CN101374862A - Methods and compositions for targeting polyubiquitin - Google Patents

Abstract

Anti-polyubiquitin monoclonal antibodies, and methods for using the antibodies, are provided.

Description

The method and composition of targeting polyubiquitin

Invention field

The present invention relates to anti-polyubiquitin antibody art, do not specifically bound from single ubiquitin more particularly to and the anti-polyubiquitin antibody of the polyubiquitin with different isopeptide bonds (isopeptide linkage) can be distinguished.

Background

Ubiquitin (ubiquitin) is a kind of little albumen matter with important regulative in many cellular pathways.The most well-known in these effects is effect of the ubiquitin in protein degradation, it is covalently attached in this ubiquitin and target protein, recognize and destroyed (referring to Wilkinson, Semin.Cell Devel.Biol.11 (3) so that target protein is 26S proteasomes:141-148(2000)).The protein kinase regulation of unlike signal pathway is also relevant with ubiquitination effect (referring to Sun and Chen, Curr.Opin.CellBiol.16:119-126(2004)).For example, the I κ B phosphorylations through I kappa b kinases, which act on I κ B ubiquitination, is able to possibility, and then degraded by 26S proteasomes；Because I κ B are NF κ B inhibitor, therefore I κ B degraded have activated NF κ B (Ghosh and Karin, Cell 109 (Suppl.):S81-S96(2002)；Palombella etc., Cell 78:773-785(1994)).Ubiquitination effect goes back mediated dna reparation (referring to Sun and Chen, Curr.Opin.Cell Biol.16:119-126(2004)).After DNA damage, (PCNA) of proliferating cell nuclear antigen though single ubiquitination effect have activated any DNA damage can synthetic DNA resistant to damage polymerase (Stelter and Ulrich, Nature 425:188-191(2003).Other wherein known physiology courses for being related to ubiquitination effect include cell division, cell growth, cell movement and Apoptosis/cell death (Johnson, Nat.Cell Biol.4:E295-E298(2002)；Pickart, Mol.Cell.8:499-504(2001)).

A kind of covalent attachment of ubiquitin (albumen of 76 amino acid) with target protein is a kind of three steps enzymatic processes (Pickart, Annu.Rev.Biochem.70:503-533(2001)).First, the ubiquitin kinase E1 formation ubiquitin-E1 thioesters in ATP- dependent responses.In second step, ubiquitin is transferred to the member of ubiquitin conjugating enzyme protein (E2) family by ubiquitin-E1 thioesters.In the third step, with the help of ubiquitin protein ligase (E3), isopeptide bond is formed between the epsilon-amino of lysine residue on ubiquitin carboxyl terminal and target protein.Ubiquitin part is removed (Guterman and Glickman, Curr.Prot.Pep.Sci.5 by the enzyme for being referred to as ubiquitin protease from target protein:201-210(2004)).The outstanding role of ubiquitin is that as important regulation molecule human genome contains many different albumen for being related to ubiquitination effect or going ubiquitination to act on:Identified so far at least 40 kinds different E2,500 kinds of different E3 it is different with 80 kinds remove ubiquitin protease (Wong etc., Drug.Discov.Today 8:746-754(2003)).

Ubiquitin contains 7 lysine residues (Lys6, Lys22, Lys27, Lys33, Lys29, Lys48 and Lys63), therefore ubiquitin itself can be used for ubiquitination as target protein and act on (Peng etc., Nat.Biotechnol.21:921-926(2003)；Pickart and Fushman, Curr.Opin.Chem.Biol.8:610-616(2004)).Molecule produced by after the ubiquitination effect of ubiquitin albumen is referred to as polyubiquitin molecule, and can include two or more ubiquitin parts.In theory, (Peng etc., Nat.Biotechnol.21 can occur in 7 lysine residues on any one for the ubiquitination effect of ubiquitin:921-926 (2003)) so that there is different types of polyubiquitin that different lysine residues in ubiquitin are bonded to isopeptide bond.More than one lysine key can be had by being possible to the single polyubiquitin molecule with more than two ubiquitin part.There are some researches show type (Tenno etc., Genes the to Cells 9 of the lysine key formed between E2 enzymes one ubiquitin molecule of influence and another ubiquitin molecule:865-875(2004)；Deng etc. (2000)；Hofmann and Pickart (2001)).The form that polyubiquitin and ubiquitin can act as free molecule and be covalently attached with target protein is present.

