the variant of at least one biologic activity maintaining IL-20 also contained in this term.

Term " IL-24 " refers to, from any vertebrate origin, comprise Mammals, such as any natural IL-24 of primates (such as people and monkey) and rodents (such as Mouse and rat), except as otherwise noted.Any form IL-24 that in " total length ", unprocessed IL-24 and cell, processing produces contained in this term.This term is also contained the natural of IL-24 and be there is variant, such as splice variant, allelic variant, and other isoform (isoform).Natural IL-24 fragment or the variant of at least one biologic activity maintaining IL-24 also contained in this term.

Term " IL-22BP " or " IL-22 associated proteins " are for referring to from any vertebrate origin during this paper, comprise Mammals, the such as any natural IL-22BP of primates (such as people and monkey) and rodents (such as Mouse and rat), except as otherwise noted.Any form IL-22BP that in " total length ", unprocessed IL-22BP and cell, processing produces contained in this term.This term is also contained the natural of IL-22BP and be there is variant, such as splice variant, allelic variant, and other isoform (isoform).Natural IL-22BP fragment or the variant of at least one biologic activity maintaining IL-22BP also contained in this term.Natural IL-22BP is also called " IL-22RA2 " in the art.

Term IL-20Ra refers to the polypeptide fraction of IL-19 acceptor heterodimer or IL-20 acceptor heterodimer.This term is contained from any vertebrate origin, comprises Mammals, such as any natural IL-20Ra of primates (such as people and monkey) and rodents (such as Mouse and rat), except as otherwise noted.Any form IL-20Ra that in " total length ", unprocessed IL-20Ra and cell, processing produces contained in this term.This term is also contained the natural of IL-20Ra and be there is variant, such as splice variant, allelic variant, and other isoform (isoform).Natural IL-20Ra fragment or the variant of at least one biologic activity maintaining IL-20Ra also contained in this term.Natural IL-20Ra is also called " IL-20R1 " in the art.

Term IL-20Rb refers to the polypeptide fraction of IL-19 acceptor heterodimer or IL-20 acceptor heterodimer.This term is contained from any vertebrate origin, comprises Mammals, such as any natural IL-20Rb of primates (such as people and monkey) and rodents (such as Mouse and rat), except as otherwise noted.Any form IL-20Rb that in " total length ", unprocessed IL-20Rb and cell, processing produces contained in this term.This term is also contained the natural of IL-20Rb and be there is variant, such as splice variant, allelic variant, and other isoform (isoform).Natural IL-20Rb fragment or the variant of at least one biologic activity maintaining IL-20Rb also contained in this term.Natural IL-20Rb is also called " IL-20R2 " in the art.

Term " IL-10R2 " refers to the polypeptide fraction of IL-22 acceptor heterodimer or IL-20 acceptor heterodimer.This term is contained from any vertebrate origin, comprises Mammals, such as any natural IL-10R2 of primates (such as people and monkey) and rodents (such as Mouse and rat).Any form IL-10R2 that in " total length ", unprocessed IL-10R2 and cell, processing produces contained in this term.This term is also contained the natural of IL-10R2 and be there is variant, such as splice variant, allelic variant, and other isoform (isoform).Natural IL-10R2 fragment or the variant of at least one biologic activity maintaining IL-10R2 also contained in this term.Natural IL-10R2 is also called " IL-10Rb " in the art.

" separation " biological molecule, all each peptide species, polynucleotide and antibody as herein disclosed, refers to identify and the biological molecule of separating from least one composition of its natural surroundings and/or reclaiming.

" activated " or " activity " refers to biology and/or the immunologic competence of natural IL-22 or IL-22R when relating to IL-22 or IL-22R, wherein " biology " activity refers to be caused by natural IL-22 or IL-22R, the biological function except the ability of the antibody tormation of the antigenic epitopes had for natural IL-22 or IL-22R except induction." immunology " activity refers to the ability of the antibody tormation of inducing the antigenic epitopes had for natural IL-22 or IL-22R.

Term " antagonist " uses with most broad sense, comprise part or block completely, suppress or in and polypeptide, such as any molecule of the biologic activity of natural IL-22 or IL-22R polypeptide.The molecule that " antagonist " is also contained completely or the mRNA of suppression coded polypeptide of part transcribes or translates.Suitable antagonist molecules comprises such as antagonistic antibodies or antibody fragment; Natural polypeptides; The fragment of natural polypeptides or amino acid sequence variation; Peptide; Antisense oligonucleotide; Organic molecule; And the nucleic acid of coded polypeptide antagonist or antagonistic antibodies.Mention that namely " one " antagonist contains the combination of single antagonist or two or more different antagonists.

Term " agonist " uses with most broad sense, comprise part or mimic peptide, such as any molecule of the biologic activity of natural IL-22 or IL-22R polypeptide completely.The molecule that the mRNA that " agonist " also contains stimulus coding polypeptide transcribes or translates.Suitable agonist molecule comprises such as agonistic antibody or antibody fragment; Natural polypeptides; The fragment of natural polypeptides or amino acid sequence variation; Peptide; Antisense oligonucleotide; Organic molecule; And the nucleic acid of coded polypeptide agonist or agonistic antibody.Mention that namely " one " agonist contains the combination of single agonist or two or more different agonists.

" alleviation " or " alleviating " (alleviation) refers to both therapeutic treatment and preventative or precaution measure, wherein target be prevention or slow down (alleviating) for pathological condition or illness.The experimenter for the treatment of is needed to comprise that those suffer from illness for a long time and that tend to suffer from illness or illness will be prevented.

It is contrary with short term patterns that " for a long time " uses finger, uses medicament in a continuous mode, thus initial therapy effect is maintained longer for some time." intermittently " using finger is not the treatment that free of discontinuities is carried out continuously, but periodic in essence.

In order to the object for the treatment of, " Mammals " aim enters mammiferous any animal, comprises people, rodents (such as Mouse and rat), and monkey; Domestic animal and livestock; And zoological park, motion, experiment or pet animals, such as dog, cat, ox, horse, sheep, pig, goat, rabbit, etc.In some embodiment, Mammals is selected from people, rodents or monkey.

Use (jointly) while of comprising of " associating " one or more other therapeutical agents uses the continuous administration with any order.

" carrier " for comprising pharmaceutics acceptable carrier, vehicle or stablizer during this paper, they in adopted dosage and concentration to being exposed to its cell or Mammals is nontoxic.Usually, physiology acceptable carrier is pH aqueous buffer solution.The example that physiology can accept carrier comprises buffer reagent, such as phosphoric acid salt, Citrate trianion and other organic acid; Antioxidant, comprises xitix; Lower molecular weight (being less than about 10 residues) polypeptide; Protein, such as serum albumin, gelatin or immunoglobulin (Ig); Hydrophilic polymer, such as polyvinylpyrrolidone; Amino acid, such as glycine, glutamine, l-asparagine, arginine or Methionin; Monose, disaccharides and other carbohydrate, comprise glucose, seminose or dextrin; Sequestrant, such as EDTA; Sugar alcohol, such as N.F,USP MANNITOL or sorbyl alcohol; Salify gegenion, such as sodium; And/or nonionogenic tenside, such as TWEEN ^tM, polyoxyethylene glycol (PEG) and PLURONICS ^tM.

" antibody " (Ab) and " immunoglobulin (Ig) " (Ig) is the glycoprotein with similar structural characteristics.Although antibody shows the binding specificity to specific antigen, immunoglobulin (Ig) comprises antibody and general other both antibody molecule lacking antigen-specific.A rear class polypeptide is such as generated with low-level by lymphsystem and is generated with the level raised by myelomatosis.

Term " antibody " and " immunoglobulin (Ig) " exchange with most broad sense and use, comprise monoclonal antibody (such as total length or intact monoclonal antibodies), polyclonal antibody, univalent antibody, multivalent antibody, multi-specificity antibody (such as bi-specific antibody, as long as they show the biologic activity of expectation), but also some antibody fragment (as specifically described) can be comprised herein.Antibody can be chimeric, people, humanized and/or affinity maturation.

The antibody of specific binding specific antigen refers to enough avidity conjugated antigens, to make this antibody in targeting antigen, can be used as the antibody of diagnostic reagent and/or therapeutical agent.Preferably, according to the measurement of such as radioimmunoassay (RIA), the combination degree of this antibody-like and non-target polypeptide is less than about 10% of the combination to target antigen.In certain embodiments, the antibody in conjunction with target antigen has≤1 μM ,≤100nM ,≤10nM ,≤1nM or≤0.1nM dissociation constant (Kd).

" variable region " or " variable domain " of antibody refers to the amino terminal domain of heavy chain of antibody or light chain.The variable domain of heavy chain can be described as " VH ".The variable domain of light chain can be described as " VL ".These structural domains are generally the most variable portion of antibody and comprise antigen binding site.

Term " variable " refer to some part in variable domain between antibody sequence difference extensively and for often kind of specific antibodies to the combination of its specific antigen and specific truth.But variability is not uniformly distributed in the whole variable domain of antibody.It concentrates in light chain and heavy chain variable domain three sections being called complementary determining region (CDR) or hypervariable region (HVR).In variable domain, the part of high conservative is called framework region (FR) more.Each self-contained four FR of variable domain of native heavy and light chain, they take beta-pleated sheet conformation mostly, by forming loop connecting and three CDR forming a beta-pleated sheet structure part in some situation connect.CDR in every bar chain is by FR keeping together closely, and facilitate the formation of the antigen binding site of antibody (see Kabatetal. together with the CDR of another chain, SequencesofProteinsofImmunologicalInterest, 5th edition, NationalInstituteofHealth, Bethesda, MD (1991)).Constant domain does not participate in the combination of antibody and antigen directly, but shows multiple effector functions, the participation of antibody in the cytotoxicity of such as antibody dependent cellular.

According to the aminoacid sequence of its constant domain, " light chain " from the antibody (immunoglobulin (Ig)) of any invertebrate species can be included into the one in two kinds of distinct types, is called card handkerchief (κ) and lambda (λ).

According to its light chain constant domain amino acid sequence, antibody (immunoglobulin (Ig)) can be included into different classes.Immunoglobulin (Ig) is divided into five large classes: IgA, IgD, IgE, IgG and IgM, wherein some can be further divided into subclass (isotype), such as IgG ₁, IgG ₂, IgG ₃, IgG ₄, IgA ₁and IgA ₂.The heavy-chain constant domains corresponding with inhomogeneous immunoglobulin (Ig) is called α, δ, ε, γ and μ.The subunit structure of different classes of immunoglobulin (Ig) and three-dimensional structure are well-known, and generality is described in such as Abbasetal., CellularandMol.Immunology, 4thed. (2000).Antibody can be a part for the larger fusion molecule that antibody covalently or non-covalently associates with one or more other oroteins or peptide and formed.

Term " full length antibody " and " complete antibody " are used interchangeably in this article, refer to complete form substantially antibody but not as hereafter the antibody fragment that defines.This term specifically refers to that heavy chain comprises the antibody in Fc district.

" antibody fragment " only comprises a part for complete antibody, and wherein said part retains at least one item usually relevant with it when this part is present in complete antibody, as many as great majority or all functions.In one embodiment, antibody fragment comprises the antigen binding site of complete antibody, so retains the ability of conjugated antigen.In another embodiment, antibody fragment, such as comprise the antibody fragment in Fc district, retain at least one biological function usually relevant with it when being usually present in complete antibody with Fc district, such as FcRn combination, regulation and control antibody half life, ADCC function and complement combine.In one embodiment, antibody fragment is the Half-life in vivo univalent antibody substantially similar to complete antibody.Such as, such antibody fragment can comprise an antigen binding arm and its with can give this fragment and be connected with the Fc sequence of body internal stability.

Produce two identical Fabs with Papain digestion of antibodies, be called " Fab " fragment, there is an antigen binding site separately, and remaining " Fc " fragment, its title reflects the ability that it is easy to crystallization.Pepsin produces a F (ab ') ₂fragment, it has two antigen binding sites and still can crosslinking antigen.

" Fv " is the minimum antibody fragment comprising complete antigen binding site.In one embodiment, two-chain Fv species is made up of tight a, heavy chain variable domain of Non-covalent binding and the dimer of a light-chain variable domain.In scFv (scFv) kind, a heavy chain variable domain can be connected by flexible peptide linker covalency with a light-chain variable domain, and light chain and heavy chain are combined in " dimer " structure similar with two-chain Fv species.Just in such configuration, three CDR of each variable domain interact and at V _h-V _ldimer interface determines an antigen binding site.Six CDR give antibody jointly with antigen-binding specificity.But even single variable domain (or only comprising half Fv of three CDR to antigen-specific) also has the ability of identification and conjugated antigen, just avidity is lower than entire binding site.

Fab fragment comprises heavy chain and light-chain variable domain, but also comprises the constant domain of light chain and first constant domain (CH1) of heavy chain.The difference of Fab ' fragment and Fab fragment is that the C-terminal of heavy chain CH1 structural domain adds minority residue, comprises the one or more halfcystines from antibody hinge region.Fab '-SH carries the appellation of the Fab ' of free sulphur alcohol radical to wherein constant domain cysteine residues herein.F (ab ') ₂antibody fragment is as there being the paired Fab ' fragment of hinge cysteine to generate between Fab ' fragment at first.Also know other chemical coupling of antibody fragment.

" scFv " or " scFv " antibody fragment comprises the V of antibody _hand V _lstructural domain, wherein these structural domains are present on a polypeptide chain.Generally speaking, scFv polypeptide is at V _hwith V _lalso comprise peptide linker between structural domain, make scFv can form the desired structure of conjugated antigen.About the summary of scFv see Pluckthun, in: ThePharmacologyofMonoclonalAntibodies, vol.113, RosenburgandMoore compile, Springer-Verlag, NewYork, pp.269-315 (1994).

Term " double antibody " refers to the small antibody fragments with two antigen binding sites, and this fragment is at same polypeptide chain (V _h-V _l) in comprise connected heavy chain variable domain (V _h) and light-chain variable domain (V _l).Making by using too short joint can not match between on same chain two structural domains, forcing the complementary domain of these structural domains and another chain to match, thus produce two antigen binding sites.Double antibody can be divalence or dual specific.What double antibody was more complete is recorded in such as EP404, and 097; WO93/1161; Hudsonetal. (2003) Nat.Med.9:129-134; Hollingeretal., Proc.Natl.Acad.Sci.USA90:6444-6448 (1993).Three antibody (triabody) and four antibody (tetrabody) are recorded in Hudsonetal. (2003) Nat.Med.9:129-134.

Term " monoclonal antibody " is for referring to the antibody obtained from the antibody of a group homogeneity substantially during this paper, each antibody namely forming colony is identical, except may such as, with the possible sudden change of indivisible existence, naturally occurring sudden change.So, modifier " mono-clonal " shows that antibody is not the feature of the mixture of discrete antibody.In certain embodiments, this type of monoclonal antibody typically comprises the antibody of the peptide sequence comprised in conjunction with target thing, and its thing Binding peptide sequence that hits the more selects the process of single target thing Binding peptide sequence to obtain in peptide sequence by comprising comforming.Such as, chosen process can be comform polyclone such as hybridoma clone, phage clone or recombinant DNA clone set in select Unique clones.Be to be understood that, selected target thing binding sequence can change further, such as in order to improve avidity to target thing, by target thing binding sequence humanization, improve its output in cell culture, reduce its immunogenicity in vivo, create multi-specificity antibody etc., and the antibody comprising the target thing binding sequence after change is also monoclonal antibody of the present invention.Different from the polyclonal antibody preparations typically comprised for the different antibodies of different determinant (epi-position), often kind of monoclonal antibody of monoclonal antibody preparations is for the single determinant on antigen.Outside their specificity, the advantage of monoclonal antibody preparations is that they are not subject to the pollution of other immunoglobulin (Ig) usually.

Modifier " mono-clonal " show antibody basically homogeneity antibody population obtain feature, should not be construed as require produce antibody by any ad hoc approach.Such as, the monoclonal antibody used according to the present invention is generated by multiple technologies, comprise such as hybridoma (such as Kohleretal., Nature256:495 (1975); Harlowetal., Antibodies:ALaboratoryManual, ColdSpringHarborLaboratoryPress, 2nded.1988; Hammerlingetal., in: MonoclonalAntibodiesandT-CellHybridomas, 563-681, Elsevier, N.Y., 1981), recombinant DNA method is (see such as U.S. Patent No. 4,816,567), display technique of bacteriophage is (see such as Clacksonetal., Nature352:624-628 (1991); Marksetal., J.Mol.Biol.222:581-597 (1992); Sidhuetal., J.Mol.Biol.338 (2): 299-310 (2004); Leeetal., J.Mol.Biol.340 (5): 1073-1093 (2004); Fellouse, Proc.Nat.Acad.Sci.USA101 (34): 12467-12472 (2004); Leeetal., J.Immunol.Methods284 (1-2): 119-132 (2004)) and for generating the technology of people or human-like antibodies (see such as WO98/24893 in the animal of gene with part or whole human immunoglobulin gene's seat or encoding human immunoglobulin's sequence; WO96/34096; WO96/33735; WO91/10741; Jakobovitsetal., Proc.Natl.Acad.Sci.USA90:2551 (1993); Jakobovitsetal., Nature362:255-258 (1993); Bruggemannetal., YearinImmuno.7:33 (1993); U.S. Patent No. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016; Marksetal., Bio/Technology10:779-783 (1992); Lonbergetal., Nature368:856-859 (1994); Morrison, Nature368:812-813 (1994); Fishwildetal., NatureBiotechchnol.14:845-851 (1996); Neuberger, NatureBiotechnol.14:826 (1996); LonbergandHuszar, Intern.Rev.Immunol.13:65-93 (1995)).

Monoclonal antibody clearly comprises in this article " being fitted together to " antibody, a wherein part for heavy chain and/or light chain or homology identical with derived from the corresponding sequence of Special Thing species or genus in the antibody of specific antibodies classification or subclass, and the remainder of chain with derived from another species or belong to the identical or homology of corresponding sequence in the antibody of another antibody isotype or subclass, and the fragment of this antibody-like, as long as they show the biologic activity (U.S. Patent No. 4 of expectation, 816,567; Morrisonetal., Proc.Natl..Acad.Sci.USA81:6851-6855 (1984)).

" humanization " form of inhuman (such as mouse) antibody refers to that bottom line comprises the chimeric antibody of the sequence derived from non-human immunoglobulin.In one embodiment, humanized antibody refers to the immunoglobulin (Ig) that some hypervariable region residues in human normal immunoglobulin (receptor antibody) is replaced with the some hypervariable region residues with non-human species's (donor antibody) such as mouse, rat, rabbit or the non-human primates of expecting specificity, avidity and/or ability.In some situation, framework region (FR) residue of human normal immunoglobulin is replaced with corresponding non-human residues.In addition, humanized antibody can be included in the residue do not found in receptor antibody or donor antibody.Carrying out these modifications can be performance in order to improve antibody further.Generally speaking, humanized antibody will comprise at least one, usual two whole following variable domains substantially, wherein all or substantially all height become ring and correspond to the Gao Bianhuan of non-human immunoglobulin, and all or substantially all FR be the FR of human normal immunoglobulin sequence.Humanized antibody optionally also will comprise at least part of constant region for immunoglobulin (Fc), normally the constant region of human normal immunoglobulin.More details are see Jonesetal., Nature321:522-525 (1986); Riechmannetal., Nature332:323-329 (1988); Presta, Curr.Op.Struct.Biol.2:593-596 (1992).Also can see following summary and the reference quoted thereof: VaswaniandHamilton, Ann.Allergy, Asthma & Immunol.1:105-115 (1998); Harris, Biochem.Soc.Transactions23:1035-1038 (1995); HurleandGross, Curr.Op.Biotech.5:428-433 (1994).

" people's antibody " refers to have the aminoacid sequence corresponding with the aminoacid sequence of the antibody generated by people and/or use the antibody generated for any technology of raw human antibodies disclosed herein.This definition clear-cut of people's antibody gets rid of the humanized antibody comprising inhuman antigen binding residues.

According to the aminoacid sequence of its heavy-chain constant domains, immunoglobulin (Ig) can be included into different classes.Immunoglobulin (Ig) has five large classes: IgA, IgD, IgE, IgG and IgM, wherein some can be further divided into subclass (isotype), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.

" affinity maturation " antibody refers to have in one or more HVR of antibody the antibody that a place or many places change, cause this antibody to improve to some extent compared with the parental antibody not having these to change to the avidity of antigen.In one embodiment, the antibody of affinity maturation has the avidity to target antigen of nmole or even picomole magnitude.The antibody of affinity maturation generates by code known in the art.Marksetal., Bio/Technology10:779-783 (1992) describes and reorganizes by VH and VL structural domain the affinity maturation carried out.The random mutagenesis of HVR and/or Framework residues is described: Barbasetal., Proc.Nat.Acad.Sci.USA91:3809-3813 (1994) with Publication about Document; Schieretal., Gene169:147-155 (1995); Yeltonetal., J.Immunol.155:1994-2004 (1995); Jacksonetal., J.Immunol.154 (7): 3310-9 (1995); Hawkinsetal., J.Mol.Biol.226:889-896 (1992).

" barrier " antibody, " neutrality " antibody or " Antagonism " antibody refer to the antibody of the biologic activity suppressing or reduce the antigen that it combines.This antibody-like can suppress the biologic activity of antigen substantial or completely." agonistic antibody " divide for finger during this paper or the antibody of the biologic activity of simulating polypeptide of interest completely.

Antibody " effector functions " refers to that those are attributable to antibody Fc district (native sequences Fc district or amino acid sequence variation Fc district) and the biologic activity changed with antibody isotype.The example of antibody mediated effect device function comprises: C1q combines and CDC; Fc receptors bind; The cytotoxicity (ADCC) of antibody dependent cellular mediation; Phagolysis; Cell surface receptor (such as B-cell receptor) is lowered; Activate with B cell.

" binding affinity " is often referred to the intensity of whole noncovalent interaction summation between the single binding site of molecule (such as antibody) and its binding partners (such as antigen).Except as otherwise noted, when for this paper, " binding affinity " refers to reflect in conjunction with 1: 1 interactional inherent binding affinity between right member's (such as antibody and antigen).The usual available dissociation constant (Kd) of the avidity of molecule X to its mating partner Y is stated.The common method that avidity is known by this area is measured, and comprises described herein.Low-affinity antibody usually conjugated antigen and be tending towards easily dissociating slowly, and high-affinity antibody conjugated antigen and be tending towards the combination keeping the longer time faster usually.The multiple method measuring binding affinity is known in this area, wherein any one object all used in the present invention.Described below is concrete exemplary.

In one embodiment, be that the radio-labelled antigen binding assay (RIA) that object antibody and antigen thereof by using Fab pattern described in following assay method carry out is measured according to " Kd " of the present invention or " Kd value ".By under the condition of titration series that there is unlabelled antigen, with Cmin ¹²⁵i labelled antigen balance Fab, then catches with the flat board of anti-Fab antibody bag quilt the antigen combined and measures the solution binding affinity (Chen, etal., JMolBiol293:865-881 (1999)) of Fab to antigen.In order to determine condition determination, catch with 5 μ g/ml in 50mM sodium carbonate (pH9.6) and spent the night by microtiter plate (Dynex) with anti-Fab antibody (CappelLabs) bag, use 2% in PBS (w/v) bovine serum albumin(BSA) to close 2-5 hour in room temperature (about 23 DEG C) subsequently.In non-adsorbed flat board (Nunc#269620), by 100pM or 26pM [ ¹²⁵i]-antigen mix with the object Fab of serial dilution (such as with Prestaetal., CancerRes.57:4593-4599 (1997) in VEGF antibody, the assessment of Fab-12 is consistent).Then by object Fab incubated overnight; But, the sustainable longer time (such as 65 hours) is incubated to ensure to reach balance.After this, mixture is transferred to seizure plate to carry out incubation at room temperature (such as 1 hour).Then remove solution, and wash plate 8 times with the PBS containing 0.1%Tween-20.After dull and stereotyped drying, add 150 μ l/ hole scintillation solution (MicroScint-20; Packard), then in Topcount gamma counter (Packard) to plate count 10 minutes.The concentration selecting each Fab to provide to be less than or equal to maximum combined 20% is for competitive binding assay method.

According to another embodiment, Kd or Kd value uses BIAcore by surperficial plasmon resonance assays ^tM-2000 or BIAcore ^tM-3000 (BIAcore, Inc., Piscataway, NJ) use immobilized antigen CM5 chip to measure about 10 response units (RU) at 25 DEG C.In brief, carboxymethylation dextran biosensor matrix chip (CM5, BIAcoreInc.) is activated according to specification sheets hydrochloric acid N-ethyl-N '-(3-dimethylaminopropyl)-carbodiimide (EDC) of supplier and N-hydroxy-succinamide (NHS).With 10mM sodium acetate pH4.8 by antigen diluent to 5 μ g/ml (about 0.2 μM), be then injected into the coupling protein matter of acquisition about 10 response units (RU) with the flow velocity of 5 μ l/ minutes.After injecting antigen, inject 1M thanomin with closed unreacted group.In order to carry out kinetic measurement, be infused in the Fab (0.78nM to 500nM) of the middle twice serial dilution of PBS (PBST) containing 0.05%Tween-20 at 25 DEG C with the flow velocity of about 25 μ l/ minutes.Simple Lang Gemiaoer (Langmuir) combination model (BIAcoreEvaluationSoftwareversion3.2) is one to one used to be combined and the sensing figure calculations incorporated speed (k that dissociates by matching simultaneously _on) and dissociation rate (k _off).Equilibrium dissociation constant (Kd) is with ratio k _off/ k _oncalculate.See such as Chen, Y., etal., JMolBiol293:865-881 (1999).If according to surperficial plasmon resonance assays above, association rate is more than 10 ⁶m ^-1s ^-1so association rate can use fluorescent quenching technology to measure, namely spectrophotometer (astop-flowequippedspectrophometer) (AvivInstruments) or the middle measurement with stirring cuvette of 8000 serial SLM-Aminco spectrophotometers (ThermoSpectronic) of cut-off device is such as equipped with according to spectrometer, under the condition of antigen that there is increasing concentration, the anti-antigen-antibody of 20nM (Fab form) measured in PBS, pH7.2 (excites=295nm the fluorescent emission intensity of 25 DEG C; Transmitting=340nm, 16nm band is logical) rising or reduction.

According to " association rate " of the present invention (on-rate, rateofassociation, associationrate) or " k _on" also can use BIAcore as mentioned above ^tM-2000 or BIAcore ^tM-3000 systems (BIAcore, Inc., Piscataway, NJ) measure.

" separation " antibody refers to identify and the antibody separating from a kind of composition of its natural surroundings and/or reclaim.The contaminative composition of its natural surroundings refers to disturb the diagnosis of this antibody or the material of therepic use, can comprise the solute of enzyme, hormone and other oroteins character or non-proteinaceous.In preferred embodiments, by antibody purification to (1) mensuration according to Lowry method, antibody weight is more than 95%, most preferably weight is more than 99%, (2) be enough to by using spinning cup sequenator to obtain the N-end of at least 15 residues or the degree of internal amino acid sequence, or (3) are according to the SDS-PAGE under reductibility or non-reducing conditions and use Coomassie blue or preferred Silver stain, reach homogeneity.Since at least one composition of antibody natural surroundings can not exist, the antibody be so separated comprises the antibody iM situ in reconstitution cell.But the antibody of separation will be prepared by least one purification step usually.

Term " marker " is for referring to during this paper and certain molecule (such as nucleic acid, polypeptide or antibody) the directly or indirectly detectable compounds of coupling " process mark/tape label thing " molecule generating or composition.Marker can be self detectable (such as radioisotopic tracer or fluorescent marker), or when enzyme marker, can catalytic substrate compound or composition generation chemically changed, produces detectable product.

" solid phase " means certain molecule, and (such as nucleic acid, polypeptide or antibody can be adhered the non-aqueous base on it.The example of solid phase contained herein comprises those solid phases be partially or completely made up of glass (such as controlled pore glass), polysaccharide (such as agarose), polyacrylamide, polystyrene, polyvinyl alcohol and polysiloxane (silicone).In certain embodiments, according to linguistic context, solid phase can comprise the hole of assay plate; In other embodiments, it refers to purification column (such as affinity column).This term also comprises the discontinuous solid phase of discrete particle, such as U.S. Patent No. 4, and 275, described in 149.

" liposome " refers to be made up of various types of lipid, phosphatide and/or tensio-active agent, can be used for the vesicles to Mammals deliver drugs (such as nucleic acid, polypeptide, antibody, agonist or antagonist).The composition of liposome is arranged in bilayer formation usually, similar to biomembranous lipid arrangement.

" small molecules " or " organic molecule " is defined as molecular weight in this article and is less than about 500 daltonian organic molecules.

" oligopeptides " in conjunction with target polypeptide refers to enough avidity in conjunction with target polypeptide, to make this oligopeptides in target polypeptide, can be used as the oligopeptides of diagnostic reagent and/or therapeutical agent.In certain embodiments, according to the measurement of such as surperficial plasmon resonance assays, the combination degree of the non-target polypeptide of oligopeptides nothing to do with is less than this oligopeptides to about 10% of the combination of target polypeptide.In certain embodiments, oligopeptides with≤1 μM ,≤100nM ,≤10nM ,≤1nM or≤0.1nM dissociation constant (Kd) in conjunction with target polypeptide.

" organic molecule " in conjunction with target polypeptide refers to except oligopeptides as defined herein or antibody, can, with enough avidity in conjunction with target polypeptide, make this organic molecule in target polypeptide, can be used as the organic molecule of diagnostic reagent and/or therapeutical agent.In certain embodiments, according to the measurement of such as surperficial plasmon resonance assays, the combination degree of the non-target polypeptide of organic molecule nothing to do with is less than this organic molecule to about 10% of the combination of target polypeptide.In certain embodiments, organic molecule with≤1 μM ,≤100nM ,≤10nM ,≤1nM or≤0.1nM dissociation constant (Kd) in conjunction with target polypeptide.

" biology system " refers to comprise system in external, the ex vivo of the mammalian cell enjoying common signal pathway or body.

Term " immune correlated disease " refers to the disease being caused, mediate or otherwise facilitate morbidity in Mammals by immune system composition.Also comprise and stimulate or intervene immunne response has improvement result disease to disease progression.This term comprises immune-mediated inflammatory diseases, the inflammatory diseases of nonimmune mediation, transmissible disease, immunodeficient disease and tumorigenesis.

Term " T cell mediation disease " refers to the disease that wherein T cell directly or indirectly mediated or otherwise facilitated Mammals and falls ill.The disease of T cell mediation may be relevant with the effect that cell-mediated effect, lymphokine mediate etc., and even relevant with B cell effect, if B cell is stimulated, such as, is subject to the stimulation of the lymphokine of being secreted by T cell.

When for this paper, term " psoriatic " is defined as (circumscribed) that have scope to limit, discrete and that converge, the micro-illness that is red, the outburst of silver color squamous maculopapule that are characterized as and mainly betide elbow, knee, scalp or trunk.

No matter term " tumour ", for referring to the growth of all neoplastic cells and propagation during this paper, is pernicious or optimum, and before all cancers with the biological cells and tissues of cancer.It is not mutually exclusive when term " cancer ", " carcinous ", " cell proliferative disorders ", " proliferative disorders " and " tumour " are mentioned in this article.

Term " tumor development/progress " refers to growth and/or the propagation of tumour.

Term " cancer " and " carcinous " are pointed to or describe feature in Mammals and be generally the not modulated physiology illness of Growth of Cells/propagation.The example of cancer includes but not limited to cancer, lymphoma (such as He Jiejinshi (Hodgkin) lymphoma and non_hodgkin lymphoma), blastoma, sarcoma and leukemia.The more specifically example of this type of cancer comprises squamous cell carcinoma, small cell lung cancer, nonsmall-cell lung cancer, the gland cancer of lung, the squama cancer of lung, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, carcinoma of the pancreas, glioma, cervical cancer, ovarian cancer, liver cancer (livercancer), bladder cancer, hepatoma (hepatoma), mammary cancer, colorectal carcinoma, the rectum cancer, cancer of the stomach, carcinoma of endometrium or uterus carcinoma, salivary-gland carcinoma, kidney, liver cancer (livercancer), prostate cancer, carcinoma vulvae, thyroid carcinoma, liver cancer (hepaticcarcinoma), leukemia and other lympho-proliferative illness, and various types of head and neck cancer.

" autoimmune conditions " or " autoimmunization (property) " refers to any illness that wherein there occurs body fluid or the cell-mediated immunne response organized for health oneself." IL-23 mediation autoimmune conditions " refers to be caused by IL-23 activity, maintain or any autoimmune conditions of aggravation.

The expansion of " inflammation " finger injury or the leukocytic accumulation of infection site and blood vessel, typically causes pain, swelling and rubescent.

" chronic inflammatory diseases " refers to the reason sustainable existence that causes inflammation and is difficult to the inflammation that maybe can not eliminate.

" autoimmune inflammation " refers to the inflammation relevant with autoimmune conditions.

" arthritic inflammation " refers to the inflammation relevant with sacroiliitis.

" inflammatory bowel " or " IBD " refers to the chronic disease being characterized as gastrointestinal tract inflammation.IBD contains ulcerative colitis, and it affects large intestine and/or rectum, and Crohn disease, and it can affect whole gastro-intestinal system, but more commonly affects small intestine (ileum) and possible large intestine.

The inflammation of " sacroiliitis " articulations digitorum manus, include but not limited to osteoarthritis, gout, infection associated joint inflammation, Lai Teershi (Reiter) syndrome sacroiliitis and the sacroiliitis relevant with autoimmune conditions, such as rheumatoid arthritis, psoriatic arthritis, lupus associated joint inflammation, arthritis vertebralis and scleroderma associated joint are scorching.

Term " significant quantity " refers to the concentration that certain molecule (such as nucleic acid, polypeptide, agonist or antagonist) causes concrete described object to realize or amount." significant quantity " can be determined by rule of thumb." treatment significant quantity " refers to that certain molecule effectively realizes concentration or the amount of described result for the treatment of.This amount also can be determined by rule of thumb.

Term " cytotoxic agent " is suppressing for referring to during this paper or stop cell function and/or cause the material of cytoclasis.This term intention comprises radio isotope (such as I ¹³¹, I ¹²⁵, Y ⁹⁰and Re ¹⁸⁶), the enzyme of chemotherapeutics and toxin such as bacterium, fungi, plant or animal origin lives toxin or its fragment.

" chemotherapeutics " refers to the chemical compound that can be used for Therapeutic cancer.The example of chemotherapeutics comprises Zorubicin (adriamycin), Dx (doxorubicin), epirubicin (epirubicin), 5 FU 5 fluorouracil (5-fluorouracil), cytosine arabinoside (cytosinearabinoside) (" Ara-C "), endoxan (cyclophosphamide), Tespamin (thiotepa), busulfan (busulfan), cytoxin, taxoid (taxoid) is Taxol (paclitaxel) (Taxol such as, Bristol-MyersSquibbOncology, Princeton, and Taxotere (doxetaxel) (Taxotere NJ), Rhone-PoulencRorer, Antony, France), toxotere, methotrexate (methotrexate), cis-platinum (cisplatin), melphalan (melphalan), vinealeucoblastine(VLB) (vinblastine), bleomycin (bleomycin), Etoposide (etoposide), ifosfamide (ifosfamide), ametycin (mitomycinC), mitoxantrone (mitoxantrone), vincristine(VCR) (vincristine), vinorelbine (vinorelbine), carboplatin (carboplatin), teniposide (teniposide), daunomycin (daunomycin), carminomycin (carminomycin), aminopterin-induced syndrome (aminopterin), dactinomycin (dactinomycin), mitomycin (mitomycins), Ai Sibo mycin (esperamicins) (see U.S. Patent No. 4,675,187), melphalan (melphalan) and other relevant mustargen (nitrogenmustards).This definition also comprise act as adjustment or inhibitory hormone to the hormone preparation of the effect of tumour, such as tamoxifen and onapristone.

" growth inhibitor " for referring to during this paper in vitro or T suppression cell in vivo, the especially compound of the growth of cancer cells of any gene that process LAN is identified herein or composition.So, growth inhibitor be significantly reduce be in the S phase process LAN described in the medicament of cell percentages of gene.The example of growth inhibitor comprises and blocks the cell cycle and to advance the medicament of (being in the position beyond the S phase), such as induces the medicament that G1 stagnates and the M phase stagnates.Classical M phase blocker comprises Changchun medicine class (vincas) (vincristine(VCR) (vincristine) and vinealeucoblastine(VLB) (vinblastine)), PTX (taxol) and Topoisomerase II inhibitors such as Dx (doxorubicin), epirubicin (epirubicin), daunorubicin (daunorubicin), Etoposide (etoposide) and bleomycin (bleomycin).Medicaments of those retardances G1 also overflow and enter the S phase and stagnate, such as DNA alkylating agent class such as tamoxifen (tamoxifen), prednisone (prednisone), Dacarbazine (dacarbazine), chlormethine (mechlorethamine), cis-platinum (cisplatin), Rheumatrex (methotrexate), 5 FU 5 fluorouracil (5-fluorouracil) and ara-C.More information can see TheMolecularBasisofCancer, MendelsohnandIsrael compiles, 1st chapter, be entitled as " Cellcycleregulation, oncogenes, andantineoplasticdrugs ", Murakamietal., WBSaunders, Philadelphia (1995), especially the 13rd page.

Term " cytokine " " be discharged by a kind of cell mass, the common name of the protein of another cell mass is acted on as extracellular medium.The example of this type cytokines has lymphokine, monokine and traditional polypeptide hormone.Cytokine comprises tethelin, such as human growth hormone, N-methionyl human growth hormone and Trobest; Parathyroid hormone; Thyroxine; Regular Insulin; Proinsulin; Relaxins; Relaxins is former; Glycoprotein hormone, such as follicle stimulating hormone (FSH), thyrotropic hormone (TSH) and metakentrin (LH); Liver growth factor; Fibroblast growth factor; Prolactin antagonist; Human placental lactogen; Tumor necrosis factor-alpha and-β; Mu Leshi (Mullerian) inhibitory substance; Mouse gonad-stimulating hormone related peptides; Statin; Activator; Vascular endothelial growth factor; Integrin; Thrombopoietin (TPO); Nerve growth factor, such as NGF-β; Thr6 PDGF BB; Transforming growth factor (TGF), such as TGF-α and TGF-β; Insulin like growth factor-1 and-II; Erythropoietin (EPO); Bone-inducing factor (osteoinductivefactor); Interferon, rabbit, such as interferon-' alpha ' ,-β and-γ; G CFS (CSF), such as scavenger cell CSF (M-CSF), granulocyte-macrophage CSF (GM-CSF) and granulocyte CSF (G-CSF); Interleukin (IL), such as IL-1, IL-1 α, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; Tumour necrosis factor, such as TNF-α or TNF-β; And other polypeptide factor, comprise LIF and kit part (KL).When for this paper, term cytokine comprises from natural origin or from the protein of recombinant cell culture thing and the biologic activity equivalent of native sequence cytokines.

When for this paper, term " inflammatory cell " refers to the cell strengthening inflammatory response, such as mononuclearcell, eosinocyte, scavenger cell and polymorphic nucleus neutrophil(e) cell (PMN).

II. the compositions and methods of the invention

a.IL-22 or IL-22R polynucleotide and polypeptide

The invention provides IL-22 or the IL-22R polypeptide of separation and the nucleotide sequence be separated of these polypeptide of coding.IL-22 or IL-22R polypeptide that is that IL-22 or IL-22R polypeptide contains natural total length or maturation and IL-22 or IL-22R variant.IL-22 or IL-22R variant can be changed by importing suitable Nucleotide in IL-22 or IL-22RDNA and/or be prepared by IL-22 or the IL-22R polypeptide that synthesis is expected.Those skilled in the art will understand, and amino acid change may change the post translational processing of IL-22 or IL-22R, such as change number or the position of glycosylation site or change film anchor feature.

As described in this, the variation in natural IL-22 or IL-22R or in each structural domain of IL-22 or IL-22R can be passed through, such as, use any technology and the principle of conservative property and non-conservative mutations, such as U.S. Patent No. 5,364, cited producing in 934.Variation can be substituting, delete or inserting of one or more codons of coding IL-22 or IL-22R, and it causes the change in the aminoacid sequence of IL-22 or IL-22R compared with native sequences IL-22 or IL-22R.Optional, described variation is any other amino acid replacement of at least one amino acid in one or more structural domains of IL-22 or IL-22R.Determine which amino-acid residue can be inserted into, substitute or delete and can not adversely affect and expect that active guidance can be minimized in the number that the aminoacid sequence that carries out in high homology region changes be found by the sequence of the known protein molecular of the sequence and homology that compare IL-22 or IL-22R.Amino acid replacement can be the result that an amino acid is replaced with another amino acid with analog structure and/or chemical property, such as replaces leucine with Serine, that is, conservative amino acid is replaced.Inserting or delete can optionally in about 1 to 5 amino acid whose scope.By systematically producing amino acid whose insertion, deletion in the sequence or substituting and the activity represented by total length or ripe native sequences the mutation testing produced, the variation of allowing can be determined.

In certain embodiments, interested conservative property substitutes and shows under preferred alternative gauge outfit in table 6.Substitute if this change causing biologic activity, so introduce more substantial change, in table 6, be called that illustration substitutes, or hereafter amino acid classes is further described, and screen product.

Table 6

Substance in the function of IL-22 or IL-22R polypeptide or immunology identity modify by select keep following in effect on significantly different alternative come: the structure of the polypeptide backbone of (a) replacement area, such as pleated sheet or helical conformation, the electric charge of (b) target site punishment or hydrophobicity, or the volume of (c) side chain.Based on common side chain properties, residue can be there is divide into groups natural as follows:

(1) hydrophobic: nor-leucine, met, ala, val, leu, ile;

(2) neutral, hydrophilic: cys, ser, thr;

(3) acid: asp, glu;

(4) alkalescence: asn, gln, his, lys, arg;

(5) residue of chain orientation is affected: gly, pro; With

(6) aromatic: trp, tyr, phe.

Non-conservation substitutes the member needing to exchange these one of classifications or other classifications.

This alternative residue also can be imported into conservative property alternate site, or preferred, imports remaining (non-conservation) site.

Methods known in the art can be used to produce variation, such as can carry out oligonucleotide mediated (fixed point) mutagenesis, Alanine-scanning and PCR mutagenesis to the DNA of clone.Site-directed mutagenesis [Carteretal., Nucl.AcidsRes., 13:4331 (1986); Zolleretal., Nucl.AcidsRes., 10:6487 (1987)], cassette mutagenesis [Wellsetal., Gene, 34:315 (1985)], restricted selection mutagenesis [Wellsetal., Philos.Trans.R.Soc.LondonSerA, 317:415 (1986)] or other known technology produce IL-22 or IL-22R modification D NA.

IL-22 or IL-22R polypeptide fragment is additionally provided at this.These fragments in N-end or the brachymemma of C-end, maybe can lack internal residues, such as, when compared with total length natural protein.Some fragment lacks for the non-key amino-acid residue of the expectation biologic activity of IL-22 or IL-22R polypeptide.Thus, in certain embodiments, the fragment of IL-22 or IL-22R has biologic activity.In certain embodiments, the fragment of total length IL-22 lacks N-distal tip signal peptide sequence.In certain embodiments, the fragment of total length IL-22R is the soluble form of IL-22R, and it is not membrane-bound, such as, lacks the form of the IL-22R of membrane spaning domain.Such as, the soluble form of mankind IL-22R can lack the membrane spaning domain of all or substantial portions of the about amino acid 229-251 of SEQIDNO:3.

The covalent modification of IL-22 or IL-22R is included within the scope of the invention.The covalent modification of one type comprises makes the Target amino acid Residue of IL-22 or IL-22R polypeptide and organic derivatization reagent react, and described reagent can react with the selected side chain of IL-22 or IL-22R or N-or C-terminal residue.Use bifunctional reagent derivatize to be useful, such as, be cross-linked to water-insoluble supported matrix or surface for by IL-22 or IL-22R, for the method for anti-IL-22 or the IL-22R antibody of purifying, vice versa.Normally used linking agent comprises; such as; 1; the ester of 1-bis-(diazonium ethanoyl)-2-phenylethane, glutaraldehyde, N-hydroxy-succinamide ester such as 4-azidosalicylic acid, comprise double amber imide ester such as 3 with difunctional imido-ester; 3 '-dithio two (succinyl phosphorons amino propyl acid ester), difunctional maleimide such as two-N-dimaleoyl imino-1,8-octanes and reagent is 3-[(p-azidophenyl) dithio] imino-methyl propionate such as.

Other are modified and comprise glutaminyl and the asparaginyl residues desamidation respectively to corresponding glutamy and aspartyl residue, the hydroxylation of proline(Pro) and Methionin, the phosphorylation of the hydroxyl of seryl or threonyl residues, Methionin, [the T.E.Creighton that methylates of the α amino of arginine and histidine side chains, Proteins:StructureandMolecularProperties, W.H.Freeman & Co., SanFrancisco, pp.79-86 (1983)], the acetylize of N-terminal amine and the amidation of any C-terminal carboxyl(group).

The another kind of covalent modification comprising IL-22 or IL-22R polypeptide within the scope of the invention comprises the native glycosylation pattern changing polypeptide." change natural glycosylation pattern " at these one or more carbohydrate moiety meaning to find in deletion native sequences IL-22 or IL-22R (by removing the glycosylation site on basis, or pass through method deletion glycosylation that is chemical and/or zymetology), and/or add non-existent one or more glycosylation site in native sequences IL-22 or IL-22R.In addition, this term is included in the qualitative change of the glycosylation aspect of natural protein, is included in the character of the various carbohydrate moiety of existence and the change of ratio aspect.

IL-22 or IL-22R polypeptide of the present invention also can be modified to form chimeric molecule in a certain way, and it comprises IL-22 or IL-22R merged with another heterologous polypeptide or aminoacid sequence.In one embodiment, chimeric molecule comprises the fusions of IL-22 or IL-22R and tag polypeptide, and this tag polypeptide provides anti-tag antibody can the epi-position of selective binding.Epitope tag is generally placed in amino or the C-terminal of IL-22 or IL-22R.The existence of the form of this band epitope tag of IL-22 or IL-22R can use the antibody for described tag polypeptide to detect.Further, epitope tag is provided to make IL-22 or IL-22R can easily by using anti-tag antibody or other affinity purification in conjunction with the affinity matrix of epitope tag to carry out purifying.Various tag polypeptide and their corresponding antibody are well known in the art.Example comprises polyhistidyl (poly-his) or polyhistidyl-glycine (poly-his-gly) label; Influenza HA tag polypeptide and its antibody 12CA5 [Fieldetal, Mol.Cell.Biol, 8:2159-2165 (1988)]; C-myc label and its antibody 8F9,3C7,6E10, G4, B7 and 9E10 [Evanetal., MolecularandCellularBiology, 5:3610-3616 (1985)]; And HSV gD (gD) label and its antibody [Paborskyetal., ProteinEngineering, 3 (6): 547-553 (1990)].Other tag polypeptide comprises Flag peptide [Hoppetal., BioTechnology, 6:1204-1210 (1988)]; KT3 epitope peptide [Martinetal., Science, 255:192-194 (1992)]; Alpha-tubulin epitope peptide [Skinneretal., J.Biol.Chem., 266:15163-15166 (1991)]; With T7 gene 10 protein peptide tag [Lutz-Freyermuthetal, Proc.Natl.Acad.Sci.USA, 87:6393-6397 (1990)].

In another embodiment, chimeric molecule can comprise the fusions of the specific region of IL-22 or IL-22R polypeptide and immunoglobulin (Ig) or immunoglobulin (Ig).For the chimeric molecule (also referred to as " immunoadhesin ") of bivalent form, this fusions can be the Fc district of IgG molecule.IL-22 or the IL-22R polypeptide that Ig fusions preferably comprises soluble form replaces substituting of Ig molecule at least one variable region interior.In an especially preferred embodiment, immunoglobulin fusions comprises hinge, CH2 and CH3 of IgG1 molecule, or hinge, CH1, CH2 and CH3 district.About immunoglobulin fusions production also see June 27 nineteen ninety-five authorize U.S. Patent No. 5,428,130.

1.IL-22 or the preparation of IL-22R

The preparation of IL-22 or IL-22R by conventional recombination method, such as, can cultivate the vector of nucleic acid or the cell of transfection with containing coding IL-22 or IL-22R, illustrated in described nucleic acid nucleic acid as shown in Figure 1, its IL-22 that encodes.Additionally provide the host cell comprising any such carrier.For example, host cell can be Chinese hamster ovary celI, intestinal bacteria or yeast.Further provide the method for producing any polypeptide described here, cultivate host cell under being included in the condition being suitable for expressing the polypeptide expected, and reclaim the polypeptide expected from cell culture.

In other embodiments, the invention provides chimeric molecule, it comprises the polypeptide any described here merging and have heterologous polypeptide or aminoacid sequence.The example of this chimeric molecule comprises the polypeptide any described here merging and have epitope tag sequence or immunoglobulin fc region.

Certainly, contemplate selectable method well known in the art also can be used to prepare IL-22 or IL-22R.Such as, IL-22 or IL-22R sequence or its part can produce by utilizing the direct peptide of solid phase technique to synthesize [see, such as Stewartetal., Solid-PhasePeptideSynthesis, W.H.FreemanCo., SanFrancisco, CA (1969); Merrifield, J.Am.Chem.Soc, 85:2149-2154 (1963)].Artificial technology can be utilized or carry out protein synthesis in vitro by automatization.For example, AppliedBiosystems peptide synthesizer (FosterCity, CA) can be utilized to utilize the explanation of manufacturer to realize Fully automated synthesis.The various piece of chemosynthesis IL-22 or IL-22R described herein can be distinguished, utilize Combination of Methods that is chemical or zymetology to produce total length IL-22 or IL-22R.

Recombinant expressed IL-22 or IL-22R can reclaim from substratum or from host cell lysate.Following code is the demonstration of applicable purifying code: the classification on ion exchange column; Alcohol settling; Reversed-phase HPLC; Chromatography on tripoli or on Zeo-karb such as DEAE; Chromatofocusing; SDS-PAGE; Ammonium sulfate precipitation; Utilize the gel-filtration of such as SephadexG-75; Albumin A Sepharsoe post is to remove pollutent such as IgG; With the form of metal chelating column in conjunction with the band epitope tag of described IL-22 or IL-22R.Can use the various methods of protein purification, such method is known in the art, at such as Deutscher, MethodsinEnzvmology, and 182 (1990); Scopes, ProteinPurification:PrinciplesandPractice, Springer-Verlag, NewYork have description in (1982).The purification step selected will depend on, such as, and the character of the production method of employing, and specific IL-22 or IL-22R produced.

2. the detection of genetic expression

The expression of the gene of coding IL-22 or IL-22R can be detected by the various methods of this area, such as, by detecting the expression of the mRNA of coding IL-22 or IL-22R.As used herein, term " detection " is contained quantitative or is detected qualitatively.By detecting IL-22 or IL-22R genetic expression, people can identify those tissues of such as expressing IL-22 or IL-22R gene.Genetic expression can use some method well known by persons skilled in the art to measure, such as, and Northern trace (Thomas, Proc.Natl.Acad.Sci.USA, 77:5201-5205 [1980]); Quantitative PCR; Or utilize according to the in situ hybridization at the probe of the suitable mark of this sequence provided.Alternatively, genetic expression can be measured by immunologic method, such as to the immunohistochemical staining of tissue slice, and the analysis to cell culture or body fluid, directly measure the expression of gene product.To the immunohistochemical staining of sample liquids and/or analyze useful antibody and be encompassed in this any antibody provided.Easily, antibody can for the native sequences of IL-22 or IL-22R polypeptide; For the synthetic peptide of fragment comprising IL-22 or IL-22R peptide sequence; Or prepare for the exogenous array (comprising synthetic peptide) merged to IL-22 or IL-22R polypeptide or its fragment.

b antibody

Provide the antibody in conjunction with any above-mentioned or following polypeptide.In one embodiment, the antibody of the separation in conjunction with IL-19, IL-20, IL-22, IL-24, IL-20Ra, IL-20Rb, IL-10R2 or IL-22R polypeptide is provided.Exemplary antibody comprises antibody that is polyclonal, monoclonal, humanized, people, dual specific and Heteroconjugate.Antibody can be antibody fragment, such as Fab, Fab '-SH, Fv, scFv or (Fab ') 2 fragment.In one embodiment, the antibody of the separation in conjunction with IL-22 or IL-22R is provided.In such embodiment, antibody moiety or the activity (i.e. " barrier " antibody) that blocks IL-22 or IL-22R polypeptide completely.

Provide the exemplary monoclonal antibody in conjunction with IL-22 and IL-22R herein, further describe in an embodiment.Those antibody comprise anti-IL-22 antibody, be called 3F11.3 (" 3F11 "), 11H4.4 (" 11H4 ") and 8E11.9 (" 8E11 "), and anti-IL-22R antibody, be called 7E9.10.8 (" 7E9 "), 8A12.32 (" 8A12 "), 8H11.32.28 (" 8H11 ") and 12H5.In one embodiment, the hybridoma generating those antibody any is provided.In one embodiment, the monoclonal antibody of to compete IL-22 with 3F11.3,11H4.4 or 8E11.9 and being combined is provided.In another embodiment, provide and 3F11.3,11H4.4 or 8E11.9 monoclonal antibody antibody in conjunction with identical epi-position.In another embodiment, the monoclonal antibody of to compete IL-22R with 7E9,8A12,8H11 or 12H5 and being combined is provided.In one embodiment, provide and 7E9,8A12,8H11 or 12H5 monoclonal antibody in conjunction with identical epi-position.Provided hereinafter the various embodiments of antibody:

1. polyclonal antibody

Antibody can comprise polyclonal antibody.Method for the preparation of polyclonal antibody is well known by persons skilled in the art.Polyclonal antibody can generate in Mammals, such as, by the agent of one or many injecting immune and adjuvant as required.Usually, immunizing agent and/or adjuvant will be expelled in Mammals by repeatedly subcutaneous or peritoneal injection.Immunizing agent can comprise polypeptide of interest or its fusion rotein.By immunizing agent and knownly have immunogenic protein molecule may be useful in institute's immunising mammals.The example of this type of immunogenic protein includes but not limited to Shi Kong Wei hemocyanin, serum albumin, bovine thyroglobulin and Trypsin inhibitor SBTI.The example of adoptable adjuvant comprises Freund's complete adjuvant and MPL-TDM adjuvant (the trehalose dicorynomycolate of monophosphoryl lipid A, synthesis).Immunization protocol can be made a choice without the need to too much testing by those skilled in the art.

2. monoclonal antibody

Or antibody can be monoclonal antibody.Monoclonal antibody can use hybridoma to prepare, described in such as KohlerandMilstein, Nature256:495 (1975).In hybridoma, mouse, hamster or other suitable host animal maybe can generate the lymphocyte of the antibody of specific binding immunizing agent to cause to generate with immunizing agent immunity usually.Or, can immunological lymphocyte in vitro.

Immunizing agent will generally include polypeptide of interest or its fusion rotein.Usually, or use peripheral blood lymphocyte (" PBL "), if wish the cell that people originates from, or use splenocyte or lymphocytic nodal cell, if wish non-human mammalian sources.Then, use suitable fusogen, such as polyoxyethylene glycol, lymphocyte and immortalized cell line are merged to form hybridoma (Goding, MonoclonalAntibodies:PrinciplesandPractice, AcademicPress (1986), pp.59-103).The myeloma cell that the mammalian cell that immortalized cell line normally transforms, particularly rodents, ox and people originate from.Usually, rat or mouse myeloma cell line is adopted.Hybridoma can be cultivated in suitable substratum, and described substratum is preferably containing the immortalized cells growth suppressing not merge or one or more materials of surviving.Such as, if parental cell lacks enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), substratum so for hybridoma usually will containing xanthoglobulin, aminopterin-induced syndrome and thymidine (" HAT substratum "), and these materials stop the growth of HGPRT deficient cells.

Preferred immortalized cell line is that those efficiently merge, support the high-caliber expression antibody that selected antibody-producting cell is stable and clone to substratum sensitivities such as such as HAT substratum.Preferred immortalized cell line is mouse source myelomatosis system, can from such as Sol gram institute cell distribution center (SalkInstituteCellDistributionCenter, SanDiege, and American type culture collection (AmericanTypeCultureCollection California), Manassas, Virginia) obtain.Human myeloma and mouse-people's heteromyeloma cell lines for generating human monoclonal antibodies are also existing describes (Kozbor, J.Immunol.133:3001 (1984); Brodeuretal., MonoclonalAntibodyProductionTechniquesandApplications, MarcelDekker, Inc., NewYork (1987) pp.51-63).

Then the substratum can cultivated wherein hybridoma measures the existence in conjunction with the monoclonal antibody of polypeptide of interest.Preferably, by immunoprecipitation or by external binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA), measure the binding specificity of the monoclonal antibody generated by hybridoma.This type of technology and assay method are known in the art.The binding affinity of monoclonal antibody is analyzed by the Scatchard of such as MunsonandPollard, Anal.Biochem.107:220 (1980) and is measured.

Obtain the hybridoma expected in qualification after, this clone carries out subclone by limiting dilution flow process, and is undertaken cultivating (Goding sees above) by standard method.The substratum being suitable for this purpose comprises EagleShi substratum and the RPMI-1640 substratum of such as DulbeccoShi improvement.Or hybridoma can carry out culturing in vivo as ascites in Mammals.

By conventional immune globulins purifying flow process, such as such as albumin A-Sepharose, hydroxyapatite, gel electrophoresis, dialysis or affinity chromatography, from the monoclonal antibody that substratum or ascites isolated or purified subclone are secreted.

By using combinatorial libraries screening to have, monoclonal antibody can expect that active antibody creates.Such as, this area is known for generating phage display library and this type of library screening being had to the multiple method of antibody of required binding characteristic.These class methods are general is recorded in Hoogenboometal. (2001) in MethodsinMolecularBiology178:1-37 (O ' Brienetal., ed., HumanPress, Totowa, NJ), some embodiment and in Leeetal. (2004) J.MoI.Biol.340:1073-1093.