As ubiquitin, find to be related to polyubiquitin in many cell processes, these processes include intracellular transport, endocytosis, gene expression/silence, proteolysis, kinase activator effect, translation and DNA and repair (Hoege etc., Nature 419:135-141(2002)；Spence etc., Mol.Cell.Biol.15:1265-1273(1995)；Hofmann and Pickart, Cell 96:645-653(1999).However, in identical approach compared with single ubiquitin and single ubiquitination effect, polyubiquitin and polyubiquitinization effect can have dramatically different physiological role.For example, when PCNA single ubiquitination effect causes fallibility archaeal dna polymerase to activate after DNA damage, activation (Stelter and Ulrich, the Nature 425 of Error-prone DNA repair can be caused by being then observed in the polyubiquitinization effect that the PCNA at identical residue is acted on single ubiquitination:188-191(2003)；Hoege etc., Nature419:135-14l(2002)；Spence etc., Mol.Cell.Biol.15:1265-1273(1995)；And Hofmann and Pickart, Cell 96:645-653(1999)).

The even polyubiquitin with different lysine keys is all shown with different physiological roles.The two kinds of polyubiquitins at most studied are the polyubiquitins of Lys48 connections and Lys63 connections, structural research to both polyubiquitins proposes that the polyubiquitin of different lysine connections can use visibly different conformation, thus allow that there are different interaction (Tenno etc., Genes to Cells 9 from selected binding partners:865-875(2004)).Although generally indicating target protein energy proteolytic degradation by the covalent modification of the Lys48 polyubiquitins connected, but there are some evidences proves that the polyubiquitin of Lys48 connections can also adjust some albumen (Chau etc., Science 243 by non-proteolytic mode:1576-1583(1989)；Finley etc., Mol.Cell.Biol.14:5501-5509(1994)；Flick etc., Nat.Cell.Biol.6:634-641(2004)).In contrast, the polyubiquitin of Lys63 connections is related to the intracellular pathway of a variety of non-proteolytics, (yeast cells of expressing K 63R- ubiquitins is that DNA repairs deficiency), kinase activator effect, intracellular transport and translation (Pickart and Fushman, Curr.Opin.Chem.Biol.8 are repaired including DNA:610-616(2004)；Hicke and Dunn, Annu Rev.Cell Dev.Biol.19:141-172(2003)；Spece etc., Mol.Cell Biol.15:1265-1273(1995)；Ulrich, Eukaryot.Cell 1:1-10(2002)；Spence etc., Cell 102:67-76(2000)；Seibenhener etc., Mol.Cell.Biol.24 (18):8055-8068(2004)).In a specific example, pass through parkin in the way of independent of proteasome, synphilin-1 for K63 connections polyubiquitin institute normally ubiquitination, but synphilin-1 also can destroy (Lim etc., J.Neurosci.25 (8) by the ubiquitination effect targeting of the polyubiquitin of K48 connections:2002-9(2005)).One analysis to the subject with Parkinson's disease shows that synphilin-1 K63- polyubiquitinizations effect may relate to formation (Lim etc., the J.Neurosci.25 (8) of the Lewy cytorrhyctes (Lewy body inclusion) related to disease:2002-9(2005)).

The polyubiquitin of other lysine connections does not obtain detailed, extensive research also, and reason is to be difficult to differentiate between them.So far, research is dependent on expressing the cell of the ubiquitin of process mutagenesis that wherein one or more lysines have been removed, the polyubiquitin with specific bonding of enzyme' s catalysis or for one type of differentiation and the technology of such as mass spectrography of another type of polyubiquitin.For analyzing the normal physiologic behavior of polyubiquitin of specific lysine connection, any one is unsuitable in those described above method or trouble is heavy.Although in the presence of antibody (Fujimoro etc., the FEBS Lett.349 that polyubiquitin is specific to compared with single ubiquitin:173-180 (1994)), but up to now still without can distinguish with different lysine keys polyubiquitin antibody.

Not surprisingly be, due to their known important function in many cell processes, therefore ubiquitin and polyubiquitin are also relevant with many diseases (referring to Argiles, Ubiquitin andDisease, R.G.Landes (1998)).Ubiquitin imbalance (Mitch and Goldberg, New Engl.J.Med.335 are observed in muscular atrophy:1897-905(1996)；Bodine etc., Science 294:1704-1708(2001)).It is that some genetic diseases are associated with abnormal ubiquitin activity, including cystic fibrosis (Ward etc., Cell 83:121-127 (1995)), Angelman ' s syndromes (Kishino etc., Nature Genet.15:70-73 (1997)) and Liddle syndrome (Staub etc., EMBO J 16:6325-6336(1997)).Ubiquitin also works in immune and inflammatory response；For instance, it has been found that extracellular ubiquitin inhibits endotoxic response in TNF α human peripheral blood monocyte as a kind of cell factor, and adjust endotoxin hypoergia (Majetschak etc., Blood 101:1882-1890(2003)；Ciechanover, EMBO J 17:7151-7160(1998)).Similarly, it has been found that there is ubiquitin and polyubiquitin in human serum, observe that both molecules have higher level (Takada etc., Clinical Chem.43 in the patients serum with parasitic disease and allergic disease:1188-1195(1997)).

The imbalance of the approach of some ubiquitins mediation further relates to cancer (Spataro etc., Br.J.Cancer 77:448-55(1998)；Beckmann etc., Hum.Mutat.25:507-12(2005)).For example, mutation (Hashizume etc., J.Biol.Chem.276 just related to breast cancer in different dimerization ubiquitin protein ligase BRCA1-BARD1:14537-40 (2001)), the mutation of ability that destruction Myc will be degraded by ubiquitin-pathway have activated c-Myc carcinogenic potential, and (Salghetti etc., EMBO are J.18:717-726 (1999)), and the v-Jun converted by ubiquitination and can not be degraded to the correlative c-Jun of its non-carcinogenic, and thus causing uncontrolled growth, (Ciechanover, EMBO are J.17:7151-7160(1998)；Trier etc., Cell 78:787-798(1994)).

Ubiquitin and polyubiquitin (Chung etc., TINS 24 (11Suppl.) S7-S14 (2001)) are at large have studied in the nervous system disease of context.It is positive immunostaining (Alves-Rodrigues etc., Trends Neurosci.21 to single ubiquitin and/or polyubiquitin to accumulate in Huntington disease, spinocebellar ataxia, prion encephalopathic, Pick disease, Lewy corpusculums disease, Parkinson's disease and inclusion, corpusculum and neurofibrillary tangles in Alzheimer's:516-520(1998)；Cammarata etc., Neurosci Lett.156:96-98(1993)；Kalchman etc., J.Biol.Chem.271:19385-94(1996)；Holmberg etc., Human Mol.Genet.7:913-918(1998)；Yedidia etc., EMBO are J.20:5383-91(2001)；Mori etc., Science 235:1641-44(1987)；Leigh etc., Acta Neuropathol. (Berl.) 79:61-72(1989)；With Kuzuhara etc., Acta Neuropathologica 75:345-353(1988)).Although by associated (Leroy etc., the Nature 395 of some type of Parkinson's disease and ubiquitin carboxyl-terminal hydrolase L1 (UCH-L1) gene, the mutation gone in ubiquitin protease:451-452 (1998)), but other types of Parkinson's disease but (Shimura etc., Nature Genet.25 associated with Inactivating mutations in Parkin (a kind of known simultaneously ubiquitination synphilin-1 of interacting with ubiquitin conjugating enzyme UbcH7 E2- dependence ubiquitins protein ligase):302-305 (2000), Zhang etc., Proc.Natl.Acad.Sci.97:13354-13359(2000)；Lim etc., J.Neurosci.25 (8):2002-9(2005)).The mutation of both types results in abnormal proteolysis processing and unsuitable protein aggregation (referring to McNaught etc., Nature Rev.Neurosci.2:589-594(2001)).It has also been found that UCH-L1 mutation and Huntington disease are isolated (Naze etc., Neurosci.Lett.328:1:1-4(2002)).The ubiquitin mutant in Alzheimer's human brain is identified, it is effectively mixed in polyubiquitin chain, but once formed and be difficult to be removed ubiquitination, the domination for potentially resulting in normal cell protein hydrolysis system of processing suppresses (Lam etc., Proc.Natl.Acad.Sci.97:9902-9906(2000)).