In principle, select synthetic antibody to clone by screening phage library, described phage library contains the phage of showing and merging to various antibody variable regions (Fv) fragment of bacteriophage coat protein.By this type of phage library of affinity chromatography elutriation for required antigen.Expression can be adsorbed to antigen in conjunction with the clone of the Fv fragment of required antigen, thus separates with uncombined clone in library.Then combining clone is from wash-out antigen, and can by the extra further enrichment of Antigen adsorption/elution cycles.Any antibody of the present invention can obtain as follows, namely suitable antigen selection code is designed to select interested phage clone, then the Fv sequence from interested phage clone and Kabatetal. is used, SequencesofProteinsofImmunologicalInterest, FifthEdition, NIHPublication91-3242, BethesdaMD (1991), suitable constant region (Fc) the sequence construct full length antibody clone recorded in vols.1-3.

Monoclonal antibody also generates by recombinant DNA method, such as U.S. Patent No. 4, and 816, described in 567.The DNA of code book invention monoclonal antibody is easy to use old process to be separated and the order-checking oligonucleotide probe of gene of specific binding coding mouse source heavy chain of antibody and light chain (such as use can).Hybridoma of the present invention is the preferred source of this type of DNA.Once be separated, DNA can be placed in expression vector, then this expression vector is transfected in the host cell not producing immunoglobulin (Ig) protein in addition, such as Simian COS cells, Chinese hamster ovary (CHO) cell or myeloma cell, to obtain the synthesis of monoclonal antibody in recombinant host cell.All right modifying DNA, such as, by substituting, namely the encoding sequence of employment heavy chain and constant region of light chain replaces homology mouse source sequence (U.S. Patent No. 4,816,567; Morrisonetal., see above), or the encoding sequence all or in part of immunoglobulin coding sequence and NIg polypeptide is engaged by covalency.This type of NIg polypeptide available substitutes the constant domain of antibody of the present invention, or the variable domain of an antigen binding site of its alternative antibody of the present invention available is to produce chimeric bivalent antibody.

3. univalent antibody

Additionally provide univalent antibody.Method for the preparation of univalent antibody is well-known in the art.Such as, a kind of method involves the recombinant expressed of the heavy chain of light chain immunoglobulin and process modification.Heavy chain is by brachymemma, and any point generally in Fc district, is cross-linked in order to prevent heavy chain.Or relevant cysteines residue is substituted by another amino-acid residue or deleted, in order to prevent to be cross-linked.

In vitro method is also suitable for preparing univalent antibody.Digestion antibody is to generate its fragment, and particularly Fab fragment, the routine techniques that this area can be used to know realizes.

4. antibody fragment

Additionally provide antibody fragment.Antibody fragment can pass through traditional means, such as enzymatic digestion, or is generated by recombinant technology.In some cases, antibody fragment is used to have superiority, instead of complete antibody.The reduced size of fragment allows quick removing, and can cause being easier to close to solid tumor.About the summary of some antibody fragment see Hudsonetal. (2003) Nat.Med.9:129-134.

The multiple technologies for generating antibody fragment are developed.Traditionally, these fragments derivative are carried out (see such as Morimotoetal., JournalofBiochemicalandBiophysicalMethods24:107-117 (1992) by proteolytic digestion complete antibody; Brennanetal., Science229:81 (1985)).But, directly can generate these fragments by recombinant host cell now.Fab, Fv and scFv antibody fragment all at expression in escherichia coli and by E. coli secretion, so can be allowed and is easy to generate these a large amount of fragments.Can from phage antibody library discussed above isolated antibody fragment.Or, directly can reclaim Fab '-SH fragment chemical coupling to form F (ab ') from intestinal bacteria ₂fragment (Carteretal., Bio/Technology10:163-167 (1992)).According to another kind of method, directly F (ab ') can be separated from recombinant host cell culture ₂fragment.Comprise salvage receptor binding epitope residue, there is Fab and F (ab ') of the Half-life in vivo of prolongation ₂fragment is recorded in U.S. Patent No. 5, and 869,046.Other technology for generating antibody fragment will be apparent for skilled practitioner.In certain embodiments, antibody is Single-Chain Fv Fragment of Murine (scFv).See WO93/16185; U.S. Patent No. 5,571,894; And 5,587,458.Fv and scFv is the unique type having entire binding site, lack constant region; So, non-specific binding is reduced when they may be suitable for using in vivo.ScFv fusion rotein can be built to generate the amino of effector protein at scFv or the fusion of C-terminal.Compile see AntibodyEngineering, Borrebaeck, see above.Antibody fragment can also be " linear antibodies ", such as, as U.S. Patent No. 5, and 641, described in 870.This type of linear antibodies can be monospecific or dual specific.

5. humanized antibody

Additionally provide humanized antibody.This area is known for by humanized for non-human antibody multiple method.Such as, humanized antibody can have one or more amino-acid residue introduced from inhuman source.These non-human amino acid residues are often referred to as " input " residue, variable domain that they are typically taken from " input ".Humanization substantially can be followed the method for Winter and colleague thereof and carry out (Jonesetal. (1986) Nature321:522-525; Riechmannetal. (1988) Nature332:323-327; Verhoeyenetal. (1988) Science239:1534-1536), by substituting the corresponding sequence of people's antibody with hypervariable region sequence.Therefore, this type of " humanization " antibody is chimeric antibody (U.S. Patent No. 4,816,567), is wherein substantially less than the corresponding sequence of whole people's variable domain from non-human species and substitutes.In practice, humanized antibody typically people's antibody of substituting with the residue from site similar in rodent antibodies of some of them some hypervariable region residues and some possible FR residues.

For building the selection of people's variable domain of humanized antibody, comprising light chain and heavy chains, can be important for reduction antigenicity.According to so-called " the suitableeest " (best-fit) method, screen with the whole library of the known people's variable domain sequence of the variable domain sequence pair of rodent antibodies.Then select and people's framework region (Simsetal. (1993) J.Immunol.151:2296 of the immediate human sequence of rodents sequence as humanized antibody; Chothiaetal. (1987) J.Mol.Biol.196:901).Another kind method uses by the derivative specific frame district of the consensus sequence of everyone antibody of specific light chain or heavy chain subgroup.Same framework can be used for several different humanized antibodies (Carteretal. (1992) Proc.Natl.Acad.Sci.USA89:4285; Prestaetal. (1993) J.Immunol.151:2623).

Generally wish that antibody keeps high-affinity to antigen and other favourable biological characteristics after humanization.In order to realize this goal, according to a kind of method, prepare humanized antibody by the method using the three-dimensional model of parent and humanized sequence to analyze parental array and various conceptual humanized products.Three dimensional immunoglobulin model is that the public is obtainable and be familiar with by those skilled in the art.The computer program of the possible three-dimensional conformation structure of diagram and the selected candidate immunoglobulin sequences sequence of display can be obtained.Check that these display images are allowed and analyze residue may act in candidate immunoglobulin sequences sequence functionating, namely analyzing influence candidate immunoglobulin sequences is in conjunction with the residue of the ability of its antigen.Like this, can FR residue be selected from acceptor and list entries and combine, thus obtain the antibody characteristic expected, such as the avidity of target antigen be improved.Generally speaking, some hypervariable region residues directly and most essence relate to the impact that antigen is combined.

6. people's antibody

Additionally provide people's antibody.People's antibody can be selected from people's charon phages and shows that the Fv in storehouse clones variable domain sequence and known people's constant domain sequence and builds by combining as mentioned above.Or, human monoclonal antibodies of the present invention can be generated by hybridoma method.Human myeloma and mouse-people's heteromyeloma cell lines for generating human monoclonal antibodies are on the books, such as KozborJ.Immunol., 133:3001 (1984); Brodeuretal., MonoclonalAntibodyProductionTechniquesandApplications, pp.51-63 (MarcelDekker, Inc., NewYork, 1987); And Boerneretal., J.Immunol., 147:86 (1991).

Such as, the transgenic animal (such as mouse) lacking and can give birth to human antibodies's full repertoire when endogenous immunoglobulin generates in immunity afterwards are likely created on now.Such as, the suppression completely of deleting and causing endogenous antibody tormation of isozygotying of antibody heavy chain joining region (JH) gene in chimeric and germ line mutant mice has been described.In this type of germ line mutant mice, shift a large amount of human germline immunoglobulin's gene will cause raw human antibodies after antigen is attacked.See such as Jakobovitsetal., Proc.Natl.Acad.Sci.USA90:2551 (1993); Jakobovitsetal., Nature362:255-258 (1993); Bruggermannetal., YearinImmunol.7:33 (1993).

Gene shuffling also can be used for deriving people's antibody from inhuman (such as rodents) antibody, and wherein people's antibody has the avidity similar to starting non-human antibody and specificity.According to this method, it is also referred to as " the epi-position marking " (epitopeimprinting), heavy chain or the variable region of light chain employment V domain gene complete or collected works of the non-human antibody fragment obtained by display technique of bacteriophage as described herein are replaced, and produce non-human chain-human chain scFv or Fab block polymer group.Non-human chain/human chain is caused to be fitted together to the separation of scFv or Fab with the selection that antigen carries out, wherein human chain has recovered antigen binding site eliminate corresponding non-human chain in one-level phage display clone after, the i.e. selection of Epitopic determinants (marking, imprint) human chain mating partner.When repeating this process to replace the non-human chain of residue, obtain people's antibody (see PCTWO93/06213, being disclosed on April 1st, 1993).From traditional to transplant the humanization of the non-human antibody carried out by CDR different, this technology provides the antibody of complete people, and they are containing FR or the CDR residue of non-human origins.

7. bi-specific antibody

Additionally provide bi-specific antibody.Bi-specific antibody refer to at least two kinds not synantigen there is the monoclonal antibody of binding specificity.In certain embodiments, bi-specific antibody is people's antibody or humanized antibody.In certain embodiments, one of binding specificity is for interested polypeptide, and another of binding specificity is for other antigen any.In certain embodiments, bi-specific antibody can in conjunction with two of interested polypeptide kind of different epi-position.Bi-specific antibody also can be used for the cell being positioned by cytotoxic agent to express polypeptide of interest such as cell surface polypeptide.These antibody have TAT226 brachium conjunctivum and the arm in conjunction with cytotoxic agent (such as such as saporin, anti-interferon-α, vinca alkaloids, ricin A chain, Rheumatrex or radioactive isotope hapten).Bi-specific antibody can be prepared into full length antibody or antibody fragment (such as F (ab ') ₂bi-specific antibody).

Known in the art for building the method for bi-specific antibody.Traditional, the recombinant production of bi-specific antibody is based on the coexpression of two pairs of heavy chain immunoglobulin-light chains, and wherein two kinds of heavy chains have different specificitys (MillsteinandCuello, Nature305:537 (1983)).Due to the random assignment of heavy chain immunoglobulin and light chain, these hybridomas (four source hybridomas (quadroma)) generate the potential mixture of 10 kinds of different antibodies molecules, wherein only have a kind ofly to have correct bispecific structure.The purifying of the correct molecule usually undertaken by affinity chromatography step quite bothers and Product yields is low.Similar code is disclosed in WO93/08829 and Trauneckeretal. announced on May 13rd, 1993, EMBOJ.10:3655 (1991).

According to a kind of different way, antibody variable domains and the immunoglobulin (Ig) constant domain sequence will with expectation binding specificity (antibody-antigene binding site) merge.Such as, with comprise at least part of hinge, the heavy chain immunoglobulin constant domain in CH2 and CH3 district merges.In certain embodiments, at least one fusions, existence comprises first CH (CH1) of light chain in conjunction with necessary site.By encode immunoglobulin heavy fusions and, when needed, the DNA of light chain immunoglobulin inserts expression vector separately, and cotransfection is in suitable host organisms.There is provided in the embodiment of optimum yield when the three peptide species chain ratios for building do not wait, this is that the mutual ratio of adjustment three peptide species fragment provides great handiness.But, when at least two peptide species chains cause high yield with same ratio expression or when there is no special meaning in this ratio, likely the encoding sequence of two kinds or all three peptide species chains is inserted an expression vector.

In an embodiment of the method, bi-specific antibody is by a hybrid immunoglobulin heavy chain arm with the first binding specificity, and the hybrid immunoglobulin heavy chain-light chain on another arm is formed (providing the second binding specificity).Due to the separating pathway that the existence of light chain immunoglobulin only in half bispecific molecule is provided convenience, therefore find that this unsymmetrical structure is convenient to the bispecific compound expected to separate with undesired immunoglobulin chain combinations.The method is disclosed in WO94/04690.About generating the further details of bi-specific antibody see such as Sureshetal., MethodsinEnzymology121:210 (1986).

According to another kind of method, the interface between a pair antibody molecule can be transformed, maximize with the per-cent of the heterodimer will reclaimed from recombinant cell culture thing.Interface comprises at least part of antibody constant territory CH3 structural domain.In the method, one or more p1 amino acid side chain larger side chains (such as tyrosine or tryptophane) of first antibody molecular interface are replaced.By by comparatively p1 amino acid side chain (such as L-Ala or the Threonine) replacement of large amino acid side chain, the interface of second antibody molecule produces compensatory " cavity " with the same or similar size of bulky side chain.This provide and improve the mechanism of heterodimer output than other undesired end product such as homodimer.

Bi-specific antibody comprises crosslinked or " Heteroconjugate " antibody.Such as, a kind of antibody in Heteroconjugate thing can coupling, another kind of antibody and vitamin H coupling plain with affinity.Such as, this antibody-like has been proposed to be used in undesired for immune system cell target cell (U.S. Patent No. 4,676,980), and is used for the treatment of HIV (WO91/00360, WO92/00373 and EP03089).Any cross-linking method easily can be used to prepare Heteroconjugate antibodies.Suitable linking agent is well-known in the art, is disclosed in U.S. Patent No. 4,676,980 together with many crosslinking technologicals.

The technology being generated bi-specific antibody by antibody fragment is also described in document.Such as, chemistry can be used to connect and prepare bi-specific antibody.Brennanetal., Science229:81 (1985) describes by proteolysis cutting complete antibody to generate F (ab ') ₂the code of fragment.These fragments are reduced when existence two mercaptan complexing agent sodium arsenite, prevents the formation of intermolecular disulfide bond with two mercaptan of stable vicinity.Then Fab ' the fragment produced is changed into thionitrobenzoate ester (TNB) derivative.Then one of Fab '-TNB derivative is reverted to Fab '-mercaptan again by the reduction of mercaptoethylamine, and mix, to form bi-specific antibody with the another kind of Fab '-TNB derivative of equimolar amount.The bi-specific antibody produced can be used as the selectivity immobilized reagent of enzyme.

Most new progress is convenient to directly reclaim Fab '-SH fragment from intestinal bacteria, these fragments can chemical coupling to form bi-specific antibody.Shalabyetal., J.Exp.Med.175:217-225 (1992) describes the bi-specific antibody F (ab ') of full-length human ₂the generation of molecule.By intestinal bacteria separately secretion often kind of Fab ' fragment, and carry out directed chemical coupling in vitro to form bi-specific antibody.The bi-specific antibody of formation like this in conjunction with the cell of process LAN HER2 acceptor and normal human T cells, and can trigger the lytic activity of people's cytotoxic lymphocyte for people's lacteal tumor target thing.

Also describe and directly generate and the multiple technologies being separated bispecific antibody fragment from recombinant cell culture thing.Such as, leucine zipper has been used to generate bi-specific antibody.Kostelnyetal.，J.Immunol.148(5)：1547-1553(1992)。Leucine zipper peptide from Fos with Jun albumen is connected with the Fab ' part of two kinds of different antibodies by gene fusion.Antibody homodimer, is then oxidized to form antibody heterodimer to form monomer in hinge area reduction again.This method also can be used for generating antibody homodimer.Hollingeretal., " double antibody " technology that Proc.Natl.Acad.Sci.USA90:6444-6448 (1993) records provides the replacement mechanism building bispecific antibody fragment.This fragment comprises the heavy chain variable domain (VH) and light-chain variable domain (VL) that are connected by joint, and described joint too short making can not be matched between on same chain two structural domains.Therefore, force complementary VL and the VH structural domain in VH and the VL structural domain in a fragment and another fragment to match, form two antigen binding sites thus.There was reported the another kind strategy by using scFv (sFv) dimer to build bispecific antibody fragment.See Gruberetal., J.Immunol.152:5368 (1994).

Contemplate the antibody having and tire more than two.Such as, three-specific antibody can be prepared.Tuttetal.，J.Immunol.147：60(1991)。

8. multivalent antibody

Additionally provide multivalent antibody.Multivalent antibody can be subject to the internalization (and/or alienation) of the cell of expressing this antibody institute conjugated antigen faster than bivalent antibody.Antibody of the present invention can be to be easy to multivalent antibody that generated by the recombinant expressed of the nucleic acid of encode antibody polypeptides chain, that have three or more antigen binding site (such as tetravalent antibody) (beyond IgM classification).Multivalent antibody can comprise dimerization domain and three or more antigen binding site.In certain embodiments, dimerization domain comprises (or consisting of) Fc district or hinge area.In this case, antibody will comprise the aminoterminal three or more antigen binding site in Fc district and Fc district.In certain embodiments, multivalent antibody comprises (or consisting of) three to about eight antigen binding sites.In such embodiment, multivalent antibody comprises (or consisting of) four antigen binding sites.Multivalent antibody comprises at least one polypeptide chain (such as two polypeptide chains), and wherein said polypeptide chain comprises two or more variable domain.Such as, polypeptide chain can comprise VD1-(X1) n-VD2-(X2) n-Fc, and wherein VD1 is the first variable domain, and VD2 is the second variable domain, and Fc is a polypeptide chain in Fc district, X1 and X2 represented amino acid or polypeptide, and n is 0 or 1.Such as, polypeptide chain can comprise: VH-CH1-flexible joint-VH-CH1-Fc district chain; Or VH-CH1-VH-CH1-Fc district chain.Multivalent antibody herein can comprise at least two (such as four) light chain variable domain polypeptides further.Multivalent antibody herein can comprise such as about two to about eight light chain variable domain polypeptides.The light chain variable domain polypeptide imagined herein comprises light-chain variable domain, and optionally comprises CL structural domain further.

9. single domain antibody

Additionally provide single domain antibody.Single domain antibody comprises the heavy chain variable domain all or in part of antibody or the Single polypeptide chain of variable region of light chain all or in part.In certain embodiments, single domain antibody is people's single domain antibody (Domantis, Inc., Waltham, MA; See such as U.S. Patent No. 6,248,516B1).In one embodiment, single domain antibody is made up of heavy chain of antibody variable domain all or in part.

10. antibody variants

In some embodiment, contemplate the amino acid sequence modifications of antibody described herein.Such as, the binding affinity and/or other biological characteristics that improve antibody may be wished.The amino acid sequence variation of antibody can by introducing the nucleotide sequence of encoding antibody by suitable change or being prepared by peptide symthesis.This type of is modified the residue comprised in such as antibody amino acids sequence and deletes and/or insert and/or substitute.Any deletion, insertion and alternative combinations can be carried out to obtain final construction, if final construction has the feature of expectation.When preparing sequence, amino acid change can be introduced Subject antibodies aminoacid sequence.

Can be used for identifying in antibody has " alanine scanning mutagenesis ", as described in CunninghamandWells, Science244:1081-1085 (1989) as some residue of preferred mutagenesis position or the method in region.Here, identify that a residue or one group of target residue are (as charged residue, such as arginine, aspartic acid, Histidine, Methionin and L-glutamic acid) and substitute with neutral or electronegative amino acid (such as L-Ala or Polyalanine), to affect the interaction of amino acid and antigen.Then pass through or more or other variant is introduced to alternate site, weighing the amino acid position to alternative display function susceptibility.Thus, although predetermine for the site of introducing variant amino acid sequence, but the essence of sudden change itself need not predetermine.Such as, in order to analyze the consequence of specifying site sudden change, carry out Alanine-scanning or random mutagenesis at target codon or region, and to the activity that the screening of expressed immunoglobulin (Ig) is expected.

Aminoacid sequence inserts and comprises the fusion of amino and/or C-terminal, and length range, and to be inserted in the sequence of single or multiple amino-acid residue to the polypeptide comprising residue up to a hundred or more by a residue.The example that end inserts comprises the antibody with N end methionyl residue.Other insertion variant of antibody molecule comprises to be held N or C of antibody and enzyme (as ADEPT) or the peptide fusion extending the antibody serum transformation period.

In certain embodiments, antibody of the present invention is changed the degree improving or reduce antibody glycosylation.The glycosylation of polypeptide is typical or N-connection or O-connection.N-connects and refers to that carbohydrate moiety is attached to the side chain of asparagine residue.Tripeptide sequence asparagine-X-serine and asparagine-X-threonine (wherein X is any amino acid except proline(Pro)) are recognition sequences carbohydrate moiety enzymatic being attached to asparagine side chain.So, the existence that in polypeptide, these two kinds of tripeptide sequences are arbitrary creates potential glycosylation site.The glycosylation that O-connects refers to sugars N-aceylgalactosamine, one of semi-lactosi or wood sugar to be attached to hydroxy-amino-acid, and modal is Serine or Threonine, but also can use 5-OxoPro or 5-hydroxylysine.

Add in antibody or delete glycosylation site by changing aminoacid sequence thus creating or eliminate one or more above-mentioned tripeptide sequence and complete easily (glycosylation site for N-connects).Described change is also undertaken (glycosylation site for O-connects) by interpolation in the sequence of original antibodies, deletion or alternative one or more Serine or threonine residues.

If antibody comprises Fc district, then can change the carbohydrate adhered on it.Such as, the antibody that the ripe carbohydrate structure lacking Fucose is attached to antibody Fc district is described in U.S. Patent application US2003/0157108 (Presta, L.).Also can see US2004/0093621 (KyowaHakkoKogyoCo., Ltd.).WO2003/011878 (people such as Jean-Mairet) and U.S. Patent No. 6, the antibody having decile N-acetyl-glucosamine (GlcNAc) in the carbohydrate being attached to antibody Fc district is refer in 602,684 (people such as Umana).The antibody having at least one galactose residue in the oligosaccharides being attached to antibody Fc district is reported in WO1997/30087 (people such as Patel).Also can see WO1998/58964 (Raju, S.) and WO1999/22764 (Raju, S.) about there being change carbohydrate to be attached to the antibody in its Fc district.Also can see US2005/0123546 (Umanaetal.) about having the glycosylated antigen binding molecules of improvement.

In certain embodiments, glycosylation variants comprises Fc district, and the carbohydrate structure being wherein attached to Fc district lacks Fucose.This type of variant has the ADCC function of improvement.Optional, Fc district also comprises the one or more amino acid replacements improving ADCC further, and such as Fc zone position 298,333 and/or 334 place substitutes (Eu residue numbering).The example relating to the publication of " de-Fucose type " or " Fucose shortage type " antibody comprises: US2003/0157108; WO2000/61739; WO2001/29246; US2003/0115614; US2002/0164328; US2004/0093621; US2004/0132140; US2004/0110704; US2004/0110282; US2004/0109865; WO2003/085119; WO2003/084570; WO2005/035586; WO2005/035778; WO2005/053742; Okazakietal.J.Mol.Biol.336:1239-1249 (2004); Yamane-Ohnukietal.Biotech.Bioeng.87:614 (2004).The example generating the clone of de-fucosylated antibody comprises the Lec13CHO cell (Ripkaetal.Arch.Biochem.Biophys.249:533-545 (1986) of the fucosylated defect of protein; U.S. Patent application US2003/0157108A1, Presta, L; And WO2004/056312A1, Adamsetal., especially embodiment 11) and knock out clone, the Chinese hamster ovary celI (Yamane-Ohnukietal.Biotech.Bioeng.87:614 (2004)) that such as α-1,6-fucose transferase gene FUT8 knocks out.

Another kind of variant is amino acid substitution variant.These variants have the different residue of at least one amino-acid residue to substitute in antibody molecule.The site interested of carrying out alternative mutagenesis comprises hypervariable region, but also contemplating FR changes.Table 6 gauge outfit shows conservative substituting under " preferably substituting " above.Cause required biologic activity change if this type of substitutes, so can import in table 6 and be called the more substantial variations of " illustrating alternative ", or as above with reference to amino acid classification further as described in, and to binding characteristic needed for gained antibody screening.

One class alternative variations involves one or more some hypervariable region residues of alternative parental antibody (such as humanization or people's antibody).Usually, the gained variant being used for exploitation is further selected will to have (such as improveing) biological characteristics of change relative to the parental antibody producing them.A kind of facilitated method for generating this type of alternative variations involves the affinity maturation using phage display.In brief, several hypervariable region sites (such as 6-7 site) is suddenlyd change, produces all possible amino acid replacement in each site.The antibody display of generation like this on filamentous phage particle, as the fusions of at least part of bacteriophage coat protein (such as M13 gene III product) with each particle internal packing.Then its biologic activity (such as binding affinity) is screened to the variant of phage display.In order to identify the site, candidate hypervariable region for modifying, scanning mutagenesis (such as Alanine-scanning) can be carried out and to identify, the some hypervariable region residues with significant contribution is combined to antigen.Or/in addition, analyze the crystalline structure of antigen-antibody complex to identify that the point of contact between antibody and antigen may be useful.Described contact residues and contiguous residue are the technology known according to this area, comprise detailed in this article, carry out the candidate locus substituted.Once produce such variant, the technology using this area to know, comprises as herein described, screens this group variant, the antibody in one or more relevant assay with good characteristic can be selected for further exploitation.

Prepared by the multiple method that the nucleic acid molecule of encoding antibody amino acid sequence variation is known by this area.These methods include but not limited to be separated (when natural generation amino acid sequence variation) from natural origin, or prepare by carrying out oligonucleotide mediated (or fixed point) mutagenesis, PCR mutagenesis and cassette mutagenesis to the comparatively early variant of preparation or the antibody of unmanifest pattern.

May wish to introduce a place in the Fc district of antibody of the present invention or many places amino acid modified, generate Fc region variants thus.Fc region variants can be included in the people Fc region sequence (as human IgG1, IgG2, IgG3 or IgG4Fc district) that one or more amino acid position (comprising hinge cysteine) comprises amino acid modified (as substituted).

Describe and the instruction of this area according to this, contemplate in some embodiment, antibody of the present invention can comprise a place or many places and change compared with the corresponding antibody of wild-type in such as Fc district.Compared with their wild type counterparts, these antibody will identical characteristics substantially required for treatment effect.Such as, think and to carry out in Ke Fc district causing C1q to combine and/or CDC (CDC) changes some change of (namely or strengthen or weaken), such as, described in WO99/51642.Also can see the DuncanandWinter paying close attention to other example of Fc region variants, Nature322:738-40 (1988); U.S. Patent No. 5,648,260; U.S. Patent No. 5,624,821; And WO94/29351.WO00/42072 (Presta) and WO2004/056312 (Lowman) describes the antibody variants improving the combination of FcR or reduce.The content of these patent publications is clearly taken in as a reference at this.Also can see Shieldsetal.J.Biol.Chem.9 (2): 6591-6604 (2001).Increased Plasma Half-life and to neonatal Fc receptor (FcRn) (it is responsible for Maternal immunoglobulin G to be transferred to fetus) (Guyeretal., J.Immunol.117:587 (1976) and Kimetal., J.Immunol.24:249 (1994)) combination improvement antibody be recorded in US2005/0014934A1 (Hintonetal.).These antibody comprise and have a place or many places and improve the alternative Fc district that Fc district is combined with FcRn.There is the Fc region amino acid sequence of change and C1q binding ability raises or the polypeptide variants that reduces is recorded in U.S. Patent No. 6,194,551B1, WO99/51642.The content of these patent publications is clearly taken in as a reference at this.Also can see Idusogieetal.J.Immunol.164:4178-4184 (2000).

On the one hand, the invention provides the antibody comprising modification in the interface of the Fc polypeptide forming Fc district, wherein said modification is convenient to and/or is promoted Heterodimerization.These are modified to be included in a Fc polypeptide and introduce protuberance (protuberance), and in the 2nd Fc polypeptide, introduce hole (cavity), wherein said protuberance can be arranged in described hole, thus promotes the compound of the first and second Fc polypeptide.For generating, to have these methods of antibody of modifying be known in the art, such as U.S. Patent No. 5,731, and described in 168.

11. antibody derivatives

Can further modified antibodies with comprise that this area is known and be easy to obtain extra non-proteinaceous module.Preferably, the module being suitable for antibody derivatize is water-soluble polymers.The limiting examples of water-soluble polymers includes but not limited to polyoxyethylene glycol (PEG), ethylene glycol/propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone, poly-1, 3-dioxolane, poly-1, 3, 6-trioxane, ethene/copolymer-maleic anhydride, polyamino acid (homopolymer or randomcopolymer), with dextran or poly-(n-VP) polyoxyethylene glycol, propropylene glycol homopolymers, propylene oxide/ethylene oxide copolymer, polyoxyethylated polyols (as glycerine), polyvinyl alcohol, and composition thereof.Due to its stability in water, methoxy PEG-propionaldehyde may have advantage aborning.Polymkeric substance can be any molecular weight, and can be branch or unbranched.The polymkeric substance number be attached on antibody can change, and if attached to more than a polymkeric substance, so they can be identical or different molecules.Generally speaking, number and/or the type of the polymkeric substance of derivatize can be determined according to following consideration, include but not limited to the concrete property of antibody to be modified or function, treatment etc. that whether antibody derivatives will be used to specify under condition.

In another embodiment, antibody and the conjugate of the non-proteinaceous module that selectivity heats by being exposed to radiation is provided.In one embodiment, this non-proteinaceous module is carbon nanotube (Kametal., Proc.Natl.Acad.Sci.102:11600-11605 (2005)).Radiation can be any wavelength, includes but not limited to harmless to ordinary cells but non-proteinaceous module is heated to the wavelength of the killed temperature of cell close to antibody-non-proteinaceous module.

In certain embodiments, antibody can be through mark and/or can immobilization on solid support.In yet another aspect, antibody is antiidiotypic antibody.

12. Heteroconjugate antibodies

Additionally provide Heteroconjugate antibodies.Heteroconjugate antibodies is made up of two kinds of covalently bound antibody.This antibody-like is proposed to be used in such as by undesired for immune system cell target cell (United States Patent (USP) 4,676,980) and be used for the treatment of HIV (WO91/00360; WO92/200373; EP03089).Contemplate the currently known methods Dispersal risk that can use synthetic protein chemistry in vitro, comprise the method that those relate to linking agent.Such as, disulfide exchange can be used to react or build immunotoxin by forming thioether bond.The example being suitable for the reagent of this object comprises imino-mercaptan ester/salt (iminothiolate) and 4-sulfydryl butyryl methyl ester imidate (methyl-4-mercaptobutyrimidate) and such as United States Patent (USP) 4,676, disclosed in 980.

13. cytotoxic antibodies

Additionally provide cytotoxic antibody.In certain embodiments, cytotoxic antibody is anti-IL22 antibody, such as hereafter provided, and it plays effector functions and/or inducing cell death.In certain embodiments, the ectodomain of the anti-IL-22R antibodies IL-22R of cytotoxicity.

14. effector functions engineerings

Modified antibodies in effector functions may be wished, thus strengthen the effect of such as antibody in disease therapy such as cancer.Such as, Ke Xiang Fc introduces cysteine residues in district, thus makes to form interchain disulfide bond in this zone.The homodimer antibody of generation like this can have cell killing and the antibody dependent cellular toxicity (ADCC) of the internalization ability of improvement and/or the complement-mediated of raising.See Caronetal., J.Exp.Med.176:1191-1195 (1992) and Shopes, J.Immunol.148:2918-2922 (1992).The homodimer antibody with the anti-tumor activity of enhancing also can be prepared by use heterobifunctional crosslinker as described in Wolffetal., CancerResearch53:2560-2565 (1993).Or antibody can be transformed into has dual Fc district, can have complement lysis and the ADCC ability of enhancing thus.See Stevensonetal., Anti-CancerDrugDesign3:219-230 (1989).

15. carriers, host cell and recombination method

In order to recombinant production antibody, in one embodiment, be separated its nucleic acid of coding, and be inserted into replicable vector, for cloning (DNA cloning) further or expressing.Old process can be used to be easy to be separated the DNA of encoding antibody and to check order (as used the oligonucleotide probe that can be combined with the gene specific of encoding antibody heavy and light chain).Many carriers can be utilized.The selection of carrier depends in part on the host cell that will use.Generally speaking, host cell is that protokaryon or eucaryon (normally Mammals) originate from.Will be appreciated that the constant region of any isotype can be used for this object, comprise IgG, IgM, IgA, IgD and IgE constant region, and this type of constant region can obtain from anyone or animal species.

A) prokaryotic host cell is used to generate antibody:

(1) vector construction

Standard recombinant techniques can be used to obtain the polynucleotide sequence of encode antibody polypeptides component.Can the polynucleotide sequence of expectation be separated from antibody-producting cell such as hybridoma and check order.Or, nucleotide synthesizer or round pcr synthetic polyribonucleotides can be used.Once obtain, the sequence of coded polypeptide is inserted and can copy in prokaryotic hosts and the recombinant vectors of expressing heterologous polynucleotide.In order to the present invention, this area can be used obtainable and the many carriers known.The selection of appropriate carrier by depend primarily on will insertion vector nucleic acid size and will with the concrete host cell of vector.According to its function (increase or expressing heterologous polynucleotide, or the two furthermore) and the consistency with its concrete host cell resident wherein thereof, often kind of carrier contains multiple component.Support element generally includes but is not limited to: replication orgin, selected marker gene, promotor, ribosome bind site (RBS), signal sequence, heterologous nucleic acids Insert Fragment and transcription termination sequence.

Generally speaking, comprise and can use together with these hosts with the plasmid vector of control sequence derived from the replicon of host compatibility species.Carrier carries replication site usually, and can provide the flag sequence of Phenotypic Selection in transformant.Such as, usually with the pBR322 plasmid transformation of E. coli derived from species Escherichia coli.PBR322 comprises the gene of encoding ampicillin (Amp) and tsiklomitsin (Tet) resistance, provides the means of light identification of transformed cell thus.PBR322, its derivative or other microorganism plasmid or phage also can comprise or modified and comprise can by microorganism organism for expressing the promotor of endogenous protein.The people such as Carter, U.S. Patent No. 5,648, describes the example of the pBR322 derivative for expressing specific antibodies in detail in 237.

In addition, the phage vector comprising the replicon compatible with host microorganism and control sequence can be used as the conversion carrier of these hosts.Such as, phage such as λ GEM.TM.-11 can be used to build the recombinant vectors that can be used for transform susceptible host cells such as intestinal bacteria LE392.

Expression vector of the present invention can comprise two to or multipair promotor-cistron, they are encoded each polypeptide component.Promotor is the untranslated regulating and controlling sequence being positioned at cistron upstream (5 '), the expression of its regulation and control cistron.Prokaryotic promoter is divided into two classes usually, induction type with composition.Inducible promoter refer to respond culture condition change (as nutraceutical existence whether or temperature variation) and start the promotor that the elevated levels by the cistron of its control transcribes.

Be subject to a large amount of promotors of multiple potential host cell identification as everyone knows.Digest by restriction enzyme the promotor that cuts in source DNA and the promoter sequence of separation is inserted carrier of the present invention, the cistron DNA of the promotor of selection with coding light chain or heavy chain can be operatively connected thus.Native promoter sequence and many allogeneic promoters all can be used for amplification and/or the expression of instructing target gene.In some embodiment, use allogeneic promoter, because compared with native target polypeptide promotor, they allow that the higher of expressed target gene is transcribed and higher output yield usually.

The promotor being applicable to prokaryotic hosts comprises PhoA promotor, beta-galactosidase enzymes and lactose promoter system, tryptophane (trp) promoter systems and hybrid promoter such as tac or trc promotor.But, in bacterium, there is other promotor of function (such as other known bacterium or phage promoter) to be also suitable.Their nucleotide sequence is delivered, skilled work personnel can use thus provides the joint of any required restriction site or adapter their cistrons with coding target light chain and heavy chain to be operatively connected (Siebenlistetal., Cell20:269 (1980)).

In one aspect of the invention, each cistron in recombinant vectors comprises the secretory signal sequence component that the expressed polypeptide of guidance wears film transposition.Generally speaking, signal sequence can be the component of carrier, or it can be a part for the target polypeptid DNA of insertion vector.The signal sequence selected in order to the present invention should be the signal sequence being subject to host cell identification and processing (namely being excised by signal peptidase).The prokaryotic host cell of the signal sequences native of heterologous polypeptide is processed for nonrecognition, the signal sequence prokaryotic signal sequence being selected from such as lower group to be substituted: alkaline phosphatase, penicillinase, Ipp or heat-staple enterotoxin 1 I (STII) leader sequence, LamB, PhoE, PelB, OmpA and MBP.In one embodiment of the invention, the signal sequence all used in two cistrons of expression system is STII signal sequence or its variant.

On the other hand, the generation according to immunoglobulin (Ig) of the present invention can occur in the tenuigenin of host cell, does not therefore need to there is secretory signal sequence in each cistron.In that, light chain immunoglobulin and heavy chain are expressed, are folded and assemble and form Functional immunoglobulin in tenuigenin.Some host strain (as intestinal bacteria trxB-bacterial strain) provides the tenuigenin condition being beneficial to disulfide formation, thus allows the correct folding and assembling of expressed protein subunit.ProbaandPluckthun，Gene159：203(1995)。

Antibody of the present invention also can use following expression system to generate, and wherein the quantity ratios of expressed polypeptide component can be regulated and controled, thus will secrete and the maximum production of the antibody of the present invention of correct assembling.This regulation and control are realized by the translation intensity regulating and controlling polypeptide component simultaneously at least partly.

The people such as Simmons, U.S. Patent No. 5,840, discloses a kind of technology for regulating and controlling translation intensity in 523.It utilizes the variant of Translation initiator (TIR) in cistron.For appointment TIR, can create and have certain limit translation a series of amino acid of intensity or Nucleic acid sequence variants, what provide the expectation expression level for specific chains to adjust this factor thus facilitates means.The codon change that can change aminoacid sequence is caused to generate TIR variant by conventional mutagenesis techniques.In certain embodiments, the change in nucleotide sequence is reticent.Change in TIR can comprise the such as number of Shine-Dalgarno sequence or the change of spacing, and the change in signal sequence.Generate at the beginning of encoding sequence " password word bank " (i.e. change be reticent) not changing signal sequence aminoacid sequence for generating a kind of method of mutant signal sequences.This realizes by the 3rd nucleotide position changing each codon; In addition, some amino acid, such as leucine, Serine and arginine, have multiple first and second position, and this can increase complicacy building in storehouse.Yansuraetal., this mutafacient system is described in detail in METHODS:ACompaniontoMethodsinEnzymol.4:151-158 (1992).

In one embodiment, for each cistron in carrier, generate one group of carrier with certain limit TIR intensity.This finite aggregate provides the expression level of every bar chain and expects the comparison of the output of antibody products under various TIR intensity combination.Expression level by quantizing reporter gene measures TIR intensity, the people such as Simmons, and U.S. Patent No. 5,840, has a detailed description in 523.According to the comparison of translation intensity, the indivedual TIR expected are selected to combine in expression vector establishment thing of the present invention.

The prokaryotic host cell being suitable for expressing antibody of the present invention comprises archeobacteria (Archaebacteria) and eubacterium (Eubacteria), such as Gram-negative or gram-positive organism.The example of useful bacterium comprises Escherichia (Escherichia) (as colon bacillus E.coli), bacillus (Bacillus) (as subtilis B.subtilis), enterobacter (Enterobacteria), Rhodopseudomonas (Pseudomonas) (as Pseudomonas aeruginosa P.aeruginosa) species, Salmonella typhimurium (Salmonellatyphimurium), serratia marcescens (Serratiamarcescans), Klebsiella (Klebsiella), proteus (Proteus), Shigella (Shigella), rhizobium (Rhizobium), Vitreoscilla (Vitreoscilla), or paracoccus (Paracoccus).In one embodiment, gram-negative cells is used.In one embodiment, use Bacillus coli cells as host of the present invention.The example of coli strain comprises bacterial strain W3110 (Bachmann, CellularandMolecularBiology, the 2nd volume, Washington, D.C., American Academy Of Microbiology, 1987,1190-1219 page; ATCC preserving number 27,325) and derivative, comprise the bacterial strain 33D3 (U.S. Patent No. 5,639,635) with genotype W3110 Δ fhuA (Δ tonA) ptr3lacIqlacL8 Δ ompT Δ (nmpc-fepE) degP41kanR.Other bacterial strain and derivative thereof, such as intestinal bacteria 294 (ATCC31,446), intestinal bacteria B, intestinal bacteria λ 1776 (ATCC31,537) and intestinal bacteria RV308 (ATCC31,608) are also suitable.These examples just illustrate and unrestricted.This area is known for building the method having and specify genotypic any above-mentioned bacterial derivation thing, see such as Bassetal., Proteins8:309-314 (1990).Usually must consider that the reproducibility of replicon in bacterial cell selects the bacterium be suitable for.Such as, when using well-known plasmid such as pBR322, pBR325, pACYC177 or pKN410 to provide replicon, intestinal bacteria, serratia or Salmonella ssp may be suitable for use as host.Usually, host cell should secrete the proteolytic ferment of minimum, and may wish to mix extra proteinase inhibitor in cell cultures.

(2) antibody tormation

With above-mentioned expression vector transformed host cell, and cultivate in the conventional nutrient culture suitably changed expecting the gene of sequence in order to evoked promoter, selection transformant or amplification coding.

Transform and import prokaryotic hosts by DNA, DNA can be copied, or as extra-chromosomal element or pass through chromosomal composition.According to host cell used, the standard technique being suitable for these cells is used to transform.The Calcium treatment of calcium chloride is adopted to be generally used for the bacterial cell with firm cell-wall barriers.Another kind of method for transformation adopts polyoxyethylene glycol/DMSO.What use also has a kind of technology to be electroporation.

That know in this area and be suitable for cultivating in the substratum of selected host cell the prokaryotic cell prokaryocyte cultivated for generating polypeptide of the present invention.The example of suitable culture medium comprises the LB substratum (Luriabroth) that with the addition of required nutritional supplement.In some embodiment, the selective agent that substratum is also selected containing the structure of with good grounds expression vector, allows the prokaryotic cell prokaryocyte growth comprising expression vector with selectivity.Such as, in the substratum of the cell for culture expression ampicillin resistance gene, penbritin is added.

Beyond carbon, nitrogen and inorganic phosphate sources, also can any required fill-in containing proper concn, or to add separately or as the mixture with another kind of fill-in or substratum, such as compound nitrogen source.Optional, substratum can be selected from the reductive agent of lower group containing one or more: gsh, halfcystine, cystamine, thioglycolate salt/ester, dithioerythritol and dithiothreitol (DTT).

Prokaryotic host cell is cultivated in suitable temperature.In certain embodiments, for cultivation intestinal bacteria, the temperature range of cultivation is about 20 DEG C to about 39 DEG C, about 25 DEG C to about 37 DEG C or about 30 DEG C.Depend primarily on host organisms, the pH of substratum can be scope be about 5 to about 9 any pH.In certain embodiments, for intestinal bacteria, pH is about 6.8 to about 7.4 or about 7.0.

If use inducible promoter in expression vector of the present invention, be so suitable for induced protein expression under the condition activating promotor.In one aspect of the invention, PhoA promotor is used to control transcribing of polypeptide.Therefore, in order to induce, in phosphoric acid salt restriction substratum, cultivate the host cell through transforming.In certain embodiments, phosphoric acid salt restriction substratum is C.R.A.P substratum (see such as Simmonsetal., J.Immunol.Methods263:133-147 (2002)).According to adopted vector construct, other inductor multiple can be adopted, as is known in the art.

In one embodiment, expressed polypeptide of the present invention is secreted in the pericentral siphon of host cell and also therefrom reclaims.Protein recovery involves destroy microorganisms usually, usually by means such as such as osmotic shock (osmoticshock), supersound process or cracking.Once cell is destroyed, by centrifugal or filter clear cell debris or whole cell.Protein can be further purified by such as affine resin chromatography.Or protein may be transported in nutrient solution and also therefrom be separated.From nutrient solution scavenger cell, and culture supernatants can be filtered and concentrates, for being further purified generated protein.Protein expressed by the method such as polyacrylamide gel electrophoresis (PAGE) and the further separation andpreconcentration of western blot analysis generally known can be used.

In one aspect of the invention, antibody producing is carried out in a large number by fermenting process.Multiple extensive fed-batch fermentation flow process can be used for Restruction albumen.Large scale fermentation has the capacity of at least 1000 liters, is about 1 in certain embodiments, the capacity of 000 to 100,000 liter.These fermentor tanks use agitator paddle to distribute oxygen and nutrient, especially glucose (preferred carbon source/energy).On a small scale fermentation is often referred to and is no more than at volume capacity the fermentation carried out in the fermentor tank of about 100 liters, and scope can be about 1 rise to about 100 liters.

During the fermentation, usually expect that density (as OD550 is about 180-220, being in early stage stationary phase at this phase cell) starts the induction of protein expression afterwards being cultured under suitable conditions by cell.According to adopted vector construct, multiple inductor can be used, know as this area with above-described.Can by the time shorter for cell cultures before induction.Usually cell induction is about 12-50 hour, but longer or shorter induction time can be used.

In order to improve the seed output and quality of polypeptide of the present invention, multinomial fermentation condition can be revised.Such as, in order to improve the correct assembling of secreted antibody polypeptides and fold, the additional carrier expressing chaperone such as Dsb albumen (DsbA, DsbB, DsbC, DsbD and/or DsbG) or FkpA (having a kind of peptidyl prolyl-cis of Chaperone Activity, trans-isomerase) that can overuse carrys out cotransformation host prokaryotic cell.Prove that chaperone promotes the correct folding and solubleness of the heterologous protein generated in bacterial host cell.Chenetal., J.Biol.Chem.274:19601-19605 (1999); The people such as Georgiou, U.S. Patent No. 6,083,715; The people such as Georgiou, U.S. Patent No. 6,027,888; BothmannandPluckthun, J.Biol.Chem.275:17100-17105 (2000); RammandPluckthun, J.Biol.Chem.275:17106-17113 (2000); Arieetal., Mol.Microbiol.39:199-210 (2001).

In order to be down to minimum by the proteolysis of expressed heterologous protein (especially to the heterologous protein of proteolysis sensitivity), some host strain of proteolysis enzyme defect can be used for the present invention.Such as, can host cell strains be modified, in the gene of the known bacteria protease of coding, carry out genetic mutation, such as proteinase II I, OmpT, DegP, Tsp, proteolytic enzyme I, proteolytic enzyme Mi, proteolytic enzyme V, proteolytic enzyme VI and combination thereof.Can obtain some e. coli protein enzyme defect bacterial strain, see such as Jolyetal., (1998) see above; The people such as Georgiou, U.S. Patent No. 5,264,365; The people such as Georgiou, U.S. Patent No. 5,508,192; Haraetal., MicrobialDrugResistance2:63-72 (1996).

In one embodiment, in expression system of the present invention, proteolysis enzyme defect is used and through the coli strain of the Plastid transformation of one or more chaperones of overexpression as host cell.

(3) antibody purification

In one embodiment, the antibody that generates is further purified herein to obtain the goods of homogeneity substantially, for further measuring and using.The Standard protein purification method that this area is known can be adopted.Flow process is below the illustration of appropriate purification flow process: the chromatography on the classification on the affine or ion exchange column of immunity, alcohol settling, reversed-phase HPLC, tripoli or Zeo-karb such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation and use the gel-filtration of such as SephadexG-75.

In one aspect, the albumin A be fixed in solid phase is used for the immunoaffinity purification of antibody products of the present invention.Albumin A is the 41kD cell wall protein from streptococcus aureus (Staphylococcusaureas), and it is with high-affinity binding antibody Fc district.Lindmarketal.，J.Immunol.Meth.62：1-13(1983)。The solid phase that albumin A is fixed thereon can be the pillar with glass or quartz surfaces, or controlled pore glass post or silicic acid post.In some applications, pillar with pack quilts such as such as glycerine, in order to the non-specific adhesion of likely preventing pollution thing.

As the first step of purifying, the prepared product derived from cell culture described above can be applied in albumin A immobilization solid phase, make object antibody Specific binding proteins A.Then solid phase is cleaned to remove the pollutent with solid phase non-specific binding.Object antibody is reclaimed from solid phase finally by wash-out.

B) eukaryotic host cell is used to generate antibody:

Carrier for eukaryotic host cell generally includes one or more following non-limiting components: signal sequence, replication orgin, one or more marker gene, enhancer element, promotor and transcription termination sequence.

(1) signal sequence component

The carrier used in eukaryotic host cell also can comprise signal sequence at the N end of object mature protein or polypeptide or have other polypeptide of special cleavage site.Can select to be subject to host cell identification and the Heterologous signal sequences processing (namely being excised by signal peptidase).In mammalian cell expression, can utilize mammalian signal sequences and viral secretory leading, such as herpes simplex gD signal.The DNA of these prosomas is connected to the DNA of encoding antibody in the mode meeting reading frame.

(2) replication orgin

Usually, mammalian expression vector does not need replication orgin component.Such as, SV40 starting point may only just use because comprising early promoter usually.

(3) Select gene component

Cloning and expression carrier can comprise Select gene, also referred to as selection marker.Typical Select gene is encoded following protein: (a) gives the resistance to microbiotic or other toxin, as penbritin, Liu Suanyan NEOMYCIN SULPHATE, methotrexate or tsiklomitsin; B () supplies corresponding auxotrophy; Or (c) provides the critical nutrients that can not obtain from complex medium.

An example of selection scheme utilizes medicine to block the growth of host cell.Those Hemapoiesis through heterologous gene successful conversion give the protein of drug resistance, thus survive selection scheme.The example of this type of dominant selection uses drug neomycin, mycophenolic acid and Totomycin.

Another example being suitable for the selection marker of mammalian cell is the selection marker of the cell can identifying picked-up antibody nucleic acids of having the ability, such as DHFR, thymidine kinase, metallothionein(MT) I and II (preferred primate metallothionein gene), adenosine deaminase, ornithine decarboxylase etc.

Such as, in some embodiment, first by all transformants being carried out in the substratum containing methotrexate (a kind of competitive antagonist of Mtx, DHFR) cultivate to identify the cell transformed through DHFR Select gene.In some embodiment, when adopting wild-type DHFR, suitable host cell is Chinese hamster ovary (CHO) clone (as ATCCCRL-9096) of such as DHFR active defects.

Or, by containing for the selective agent such as aminoglycoside antibiotics of selection marker as the substratum of kantlex, Liu Suanyan NEOMYCIN SULPHATE or G418 in culturing cell select the DNA sequence dna of encoded antibody, wild type DHFR protein and another kind of selection marker such as aminoglycoside 3 '-phosphotransferase (APH) to transform or the host cell (particularly comprising the wild-type host of endogenous DHFR) of cotransformation.See U.S. Patent No. 4,965,199.

(4) promotor component

Cloning and expression carrier comprises the promotor being subject to host organisms identification usually, and is operatively connected with the nucleic acid of encoding polypeptides of interest (such as antibody).Known eukaryotic promoter sequence.Such as, in fact, all eukaryotic genes all have and are rich in AT district, and it is positioned at site upstream about 25 to 30 base places of initiation transcription.Be CNCAAT district permitting the another kind of sequence that 70 to 80 base places, polygenic transcriptional start point upstream find, wherein N can be any Nucleotide.Holding at 3 ' of most of eukaryotic gene is AATAAA sequence, and it may be the signal of 3 ' end interpolation polyadenylic acid (polyA) tail to encoding sequence.In certain embodiments, in the insertion carrier for expression of eukaryon that any or all these sequences can be suitable.

In mammalian host cell from carrier transcribe be subject to such as obtaining from virus (such as polyomavirus, fowlpox virus, adenovirus (such as 2 type adenovirus), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B virus and simian virus 40 (SV40)) genome, from heterologous mammal promotor (as actin promoter or immunoglobulin promoter), from the control of the promotor of heat-shock promoters, if the words that these promotors are compatible with host cell systems.

Obtain the early stage of SV40 virus and late promoter with the form of SV40 restriction fragment easily, this fragment also comprises SV40 virus origin of replication.The immediate early promoter of human cytomegalic inclusion disease virus is obtained easily with the form of HindIIIE restriction fragment.United States Patent (USP) 4,419, discloses the system using bovine papilloma virus as carrier expressible dna in mammalian hosts in 446.U.S. Patent No. 4,601, describes the one amendment of this system in 978.Also can see Reyesetal., Nature297:598-601 (1982) about the control following table intelligent beta-interferon cDNA at the thymidine kinase promoter from hsv in mouse cell.Or, Rous sarcoma virus long terminal repeat can be used as promotor.

(5) enhancer element component

Often through inserting enhancer sequence in the carrier to improve higher eucaryotic cells transcribing the DNA of code book invention antibody.It is now know that from many enhancer sequence of mammalian genes (sphaeroprotein, elastoser, white protein, α-fetoprotein and Regular Insulin).But, usually use the enhanser from eukaryotic cell virus.Example comprises the enhanser (bp100-270) of SV40 replication orgin side in late period, the sub-enhanser of cytomegalovirus early promoter, the enhanser of polyomavirus replication orgin side in late period and adenovirus cancers.Also can see Yaniv, Nature297:17-18 (1982) about the enhancer element activating eukaryotic promoter.Enhanser can montage in carrier, be positioned at 5 ' or 3 ' position of antibody polypeptides encoding sequence, but be generally positioned at 5 ' site of promotor.

(6) Transcription Termination component

The expression vector used in eukaryotic host cell also can comprise termination and transcribe the necessary sequence with stable mRNA.This type of sequence can obtain from 5 ' end of eucaryon or viral DNA or cDNA non-translational region with 3 ' end once in a while usually.The non-translational region transcription that these regions are included in the mRNA of encoding antibody becomes the nucleotide segment of polyadenylated fragments.A kind of useful Transcription Termination component is Trobest polyadenylation district.See WO94/11026 and disclosed in expression vector.

(7) selection of host cell and conversion

The host cell being suitable for the DNA cloning or express in this paper carrier comprises higher eucaryotic cells described herein, comprises vertebrate host cell.The breeding of vertebrate cells in cultivation (tissue culture) becomes old process.The example of useful mammalian host cell line has monkey kidney CV1 system (COS-7, ATCCCRL1651) transformed through SV40, human embryo kidney (HEK) system (293 cells or for suspension culture and 293 cells of subclone, Grahametal., J.Gen.Virol.36:59 (1977)), baby hamster kidney cell (BHK, ATCCCCL10), Chinese hamster ovary cell/-DHFR (CHO, Urlaubetal., Proc.Natl.Acad.Sci.USA77:4216 (1980)), mouse Sai Tuoli (Sertoli) cell (TM4, Mather, Biol.Reprod.23:243-251 (1980)), monkey-kidney cells (CV1, ATCCCCL70), African green monkey kidney cell (VERO-76, ATCCCRL1587), human cervical carcinoma cell (HELA, ATCCCCL2), Madin-Darby canine kidney(cell line) (MDCK, ATCCCCL34), ox mouse (buffalorat) liver cell (BRL3A, ATCCCRL1442), human pneumonocyte (W138, ATCCCCL75), human liver cell (HepG2, HB8065), mouse mammary tumor (MMT060562, ATCCCCL51), TRI cell (Matheretal., AnnalsN.Y.Acad.Sci.383:44-68 (1982)), MRC5 cell, FS4 cell, be (HepG2) with human liver cell knurl (hepatoma).

In order to generate antibody, with expression mentioned above or cloning vector transformed host cell, and cultivate in the conventional nutrient culture suitably changed expecting the gene of sequence in order to evoked promoter, selection transformant or amplification coding.

(8) cultivation of host cell

The host cell for generating antibody of the present invention can be cultivated in multiple substratum.Commercially available culture medium is HamShi F10 (Sigma), minimum essential medium (MEM such as, Sigma), RPMI-1640 (Sigma) and DulbeccoShi improvement EagleShi substratum (DMEM, Sigma) is suitable for cultivating host cell.In addition, any substratum of recording in following documents can be used as the substratum of host cell: Hametal., Meth.Enz.58:44 (1979); Barnesetal., Anal.Biochem.102:255 (1980); U.S. Patent No. 4,767,704; 4,657,866; 4,927,762; 4,560,655; 5,122,469; WO90/03430; WO87/00195; Or United States Patent (USP) review 30,985.These substratum any can hormone supplemented and/or other somatomedin (such as Regular Insulin, transferrin or Urogastron), salt (such as sodium-chlor, calcium, magnesium and phosphoric acid salt), buffer reagent (such as HEPES), Nucleotide (such as adenosine and thymidine), microbiotic (such as GENTAMYCIN as required ^tMmedicine), trace elements (be defined as usually exist with the final concentration of micro-molar range mineral compound) and glucose or the equivalent energy.Other fill-in any that those skilled in the art will know that can also be contained by suitable concentration.The host cell that culture condition such as temperature, pH etc. are expression and select is previously used, and this is obvious for those of ordinary skill.

(9) purifying of antibody

When using recombinant technology, antibody can be generated in cell, or direct secretion is in substratum.If generate antibody in cell, so first particle debris can be removed by such as centrifugal or ultrafiltration, or host cell or crack fragment.If antibody-secreting is in substratum, so first the supernatant liquor from these expression systems can be concentrated by commodity in use protein concentration filter (such as Amicon or MilliporePellicon ultra filtration unit).Proteinase inhibitor such as PMSF can be comprised in any above-mentioned steps to be hydrolyzed with arrestin, and microbiotic can be comprised to prevent the growth of external contaminant.