Obviously the composition and method of the polyubiquitin with different lysine keys can be distinguished by not only possessing, and it should be beneficial to possess the composition and method of the approach that can be effectively targeted to and adjust ubiquitin and polyubiquitin mediation.The present invention relates to above-mentioned composition and method provided herein.

All bibliography cited herein including patent application and publication are incorporated by using it is used as reference.

Disclosure of the invention content

The invention provides the new antibodies that can combine and/or adjust the bioactivity related with polyubiquitin to polyubiquitin.

In one embodiment there is provided a kind of antibody of the separation specifically bound with polyubiquitin, the wherein antibody is not specifically bound with single ubiquitin.In one embodiment, there is provided a kind of antibody with the separation of the first polyubiquitin specific binding comprising the first lysine key, wherein the antibody is not specifically bound with the second polyubiquitin comprising the second lysine key, and wherein the first lysine key is different from the second lysine key.In an aspect, the polyubiquitin of antibody is further connected with lysine 6 polyubiquitin, the polyubiquitin of the connection of lysine 11, the polyubiquitin of the connection of lysine 27, the polyubiquitin of the connection of lysine 29, the polyubiquitin of the connection of lysine 33, the polyubiquitin that lysine 48 is connected or the connection of lysine 63 is specifically bound.

In one embodiment, there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with the first K48, the wherein antibody is not specifically bound from the second polyubiquitin (polyubiquitin of i.e. non-K48 connections) of the lysine type of attachment comprising different polyubiquitins.In one embodiment, the second polyubiquitin is the polyubiquitin of K63 connections.

In one embodiment, there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with the first K63, the wherein antibody is not specifically bound from the second polyubiquitin (polyubiquitin of i.e. non-K63 connections) of the lysine type of attachment comprising different polyubiquitins.In one embodiment, the second polyubiquitin is the polyubiquitin of K48 connections.

In one embodiment, there is provided a kind of antibody of the separation all specifically bound with the first polyubiquitin comprising the first lysine key and the second polyubiquitin comprising the second lysine key, wherein the first lysine key is different from the second lysine key, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody has the binding affinity substantially reduced compared with binding affinity of the antibody to the first polyubiquitin with the combination of the second polyubiquitin.

In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -48, the wherein antibody is not specifically bound with single ubiquitin.In one embodiment, antibody is further selected from respectively SEQ ID NOs comprising at least one:1-25,151-175,265-279,392-459 and 695-704；SEQ ID NOs:27-51,177-201,281-295,461-528 and 706-715；SEQ ID NOs:53-77,203-227,297-311,530-597 and 717-726；And SEQ ID NOs:HVR-H1, HVR-H2, HVR-H3 and HVR-L3 any 313-327 and 728-737 hypervariable region (HVR) sequence.In one embodiment, antibody is further comprising at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, and wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO:825), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is selected from valine, phenylalanine, leucine and isoleucine；Amino acid e is selected from serine and tyrosine；Amino acid f is tyrosine；Amino acid g is selected from serine and tyrosine；Amino acid h is selected from serine and tyrosine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l mn o p q r s t u v w x y z a ' (SEQ ID NO:826), wherein amino acid k is serine；Amino acid/11 is isoleucine；Amino acid m is selected from serine and tyrosine；Amino acid n is selected from proline and serine；Amino acid o is tyrosine；Amino acid p is tyrosine；Amino acid q is selected from serine and glycine；Amino acid r is selected from serine and tyrosine；Amino acid s is threonine, and amino acid t is selected from serine and tyrosine；Amino acid u is tyrosine；Amino acid v is alanine；Amino acid w is aspartic acid；Amino acid x is serine；Amino acid y is valine；Amino acid z is lysine；It is glycine with amino acid a '；And wherein HVR-H3 includes amino acid sequence b ' c ' d ' e ' f ' g ' h ' i ' j ' k ' l ', wherein amino acid b ' is selected from glutamic acid, serine, glycine and tyrosine；Amino acid c ' is selected from glycine, tyrosine, serine and asparagine；Amino acid d ' is selected from tyrosine, serine, lysine, phenylalanine and glutamic acid；Amino acid e ' is selected from serine, tyrosine, glycine and tryptophan；Amino acid f ' is selected from glutamine, tyrosine, serine and glycine；Amino acid g ' is selected from glycine, serine, tyrosine, methionine and alanine；Amino acid h ' is selected from glycine, alanine, proline and isoleucine；Amino acid i ' is selected from phenylalanine, isoleucine, methionine, alanine and leucine, or is not present；Amino acid j ' is phenylalanine or is not present；Amino acid k ' is aspartic acid；And amino acid/11 ' it is tyrosine.In one embodiment, antibody further includes HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding in Figure 10 A and 10B and corresponding to those sequences listed by clone apu01, apu02, apu03, apu04, apu05, apu06, apu07, apu08, apu09, apu10, apu11, apu12, apu13, apu14 or apu15.

In one embodiment, antibody includes at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, and wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO:827), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is isoleucine；Amino acid e is selected from serine and phenylalanine；Amino acid f is tyrosine；Amino acid g is selected from serine and glycine；Amino acid h is selected from serine and glycine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p q r s t u v w x y z a ' (SEQ ID NO:828), wherein amino acid k is serine；Amino acid/11 is isoleucine；Amino acid m is tyrosine；Amino acid n is serine；Amino acid o is tyrosine；Amino acid p is tyrosine；Amino acid q is serine；Amino acid r is tyrosine；Amino acid s is threonine, and amino acid t is serine；Amino acid u is tyrosine；Amino acid v is alanine；Amino acid w is aspartic acid；Amino acid x is serine；Amino acid y is valine；Amino acid z ' is lysine；It is glycine with amino acid a '；And wherein HVR-H3 includes amino acid sequence b ' c ' d ' e ' f ' g ' h ' i ' j ' k ' (SEQ ID NO:829), wherein amino acid b ' is selected from serine and glycine；Amino acid c ' is tyrosine；Amino acid d ' is serine；Amino acid e ' is selected from tyrosine and tryptophan；Amino acid f ' is selected from serine, tyrosine, arginine, phenylalanine and histidine；Amino acid g ' is selected from glutamic acid, serine, leucine, phenylalanine, methionine, asparagine and valine；Amino acid h ' is selected from alanine and glycine；Amino acid i ' is selected from leucine, methionine, phenylalanine and isoleucine；Amino acid j ' is aspartic acid；It is tyrosine with amino acid k '.In one embodiment, antibody further includes HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding in Figure 16 A and corresponding to those sequences listed by clone apu2.01, apu2.02, apu2.03, apu2.04, apu2.05, apu2.06, apu2.07, apu2.08, apu2.09 or apu2.10.

In one embodiment, antibody, which is further included, contains amino acid sequence m ' n ' o ' p ' q ' r ' s ' t ' u ' v ' w ' (SEQ ID NO:830) HVR-L3 sequences, wherein amino acid m ' are glutamine；Amino acid n ' is glutamine；Amino acid o ' is selected from serine and tyrosine；Amino acid p ' is selected from serine and tyrosine；Amino acid q ' is selected from serine and tyrosine；Amino acid r ' is selected from serine and tyrosine；Amino acid s ' is selected from serine and tyrosine；Amino acid t ' is selected from leucine, serine, proline and tyrosine；Amino acid u ' is proline or is not present；Amino acid v ' is selected from phenylalanine, isoleucine, valine and leucine；It is threonine with amino acid w '.In one embodiment, antibody further includes SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and corresponding in Figure 10 C correspond to clone apu01, apu02, apu03, apu04, apu05, apu06, apu07, apu08, apu09, apu10, apu11, apu12, apu13, apu14 or apu15 listed by HVR-L3 sequences HVR-L3 sequences.In one embodiment, antibody, which is further included, contains amino acid sequence Q-Q-S-S-Y-S-S-L-I-T (SEQ ID NO:728) HVR-L3 sequences.In one embodiment, antibody further includes SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and corresponding in Figure 16 B correspond to clone apu2.01, apu2.02, apu2.03, apu2.04, apu2.05, apu2.06, apu2.07, apu2.08, apu2.09 or apu2.10 listed by HVR-L3 sequences HVR-L3 sequences.