The antibody compositions that such as hydroxyapatite, gel electrophoresis, dialysis and affinity chromatography (affinity chromatography is one technology easily) can be used to carry out purifying prepare from cell.Albumin A depends on kind and the isotype of any immunoglobulin Fc domain existed in antibody as the suitability of affinity ligand.Albumin A can be used for the antibody (Lindmarketal., J.Immunol.Meth.62:1-13 (1983)) of purifying based on people γ 1, γ 2 or γ 4 heavy chain.Protein G recommends to be used for all mouse isotypes and people γ 3 (Gussetal., EMBOJ.5:1567-1575 (1986)).Matrix accompanying by affinity ligand can be agarose, but can use other matrix.The matrix of physically stable such as controlled pore glass or poly-(styrene divinyl) benzene can obtain than agarose flow velocity and shorter process period faster.If antibody comprises CH3 structural domain, then BakerbondABX can be used ^tMresin (J.T.Baker, Phillipsburg, NJ) carries out purifying.According to antibody to be recycled, the chromatography on the classification on other oroteins purification technique such as ion exchange column, alcohol settling, reversed-phase HPLC, tripoli, heparin SEPHAROSE also can be used ^tMon chromatography, negatively charged ion or Zeo-karb (such as poly aspartic acid post) on chromatography, chromatofocusing, SDS-PAGE and ammonium sulfate precipitation.

After any any preliminary purification step, mixture containing object antibody and pollutent can be carried out further purifying, such as low pH hydrophobic interaction chromatography, uses pH to be about the elution buffer of 2.5-4.5, preferably carries out at low salt concn (according to appointment 0-0.25M salt).

Generally speaking, be that this area has been improved and set up for the preparation of the various methods of antibody for research, test and Clinical practice, with method mentioned above be consistent and/or those skilled in the art think that for specific antibody interested be suitable.

c. immune conjugate

Immune conjugate or " antibody-drug conjugates " are used in topical delivery cytotoxic agent in cancer therapy.See such as Syrigosetal. (1999) AnticancerResearch19:605-614; Niculescu-Duvazetal. (1997) Adv.DrugDeliv.Rev.26:151-172; U.S. Patent No. 4,975,278.Immune conjugate is allowed by drug moiety targeting Delivery to tumour, and systemic application without coupling cytotoxic agent may attempt eliminate tumour cell beyond cause unacceptable to Normocellular toxic level.See Baldwinetal. (Mar.15,1986) Lancetpp.603-05; Thorpe (1985) " AntibodyCarriersOfCytotoxicAgentsInCancerTherapy:AReview; " in: MonoclonalAntibodies ' 84:BiologicalandClinicalApplications (A.Pincheraetal., eds.) pp.475-506.

On the one hand, immune conjugate comprises the antibody in conjunction with IL-19, IL-20, IL-22, IL-24, IL22R, IL-20Ra, IL-20Rb or IL-10R2, such as provided herein, and cytotoxic agent, such as chemotherapeutics, growth inhibitor, toxin (enzyme activity toxin or its fragment as bacterium, fungi, plant or animal origin) or radio isotope (namely radiating conjugate).

Be hereinbefore described the chemotherapeutics that can be used for generating this type of immune conjugate.Spendable enzyme activity toxin and fragment thereof comprise diphtheria toxin A chain, the nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa Pseudomonasaeruginosa), ricin (ricin) A chain, toxalbumin (abrin) A chain, capsule lotus root toxalbumin (modeccin) A chain, α-broom aspergillin (sarcin), tung oil tree (Aleutites.fordii) toxalbumin, Dianthus caryophyllus L. (dianthin) toxalbumin, dyers' grapes (Phytolacaamericana) toxalbumin (PAPI, PAPII and PAP-S), balsam pear (Momordicacharantia) inhibition, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonariaofficinalis) inhibition, gelonin (gelonin), NSC-69529 (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).Multiple radionuclide can be used for generating radiation coupled antibody.Example comprises ²¹²bi, ¹³¹i, ¹³¹in, ⁹⁰y and ¹⁸⁶re.

The conjugate of antibody and cytotoxic agent can use multiple bifunctional protein coupling agent to prepare, such as N-succinimido-3-(2-pyridyl dithio) propionic ester (SPDP), iminothiolane (IT), imido-ester (all example hydrochloric acid hexanedioyl imido acid dimethyl esters), active ester class (such as suberic acid two succinimido ester), aldehydes (such as glutaraldehyde), double azido compound (such as two (p-azido benzoyl base) hexanediamine), dual azepine derivatives (such as two (p-diazoniumbenzoyl) quadrol), vulcabond (such as toluene 2, 6-vulcabond), with double activated fluorine cpd (such as 1, 5-bis-fluoro-2, 4-dinitrobenzene) dual-function derivative.Such as, ricin immunotoxin can be prepared as described in Vitettaetal., Science238:1098 (1987).The 1-isothiocyanic acid phenmethyl-3-methyl diethylene triaminepentaacetic acid(DTPA) (MX-DTPA) of carbon-14 mark is for the exemplary sequestrant by radioactive nucleotides and antibody coupling.See WO94/11026.

Also contemplate antibody herein and one or more small molecule toxins such as calicheamicin (calicheamicin), maytansinoid class (maytansinoids), trichothecin (trichothene) and CC1065 and these toxin have the conjugate of the derivative of neurotoxin active.

1. maytenin and maytansinoid class

In one embodiment, immune conjugate comprises the antibody that coupling has one or more maytansinoid molecule.Maytansinoid class is the mitotic inhibitor by suppressing tubulin polymerization to play a role.Maytenin is separated from East Africa shrub tingia Caulis Mayteni (Maytenusserrata) at first and obtains (U.S. Patent No. 3,896,111).Find that certain micro-organisms also generates maytansinoid class, such as maytansinol and C-3 maytansinol ester (United States Patent (USP) 4,151,042) subsequently.Such as followingly U.S. patents disclose synthesis maytansinol and derivative and analogue: 4,137,230; 4,248,870; 4,256,746; 4,260,608; 4,265,814; 4,294,757; 4,307,016; 4,308,268; 4,308,269; 4,309,428; 4,313,946; 4,315,929; 4,317,821; 4,322,348; 4,331,598; 4,361,650; 4,364,866; 4,424,219; 4,450,254; 4,362,663; And 4,371,533, clearly its disclosure is collected herein by reference.

In the trial improving its therapeutic index, by maytenin and maytansinoid class and the antibody coupling in conjunction with the antigen on tumor cell surface.Such as following patent discloses the immune conjugate and therepic use thereof that comprise maytansinoid class: United States Patent (USP) 5,208,020; 5,416,064; And European patent EP 0425235B1, clearly its disclosure is collected herein by reference.Liuetal., Proc.Natl.Acad.Sci.USA93:8618-8623 (1996) describes the immune conjugate being called the maytansinoid of DM1 comprising and be connected with the monoclonal antibody C242 for human colorectal cancer.Find that this conjugate has the high cell toxicity of colon cancer cell for cultivating, and show anti-tumor activity in tumor growth assay method in vivo.Charietal., CancerResearch52:127-131 (1992) describes the wherein maytansinoid immune conjugate through disulfde linker and the murine antibody A7 in conjunction with antigen in CCL188 or the another kind of mouse monoclonal antibody TA.1 coupling in conjunction with HER-2/neu oncogene.The cytotoxicity of TA.1-maytansinoid conjugate is tested in vitro, each cell expressing 3 × 10 of this clone on human breast cancer cell system SK-BR-3 ⁵individual HER-2 surface antigen.Drug conjugates reaches the cytotoxicity degree similar to free maytansinoid drugs, and this improves by the maytansinoid molecule amount increasing each antibody molecule coupling.A7-maytansinoid conjugate shows low systemic cellular toxicity in mouse.

Antibody-maytansinoid conjugate is by be connected antibody with maytansinoid molecular chemistry and prepared by the biologic activity significantly not weakening antibody or maytansinoid molecule.Each antibody molecule coupling average 3-4 maytansinoid molecule shows effect in enhancing is for the cytotoxicity of target cell, and the function of antagonist or solubleness do not have negative impact, although estimate that the use than naked antibody is also strengthened cytotoxicity by the toxin of even each antibody band molecule.Maytansinoid class is well known in the art, and known technology can be used to synthesize or be separated from natural origin.Such as United States Patent (USP) 5,208,020 and other patent mentioned above and non-Patent Publication thing in disclose suitable maytansinoid class.Preferred maytansinoid class is aromatic nucleus or other position maytansinol analogue through modifying of maytansinol and maytansinol molecule, such as various maytansinol ester.

This area knows that many linking groups can be used for Dispersal risk-maytansinoid conjugate, comprise such as United States Patent (USP) 5,208,020 or European patent 0425235B1 and Charietal., CancerResearch52:127-131 (1992) in disclosed.Linking group comprises disulphide group, sulfide group, acid-unstable group, photo-labile group, the unstable group of peptase or the unstable group of esterase, disclosed in as mentioned previously in patent, preferred disulphide and sulfide group.

Multiple bifunctional protein coupling agent can be used to carry out the conjugate of Dispersal risk and maytansinoid, such as N-succinimido-3-(2-pyridyl dithio) propionic ester (SPDP), succinimido-4-(N-Maleimidomethyl) hexanaphthene-1-carboxylicesters, iminothiolane (IT), imido-ester (all example hydrochloric acid hexanedioyl imido acid dimethyl esters), active ester class (such as suberic acid two succinimido ester), aldehydes (such as glutaraldehyde), double azido compound (such as two (p-azido benzoyl base) hexanediamine), dual azepine derivatives (such as two (p-diazoniumbenzoyl)-quadrol), vulcabond (such as toluene 2, 6-vulcabond), with double activated fluorine cpd (such as 1, 5-bis-fluoro-2, 4-dinitrobenzene) dual-function derivative.Some coupling agent, comprise N-succinimido-3-(2-pyridyl dithio) propionic ester (SPDP) (Carlssonetal., Biochem.J.173:723-737 (1978)) and N-succinimido-4-(2-pyridylthio) valerate (SPP), provide disulfide linkage to connect.

According to the type connected, joint can be attached to multiple positions of maytansinoid molecule.Such as, conventional coupling techniques can be used by forming ester bond with the reaction of hydroxyl.Reaction can occur in there is hydroxyl C-3 position, through methylol modify C-14 position, through the C-15 position of hydroxyl modified and the C-20 position with hydroxyl.In a preferred embodiment, key connection is formed in the C-3 position of maytansinol or maytansinol analogue.

2.Auristatin and dolastatin

In some embodiment, immune conjugate comprises antibody (U.S. Patent No. 5,635,483 with dolastatin (dolastatin) or dolastatin peptide analogs or derivative such as auristatin coupling; 5,780,588).Dolastatin class and auristatin class have demonstrated to be disturbed microtubule dynamics, GTP hydrolysis and core and cell fission (Woykeetal (2001) Antimicrob.AgentsandChemother.45 (12): 3580-3584) and has anticancer (U.S. Patent No. 5,663,149) and anti-mycotic activity (Pettitetal (1998) Antimicrob.AgentsChemother.42:2961-2965).Dolastatin or auristatin drug moiety can be attached to antibody (WO02/088172) via the N of peptide drug moiety (amino) end or C (carboxyl) end.

Exemplary auristatin embodiment comprises monomethyl auristatin drug moiety DE and DF that N-end connects, be disclosed in " MonomethylvalineCompoundsCapableofConjugationtoLigands ", U.S. Patent Application Publication No.2005-0238649A1, is clearly collected herein by reference complete for its disclosure.

Typically, based on the drug moiety of peptide by forming peptide bond to prepare between two or more amino acid and/or peptide fragment.This type of peptide bond can be prepared (see E. according to the such as well-known liquid phase synthesizing method in chemistry of peptides field andK.L ü bke, ThePeptides, volume1, pp76-136,1965, AcademicPress).Auristatin/ dolastatin drug moiety can be prepared according to the method in Publication about Document: US5,635,483; US5,780,588; Pettitetal (1989) J.Am.Chem.Soc.111:5463-5465; Pettitetal (1998) Anti-CancerDrugDesign13:243-277; Pettit, G.R., etal.Synthesis, 1996,719-725; Pettitetal (1996) J.Chem.Soc.PerkinTrans.15:859-863; And Doronina (2003) NatBiotechnol21 (7): 778-784; U.S. Patent Application Publication No.2005-0238649A1, by its complete be collected herein by reference (disclose and such as prepare joint and the method that such as MMAE and MMAF is coupled to the monomethyl α-amino-isovaleric acid compound of joint).

3. calicheamicin

Another kind of interested immune conjugate comprises the antibody with one or more calicheamicin molecules coupling.Calicheamicin microbiotic family can generate double-strand DNA cleavage at sub-picomolar concentrations.About the preparation of calicheamicin family conjugate see United States Patent (USP) 5,712,374; 5,714,586; 5,739,116; 5,767,285; 5,770,701; 5,770,710; 5,773,001; 5,877,296 (all authorizing Cyanamid company of the U.S.).Available calicheamicin analog includes but not limited to γ ₁ ⁱ, α ₂ ⁱ, α ₃ ⁱ, N-ethanoyl-γ ₁ ⁱ, PSAG and θ ⁱ ₁(Hinmanetal., CancerResearch53:3336-3342 (1993); Lodeetal., CancerResearch58:2925-2928 (1998); And the above-mentioned United States Patent (USP) authorizing Cyanamid company of the U.S.).Can be QFA with the another kind of antitumor drug of antibody coupling, it be a kind of antifolic thing.Calicheamicin and QFA have action site in born of the same parents, and not easily through plasma membrane.Therefore, these reagent greatly strengthen their cytotoxic effect via the cellular uptake of antibody-mediated internalization.

4. other cytotoxic agent

BCNU, streptozocin (streptozoicin), vincristine(VCR) (vincristine), 5 FU 5 fluorouracil, United States Patent (USP) 5 can be comprised with other antineoplastic agent of antibody coupling, 053,394,5,770, the reagent family being referred to as LL-E33288 mixture recorded in 710 and Ai Sibo mycin class (esperamicins) (United States Patent (USP) 5,877,296).

Available enzyme activity toxin and fragment thereof comprise diphtheria toxin A chain, the nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa Pseudomonasaeruginosa), ricin (ricin) A chain, toxalbumin (abrin) A chain, capsule lotus root toxalbumin (modeccin) A chain, α-broom aspergillin (sarcin), tung oil tree (Aleutitesfordii) toxalbumin, Dianthus caryophyllus L. (dianthin) toxalbumin, dyers' grapes (Phytolacaamericana) toxalbumin (PAPI, PAPII and PAP-S), balsam pear (Momordicacharantia) inhibition, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonariaofficinalis) inhibition, gelonin (gelonin), NSC-69529 (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).See the WO93/21232 such as announced on October 28th, 1993.

In yet another aspect, immune conjugate can comprise antibody and have the compound of nucleolysis activity (as rnase or DNA endonuclease, such as deoxyribonuclease; DNA enzymatic).

In order to selective destruction tumour, immune conjugate can comprise anti-FGFR2 antibody and high radioactive atom.Multiple radio isotope can be used for the anti-FGFR2 antibody generating radiation coupling.Example comprises At ²¹¹, I ¹³¹, I ¹²⁵, Y ⁹⁰, Re ¹⁸⁶, Re ¹⁸⁸, Sm ¹⁵³, Bi ²¹², P ³², Pb ²¹²with the radio isotope of Lu.When conjugate is used for diagnosing, radioactive atom can be comprised and study for scitiphotograph, such as Tc ^99mor I ¹²³, or comprise spin label for nucleus magnetic resonance (NMR) imaging (also referred to as nuclear magnetic resonance, mri), such as iodo-123, iodine-131, indium-111, fluoro-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese or iron.

In a known way radioactivity or other marker can be mixed immune conjugate.Such as, can biosynthesizing peptide, or by chemical amino acid synthesis method synthetic peptide, wherein use and involve the suitable amino group acid precursor that such as fluoro-19 replace hydrogen.Marker can be adhered to by cysteine residues in peptide, such as Tc ^99mor I ¹²³, Re ¹⁸⁶, Re ¹⁸⁸and In ¹¹¹.Yttrium-90 can be adhered to through lysine residue.IODOGEN method (Frakeretal., Biochem.Biophys.Res.Commun.80:49-57 (1978)) can be used for mixing iodo-123." MonoclonalAntibodiesinImmunoscintigraphy " (Chatal, CRCPress, 1989) describe other method in detail.

d. antagonist and agonist

Provide the antagonist of IL-22.This antagonist comprises those (such as, anti-IL-22 antibody) of directly acting on IL-22 and those (such as, anti-IL-22R antibody) of affecting indirectly IL-22 activity.This antagonist is useful, such as, for 1) treat inflammatory conditions and autoimmune conditions, and 2) regulation and control IL-23 or IL-22 intracellular signaling.In a specific embodiment, the composition comprising the antagonist of IL-22 or IL-22R is useful for the amount of psoriatic tissue in reduction Mammals.In another specific embodiment, the composition comprising the antagonist of IL-22 or IL-22R is useful for inhibition tumor cell is bred partially or completely.

In one aspect, the antagonist of IL-22 is anti-IL-22 antibody or anti-IL-22R antibody.In certain embodiments, anti-IL-22 antibody is blocking antibody, and it completely or partially blocks the interaction of IL-22 and its acceptor.In certain embodiments, anti-IL-22RR antibody is blocking antibody, and it completely or partially blocks the interaction of IL-22R and IL-22.In certain embodiments, the extracellular ligand binding domains of anti-IL-22R antibodies IL-22R.Such as, anti-IL-22R antibody can in conjunction with the extracellular ligand binding domains of mankind IL-22R, and it finds in SEQIDNO:3 from about amino acid/11 8-228.

In yet another aspect, the antagonist of IL-22 is the oligopeptides in conjunction with IL-22 or IL-22R.In one embodiment, oligopeptides is in conjunction with the extracellular ligand binding domains of IL-22R.Oligopeptides can use known oligopeptides synthetic method chemically to synthesize, and maybe can use recombinant technology to prepare and purifying.This oligopeptides length is normally at least about 5 amino acid, or length is at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 amino acid.This oligopeptides can use known technology not identify with not needing undo experimentation.To this, notice, to few peptide library selection can the oligopeptides of specific binding polypeptide target thing be well known in the art (see, such as, U.S. Patent No. 5,556,762,5,750,373,4,708,871,4,833,092,5,223,409,5,403,484,5,571,689,5,663,143; Open No.WO84/03506 and WO84/03564 of PCT; Geysenetal., Proc.Natl.Acad.Sci.U.S.A., 81:3998-4002 (1984); Geysenetal., Proc.Natl.Acad.Sci.USA, 82:178-182 (1985); Geysenetal, in SyntheticPeptidesasAntigens, 130-149 (1986); Geysenetal., J.Immunol.Meth., 102:259-274 (1987); Schoofsetal., J.Immunol, 140:611-616 (1988); Cwirla, S.E.etal. (1990) Proc.Natl.Acad.Sci.USA, 87:6378; Lowman, H.B.etal. (1991) Biochemistry, 30:10832; Clackson, T.etal. (1991) Nature, 352:624; Marks, J.D.etal. (1991) J.Mol.Biol, 222:581; Kang, A.S.etal. (1991) Proc.Natl.Acad.Sci.USA, 88:8363; And Smith, G.P. (1991) CurrentOpin.Biotechnol, 2:668).In certain embodiments, oligopeptides can be coupled to cytotoxic agent.

In yet another aspect, the antagonist of IL-22 is different from oligopeptides described here or antibody, organic molecule in conjunction with IL-22 or IL-22R.Organic molecule can be, such as, and small molecules.In one embodiment, organic molecule is in conjunction with the extracellular domain of IL-22R.Organic molecule in conjunction with IL-22 or IL-22R can use known method (such as, see, open No.WO00/00823 and WO00/39585 of PCT) identify and chemically synthesize.The usual size of this organic molecular species is less than about 2000 dalton, or size is less than about 1500,750,500,250 or 200 dalton, wherein known technology can be able to be used not need excessive experiment to identify in conjunction with this organic molecular species of IL-22 or IL-22R., notice, can the technology of molecule of Binding peptide target thing be (such as, see, open No.WO00/00823 and WO00/39585 of PCT) well known in the art to organic molecule library screening at this point.In certain embodiments, organic molecule can be coupled to cytotoxic agent.

In yet another aspect, IL-22 antagonist is solvable IL-22 acceptor, such as, and non-membrane-bound IL-22R form.The IL-22R of this soluble form can with membrane-bound IL-22R competition binding IL-22.In certain embodiments, the IL-22R of soluble form can comprise all parts or the ligand binding moiety of the extracellular domain of IL-22R, such as, comprises all parts or the ligand binding moiety of the amino acid/11 8-228 of SEQIDNO:3.In certain embodiments, the IL-22R of soluble form lacks membrane spaning domain.Such as, the soluble form of mankind IL-22R can lack all of the membrane spaning domain of the about amino acid 229-251 of SEQIDNO:3 or substantial part.

Report the soluble receptor of the natural generation of IL-22.See DumoutierL.etal., " CloningandcharacterizationofIL-22bindingprotein; anaturalantagonistofIL-10-relatedTcell-derivedinduciblef actor/IL-22, " J.Immunol.166:7090-7095 (2001); And XuW.etal., " AsolubleclassIIcytokinereceptor, IL-22RA2, isanaturallyoccurringIL-22antagonist, " Proc.Natl.Acad.Sci.U.S.A.98:9511-9516 (2001).In this area, this acceptor is variously referred to as " IL-22BP " or " IL-22RA2 ".The sequence of mankind IL-22BP shows in the diagram.Term " IL-22BP " or " IL-22 associated proteins " refer to from any vertebrate origin as used herein, such as primates is (such as to comprise Mammals, the mankind and monkey) and rodent is (such as, Mouse and rat) any natural IL-22BP, unless otherwise stated.

In yet another aspect, the antagonist of IL-22 is antisense nucleic acid, and it reduces the expression (that is, it reduces the translation of transcribing of IL-22 or IL-22R gene and/or IL-22 or IL-22RmRNA) of IL-22 or IL-22R gene.In certain embodiments, antisense nucleic acid combines the nucleic acid (DNA or RNA) of coding IL-22 or IL-22R.In certain embodiments, antisense nucleic acid is the oligonucleotide (comprise between two end points institute a little) that length is about 10-30 Nucleotide.In certain embodiments, antisense oligonucleotide comprises sugar-phosphodiester trunk (or other sugared key of modification, comprise phosphorothioate bond and the key as described in WO91/06629), the sugar-phosphodiester trunk of wherein this modification has resistance to endogenous nuclease.In one embodiment, antisense nucleic acid is oligodeoxyribonucleotide, and it causes the degraded of mRNA and/or the transcribing or translating of reduction of coding IL-22 or IL-22R.In certain embodiments, antisense nucleic acid is the RNA of the expression being reduced target nucleic acid by " RNA interference " (" RNAi ").For the summary of RNAi, see, such as, Novinaetal. (2004) Nature430:161-164.This RNA derives from, such as, and short interfering rna (siRNA) and microRNA.Such as, the double-strand oligoribonucleotide that siRNA can be about 18-26 Nucleotide as length synthesizes.See above.

In yet another aspect, the agonist of IL-22 is provided.Exemplary agonist includes, but not limited to natural IL-22 or IL-22R; Maintain the fragment of IL-22 or IL-22R of at least one activity of natural polypeptides, variant or modified forms; Can in conjunction with and activate the reagent of IL-22R; And the reagent of the overexpression of the nucleic acid of induction IL-22 or IL-22R or coding IL-22 or IL-22R.

e. medicinal proportional preparation

The invention provides medicinal proportional preparation.In one embodiment, medicinal proportional preparation comprises: 1) active agents, such as any polypeptide mentioned above, antibody, agonist or antagonist; With 2) pharmacopedics acceptable carrier.In another embodiment, medicinal proportional preparation comprises other therapeutical agent of at least one further.

Treatment preparaton will be by having the medicament and optional pharmacopedics acceptable carrier, vehicle or stablizer (Remington ' sPharmaceuticalSciences of expecting purity, 16thedition, Osol, A.Ed., 1980) mix, supply storage with the form preparation of freeze-dried formulation or the aqueous solution.Acceptable carrier, vehicle or stablizer are nontoxic in adopted dosage and concentration to recipient, comprise buffer reagent, such as phosphoric acid salt, Citrate trianion and other organic acid; Antioxidant, comprises xitix and methionine(Met); Sanitas (such as octadecyl dimethyl benzyl ammonium chloride; Hexamethonium chloride; Benzalkonium chloride, benzethonium chloride; Phenol, butanols or phenylcarbinol; Alkyl paraben, such as methyl p-hydroxybenzoate or propyl ester; Pyrocatechol; Resorcinol; Hexalin; 3-amylalcohol; And meta-cresol); Lower molecular weight (being less than about 10 residues) polypeptide; Protein, such as serum albumin, gelatin or immunoglobulin (Ig); Hydrophilic polymer, such as polyvinylpyrrolidone; Amino acid, such as glycine, glutamine, l-asparagine, Histidine, arginine or Methionin; Monose, disaccharides and other carbohydrate, comprise glucose, seminose or dextrin; Sequestrant, such as EDTA; Carbohydrate, such as sucrose, N.F,USP MANNITOL, trehalose or sorbyl alcohol; Salify gegenion, such as sodium; Metal composite (such as Zn-protein complex); And/or nonionogenic tenside, such as TWEEN ^tM, PLURONICS ^tMor polyoxyethylene glycol (PEG).

Fat transfection or liposome also can be used for medicament to deliver into cell.If medicament is antibody fragment, then the minimum inhibition fragment of preferred specific binding target protein.Such as, according to the variable region sequences of antibody, the peptide molecule retained in conjunction with target protein sequence ability can be designed.This type of peptide can chemosynthesis and/or by recombinant DNA technology generate (see such as Marascoetal, Proc.Natl.Acad.Sci.USA90:7889-7893 [1993]).Antibody disclosed herein also can be mixed with immunoliposome.The method known by this area prepares the liposome comprising antibody, such as Epsteinetal., Proc.Natl.Acad.Sci.USA82:3688 (1985); Hwangetal., Proc.Natl.Acad.Sci.USA77:4030 (1980); And U.S. Patent No. 4,485,045 and 4,544, described in 545.U.S. Patent No. 5,013, discloses the liposome extended cycling time in 556.Useful especially liposome can be generated by reverse phase evaporation with the lipid composition containing phosphatidylcholine, cholesterol and PEG derivatization phospholipid acyl thanomin (PEG-PE).Liposome is pushed through the filter having and limit aperture, to produce the liposome with desired diameter.Can by the Fab ' fragment of antibody of the present invention through disulfide exchange reaction and liposome coupling, as described in Martinetal., J.Biol.Chem.257:286-288 (1982).Optionally in liposome, comprise chemotherapeutics (such as Dx).See Gabizonetal., J.NationalCancerInst.81 (19): 1484 (1989).

Medicament also can wrap be loaded in such as by (being such as Walocel MT 20.000PV or gelatin-microcapsule and poly-(methyl methacrylate) microcapsule respectively) in condensation technique or the microcapsule prepared by interfacial polymerization, in colloidal drug delivery system (such as liposome, albumin microspheres, microemulsion, nano particle and Nano capsule) or in macro emulsion.This type of technology is disclosed in such as Remington ' sPharmaceuticalSciences, 16thedition, Osol, A.Ed., and 1980.

The extended release preparation of medicament can be prepared.The suitable example of extended release preparation comprises the solid hydrophobic polymers semipermeable matrices containing medicament, and this matrix is the form of standardized product, such as film or microcapsule.The example of sustained-release matrix comprises polyester, hydrogel (such as poly-(2-hydroxyethyl-methacrylic ester) or poly-(vinyl alcohol)), polylactide (U.S. Patent No. 3,773,919), multipolymer, nondegradable ethane-acetic acid ethyenyl, the degradable lactic acid-ethanol copolymer such as LUPRONDEPOT of Pidolidone and Pidolidone γ ethyl ester ^tM(the Injectable microspheres body be made up of lactic acid-ethanol copolymer and leuprorelin acetate) and poly-D-(-)-3-hydroxybutyrate.Although the such as polymkeric substance such as ethane-acetic acid ethyenyl and lactic acid-ethanol can discharge molecule and reach more than 100 days, the time of some hydrogel release protein is shorter.When the antibody encapsulated maintains in vivo for a long time, they may, owing to being exposed to the wet environment of 37 DEG C and sex change or gathering, cause loss of biological activity and immunogenicity to change.Stabilization strategy reasonable in design can be carried out according to related mechanism.Such as, if find that aggregation of multiple is the intermolecular S-S key formation via sulphur-disulfide exchange, so by modifying sulfhydryl residue, being suitable for additive and developing particular polymers substrate composition realizing stablizing by acidic solution freeze-drying, controlling moisture, employing.

Medicinal proportional preparation herein also can concrete indication is necessary exceedes a kind of active compound containing to treat to some extent.Such as, on the one hand, comprise containing the medicinal proportional preparation exceeding a kind of active compound: 1) at least one IL-22 antagonist, such as, in conjunction with the antibody of IL-22 and/or the antibody in conjunction with IL-22R; With 2) at least one is in conjunction with antibody listed in the antibody (wherein can with 2 of any number of any combination selection) of IL-19, IL-20, IL-24, IL20Ra, IL-20Rb or IL-10R2).On the other hand, medicinal compositions comprises the active compound that two or more have complementary activity.Such as, in one embodiment, medicinal compositions can comprise: 1) at least one IL-22 antagonist, such as, in conjunction with the antibody of IL-22 and/or the antibody in conjunction with IL-22R; With 2) antagonist of TNF-α or IL-12.Another aspect, can comprise cytotoxic agent or growth inhibitor containing the medicinal proportional preparation exceeding a kind of active compound.

f. methods for the treatment of

Provide the methods for the treatment of using any above-mentioned composition or medicinal proportional preparation.Unless otherwise stated, these methods comprise the methods for the treatment of in external, ex vivo (exvivo) and body.In all fields, the method for the signal transduction path stimulating or suppress IL-23 mediation is provided.Provide and stimulate or suppress Th _iL-17the method of cell function.Additionally provide the method for the treatment of inflammatory and/or autoimmune conditions.Further provide the method for the treatment illness relevant to IL-23 or IL-22 intracellular signaling.Additionally provide treatment Th _iL-17the method of the illness of mediation.The following provide these and other aspects of the present invention.