In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -48, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody includes SEQ ID NO:269 HVR-H1 sequences, SEQ ID NO:285 HVR-H2 sequences, SEQ ID NO:301 HVR-H3 sequences, SEQ ID NO:79 HVR-L1 sequences, SEQID NO:80 HVR-L2 sequences and SEQ ID NO:317 HVR-L3 sequences.In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -48, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody includes SEQ ID NO:701 HVR-H1 sequences, SEQ ID NO:712 HVR-H2 sequences, SEQ ID NO:723 HVR-H3 sequences, SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and SEQ ID NO:734 HVR-L3 sequences.In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -48, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody includes SEQ ID NO:701 HVR-H1 sequences, SEQ ID NO:712 HVR-H2 sequences, SEQ ID NO:723 HVR-H3 sequences, SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and SEQ IDNO:734 HVR-L3 sequences.

In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -63, the wherein antibody is not specifically bound with single ubiquitin.In one embodiment, antibody is further selected from respectively SEQ ID NOs comprising at least one:81-89,229-239,329-336,599-629 and 739-748；SEQ ID NOs:91-99,241-251,338-345,631-661 and 750-759；SEQ ID NOs:101-109,253-263,347-354,663-693 and 761-770；And SEQ ID NOs:HVR-H1, HVR-H2, HVR-H3 and HVR-L3 any 356-363 and 772-781 hypervariable region (HVR) sequence.In one embodiment, antibody includes at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, and wherein HVR-H1 includes amino acid sequence a bc d e f g h i j (SEQ ID NO:831), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is selected from valine, isoleucine and phenylalanine；Amino acid e is selected from serine and tyrosine；Amino acid f is selected from serine and tyrosine；Amino acid g is selected from serine and tyrosine；Amino acid h is selected from serine and tyrosine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p qr s t u v w x y z a ' (SEQ ID NO:832), wherein amino acid k is selected from serine and tyrosine；Amino acid/11 is isoleucine；Amino acid m is selected from serine and tyrosine；Amino acid n is selected from proline and serine；Amino acid o is selected from serine and tyrosine；Amino acid p is selected from serine and tyrosine；Amino acid q is selected from serine and glycine；Amino acid r is selected from serine and tyrosine；Amino acid s is threonine, and amino acid t is selected from serine and tyrosine；Amino acid u is tyrosine；Amino acid v is alanine；Amino acid w is aspartic acid；Amino acid x is serine；Amino acid y is valine；Amino acid z is lysine；It is glycine with amino acid a；And wherein HVR-H3 includes amino acid sequence b ' c ' d ' e ' f ' g ' h ' i ' j ' k ' l ' m ' n ' o ' p ' q ' r ' s ' t ' u ' v ', wherein amino acid b ' is selected from serine, glutamic acid, glycine and tryptophan；Amino acid c ' is selected from glycine, tyrosine, isoleucine, glutamine and serine；Amino acid d ' is selected from tyrosine, methionine, glycine and isoleucine；Amino acid e ' is selected from tyrosine, arginine, phenylalanine, tryptophan, alanine and proline；Amino acid f ' is selected from tyrosine, tryptophan, serine and glycine；Amino acid g ' is selected from glutamine, tyrosine, serine, phenylalanine and valine；Amino acid h ' is selected from glycine, threonine, tryptophan, lysine and proline；Amino acid i ' is selected from tyrosine, alanine, tryptophan, glutamic acid, proline and serine；Amino acid j ' is selected from tryptophan, isoleucine, tyrosine and alanine；Amino acid k ' is selected from tryptophan, tyrosine, glycine and aspartic acid, or is not present；Amino acid/11 ' tyrosine, serine, phenylalanine and tryptophan are selected from, or be not present；Amino acid m ' is selected from tyrosine, aspartic acid and serine, or is not present；Amino acid n ' is selected from tyrosine and alanine, or is not present；Amino acid o ' is selected from threonine, serine, valine, glycine and tyrosine, or is not present；Amino acid p ' is selected from glycine, aspartic acid, serine, methionine and tyrosine, or is not present；Amino acid q ' is selected from tyrosine, alanine and glycine, or is not present；Amino acid r ' is selected from tyrosine, leucine and glycine, or is not present；Amino acid s ' is glycine or is not present；Amino acid t ' is selected from methionine and leucine, or is not present；Amino acid u ' is aspartic acid；It is tyrosine with amino acid v '.In one embodiment, antibody further includes HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding in Figure 11 A and 11B and corresponding to those sequences listed by clone apu17, apu18, apu19, apu20, apu21, apu22, apu23 and apu24.

In one embodiment, antibody includes at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, and wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO:833), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is selected from isoleucine, valine and leucine；Amino acid e is selected from serine, lysine and valine；Amino acid f is selected from serine, tryptophan, glycine and threonine；Amino acid g is selected from serine, asparagine and glycine；Amino acid h is selected from tyrosine, isoleucine, leucine and phenylalanine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p q r s t u v w x y z a ' (SEQ ID NO:834), wherein amino acid k is selected from tyrosine, phenylalanine, aspartic acid, histidine and alanine；Amino acid/11 is isoleucine；Amino acid m is selected from serine, alanine and glutamine；Amino acid n is proline；Amino acid o is tyrosine；Amino acid p is selected from leucine, tyrosine and phenylalanine；Amino acid q is selected from serine and glycine；Amino acid r is selected from serine, threonine and tryptophan；Amino acid s is threonine, and amino acid t is selected from serine, asparagine, lysine and isoleucine；Amino acid u is tyrosine；Amino acid v is alanine；Amino acid w is aspartic acid；Amino acid x is serine；Amino acid y is valine；Amino acid z ' is lysine；It is glycine with amino acid a '；And wherein HVR-H3 includes (the SEQ ID NO of amino acid sequence b ' c ' d ' e ' f ' g ' h ' i ' j ' k ' 1 ':908), wherein amino acid b ' is glutamic acid；Amino acid c ' is tyrosine；Amino acid d ' is tyrosine；Amino acid e ' is arginine；Amino acid f ' is tryptophan；Amino acid g ' is tyrosine；Amino acid h ' is threonine；Amino acid i ' is alanine；Amino acid j ' is isoleucine；Amino acid k ' is aspartic acid；And amino acid/11 ' it is tyrosine.In one embodiment, antibody includes HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding in Figure 17 A and corresponding to those sequences listed by clone apu2.11, apu2.12, apu2.13, apu2.14, apu2.15, apu2.16, apu2.17, apu2.18, apu2.19 and apu2.20.

In one embodiment, antibody includes at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, and wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO:835), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is selected from isoleucine, valine and leucine；Amino acid e is selected from lysine and methionine；Amino acid f is selected from threonine, methionine, asparagine, arginine and isoleucine；Amino acid g is selected from glycine, valine and phenylalanine；Amino acid h is selected from tyrosine, isoleucine, leucine and phenylalanine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p q r s t u v w x y z a ' b ' (SEQ ID NO:836), wherein amino acid k is alanine；Amino acid/11 is tyrosine；Amino acid m is isoleucine；Amino acid n is selected from serine, isoleucine and threonine；Amino acid o is proline；Amino acid p is tyrosine；Amino acid q is selected from leucine, tyrosine, aspartic acid, serine and tryptophan；Amino acid r is glycine；Amino acid s is selected from tryptophan, valine, serine, asparagine, arginine and tyrosine；Amino acid t is threonine, and amino acid u is selected from arginine, asparagine, valine, threonine, serine and lysine；Amino acid v is tyrosine；Amino acid w is alanine；Amino acid x is aspartic acid；Amino acid y is serine；Amino acid z is valine；Amino acid a ' is lysine；It is glycine with amino acid b '；And wherein HVR-H3 includes m ' n ' o ' (the SEQ ID NO of amino acid sequence c ' d ' e ' f ' g ' h ' i ' j ' k ' 1 ':837), wherein amino acid c ' is serine；Amino acid d ' is arginine；Amino acid e ' is glutamic acid；Amino acid f ' is tyrosine；Amino acid g ' is tyrosine；Amino acid h ' is arginine；Amino acid i ' is tryptophan；Amino acid j ' is tyrosine；Amino acid k ' is threonine；Amino acid/11 ' it is alanine；Amino acid m ' is isoleucine；Amino acid n ' is aspartic acid；It is tyrosine with amino acid o '.In one embodiment, antibody includes HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding in Figure 23 A and 23B and corresponding to those sequences listed by clone apu3.01, apu3.02, apu3.03, apu3.04, apu3.05, apu3.06, apu3.07, apu3.08, apu3.09, apu3.10 and 3.11.