In one aspect, provide the method for the signal transduction path of IL-23 mediation in stimulating organism system, described method comprises provides IL-22 agonist to described biology system.Such as, department of biology's turnkey draws together the mammalian cell in cell culture system in vitro or in organism body.Simulate psoriatic exemplary biology system to provide in an embodiment, comprise human epidermal (RHE) (embodiment 14) or the animal model (embodiment 16) of reconstruct.In one embodiment, IL-22 agonist is IL-22.In yet another aspect, provide the method for the signal transduction path suppressing IL-23 mediation in biology system, described method comprises provides IL-22 antagonist to described biology system.In one embodiment, the antagonist of IL-22 is antibody, such as neutrality anti-IL-22 antibody and/or the anti-IL-22R antibody of neutrality.

In yet another aspect, stimulation Th is provided _iL-17the method of cell function, described method comprises makes Th _iL-17cell is exposed to IL-22 agonist.In one embodiment, IL-22 agonist is IL-22.In yet another aspect, suppression Th is provided _iL-17the method of cell function, described method comprises makes Th _iL-17cell is exposed to IL-22 antagonist.In one embodiment, IL-22 antagonist is antibody, such as neutrality anti-IL-22 antibody and/or the anti-IL-22R antibody of neutrality.Exemplary Th _iL-17cell function includes, but not limited to the immunity (delayed type hypersensitivity) of irritation cell mediation; Innate immune cells, such as medullary cell (such as, monocyte and neutrophil(e) cell) raising to inflammation part; And stimulate inflammatory cell to the infiltration in tissue.In one embodiment, Th _iL-17cell function is mediated by IL-23.

In yet another aspect, provide the method for the treatment of inflammation, described method comprises the medicinal proportional preparation comprising the antagonist of IL-22 of the administration significant quantity to this treatment of needs.In one embodiment, the antagonist of IL-22 is antibody, such as neutrality anti-IL-22 antibody and/or the anti-IL-22R antibody of neutrality.Inflammation comprises, but be not limited to, autoimmune inflammation (inflammation relevant to autoimmune conditions), chronic inflammatory diseases, skin inflammation, arthritic inflammation (comprising the inflammation relevant with rheumatoid arthritis) and Systemic Inflammatory are replied.In one embodiment, inflammation is mediated by IL-23.

In yet another aspect, provide the method for the treatment of autoimmune conditions, described method comprises the medicinal proportional preparation comprising the antagonist of IL-22 of the administration significant quantity to this treatment of needs.In one embodiment, the antagonist of IL-22 is antibody, such as neutrality anti-IL-22 antibody and/or the anti-IL-22R antibody of neutrality.Autoimmune conditions comprises, but be not limited to, connective tissue disease, multiple sclerosis, systemic lupus erythematous, inflammatory arthritis are (such as, rheumatoid arthritis), the autoimmune inflammation of autoimmunity pneumonia, guillain-Barre syndrome, autoimmune thyroiditis, insulin-dependent diabetes, uveitis, myasthenia gravis, graft versus host disease, autoimmune inflammatory illness in eye, psoriatic, the sacroiliitis relevant to autoimmunity (such as, rheumatoid arthritis), brain and inflammatory bowel.In one embodiment, described autoimmune conditions is the autoimmune conditions of IL-23 mediation.

In specific at one, provide treatment psoriatic and/or with the method for the psoriatic symptom illness that is feature.Psoriatic is considered to a kind of autoimmune disorder, the protein wherein in immune T cell identification skin and attack and find the region of this protein, squamous pathology that cause the too fast growth of new skin cells and misery, that improve.The super propagation that these characteristics of lesion are keratinocyte and the accumulation of T cell activated in the epidermis of psoriatic lesions.Although the starting molecule reason of disease is unknown, genetic linkage (Psor7 on Psor and 1p on Psor5,19pl3 on Psor4,3q21 on Psor3,1cent-q21 on Psor2,4q on Psor1,17q on 6p21.3) is depicted at least 7 kinds of psoriatic susceptible gene seats.These locus certain some relevant to other autoimmunity/inflammatory diseasess, comprise rheumatoid arthritis, atopic dermatitis or inflammatory bowel (IBD).Treat psoriatic current method to comprise and use IL-12 or TNF-alpha-2 antagonists.See, such as Nickoloffetal. (2004) J.Clin.Invest.113:1664-1675; Bowcocketal. (2005) Nat.Rev.Immunol.5:699-711; Kauffmanetal. (2004) J.Invest.Dermatol.123:1037-1044.But data provided herein have implied there is different IL-23/IL-22 signal transduction paths in psoriatic nosogenesis.Thus, the therapeutical agent regulating and controlling this signal transduction path can provide a kind of and select, and maybe can supplement other curing psoriasis method.

In one embodiment, treat psoriatic method and comprise the medicinal proportional preparation comprising IL-22 antagonist using significant quantity to patient.In one embodiment, the antagonist of IL-22 is antibody, such as neutrality anti-IL-22 antibody and/or the anti-IL-22R antibody of neutrality.In various embodiments, described method comprises and using (in same medicinal proportional preparation or the medicinal proportional preparation that separates) at least one else treatment reagent further.In a kind of such embodiment, other treatment reagent described is at least one antagonist of the cytokine being selected from IL-19, IL-20 and IL-24.This antagonist includes, but not limited to the antibody in conjunction with IL-19, IL-20, IL-24, IL-20Ra, IL-20Rb or IL-10R2.These antibody of any number can be selected with any combination.In another embodiment, described other treatment reagent be known in psoriatic treatment effective reagent.Some such treatment reagent is on the books, such as, and Nickoloffetal. (2004) J.Clin.Invest.113:1664-1675; Bowcocketal. (2005) Nat.Rev.Immunol.5:699-711; With Kauffmanetal. (2004) J.Invest.Dermatol.123:1037-1044.These reagent include, but are not limited to, the treatment reagent of targeting T-cells, such as efalizumab and/or alefacept; The antagonist of IL-12, such as, in conjunction with the blocking antibody of IL-12 or its acceptor; And the antagonist of TNF-α, such as, in conjunction with the blocking antibody of TNF-α or its acceptor.

In yet another aspect, provide the method for Tumor suppression development, described method comprises the medicinal proportional preparation comprising the antagonist of IL-22 to administration significant quantity.In one embodiment, the antagonist of IL-22 is antibody, such as neutrality anti-IL-22 antibody and/or the anti-IL-22R antibody of neutrality.In one embodiment, tumor development is mediated by IL-23.

Composition of the present invention (such as, polypeptide, antibody, antagonist, agonist and comprise any above-mentioned medicinal proportional preparation) be administered to Mammals according to known method, the preferred mankind, such as, as injecting or being used by the intravenously of the continuous infusion of for some time, by intramuscular, endoperitoneal, brain keel, subcutaneous, IA, intrasynovial, sheath, oral cavity, body surface or suck (in nose, in lung) path.It is preferred that the intravenously of polypeptide and antibody or suction are used.

In certain embodiments, antitumor and anticancer agent use can with composition of the present invention use combination.Such as, antitumor and anticancer agent (chemotherapeutics) or radiotherapy can also be accepted with the patient that composition of the present invention is treated.The preparation of this chemotherapeutics and dosage regimen can according to the specification sheetss of producer or as skilled practitioners empirically determined use.Preparation and the dosage regimen of this chemotherapy are also recorded in ChemotherapyServiceEd., M.C.Perry, Williams & Wilkins, Baltimore, MD (1992).Chemotherapeutics can prior to or be later than using of described composition, or can to give with it simultaneously.In addition, estrogen antagonist compound such as tamoxifen or Mifepristone such as onapristone (see, EP616812) also can give with the dosage that these molecules are known.

Desirably also may use the antibody of that be correlated with for other diseases or that tumour is correlated with antigen, such as, in conjunction with the antibody of CD20, CD11a, CD18, ErbB2, EGFR, ErbB3, ErbB4 or blood vessel endothelial factor (VEGF).Or/in addition, jointly can be administered to patient in conjunction with two or more antibody that are identical or two or more different antigens disclosed herein.In certain embodiments, it is beneficial that also one or more cytokines may be used to patient.In certain embodiments, composition of the present invention and growth-inhibiting reagent are used jointly.Such as, growth-inhibiting reagent can before the using of composition, use afterwards or side by side.The suitable dosage of growth-inhibiting reagent is exactly those of current use, and can be lowered due to the compound action (synergy) of growth-inhibiting reagent and composition.

For treatment or reduce the severity of immunological disease, the dosage be applicable to of composition of the present invention by depend on as the type of the disease that will treat defined above, the severity of disease and process, the reagent used be prevention or therapeutic purpose, previous treatment, patient history of disease and to the response of compound and the judgement of attending doctor.Disposable or in a series for the treatment of, compound is suitably administered to patient.

Such as, depend on type and the severity of disease, the polypeptide of about 1 μ g/kg to 15mg/kg (such as, 0.1-20mg/kg) or antibody are the initial candidate dosage used to patient, such as, be no matter by using of separating of one or many or by continuous print infusion.Typical every per daily dose from about 1 μ g/kg to 100mg/kg or more, can depend on above-mentioned factor.For continuing several days or repetitive administration for more time, depending on its situation, continuing to carry out treating until produce the suppression to disease symptoms expected.But other dosage regimens are also useful.The progress of easily monitor therapy can be carried out by the technology of routine and assay method.

g. diagnostic method and detection method

In one aspect, provide psoriatic method in diagnosis Mammals, described method comprises the expression level detected available from the gene of IL-22 or IL-22R polypeptide of encoding in described mammiferous histiocytic test sample, wherein compare expression level higher in the test sample with control sample (such as, same cell type, known normal histiocytic sample) and show to there is psoriatic in the Mammals obtaining described test sample.Detection can be qualitatively or quantitative.In one embodiment, described test sample comprises blood or serum.In one embodiment, the expression level detecting the gene of coding IL-22 or IL-22R polypeptide comprises (a) makes anti-IL-22 or anti-IL-22R antibody contacts available from described mammiferous test sample, and (b) detects the formation of mixture between antibody and IL-22 or IL-22R polypeptide described in described test sample.Described antibody can be connected with detectable.Mixture is formed and can pass through, and such as, optical microscopy, flow cytometry, fluorometry or other technology known in the art are monitored.Test sample can suffer from psoriatic individuality available from suspection.

In one embodiment, the expression level detecting the gene of coding IL-22 or IL-22R polypeptide comprises the mRNA transcriptional level detected from described gene.MRNA transcriptional level can detect quantitatively or qualitatively by various method well known by persons skilled in the art.MRNA transcriptional level also can directly or indirectly detect by the level detecting the cDNA produced from described mRNA.The exemplary method detecting mRNA transcriptional level includes, but not limited to real-time quantitative RT-PCR and the assay method based on hybridization, comprises the assay method based on microarray and the assay method based on filter membrane, such as Northern trace.

In another embodiment, the present invention relates to diagnostic kit, it contains anti-IL-22 in applicable packaging or anti-IL-22R antibody.Described test kit is preferably containing the specification sheets using described antibody to detect IL-22 or IL-22R polypeptide.In one aspect, described diagnostic kit is psoriatic diagnostic kit.

h. assay method

1. based on assay method and the animal model of cell

Useful based on the assay method of cell and the animal model of immunological disease in enforcement certain embodiments of the present invention.Some assay method based on cell provided below in an example is useful, such as, for the effect of test I L-22 antagonist or agonist.

In body, animal model is also useful for enforcement certain embodiments of the present invention.Also describe exemplary animal model below in an example.In the body of these models, character makes them be predictability for the response in human patients.The animal model of immune correlated disease comprises (genetically modified) animal that is nonrecombinant and restructuring.Non-recombinant animal model comprises, and such as, rodent, as mouse model.This model can by use standard technique cell is imported homogenic mouse to produce, such as, subcutaneous injection, tail vein injection, spleen implant, intraperitoneal implant, under the scrotum implant, etc.

Graft versus host disease model provides the means of assessment for the t cell responses of MHC antigen and secondary graft antigen.When immunologically competent cell is transplanted in patient that is immunosuppressant or that tolerate, graft versus host disease occurs.Donorcells identification also replys host antigen.Response can from life-threatening extensive inflammation to the slight state of an illness of suffering from diarrhoea and lose weight.The applicable code of evaluation graft versus host disease, at CurrentProtocolsinImmunology, sees above, describes in detail in unit 4.3.

The animal model that skin allograft repels is the means of ability that test T cell mediation in-vivo tissue destroys, and the tolerance of their effects in transplant rejection.Most of common and generally acknowledged model use mouse tail skin graft.The experiment repeated has shown skin allograft repulsion and has been mediated by T cell, helper cell and lethal effect device T cell instead of antibody.Auchincloss，H.Jr.andSachs，D.H.，FundamentalImmunology，2nded.，W.E.Pauled.，RavenPress，NY，1989，889-992。At CurrentProtocolsinImmunology, above, applicable code is described in detail in unit 4.4.Other transplant rejection models that may be used for testing compound of the present invention are Tanabe, M.etal, Transplantation (1994) 58:23 and Tinubu, the Alloqeneic Heart graft model that S.A.etal, J.Immunol. (1994) 4330-4338 describes.

Contact hypersensitivity reaction is the simple In vivo analysis of cell-mediated immunologic function (delayed type hypersensitivity).In this process, Dermal exposure is in the external source haptens causing delayed type hypersensitivity, and described delayed type hypersensitivity is measured and quantitative.Tactiosensible property relates to the initial sensitization stage (sensitizingphase), is then initiating stage (elicitationphase).When T lymphocyte meets with their previously contacted antigen, there is initiating stage.There is swelling and inflammation, make it become the fabulous model of mankind's contact dermatitis.At CurrentProtocolsinImmunology, Eds.J.E.Cologan, A.M.Kruisbeek, D.H.Margulies, E.M.ShevachandW.Strober, JohnWiley & Sons, Inc., applicable code is described in 1994, unit4.2. in detail.Also can see Grabbe, S.andSchwarz, T, Immun.Today19 (1): 37-44 (1998).

In addition, composition of the present invention can be tested on the animal model of psoriasiform disease.Such as, test in the scid/scid mouse model that composition of the present invention can describe at Schon, M.P.etal, Nat.Med. (1997) 3:183, its small mouse presents and is similar to psoriatic Histopathologic skin injury.The another kind of model be applicable to is the human skin/scid mouse Chimera prepared as described in Nickoloff, B.J.etal, Am.J.Path. (1995) 146:580.The another kind of model be applicable to is at Boymanetal., describe in JExpMed (2004) 199 (5): 731-6, wherein before the mankind, psoriatic (prepsoriatic) skin is transplanted on AGR129 mouse, causes the generation/development of psoriatic skin injury.

The knock-out animal of gene being coded in the polypeptide of this qualification that tool is defective or change can be built, as the result of homologous recombination between the DNA molecular that native gene and this gene of coded polypeptide has changed.Such as, the cDNA of encoding specific polypeptides may be used for the genomic dna according to this polypeptide of technology clones coding set up.The part of the genomic dna of encoding specific polypeptides can be deleted or replace with another kind of gene, such as, and the gene of the mark selected for monitoring integration of encoding.Usually, the constant flanking DNA of several thousand bases (5 ' and 3 ' two ends) be included in the carrier [description of homologous recombination vector see, such as ThomasandCapecchi, Cell, 51:503 (1987)].Carrier is imported in embryonic stem cell line (such as, passing through electroporation), and select the DNA that wherein imports and interior source DNA homologous recombination cell [see, such as Lietal., Cell, 69:915 (1992)].The cell selected is then injected into animal (such as, mouse or rat) blastocyst in formed aggregation chimera [see, such as Bradley, in TeratocarcinomasandEmbryonicStemCells:APracticalApproach, E.J.Robertson, ed. (IRL, Oxford, 1987), pp.113-152].Then, chimeric embryo can implant in the pregnant female foster animal of applicable puppet, and makes embryo's full-term pregnancy to create " knocking out " animal.The filial generation of carrying the DNA of homologous recombination in their sexual cell can be identified by standard technique, and all cells for cultivating wherein animal contains the animal of the DNA of homologous recombination.Knock-out animal can be characterised in that, such as, the ability that they resist some pathological condition owing to lacking described polypeptide, pathological condition occurs/develops with them.

2. the screening assay method of drug candidates

The screening assay method design of drug candidates is in order to qualification and the polypeptide identified at this or its biological active fragment is combined or compound or infect the interactional compound of polypeptide and other cell proteins.This screening strength can stand the high flux screening of chemical library by comprising, make them be particularly suitable for identifying the assay method of small molecule drug candidates.Contemplated small molecules comprises the organic or inorganic compound of synthesis, comprise peptide, preferred solvable peptide, (many) peptide-immunoglobulin-fusions and particularly, antibody, include but not limited to, chimeric or the humanized version of polyclonal antibody and monoclonal antibody and antibody fragment, single-chain antibody, antiidiotypic antibody and these antibody or fragment, and human antibodies and antibody fragment.Can implement assay method in a variety of manners, comprise protein-protein binding assay, biological chemistry screening assay method, immunoassay and the assay method based on cell, they are this area well-characterized.All assay methods require at them the polypeptide Contact test compound certain time being used in this qualification under certain condition, are enough to allow that described polypeptide and test compounds interaction aspect are common.

In binding assay, interaction combines, and the mixture of formation can be separated and detect in the reactive mixture.In a specific embodiment, polypeptide or test compounds are fixed on by covalency or non-covalent attachment in solid phase, such as, on microtiter plate.Non-covalent attachment generally by with the solution bag of polypeptide or test compounds by solid surface and drying realize.Such as, or fixing antibody, may be used for polypeptide to be anchored on solid surface to the monoclonal antibody of the polypeptide that will fix.By being added into frozen composition by with the nonimmobilized component of detectable label substance markers, such as, the bag containing anchored component is surperficial, carries out assay method.When the reactions are completed, unreacted composition is removed, and such as, by washing, detects the mixture being anchored on solid surface.When initial nonimmobilized component is with detectable, the detecting of marker being fixed on surface shows to there occurs compound.When initial nonimmobilized component does not carry marker, such as, the antibody of the tape label thing of the mixture fixed by using specific binding, can detect compound.

If test compounds is interacting at but is not incorporated into the specific polypeptide in this qualification, the interaction of it and this protein can be measured by the known method detecting protein-protein interaction.This assay method comprises traditional method, such as, and crosslinked, co-immunoprecipitation and the copurification by gradient or chromatography column.In addition, protein-protein interaction can pass through as ChevrayandNathans, Proc.Natl.Acad.Sci.USA89, disclosed by 5789-5793 (1991), to use Fields and colleague to record genetic system [FieldsandSong based on yeast, Nature (London) 340,245-246 (1989); Chienetal, Proc.Natl.Acad.Sci.USA88,9578-9582 (1991)] monitor.Many transcriptional activation agent, such as yeast GAL4, be made up of two physically discrete modular structural domains, an effect playing DNA binding domains, and another plays the function of transcriptional activation domain.The yeast expression system (being commonly referred to as " two-hybrid system ") described in above-mentioned disclosure make use of this character, have employed two kinds of hybrid proteins (hybridprotein), in one, target protein merges the DNA binding domains to GAL4, in another kind, candidate's activator matter merges to activation structure territory.The reconstruct of the GAL4 activity via protein-protein interaction is depended in expression under the control of the promotor that GAL1-lacZ reporter gene activates at GAL4.The bacterium colony containing interaction polypeptide is detected with the product look substrate of beta-galactosidase enzymes.For the complete kit (MATCHMAKER using two-hybrid techniques to identify the protein-protein interaction between two kinds of specified proteins ^tM) can buy from Clontech.This system also can expand to drafting and relate to the interactional protein domain of specified protein, and location is to these conclusive amino-acid residues that interacts.

Disturbing in the polypeptide and other cells of this qualification or the interactional compound of extracellular components to identify, the reaction mixture containing described polypeptide and described composition can be prepared under the condition of allowing described polypeptide and described interaction between component.Interactional ability is suppressed, the preparation feedback mixture when lacking or there is described test compounds in order to test test compounds.If the interaction of described polypeptide and described composition reduces when there is described test compounds, then described test compounds is claimed to suppress the interaction of described polypeptide and described composition.

In certain embodiments, identifying that the agonist of IL-22 or IL-22R polypeptide or the method for antagonist comprise makes IL-22 or IL-22R polypeptide contact potential agonist or antagonist molecules also measurement detectable change in one or more usually relevant to described IL-22 or IL-22R polypeptide biologic activity.These activity include but not limited to, describe below in an example those.

3. antibodies assay method

Antibodies research can be carried out with any known assay method, such as, and competitive binding assay method, directly and indirectly/sandwich formula assay method and immunoprecipitation assay.Zola，MonoclonalAntibodies：AManualofTechniques，PP.147-158(CRCPress，Inc.，1987)。

Competitive binding assay method relies on the standard substance of mark to compete the ability of the combination to limited amount antibody with test sample analytes.The amount of test sample target protein matter is inversely proportional to the amount of the standard substance being bonded to antibody.For the ease of measuring the amount of standard substance combined, preferably before or after described competition, make antibody insoluble, thus be bonded to the standard substance of antibody and analyte can separate with the unconjugated standard substance of maintenance and analyte easily.

Sandwich assay relates to use two kinds of antibody, and each can both in conjunction with the different immunogenic portion of the protein that will detect, or epi-position.In sandwich assay, the first antibody that test sample analytes is fixed on solid support combines, and after this second antibody is bonded to described analyte, thus forms three insoluble moiety complex.See, such as, U.S. Patent No. 4,376,110.Second antibody can self with can detection module mark (direct sandwich assay), maybe can use with can detection module mark AIA measure (indirect sandwich formula assay method).Such as, the sandwich assay of a type is ELISA assay method, can detection module be wherein enzyme.

Immunohistochemistry also may be used for the cell position determining the antigen that antibody combines.For immunohistochemistry, tissue sample can be fresh or freezing, maybe can be embedded into paraffin and fix with sanitas such as formalin.

i. mechanicals

In yet another aspect, provide comprise for illness as above diagnosis or treat the goods of useful composition.Described goods comprise container and specification sheets.The container be applicable to comprises, such as, and bottle, bottle, syringe and test tube.Described container can be made up of various material such as glass or plastics.Container is equipped with diagnosis for described illness or treatment effective composition, and can have aseptic access port (such as, described container can be have can by the intravenous solution bag of the stopper of subcutaneous injection needle-penetration or bottle).Active agent in composition polypeptide normally of the present invention, antibody, agonist or antagonist.The specification sheets be connected on container or with described container or label list understand that described composition is for diagnosing or treating selected illness.Described goods may further include second container, the acceptable damping fluid of pharmacopedics are wherein housed, such as phosphate buffered saline (PBS), Ringer's solution and dextrose solution.It may further include other the desirable materials from business and user's position, comprises the package insert of other damping fluid, thinner, filter, pin, syringe and band working instructions.

In one embodiment, the invention provides a kind of goods, comprising:

A () comprises the composition of the agonist of IL-22 or IL-22R or the material of antagonist;

B () is equipped with the container of described composition; With

(c) additional label on the container, or comprise package insert in the above-described container, use described antagonist about in the treatment of Ia disease or cancer.Described composition can include the antagonist of effective amount.

There is provided following examples only in order to illustration purpose, intention limits the scope of the invention absolutely not.

The all patents quoted in this manual and reference are by quoting income completely herein.

Embodiment

Unless otherwise stated, the commercially available reagent mentioned in embodiment uses according to the specification sheets of producer.American type culture collection (AmericanTypeCultureCollection, Manassas, VA) with the source of those cells of ATCC registration number qualification in the examples below and in whole specification sheets.

Embodiment 1: the generation of anti-IL-22 and anti-IL-22R antibody

This example illustrates the preparation of the monoclonal antibody of specific binding IL-22 or IL-22R.For the production of monoclonal antibody technology based on known in the art those, such as, at Goding, have description with upper.The immunogen adopted is the mankind IL-22R (hIL-22R) of the mankind IL-22 (hIL-22) of the purifying of total length or the purifying of total length.Briefly, hIL-22 or the hIL-22R immunogen immune mouse of the about 1-100 microgram of emulsification in adjuvant is used in.Then the mouse of extra immunogen to immunity being used in emulsification in adjuvant after 10 to 12 days is strengthened.Periodically obtain serum sample from mouse, test in ELISA assay method, be used for detecting anti-IL-22 or IL-22R antibody.

After detecting applicable antibody titers, will be the sacrifice of animal of " positive " for antibody, results splenocyte.Then the myeloma cell line of splenocyte and mouse is merged (using 35% polyoxyethylene glycol).Merge and produce hybridoma, cloned and cultivate in the substratum containing HAT (xanthoglobulin, aminopterin and thymidine).The reactivity of hybridoma for IL-22 or IL-22R is screened in ELISA.(see Fig. 5).Fig. 5 is shown in the list of the antibody that those hybridomas produce and their corresponding properties.

Embodiment 2:IL-22 intracellular signaling is by anti-IL-22 antibody blocking

STAT3 activation is the mark of IL-22 receptor activation and Cellular Signaling Transduction Mediated.Test the ability of the STAT3 activation of the antibody blocking IL-22 induction produced for mankind IL-22.Express the 293T cell of mankind IL-22 acceptor heterodimer (hIL-22R/hIL-10R2) with 0.2 × 10 ⁶/ hole is layered in 24 orifice plates.Cell is used Lipofectamine2000 ^tM(Invitrogen) with thing (TK-SIE-SRE-S) transfection of STAT3 Luciferase reporter.Thus, when STAT3 activates, cell will produce luciferase, namely can by adding the enzymic activity that fluorescent usually detects.The reduction of luciferase activity means that STAT3 is blocked.Second day, together add the hIL-22 (R & DSystems) of 0.5nM to each hole with the antibody of 20 μ g/ml.After 16 hours, lysing cell, sample reads on photometer.What show in Fig. 6 is luciferase activity relative to Renilla internal contrast, and it is the tolerance that relevant STAT3 activates.As shown in Figure 6, antibody 3F11.3,11H4.4 and 8E11.9 has significant blocking ability.

Embodiment 3: the dosage-response of anti-IL-22 antibody

For the ability blocking mankind IL-22 in STAT3 Activation Assay, test the dosage range of the antibody produced for mankind IL-22.Express 293 cells of hIL-22R/hIL-10R2 with 0.2 × 10 ⁶individual/hole is layered in 24 orifice plates.Cell uses Lipofectamine2000 ^tM(Invitrogen) with thing (TK-SIE-SRE-S) transfection of STAT3 Luciferase reporter.Second day, together add the hIL-22 (R & DSystems) of 0.5nM to each hole with anti-IL-22 antibody 3F111,8E11 or 11H4 of different concns.The concentration range of antibody from 40 μ g/ml, 2 times of final concentrations being diluted to 0.012 μ g/ml.After 16 hours, lysing cell, sample reads on photometer.As shown in Figure 7, three kinds of antibody show the similar dosage/response curve activated for blocking-up STAT3.

Embodiment 4: the dosage-response of anti-IL-22 antibody

For the ability blocking mouse IL-22 (mIL-22) in STAT3 Activation Assay, test the dosage range of the antibody produced for mankind IL-22.Express 293 cells of mIL-22R/mIL-10Rb with 0.2 × 10 ⁶individual/hole is layered in 24 orifice plates.Cell uses Lipofectamine2000 ^tM(Invitrogen) with thing (TK-SIE-SRE-S) transfection of STAT3 Luciferase reporter.Second day, together add the mIL-22 of 0.5nM (being with polyhistidyl tags) to each hole with 3F11,8E11 or 11H4 of different concns.The concentration range of antibody is from 40 μ g/ml, and 2 times are diluted to 0.012 μ g/ml.After 16 hours, lysing cell, sample reads on photometer.Fig. 8 shows anti-IL-22 antibody and mouse IL-22 plays cross reaction, and shows similar but less intense dosage/response curve.Which show anti-IL-22 antibody and may be used for mouse.

Embodiment 5: anti-IL-22 is for the avidity of mankind IL-22

Fig. 9 shows the avidity of anti-IL-22 for mankind IL-22.Avidity is analyzed by BIACore and is measured.It (is 845RU (reference units) for 11H4IgG that the anti-IL-22IgG of various amount is fixed on via N-ethyl-N '-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxy-succinamide (NHS) conjugation chemistry on CM5 chip, be 1933RU for 8E11IgG, and be 7914RU for 3F11IgG).The twice serial dilution thing of preparation IL-22, covers the scope of 0.5-250nM.Antigen samples is injected 6 minutes with the flow velocity of 20 μ l/ minutes on the surface being fixed with IgG, allows the complex dissociation 10 minutes of combination.After often taking turns antigen injection, IgG surface 10mMGly, pH1.5 regenerate.As negative control wandering cells, secure irrelevant IgG (3A5RF graft) for background response subduction.Use running buffer to all diluted sample things, namely contain the PBS of 0.05% polysorbas20 and 0.01%NaN3, Binding experiment carries out at 25 DEG C.Analytical data is carried out by the overall matching of 1: 1 combination model.These results show, and anti-IL-22 antibody has the extraordinary avidity to mankind IL-22.

Embodiment 6: the IL-22 in anti-IL-22 antibody test cell

Test the ability of IL-22 in the antibody test cell for IL-22.For FACS dyeing in the cell of IL-22, employ 293 following clones: the cell of expression hIL-22-GFP, mIL-22-GFP, mIL-20-GFP and only GFP.The antibody of test is anti-human IL-22 antibody 3F11,8E11 and 17F6.Little mouse-anti gp120 is used as isotype controls.The second antibody used is the anti-mouse IgG-PE from Jacksonlabs.Cell BrefeldinA incubation 2 hours, washs, then fixedly spends the night with 2% paraformaldehyde (paraformaldehyde) at 4 DEG C in PBS.Then cell washs in PBS, at 37 DEG C of incubations 30 minutes in 5mL0.2%Tween-20.Antibody staining carries out 30 minutes at 4 DEG C, then uses Tween-20 solution washing.Cell resuspension, in FACS damping fluid, FACScan is analyzed.Figure 10 shows FACS result.FACS result shows, and antibody 3F11 and 8E11 causes the movement (shift) in cell dyeing pattern, both IL-22 in the cell showing these antibodies mouse and the mankind.

Anti-IL-22 antibody 3F11 is used for the experiment of other cell dyeing.By 3F11 antibody and phycoerythrin fluorophore Alexa647 coupling.The mouse IgG 2a of Alexa647 coupling is had to be used as isotype controls (Caltag).The 3F11 antibodies of analysis expression hIL-22-GFP and only 293 clones of GFP.293 cells, 2% paraformaldehyde fixes 30 minutes, then washes twice with PBS/2%FCS.Cell resuspension reaches 15 minutes in 0.5% Saponin/TSM (saponin).Add normal mice serum, after 15 minutes, then add antibody with 0.5 μ g/ 1,000,000 cell and reach 30 minutes.Washed cell is also resuspended in FACS damping fluid, and FACScan analyzes.Figure 11 shows the movement (shift) that cell enters right upper quadrant in the picture of lower-left.This result shows, the 3F11 antibodies of coupling is to IL-22 in cell.

The expression of embodiment 7:IL-22 in Th1T cell

When CD4+T cell is ripe and when entering periphery lymphsystem from thymus gland, before experience is specific to their antigen of φt cell receptor (TCR), they are their naive phenotype [Sprentetal., AnnuRevImmunol. (2002) of maintenance generally; 20:551-79].The combination of the specific antigen that TCR and antigen presenting cell (APC) present causes T cell activation.Depend on that environment and cytokine stimulate, CD4+T cell can differentiating into T h1 or Th2 phenotype become effector or memory cell [Sprentetal., AnnuRevImmunol. (2002); 20:551-79 and Murphyetal., NatRevImmunol. (2002) Dec; 2 (12): 933-44].This process is called as primary activation (primaryactivation).Experienced by primary activation, CD4+T cell becomes effector or memory cell, and the phenotype that they maintain them is Th1 or Th2.Once these cells meet with antigen again, they experience secondary activation (secondaryactivation), will be faster than primary activation to the response of antigen but current, and cause by the generation of the determined effector cell factor of primary activation [Sprentetal., AnnuRevImmunol. (2002); 20:551-79 and Murphyetal., AnnuRevImmunol.2000; 18:451-94].Research finds, between the elementary of CD4+T cell and stimulation pot-life, the expression of some gene is variable [Roggeetal., NatureGenetics. (2000) 25:96-101 and Ouyangetal., ProcNatlAcadSciUSA. (1999) Mar30; 96 (7): 3888-93].

For primary activation condition, Naive T cells can be activated by Ova and APC.The RNA being separated cell under this condition can provide the information of the genetic expression regulated by difference during primary activation about what gene and between what cytokine influence Th1 and Th2 growth period.After primary activation, CD4+T cell can maintain in culture.Because previous activation and cytokine process stamp the marking (imprint) in these cells, they have become effector or memory cell.In the meantime, owing to not having APC or antigen, CD4+T cell enters stationary phase.To provide this stationary phase about juvenile cell memory cell and static memory T h1 cell the information of the difference between static memory T h2 cell.Then remaining memory T h1 and Th2 cell experience the secondary activation of AntiCD3 McAb/CD28 antibody or the stimulation of IL-12/IL-18 cytokine.These conditions provide the information about the difference between the Naive T cells of activation and the memory T cell of activation and the difference between the memory T h1 cell of activation and the memory T h2 cell of activation.

For the experiment shown in fig. 12, from DO11.10 mouse separating Morr. cell, in Th1 condition: [IL-12 (1ng/ml), IFN-γ and IL-4 (1 μ/ml)]; Th0 condition: [anti-IL12, anti-IFN-γ and anti-IL4]; Or Th2 condition: activated by OVA in [anti-IL-12 (0.5 μ g/ml), anti-IFN-γ/and IL-4 (5ng/ml)].RNA (primary stimulus) is gathered in the crops after 48 hours.Remaining cell maintains until the 7th day in culture, is then again stimulated (stimulation) by OVA and the Balb/c splenocyte through irradiating.Subset from the cell of Th1 condition is also stimulated by independent IL-12 and IL-18.RNA is gathered in the crops after 48 hours.By 5 ' nuclease (TaqMan ^tM) analyze the expression analyzing IL-22, IFN-γ and IL-4 in these RNA sample.First will express relative to the stdn of housekeeping gene HPRT probe, the multiple be then illustrated as compared with the expression level of splenocyte raises.Result shows in fig. 12, and data presentation IL-22 expresses at Th1 cell camber when secondary stimulation.Therefore, anti-IL-22 therapeutical agent will be useful in these cells of target, or when wishing to remove Th1 cell from blood, is used for the treatment of the illness of Th1 mediation, or when suspecting that IL-22 works as the diagnostic reagent of the illness of Th1 mediation.

Embodiment 8:IL-22 is produced by gamma delta T cells

In order to analyze the expression of IL-22 in gamma delta T cells, from mouse spleen isolated cell, carry out separating gamma delta T cells by MACS sorting.GL4 is anti-gamma delta T CR antibody, and it activates gamma delta T cells (Becton-Dickenson) specifically.QiagenMINIRNA separating kit is used to be used for 5 ' nuclease (TaqMan from cellular segregation RNA ^tM) analyze.Use MasterMix single stage RT-PCRMasterMix reagent (AppliedBiosystems; , and use housekeeping gene RPL10 and SPF31 stdn 4309169).Use the relative level that complete splenocyte is expressed to measure IL-22.Figure 13 shows IL-22 and expresses at the gamma delta T cells camber stimulated with GL4 antibody.

Embodiment 9:IL-22 is produced by the human T cells activated

Nucleic acid microarray is for identifying that the gene of differential expression is useful in diseased tissue compared with normal counterpart.Utilize nucleic acid microarray, the test of in the future self-test and control tissue sample and contrast mRNA sample reverse transcription and mark are to produce cDNA probe.Then by cDNA probe and the hybridization array being fixed on the nucleic acid on solid support.Configuration array, makes the sequence of each member of array and position be known.Such as, the selected works of known gene of expressing in some disease condition can be arranged on solid support.This gene expressed by the sample showing to produce this probe through the probe of mark and the hybridization of specific array member.If carry out self-test (in this case, the CD4+T cell of activation) hybridization signal of probe of sample is greater than from contrast (in this case, the CD4+T cell do not stimulated) hybridization signal of probe of sample, then in test organization, the gene of process LAN is identified.The meaning of this result is, the diagnosis marker that the protein of process LAN not only exists as disease condition in test organization is useful, and is useful as the therapeutic target thing of disease therapy situation.

The method of nucleic acid hybridization and microarray technology is well known in the art.Such as, all describe in detail in the PCT Patent Application Serial No PCT/US01/10482 submitted to March 30 calendar year 2001 for the concrete preparation of the nucleic acid of hybridizing and probe, slide glass and hybridization conditions, be incorporated in this by reference.

In this experiment, the RossetteSep from StemCellTechnologies (VancouverBC) is used ^tMscheme, from single donor purifying CD4+T cell, it makes use of for separating of the anti-CD8 of CD4+T cell, anti-CD16, anti-CD19, AntiCD3 McAb 6 and anti-CD56 antibody.The CD4+T cell anti-cd 3 antibodies (using with the concentration do not stimulated proliferation) be separated comes together to activate with ICAM-1 or anti-CD28 antibody.At 24 or 72 hours harvested cells, extract RNA, operating analysis on Affimax (AffymetrixInc., SantaClara, CA) micro-array chip.Gather in the crops (static) cell do not stimulated after purification immediately, and carry out identical analysis.Relatively express at two arbitrary its of time point the gene raised than resting cell at the cell of activation.

The result of this experiment is shown in Figure 14.Microarray results supports and meets the data in embodiment 7.Th1T cell produces a large amount of IL-22 when being upset, contrary with the Th2 cell producing IL-4 or IL-5.This result will be allowed according to Cytokines characteristic spectrum by immune disorders relevant for Th1 with Th2 separately.The Th1 cell of expressing IL-22 and IFN-γ can be treated with the therapeutical agent for these cytokines, and does not affect Th2 cell colony.

IL-22 in embodiment 10:Th1 cells express cell

In order to measure the expression level of IL-22 in T cell by FACS, cell inner dyeing is carried out to mouse Th1/Th2 cell.Primary (primary) splenocyte is made to be polarized to Th1 or Th1.In order to FACS dyeing, at each hole middle berth 100 ten thousand cells of 96 orifice plates, process 2 hours with PMA/ ionomycin (Ionomycin), then with BrefeldinA process other 2 hours.The antibody used is anti-human IL-22 (antibody 3F11.1), and anti-gp120 in contrast.Anti-mouse IFN-γ-FITC and anti-mouse IL-4-PE derives from BDBioscience (SanDiegoCA).Coupling has the goat anti-mouse IgG (also from BDBioscience) of PE to resist as two.Cell 2% paraformaldehyde fixes 30 minutes, then washes twice with PBS/2%FCS.Cell resuspension in 0.5% Saponin/TSM 15 minutes, then adds antibody 30 minutes with 0.5 μ g/, 1,000,000 cells.Then cell washing twice, anti-to add to two in 0.5% Saponin/TSM 15 minutes.Finally, washed cell is also resuspended in FACS damping fluid, and FACScan analyzes.Figure 15 shows Th1 cell and can come with Th2 cell differentiation in the little figure in top.Th1 is that IFN-γ is positive, IL4 is negative and IL-22 is positive.Th2 cell is that IFN-γ is negative, IL4 is positive and IL-22 is negative mostly.

Embodiment 11: the generation of anti-IL-22 acceptor (IL-22R)

In order to test the combination of anti-IL-22R antibody, employ 293 cells of expressing hIL-22R and the cell of expressing GFP.With different anti-hIL-22R antibody staining 1,000,000 cells of the concentration of 0.3 μ g/, 1,000,000 cells.The antibody of test is 7E9,8A12,8H11 and 12H5.Two anti-be the goat anti-mouse (JacksonLabs) of the PE coupling used with the dilution factor of 1: 200.Washed cell, dyes (0.5%BSA/PBS) in FACS damping fluid.Test antibody dyeing carries out 15 minutes at 4 DEG C, then washed cell, adds two resist other 15 minutes at 4 DEG C.Washed cell twice, then analyzes on FACScan.Result is shown in Figure 16.For each figure that wherein peak value is not overlapping, the peak in left side corresponds to contrast, and the peak on right side corresponds to test antibody.Four kinds of all anti-IL-22R antibody that Figure 16 shows test are positive for the IL-22R combined on 293 cells of transfection.Antibody 7E9,8A12,8H11 and 12H5 give good combination, and background is considerably less.

Embodiment 12:IL-22R blocking antibody

In order to the blocking-up testing anti-IL-22R antibody is active, employ Luciferase reporter thing construct (as embodiment 2 describes).If antibody has block activity, so STAT3 can not be activated, and luciferase response will be low.To the cell of hIL-22R/hIL10Rb be expressed with 0.2 × 10 ⁶individual cells/well is laid in 24 orifice plates, and Luciferase reporter thing TK-SIE-SRE-S (0.8 μ g/ hole) and RL-TK-Luc (0.16 μ g/ hole) is transfected in cell.Second day, with 0.5nM, hIL-22 is added in hole, add often kind of antibody with 20 μ g/ml.The anti-IL-22R antibody of test is: 7E9,8A12,8H11 and 12H5.The control antibodies used is GP120 and 11H4, and namely display has the anti-hIL-22 antibody blocking activity in example 2.After 16 hours, lysing cell, sample reads to detect luciferase activity on photometer.All four kinds of anti-IL-22R antibody blocking IL-22R-IL-22 that Figure 17 shows test interact.

Embodiment 13:IL-22R expresses on primary culture keratinocytes

Keratinocyte is the cell mass of hyper-proliferative during psoriatic.The therapeutical agent of target keratinocyte is useful in psoriatic alleviation.The expression of IL-22R on Primary human's keratinocyte is measured by facs analysis.Normal human epidermal's keratinocyte (NHEK) donor lot number 0526 derives from CascadeBiologies, passage number 2, grows into 80% and converges, and dyes with every increment product 300-600K cell.Anti-IL-22R serum uses with the extent of dilution of 1: 50, and the serum of pre-blood sampling (pre-bleed) is used as contrast with the extent of dilution of 1: 50.In order to IL10R2 dyeing, together with mouse IgG1-PE isotype controls (BDPharmingen#33815X), the antibody (clone #90220, mouse IgG1) from R & D uses with every increment product 0.3 μ g.It is rat anti-mouse IgG1-PE (BDPharmingen#550083) that two of anti-IL-22R serum resists, and uses with every increment product 0.1 μ g.Figure 18 shows IL-22R and IL10R2 and expresses on NHEK.Therefore, the blocking-up of IL-22R or IL-22 can prove to surpass to keratinocyte that to breed in relevant illness such as psoriatic be useful alleviating.

Embodiment 14:IL-22 is on the impact of epidermis culture

The human epidermal (RHE) of reconstruct can be used as cytokine to the model of the impact of skin.RHE and substratum are available from MatTek company (Ashland, MA).By RHE with 0.9ml substratum at 37 DEG C, 5%CO ₂equilibrate overnight (20-22 hour), to recover from transport before starting experiment, then uses 5mL substratum at 37 DEG C, 5%CO ₂under cultivate on liquid-gas interface.Use three kinds of different condition analysis IL-22 on the impact of RHE.IL-22 (1.2nM) or Urogastron (EGF-R & DSystems) (1nM) are added in substratum.Contrast is made up of untreated substratum.RHE cultivates 4 days, and every two days replaced medium, add fresh EGF or IL-22.Results RHE, fixedly spends the night in 10% neutral buffered formalin (NBF), section, with hematoxylin and eosin (H & E) dyeing.Figure 19 shows IL-22 process and causes thickening of epidermis.This shows, IL-22 causes hyperplasia, or the propagation of the cell of formation epidermis.

When the mark CK16 (K16) of these section Human Keratinocytes propagation dyes, show significantly more K16 dyeing with the RHE of IL-22 process.The skin cells of K16 only in propagation such as expresses (summary is shown in Freedbergetal, Soc.Invest.Derm.116:633-640 (2001)) in psoriatic and wound healing.Figure 20 shows in the RHE of IL-22 process relative to dyeing with the K16 of the RHE of EGF process for process.The RHE of IL-22 process shows K16 throughout whole tissue, and dyeing is locally in the section of untreated and EGF process.

Also psoriasin is induced, namely at a kind of gene that psoriatic camber is expressed with IL-22 process RHE.Psoriasin (S100A7) initial as expression in psoriatic but the protein of not expressing in normal skin be found (MadsenP., etal., J.Invest.Derm.97:701-712 (1991)).Psoriasin activation cultivation with pernicious keratinocyte in and in pernicious mammary epithelial cell express (Watsonetal., Int.J.ofBiochem.andCellBio.30:567-571 (1998)).Current Data support psoriasin is in the developing effect of inflammatory skin disease, chemotaxis and lacteal tumor.The dependency of the psoriasiform hyperplasia of psoriasin and skin describes the effect in Keratinocyte differentiation.Psoriasin also can be chemotactic, and stimulate neutrophil(e) cell and the CD4+T lymphocytic infiltration of epidermis, it is psoriatic mark.Figure 21 shows and expresses induction of high-caliber psoriasin with IL-22 process RHE.This result confirms the effect that IL-22 and IL-22R plays in psoriatic.

IL-22 approach can with the antibody blocking for IL-22 or IL-22R for the inducing effect of psoriasin.Psoriasin is expressed and is reduced to undetectable level (see Figure 23) by the anti-IL-22 antibody 8E11 used with the concentration of 20 μ g/ml.When using in the concentration of 20 μ g/ml, anti-IL-22R antibody (7E9) is also reduced psoriasin significantly and is expressed, as shown in figure 23.

Analyze anti-IL-22 and anti-IL-22R antibody to thicken to the epidermis determined them and whether can reduce with observing during IL-22 process RHE.The anti-IL-22 used with the concentration of 20 μ g/ml anti-(8E11) shows the obvious reduction (see Figure 24) that epidermis thickens.Reach the thickness of 80-90 μm with the RHE of IL-22 process, reduce RHE thickness to 50-60 μm (Figure 25) by anti-IL-22 (8E11) antibody treatment.Anti-IL-22R antibody (7E9) also reduces pachyderma.When using in the concentration of 20 μ g/ml, anti-IL-22R antibody reduces RHE thickness from 80-90 μm to 55-60 μm (Figure 25).These data show that anti-IL-22 or anti-IL-22R antibody can alleviate the symptom relevant to psoriatic, the propagation of such as epidermis and thickening.

The microarray analysis of the gene of embodiment 15:IL-22 induction

In order to determine that what gene is induced by IL-22, tile derived from Normal human epidermal's keratinocyte (NHEK) of single donor, when 70% converges with 20ng/mlIL-22 process 24 hours.Substratum and fill-in (EpiLife + HKGS) available from CascadeBiologies ^tM(Portland, OR).By cell washing and cracking.Use QiagenRNeasyMini test kit from NHEK cell purification total serum IgE.RNA is carried out microarray analysis, to gene expression amount quantitatively (about the description of microarray analysis see foregoing embodiments 9).

Psoriasin is induced 81 times when IL-22 stimulates.SPR-2G is raised 11 times (see Figure 22).These results show that IL-22 approach involves psoriatic.Therefore, be useful for the antagonist of IL-22 or IL-22R and antagonistic antibodies alleviating in psoriatic.

Embodiment 16:IL-23 induces psoriatic mark in vivo

Mouse model is used to compare the ability of IL-12 and IL-23 induction psoriatic skin feature.The rIL-12 of the 500ng of C57B1/6 mouse in ear skin injection cumulative volume 20 μ lPBS or recombinant il-2 3.Control mice is only injected with the PBS of 20 μ l.Within every two days, injection mouse continues 16 days.Each experimental group is made up of five mouse.Rear multiple time point slide calliper rule (MitutoyoAmericaCorporation) measure ear thickness with injection before injection, are reported as mean value ± standard deviation.For this experiment and experiment subsequently, utilize Prism software (GraphPad) by unidirectional or two-way ANOVA counting statistics significance.All p value≤0.05 are thought significantly.Gather the routine histology that mouse ear is used for utilizing phenodin and eosin (H & E) to dye.

As shown in fig. 26, IL-12 and IL-23 injection all increases induction of significant ear thickness for one week after first time injection.For the mouse accepting IL-12, p is < 0.001 (respectively relative to PBS to impinging upon the 12nd, 14 and 16 day).For the mouse accepting IL-23, p is < 0.001 (respectively relative to PBS to impinging upon the 8th, 12,14 and 16 day).Histologic analysis discloses compared with the control group of PBS process, and the ear of IL-12 and IL-23 injection all develops significant inflammatory cell infiltration and epidermis thickens (acanthosis); But, between these two groups, there are some clearly histological differences.First, compared with PBS control group (Figure 26 B, C), the slight acanthosis to moderate of IL-12 induction, there is significant, that principal mode is single core dermal inflammatory cell infiltration (Figure 26 D, E), and IL-23 induces significant acanthosis, there is the dermal inflammatory cellular infiltration (Figure 26 F, G) of the mixing of many polymorphonuclear leukocytes, comprise neutrophil's (arrow) and eosinocyte.The existence of epidermal hyperplasia and polymorphonuclear leukocyte is psoriatic histology mark in the mankind, and the very common histology in psoriatic mouse model finds.See P.C.vandeKerkhofetal, Dermatologica174:224 (1987) and P.R.Manganetal, Nature (2006) 441:235.

Embodiment 17:IL-22 acts on the downstream of IL-23 in vivo

In order to identify potentially in the cytokine worked in the downstream of IL-12 or IL-23, PCR in real time is used to check the expression of one group of cytokine from the ear skin sample of injection IL-12 or IL-23.Ear skin injection and histologic analysis is carried out described by embodiment as in the previous.At the 8th day of experiment, from each mouse ear isolation of RNA, carry out the horizontal quantitative of PCR in real time to the mRNA of encoding IFN-y, IL-17 and IL-22.Particularly, by the specification sheets isolation of RNA of RNeasyMini test kit (Qiagen, Valencia, CA) according to producer.ABI7500 real-time PCR system (AppliedBiosystems, FosterCity, CA) is used to use primer and probe, utilize TaqMan ^tMone-StepRT-PCRMasterMix reagent (AppliedBiosystems) carries out real-time RT-PCR.Double is carried out in reaction, and sample, for the housekeeping gene RPL-19 stdn of contrast, is reported according to Δ Δ Ct method.

As shown in fig. 27 a, inject in the ear of latter eight days in first time, what IL-12 expressed induction of IFN-γ significantly improves.Relative to the control group of PBS process, IL-23 produces induction of IL-17 and suppresses IFN-γ to produce (Figure 27 A).Enjoyably, after IL-23 injection, instead of after IL-12 injection, IL-22 is also raised (Figure 27 A) significantly.These data show to be related between IL-23 and IL-22.

In order to confirm the cytokine produced by the lymphocyte infiltrating ear, from the ear of process, elution goes out lymphocyte, measures cytokine produce when activating by ELISA.Consistent with Real-time RT-PCR data, the cell of ear from IL-23 injection preferentially produces IL-22 and IL-17, and from a large amount of IFN-γ (Figure 28) of the emiocytosis of the ear of IL-12 injection.

Embodiment 18:IL-22 is induced skin inflammation and epidermal hyperplasia in vivo

Psoriatic skin feature can be induced in vivo, as described in foregoing embodiments 16, to mouse ear subcutaneous injection IL-22 or independent PBS to determine that whether IL-22 is the same with IL-23.As shown in figure 27b, compared with the group of PBS process, IL-22 is induction of the remarkable increase of ear thickness.Another kind of cytokine IL-20 from IL-10 family only increases with the ear thickness of local induction of very slight.These discoveries are contrary with previous report, and namely the epidermis transgenosis process LAN of IL-20 induces significant epidermal hyperplasia, and this result shows, IL-20 may play a role potentially in epidermis function and psoriatic.See Blumbergetal, Cell104:9 (2001).Histologic analysis shows, the ear of IL-22 process mouse has the histological appearance similar to the ear of IL-23 treatment group, shown in Figure 26 F and G, present significant acanthosis and mixed type dermal inflammatory cellular infiltration (Figure 27 G, H), comprise many neutrophil(e) cells (arrow) and some eosinocytes.By contrast, relative to PBS treatment group (Figure 27 C, F), IL-20 process ear only has the concentrated acanthosis of mild-moderate, mixed type inflammation (Figure 27 D, E) that is that only have moderate and that concentrate very much.These data show, IL-22 be IL-23 induction skin inflammation and acanthosis necessary.

Embodiment 19: anti-IL-22 blocking antibody reduces the acanthosis of IL-23 induction significantly

Inducing psoriatic skin feature to confirm that IL-23 is worked by IL-22, checked the impact of skin inflammation that anti-IL-22 monoclonal antibody 8E11 induces IL-23 and acanthosis.As mentioned above give mouse ear subcutaneous injection IL-23 or PBS (embodiment 16), the span being just injected at 14 days is carried out.Mouse also continues 14 days with the contrast monoclonal antibody of the concentration of 200 μ g every mouse and every two days frequency peritoneal injection 8E11 once or IgGl isotype.At the 14th day, collect mouse ear, for the histologic analysis utilizing H & E to dye.

As shown in figure 29 a, relative to the process of contrast IgG1 antibody, 8E11 (" anti-IL-22mAb ") reduces significantly spinous layer of epidermis plumpness that IL-23 induces ( ^*p < 0.001) (going back comparison diagram 29D and E (anti-IL-22mAb) and B and C (contrasting IgG1)).In addition, the moderate reduction of skin inflammation aspect is also presented with the mouse of anti-IL-22mAb process.But, when compared with the ear skin with PBS process, still present moderate inflammatory cellular infiltration (comparison diagram 29D and E (anti-IL-22mAb) and F and G (PBS)) with the mouse of anti-IL-22mAb process.

The acanthosis of embodiment 20:IL-23 induction reduces significantly in IL-22 deficient mice

Inducing psoriatic skin feature to confirm that IL-23 is worked by IL-22 further, checked the impact of IL-23 on wild-type and IL-22 deficient mice.(that is, the IL-22 knock-out mice isozygotied, is called " IL-22 to IL-22 deficient mice ^-/-mouse ") produce by destroying according to the target gene of strategy described in Figure 30 A.The exons 1-4 (frame closed) of IL-22 encoding sequence is replaced with the neomycin resistance box that flank is loxP site.The chimeric mice and transgenic lines that carry conditional allele are hybridized, protamine 1 (Prm) promoters driven Cre recombinase in described transgenic lines.In the heterozygous male (that is, be heterozygosis for conditional allele and PrmCre transgenosis) of compound during spermatogenesis, conditional allele is cut.By the heterozygous male of compound and wild females mating, to allelotrope and the genetically modified loss of PrmCre of the filial generation screening excision produced.At least six generations in C57B1/6 background that offspring is backcrossed to.Murine genes type is by utilizing the PCR of the primer indicated in Figure 30 B to confirm.

From wild-type and IL-22 ^-/-check in the Th cell of mouse that the IL-22 of mRNA and protein level expresses.Utilize RT-PCR from wild-type ("+/+") and IL-22 ^-/-th1, Th2 and Th of ("-/-") mouse _iL-17check in cell that IL-22mRNA expresses (Figure 30 C), confirm IL-22mRNA not at IL-22 ^-/-detect in mouse.Utilize ELISA from wild-type (" WT ") and IL-22 ^-/-th1, Th2 and Th of (" KO ") mouse _iL-17the expression of IL-22, IL-17, IFN-γ and IL-4 is checked in cell.For each of IL-22, IL-17, IFN-γ and IL-4, in Figure 30 D, show result, indicate at the top of each chart, solid post and hollow post show the expression level in WT and KO mouse respectively.In addition, relative to wild-type cd4 t cell, from IL-22 ^-/-the cd4 t cell of mouse can be activated and is divided into all t helper cell subsets, and can produce IL-17, IFN-γ and IL-4 of normal level.But, according to expectation, IL-22 ^-/-cd4 t cell does not have IL-22.Compared with wild-type mice, observe IL-22 ^-/-mouse normally grows, and in all major lymphatic organs checked, has similar lymphocyte composition and grow (data do not show).

To IL-22 ^-/-mouse and wild type littermates as mentioned above (embodiment 16) inject IL-23 or PBS at ear skin.At the 16th day, analyze mouse ear by the histologic analysis of routine.As shown in Figure 31 A and B, compared with control group, at IL-22 ^-/-in mouse, IL-23 is induction of remarkable less ear thickness and epidermal thickness (IL-22 ^-/-mouse is called " KO " or " IL-22KO " in this figure and Figure 32; Wild-type mice is called " WT " or " IL-22WT " in this figure and Figure 32).By histological stain, (be respectively Figure 31 C and D) compared with the wild type littermates of IL-23 process, spinous layer of epidermis plumpness and skin inflammation are at IL-22 ^-/-significantly (being respectively Figure 31 E and F) is reduced in mouse.Contrary with these results, IL-22 defect does not affect (Figure 32) the ear skin inflammation that IL-12 induces at all.Therefore, data presentation, IL-22 IL-23 induce but not IL-12 induction skin inflammation and spinous layer of epidermis plumpness in play decisive role.

The lymphocyte that embodiment 21:IL-23 induces IL-22 to activate from various IL-23 produces

Inducing the ability of IL-22 to investigate IL-23 further, being separated various lymphocyte populations and having stimulated under the condition indicated at Figure 33 in vitro.Carry out ELISA to detect the IL-22 in culture supernatants, in Figure 33 A, be reported as mean value ± standard deviation.Also checked the ability of the IL-10 family cytokine of IL-23 induction except IL-22.Splenocyte from DO11.10TCR transgenic mice stimulates 4 days with 0.3 μM of OVA peptide under the t helper cell polarization condition indicated, then tranquillization two days, the AntiCD3 McAb (10 μ g/ml) closed with hardening and solvable anti-CD28 (5 μ g/ml) stimulate other 2 days again.Real-time RT-PCR is carried out to the RNA from the cellular segregation under shown condition, comes quantitative mouse IL-19, IL-20 and IL-24mRNA and express.Further comprises from normal mouse splenocyte RNA in contrast.As shown in Figure 33 B, IL-23 does not induce the expression of any other tested IL-10 family cytokine.

Embodiment 22:IL-22 is from Th _iL-17the new effector cell factor of pedigree

Recently, IL-23 with new IL-17 line balancing rate device CD4+T cell lineage (Th _iL-17) growth connect.L.E.Harrington.，Nat.Immunol6：1123(2005)；H.Park.，Nat.Immunol.6：1133(2005)。IL-23 can when there is APC and antigen from inmature CD4+T cell induction Th _iL-17lineage, but can not start IL-17 when being applied to the Naive T cells with AntiCD3 McAb/anti-CD28 activation produces.L.E.Harringtonetal.，Nat.Immunol6：1123(2005)；M.Veldhoenetal，Immunity24：179(2006)。In addition, TGF-β and IL-6 is shown to be Th _iL-17(denovo) again factor of subset differentiation.M.Veldhoenetal.，Immunity24：179(2006)。

Whether carried out testing test I L-22 may be other effector T cell cytokines of being induced by IL-23 under believable (authentic) TCR stimulates.Polarize (IL-12 and anti-IL-4) at the previous Th1 described, Th2 polarizes (IL-4, anti-IL-12 and anti-IFN-γ), Th _iL-17the CD4+T cell four days from DO11.10TCR transgenic mice is activated with 0.3 μM of OVA peptide under polarization (IL-23, anti-IFN-γ and anti-IL-4) or Th0 (anti-IL-12/23p40, anti-IFN-γ and anti-IL-4) condition.L.E.Harringtonetal，NatImmunol6：1123(2005)。From cell extraction RNA, the expression (as mentioned above, the figure in Figure 34 A) of the mRNA of various mouse cytokine of carrying out PCR in real time to detect encoding.In addition, ELISA is carried out detect the expression in the various cytokine of protein level to culture supernatants.As shown in fig. 34 a, IL-17 is induced by IL-23, and IFN-γ and IL-4 is produced by Th1 and Th2 cell respectively.On mRNA and protein level, produce Th from IL-17 _iL-17cell produces IL-22.

In order to determine that whether IL-22 is from (committed) Th that shapes completely _iL-17the new effector cell factor of pedigree, by the T cell tranquillization that polarizes as above two days, the AntiCD3 McAb (10 μ g/ml) then closed with hardening and solvable anti-CD28 (5 μ g/ml) stimulated 2 days again when presence or absence IL-23.Carry out ELISA to detect the expression of the mouse cytokine indicated on the figure of Figure 34 B.Result shows, IL-17 is from Th _iL-17subset produces specifically, and even when not having IL-23, and IL-23 improves IL-17 output.IL-23 fails to promote that IL-17 produces from Th1 and the Th2 cell of sizing.IL-22 presents the expression pattern identical with IL-17, shows that IL-22 is by this new Th _iL-17the real effector cell factor that subset is expressed.

Previously, DCRS5 it is reported activation/memory T cell on express.C.Parhametal，JImmunol168：5699(2002)。More than test and do not get rid of IL-23 and act on memory T cell to produce the possibility of IL-22.In order to more critically solve this point, using and being separated research more than the inmature CD4+T cell of DO11.10TCR transgenic mice repeats.Specifically, at Th1 polarization condition (IL-12 and anti-IL-4), Th2 polarization condition (IL-4, anti-IL-12 and anti-IFN-γ), Th that Figure 35 A notes _iL-17under polarization (IL-23, anti-IFN-γ and anti-IL-4) or other conditions, with through the pulse of OVA peptide BALB/c spleen feeder cell (through irradiation, T cell abatement) stimulation is from Rag2 ^-/-the CD4+T cell of DO11.10TCR transgenic mice.As shown in the drawing, Th _iL-17the cells produce IL-22 of highest level, and Th1 also secrete can the IL-22 of detection level.In addition, add IFN-γ or IL-4 and completely eliminate IL-17 generation; But these two kinds of cytokines only medium suppression IL-22 produce (Figure 35 A).These data show that IL-17 and IL-22 induced expression has potential different approach.But, again stimulate 48 constantly little under the secondary conditional indicated, the Th set up completely _iL-17both cells produce IL-17 and IL-22 (Figure 35 B).IL-23 improves the level (Figure 35 B) of these cytokines further in the mode do not blocked by IFN-γ or IL-4.This Th of these data validations _iL-17the stability of pedigree.

Whether being produced by identical cell between pot-life to investigate IL-17 with IL-22 further, stimulating Th with PMA and ionomycin _iL-17cell, is used for cell inner dyeing by the antibody for IL-22 or IL-17.As shown in Figure 35 C, IL-17 produces cell mainly from Th _iL-17axle is observed (left side picture).IL-22 produces cell also preferentially from Th _iL-17pedigree detects (right panel).The common dyeing of IL-22 and IL-17 discloses, from Th _iL-17the cell of the substantial portions of system produces IL-22 and IL-17 simultaneously, shows that IL-22 with IL-17 is produced by identical cell.

As discussed above, recent research also shows, other factors from APC may be the main drives after inmature CD4+T cytodifferentiation becomes IL-17 production T cell, because IL-23 fails to induce from the beginning produce IL-17 by the inmature cd4 t cell of purifying.M.Veldhoeneta1.，Immunity24：179(2006)。TGF-β and IL-6 has been accredited as generating the vital two kinds of factors of IL-17 by inmature cd4 t cell.See above.Also be crucial to determine that whether these factors produce for the IL-22 in mouse, the AntiCD3 McAb (10 μ g/ml) closed with hardening and solvable anti-CD28 (5 μ g/ml) stimulate the inmature cd4 t cell (> 98%) of purifying.With disclosed data consistent, TGF-β and IL-6, instead of IL-23, produce (Figure 36 A, right panel) induction of IL-17.Surprisingly, contrary with the induction of IL-17, IL-22 still only induces when there is IL-23, and can not be induced (Figure 36 A, left side picture) by TGF-β and IL-6.These data show, transcribing of IL-17 and IL-22 may differently be regulated.But as previously reported, when not having IL-23, TGF-β and IL-6 can not set up long-term IL-17 production T cell pedigree (Figure 36 B).Thus this digital proof, IL-23 drives T cell subset to produce one of Main Factors of IL-22.

Then, whether we checked similar IL-22 production T cell pedigree and can set up from mankind's cd4 t cell.We find, IL-23 can induce at Th _iL-17with the inmature mankind CD4+T emiocytosis IL-22 (Figure 36 C, left side picture) of the purifying of AntiCD3 McAb/anti-CD28 stimulation under polarization condition.These cells can not again add external source IL-23 again swash time produce IL-22 (Figure 36 C, right panel), show the formation of stable T cell pedigree.Although these cells are cultivated studying under similar condition to above-mentioned mouse, we fail to detect that the IL-17 of more than the assay method limit produces (data do not show).

In a word, these data determine first, and IL-23 can from mouse and the mankind's inmature cd4 t cell induction IL-22 production T cell subset.The IL-17 of this pedigree produces and depends on other environmental factorss.And under believable antigen and APC incentive condition, IL-23 drives T cell subset to produce both IL-22 and IL-17.When Naive T cells is activated by AntiCD3 McAb and anti-CD28, IL-23 also stimulates IL-22 to produce.Can produce instead of TGF-β and IL-6 of long-term lineage committed from the of short duration IL-17 of inmature induced t cell, IL-22 can not be driven to produce.

Embodiment 23:IL-19, IL-20 and IL-24 also induce epidermis to thicken

IL-22 belongs to the cytokine family comprising IL-19, IL-20 and IL-24, and all these all show the expression raised in psoriatic skin.These cytokines also carry out test to determine whether they can induce epidermal hyperplasia and acanthosis as IL-22.RHE is cultivated four days, with IL-19, IL-20, IL-22 or IL-24 of 20ng/ml or the EGF process of 6ng/ml.Treated RHE H & E dyes.Result is shown in Figure 37 A.The acanthosis having core epidermis that all cytokine inductions are lived, indicated by the length of the increase of double-headed arrow.Consistent with previous observation (above), IL-22 induced particle layer reduces, or the reduction of granular cell layer (arrow), and the cuticular hyalinization of low level (asterisk).IL-22 also induces parakeratosis (data do not show) in the cultivation RHE of 7 days.Granular layer reduces and parakeratosis is the psoriatic tissue feature frequently observed.IL-19, IL-22 and IL-24 only induce the acanthosis of epidermis, have little impact or do not have a significant effect for granular cell layer or stratum corneum.It is plump that EGF induction thickens with granular layer internal granular layer the spinous layer of epidermis compressing (arrow) with keratinocyte.The epidermis of IL-19, IL-20, IL-22 or IL-24 induction thickens in independently testing quantitative, graphically shows in Figure 38.IL-22 has maximum effect.Be considered to the inflammatory cytokine TNF-α, the IFN-γ that work in psoriatic and IL-1 β and do not stimulate keratinocyte proliferation (data do not show) in this RHE system.Thus, those cytokines may play secondary role in psoriatic, or can work by the approach independent of IL-19, IL-20, IL-22 and/or IL-24.

Immunohistochemistry is used to detect CK16 (K16), i.e. a kind of mark of epidermal hyperplasia.IL-24, IL-22 and EGF induction is expressed throughout the CK16 of non-angling epidermis, and IL-19 and IL-20 only expresses (Figure 37 B) at base strap induction CK16.

Also use immunohistochemistry to detect psoriasin (S100A7), namely at some super proliferative and inflammatory skin disorders, comprise one of several S100 family proteins of raising in psoriatic.IL-19, IL-20, IL-22 and IL-24 induce the S100A7 in base portion epidermis to express, IL-22 and IL-24 has maximum effect (Figure 37 C).S100A7 dyeing is observed in the core and tenuigenin of keratinocyte, and some protein also occurs in extracellular.By quantitative for the result shown in Figure 37 B and C, and graphically show in Figure 37 E and F.

Immunohistochemistry is also used to detect pY (705)-STAT3, i.e. the trans-activation form of STAT3.The STAT3 of activation has shown and has raised in psoriatic lesions skin.IL-19, IL-20, IL-22 and IL-24 induce the persistence STAT3 in the RHE keratinocyte found in all viable cell layers to activate, and are represented (Figure 37 D) by its nuclear location.

Embodiment 24: the blocking antibody for the acceptor of IL-20 and IL-22 reduces psoriasin expresses

IL-19 and IL-20 carries out intracellular signaling by the acceptor heterodimer of IL20Ra and IL20Rb.IL20 also carries out intracellular signaling by the acceptor heterodimer of IL-22R and IL-20Rb.IL-22 carries out intracellular signaling by the heterodimer of IL-22R and IL10R2.These receptor component are checked by flow cytometry from RHE or the cell surface expression be separated on the keratinocyte of the primary culture of Normal human epidermal's keratinocyte (NHEK, the neonatal foreskin from donations) in separation.Following monoclonal antibody is used for flow cytometry: anti-IL20Ra (for the object of this research produces in mouse); Anti-IL20Rb (for the object of this research produces in mouse); Anti-IL-22R antibody 7E9 (as above); Anti-IL-10R2FAB874P (PE coupling) (R & DSystems, Minneapolis, MN).Result is shown in Figure 39.The receptor component of often kind of antibodies is in the upper right side of each figure display (IL-22R is called as " IL-22R1 ").IL-20Rb and IL10R2 as one man expresses on the surface of NHEK, does not consider to converge, calcium level (Figure 39 A) in passage number or substratum.On the contrary, on NHEK, the cell surface expression of IL-20Ra and IL-22R1 is different between donor from donor, but being as one man relatively low is can detection level (Figure 39 A and the data do not shown).Compared with the expression level in individual layer NHEK, IL-20Ra with IL-22R is being separated on the keratinocyte of RHE with much higher horizontal expression (Figure 39 B).The reason of this species diversity is unknown.But, however it is clear that all receptor component analyzed are expressed on Human keratinocytes.The expression (data do not show) of these receptor component on immunocyte (T cell, B cell, natural killer cell and monocyte) do not detected.Thus, the part of these receptor component may provide contacting between immunity system and keratinocyte exception.

In order to check whether above-mentioned antibody can block the effect of IL-19, IL-20 and IL-22 process, as what describe in previous embodiment, the anti-IL20Ra of 20 micrograms/ml, anti-IL20Rb or anti-IL-22R are added into RHE substratum, after 1 hour, add IL-19, IL-20 or IL-22 of 20ng/ml.Then RHE is cultivated tetra-days, at second day replaced medium (comprising the 4.5ml fresh culture of cytokine and antibody).Then RHE is dyeed by immunohistochemistry for psoriasin (S100A7).Result is shown in Figure 40.The RHE of IL-19, IL-20 and IL-22 process shows respectively in first, second, and third row.With anti-IL20Ra (α IL-20Ra), anti-IL20Rb (α IL-20Rb) or anti-IL-22R (α IL-22R1) pretreated RHE display in the 3rd, the 4th and the 5th row respectively.The display in the first and second row without antibody control and Isotype control antibodies.

Result shows, and the psoriasin that anti-IL20Ra or anti-IL20Rb blocks IL-19 induction is effectively expressed.Similarly, anti-IL-22R blocks the psoriasin expression of IL-22 induction effectively.The psoriasin that anti-IL20Rb blocks IL-20 induction is effectively expressed, but anti-IL20Ra does not have.Similarly, anti-IL-22R can not block the psoriasin expression of IL-20 induction.

In order to investigate the impact that anti-IL-22R and anti-IL20Ra expresses the psoriasin that IL-20 induces further, by RHE those antibody pre-treatment of alone or in combination, afterwards with IL-20 process.Result is shown in Figure 41.As mentioned above, the psoriasin that independent anti-IL-22R or anti-IL20Ra can not block IL-20 induction expresses (secondary series of two pictures).But the combination of anti-IL20Ra and anti-both IL-22R effectively blocks the psoriasin that IL-20 induces and expresses, and shows to have complementary action (lower-left picture) in the IL-20 intracellular signaling of IL-20Ra and IL-22R in Human keratinocytes.

Embodiment 25:IL-19, IL-20, IL-22 and IL-24 induce similar gene expression profile

In order to identify the gene that IL-19, IL-20, IL-22 and IL-24 induce, with IL-19, IL-20, IL-22 or IL-24 process RHE tetra-days of 20ng/ml.Preparation RNA, hybridizes cDNA and the AffymetrixU133Plus gene chip (Affymetrix, SantaClara, CA) containing 54,675 probe sets.The genetic analysis data increasing at least 2 times are expressed for it.IL-20, IL-22 and IL-24 show similar gene expression profile.In common front 20 genes of being induced by IL-20, IL-22 and IL-24, seven is the gene that previous report is relevant to psoriatic.These genes are psoriasin (S100A7), S100A12, SCCA2, SERPINB4, CCL20, CD36 and Stat3.

In order to check whether gene that IL-20, IL-22 and IL-24 induce is presented at the rise in psoriatic, compared with being studied with the microarray of previous psoriatic skin by above-described microarray analysis (Zhouetal. (2003) Physiol.Genomics13:69-78).Because this research uses different micro-array chips to carry out, only compare reference sequences (refseqs) common between this research and current research.In the 468 kinds of reference sequences raised in psoriatic skin, induced for 356 kinds by IL-20, IL-22 and IL-24,188 kinds in them is significant (p < 0.05).Combine, above research demonstrates by having between the gene of IL-20, IL-22 and IL-24 induction and the gene raised in psoriatic skin substantial overlapping.

Embodiment 26: material preservation

Following hybridoma cell line is deposited in American type culture collection, 10801UniversityBlvd., Manassas, VA20110-2209USA (ATCC):

Hybridoma/Antibody Designation ATCC preservation date

Anti-IL-22 (3F11.3) PTA-73122006 January 13

Anti-IL-22 (3F11.3) PTA-73122006 January 13

Anti-IL-22 (11H4.4) PTA-73152006 January 13

Anti-IL-22 (8E11.9) PTA-73192006 January 13

Anti-IL-22R (7E9.10.8) PTA-73132006 January 13

Anti-IL-22R (8A12.32) PTA-73182006 January 13

Anti-IL-22R (8H11.32.28) PTA-73172006 January 13

These preservations carry out for the microbial preservation budapest treaty (BudapestTreaty) of patented procedure and the regulation of (budapest treaty) detailed rules for the implementation thereof according to international recognition.Which ensure that and maintain survival culture 30 years from the preservation.Clone can be obtained by ATCC according to the clause of budapest treaty, and the agreement of obeying between Genentech company and ATCC, which ensure the people that (a) confirmed for the official authorized by 37CFR § 1.14 and 35USC § 122 in the period co-pending of patent application, be feasible to the contact of culture, and (b) will be removed by irrevocable when license for the institute of the availability of the public is restricted about the culture of such preservation.

These preservations carry out for the microbial preservation budapest treaty (BudapestTreaty) of patented procedure and the regulation of (budapest treaty) detailed rules for the implementation thereof according to international recognition.Which ensure that and maintain survival culture 30 years from the preservation.Clone can be obtained by ATCC according to the clause of budapest treaty, and the agreement of obeying between Genentech company and ATCC, which ensure the people that (a) confirmed for the official authorized by 37CFR § 1.14 and 35USC § 122 in the period co-pending of patent application, be feasible to the contact of culture, and (b) will be removed by irrevocable when license for the institute of the availability of the public is restricted about the culture of such preservation.

The transferee of the application agrees to, if death when the culture of preserved material is cultivated under suitable conditions, lose or destroyed, then he changes after having notice with the survival sample of same culture rapidly.The availability of institute's preservation clone is also not interpreted as and implements license of the present invention to any government organs of violation according to the right that its patent law is authorized.

Think that foregoing written illustrates to be enough to enable those skilled in the art put into practice the present invention.The present invention is not limited to the scope of institute's preserved material, because institute's preservation embodiment intention is as the single illustration of some aspect of the present invention, and functionally suitable any construction all within the scope of the invention.Material preservation herein not admits that comprised written explanation is not enough to put into practice any aspect of the present invention herein, comprises its optimal mode, can not be interpreted as the particular instantiation scope of claim be limited to described by it.In fact, according to description above, except shown and description herein, multiple modification of the present invention is apparent for those skilled in the art, and within the scope of the appended claims.

Sequence table

<110> Genentech Inc (GENENTECH, INC.)

<120> be used for the treatment of to conduct to cytokine signaling relevant disease and illness,

Involve composition and the method for the antibody be combined with IL-22 and IL-22R

<130>P2293R1PCT

<141>2006-11-30

<150>US60/741,640

<151>2005-12-02

<150>US60/822,597

<151>2006-08-16

<160>4

<210>1

<211>1152

<212>DNA

The <213> mankind (Homosapiens)

<400>1

cttcagaacaggttctccttccccagtcaccagttgctcgagttagaatt50

gtctgcaatggccgccctgcagaaatctgtgagctctttccttatgggga100

ccctggccaccagctgcctccttctcttggccctcttggtacagggagga150

gcagctgcgcccatcagctcccactgcaggcttgacaagtccaacttcca200

gcagccctatatcaccaaccgcaccttcatgctggctaaggaggctagct250

tggctgataacaacacagacgttcgtctcattggggagaaactgttccac300

ggagtcagtatgagtgagcgctgctatctgatgaagcaggtgctgaactt350

cacccttgaagaagtgctgttccctcaatctgataggttccagccttata400

tgcaggaggtggtgcccttcctggccaggctcagcaacaggctaagcaca450

tgtcatattgaaggtgatgacctgcatatccagaggaatgtgcaaaagct500

gaaggacacagtgaaaaagcttggagagagtggagagatcaaagcaattg550

gagaactggatttgctgtttatgtctctgagaaatgcctgcatttgacca600

gagcaaagctgaaaaatgaataactaaccccctttccctgctagaaataa650

caattagatgccccaaagcgattttttttaaccaaaaggaagatgggaag700

ccaaactccatcatgatgggtggattccaaatgaacccctgcgttagtta750

caaaggaaaccaatgccacttttgtttataagaccagaaggtagactttc800

taagcatagatatttattgataacatttcattgtaactggtgttctatac850

acagaaaacaatttattttttaaataattgtctttttccataaaaaagat900

tactttccattcctttaggggaaaaaacccctaaatagcttcatgtttcc950

ataatcagtactttatatttataaatgtatttattattattataagactg1000

cattttatttatatcattttattaatatggatttatttatagaaacatca1050

ttcgatattgctacttgagtgtaaggctaatattgatatttatgacaata1100

attatagagctataacatgtttatttgacctcaataaacacttggatatc1150

cc1152

<210>2

<211>179

<212>PRT

The <213> mankind (Homosapiens)

<400>2

MetAlaAlaLeuGlnLysSerValSerSerPheLeuMetGlyThr

151015

LeuAlaThrSerCysLeuLeuLeuLeuAlaLeuLeuValGlnGly

202530

GlyAlaAlaAlaProIleSerSerHisCysArgLeuAspLysSer

354045

AsnPheGlnGlnProTyrIleThrAsnArgThrPheMetLeuAla

505560

LysGluAlaSerLeuAlaAspAsnAsnThrAspValArgLeuIle

657075

GlyGluLysLeuPheHisGlyValSerMetSerGluArgCysTyr

808590

LeuMetLysGlnValLeuAsnPheThrLeuGluGluValLeuPhe

95100105

ProGlnSerAspArgPheGlnProTyrMetGlnGluValValPro

110115120

PheLeuAlaArgLeuSerAsnArgLeuSerThrCysHisIleGlu

125130135

GlyAspAspLeuHisIleGlnArgAsnValGlnLysLeuLysAsp

140145150

ThrValLysLysLeuGlyGluSerGlyGluIleLysAlaIleGly

155160165

GluLeuAspLeuLeuPheMetSerLeuArgAsnAlaCysIle

170175

<210>3

<211>574

<212>PRT

The <213> mankind (Homosapiens)

<400>3

MetArgThrLeuLeuThrIleLeuThrValGlySerLeuAlaAla

151015

HisAlaProGluAspProSerAspLeuLeuGlnHisValLysPhe

202530

GlnSerSerAsnPheGluAsnIleLeuThrTrpAspSerGlyPro

354045

GluGlyThrProAspThrValTyrSerIleGluTyrLysThrTyr

505560

GlyGluArgAspTrpValAlaLysLysGlyCysGlnArgIleThr

657075

ArgLysSerCysAsnLeuThrValGluThrGlyAsnLeuThrGlu

808590

LeuTyrTyrAlaArgValThrAlaValSerAlaGlyGlyArgSer

95100105

AlaThrLysMetThrAspArgPheSerSerLeuGlnHisThrThr

110115120

LeuLysProProAspValThrCysIleSerLysValArgSerIle

125130135

GlnMetIleValHisProThrProThrProIleArgAlaGlyAsp

140145150

GlyHisArgLeuThrLeuGluAspIlePheHisAspLeuPheTyr

155160165

HisLeuGluLeuGlnValAsnArgThrTyrGlnMetHisLeuGly

170175180

GlyLysGlnArgGluTyrGluPhePheGlyLeuThrProAspThr

185190195

GluPheLeuGlyThrIleMetIleCysValProThrTrpAlaLys

200205210

GluSerAlaProTyrMetCysArgValLysThrLeuProAspArg

215220225

ThrTrpThrTyrSerPheSerGlyAlaPheLeuPheSerMetGly

230235240

PheLeuValAlaValLeuCysTyrLeuSerTyrArgTyrValThr

245250255

LysProProAlaProProAsnSerLeuAsnValGlnArgValLeu

260265270

ThrPheGlnProLeuArgPheIleGlnGluHisValLeuIlePro

275280285

ValPheAspLeuSerGlyProSerSerLeuAlaGlnProValGln

290295300

TyrSerGlnIleArgValSerGlyProArgGluProAlaGlyAla

305310315

ProGlnArgHisSerLeuSerGluIleThrTyrLeuGlyGlnPro

320325330

AspIleSerIleLeuGlnProSerAsnValProProProGlnIle

335340345

LeuSerProLeuSerTyrAlaProAsnAlaAlaProGluValGly

350355360

ProProSerTyrAlaProGlnValThrProGluAlaGlnPhePro

365370375

PheTyrAlaProGlnAlaIleSerLysValGlnProSerSerTyr

380385390

AlaProGlnAlaThrProAspSerTrpProProSerTyrGlyVal

395400405

CysMetGluGlySerGlyLysAspSerProThrGlyThrLeuSer

410415420

SerProLysHisLeuArgProLysGlyGlnLeuGlnLysGluPro

425430435

ProAlaGlySerCysMetLeuGlyGlyLeuSerLeuGlnGluVal

440445450

ThrSerLeuAlaMetGluGluSerGlnGluAlaLysSerLeuHis

455460465

GlnProLeuGlyIleCysThrAspArgThrSerAspProAsnVal

470475480

LeuHisSerGlyGluGluGlyThrProGlnTyrLeuLysGlyGln

485490495

LeuProLeuLeuSerSerValGlnIleGluGlyHisProMetSer

500505510

LeuProLeuGlnProProSerGlyProCysSerProSerAspGln

515520525

GlyProSerProTrpGlyLeuLeuGluSerLeuValCysProLys

530535540

AspGluAlaLysSerProAlaProGluThrSerAspLeuGluGln

545550555

ProThrGluLeuAspSerLeuPheArgGlyLeuAlaLeuThrVal

560565570

GlnTrpGluSer

<210>4

<211>263

<212>PRT

The <213> mankind (Homosapiens)

<400>4

MetMetProLysHisCysPheLeuGlyPheLeuIleSerPhePhe

151015

LeuThrGlyValAlaGlyThrGlnSerThrHisGluSerLeuLys

202530

ProGlnArgValGlnPheGlnSerArgAsnPheHisAsnIleLeu

354045

GlnTrpGlnProGlyArgAlaLeuThrGlyAsnSerSerValTyr

505560

PheValGlnTyrLysIleMetPheSerCysSerMetLysSerSer

657075

HisGlnLysProSerGlyCysTrpGlnHisIleSerCysAsnPhe

808590

ProGlyCysArgThrLeuAlaLysTyrGlyGlnArgGlnTrpLys

95100105

AsnLysGluAspCysTrpGlyThrGlnGluLeuSerCysAspLeu

110115120

ThrSerGluThrSerAspIleGlnGluProTyrTyrGlyArgVal

125130135

ArgAlaAlaSerAlaGlySerTyrSerGluTrpSerMetThrPro

140145150

ArgPheThrProTrpTrpGluThrLysIleAspProProValMet

155160165

AsnIleThrGlnValAsnGlySerLeuLeuValIleLeuHisAla

170175180

ProAsnLeuProTyrArgTyrGlnLysGluLysAsnValSerIle

185190195

GluAspTyrTyrGluLeuLeuTyrArgValPheIleIleAsnAsn

200205210

SerLeuGluLysGluGlnLysValTyrGluGlyAlaHisArgAla

215220225

ValGluIleGluAlaLeuThrProHisSerSerTyrCysValVal

230235240

AlaGluIleTyrGlnProMetLeuAspArgArgSerGlnArgSer

245250255

GluGluArgCysValGluIlePro

260

Claims (12)

1. an antibody of specific binding IL-22, wherein said antibody is:

A antibody that () is produced by the hybridoma 8E11.9 of ATCC registration number PTA-7319;

The form of the Affinity maturation of the antibody of (b) (a);

The humanization form of the antibody of (c) (a) or (b); Or

The Fab of the antibody of (d) (a), (b) or (c).

2. the antibody of claim 1, wherein said antibodies human il-22.

3. the antibody of claim 1, wherein said antibodies mouse IL-22.

4. the antibody of claim 1, wherein said antibodies human il-22 and mouse IL-22.

5. the antibody of any one of claim 1-4, IL-22 in wherein said antibodies born of the same parents.

6. the antibody of claim 2 or 4, wherein said antibody with the KD of≤1nM in conjunction with human il-22.

7. the antibody of claim 1, wherein said antibody be produced by the hybridoma 8E11.9 of ATCC registration number PTA-7319 and with the KD of 0.72nM in conjunction with human il-22.

8. the antibody of claim 1-4 and 7 any one, wherein said antibody is connected with detectable.

9. the antibody of claim 5, wherein said antibody is connected with detectable.

10. the antibody of claim 6, wherein said antibody is connected with detectable.

11. 1 kinds of compositions, it comprises the antibody of any one of claim 1-10.

12. 1 kinds for detecting the test kit of IL-22, this test kit comprises:

The composition of (a) claim 11; With

B () uses said composition to detect the specification sheets of IL-22.