In one embodiment, antibody includes the HVR-L3 sequences containing amino acid sequence w ' x ' y ' z ' A B C D E F G, and wherein amino acid w ' is glutamine；Amino acid x ' is glutamine；Amino acid y ' is selected from serine and tyrosine；Amino acid z ' is selected from serine and tyrosine；Amino acid A is selected from serine and tyrosine；Amino acid B is selected from serine and tyrosine；Amino acid C is selected from proline, serine and leucine；Amino acid D is selected from serine, proline and tyrosine, or is not present；Amino acid E is selected from leucine and phenylalanine, or is not present；Amino acid F is selected from phenylalanine, valine, threonine and isoleucine；Arginine, threonine and phenylalanine are selected from amino acid G.In one embodiment, antibody includes SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and corresponding in Figure 11 C correspond to clone apu17, apu18, apu19, apu20, apu21, apu22, apu23 and apu24 listed by HVR-L3 sequences HVR-L3 sequences.In one embodiment, antibody, which is included, contains amino acid sequence Q-Q-Y-S-S-Y-S-S-L-F-T (SEQ IDNO:772) HVR-L3 sequences.In one embodiment, antibody includes SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and corresponding in Figure 17 B correspond to clone apu2.11, apu2.12, apu2.13, apu2.14, apu2.15, apu2.16, apu2.17, apu2.18, apu2.19 and apu2.20 listed by HVR-L3 sequences HVR-L3 sequences.In one embodiment, antibody includes SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and corresponding to SEQ ID NO:The HVR-L3 sequences of 777 HVR-L3 sequences.

In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -63, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody includes SEQ ID NO:330 HVR-H1 sequences, SEQ ID NO:339 HVR-H2 sequences, SEQ ID NO:348 HVR-H3 sequences, SEQ ID NO:79 HVR-L1 sequences, SEQ IDNO:80 HVR-L2 sequences and SEQ ID NO:357 HVR-L3 sequences.In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -63, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody includes SEQ ID NO:739 HVR-H1 sequences, SEQ ID NO:750 HVR-H2 sequences, SEQ ID NO:761 HVR-H3 sequences, SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and SEQ ID NO:772 HVR-L3 sequences.In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -63, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody includes SEQ ID NO:740 HVR-H1 sequences, SEQ ID NO:751 HVR-H2 sequences, SEQ ID NO:762 HVR-H3 sequences, SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and SEQ IDNO:773 HVR-L3 sequences.In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -63, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody includes SEQ ID NO:744 HVR-H1 sequences, SEQ ID NO:755 HVR-H2 sequences, SEQ ID NO:766 HVR-H3 sequences, SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80 HVR-L2 sequences and SEQ ID NO:777 HVR-L3 sequences.In one embodiment there is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -63, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody includes SEQ ID NO:795 HVR-H1 sequences, SEQ ID NO:807 HVR-H2 sequences, SEQ ID NO:819 HVR-H3 sequences, SEQ ID NO:79 HVR-L1 sequences, SEQID NO:80 HVR-L2 sequences and SEQ ID NO:777 HVR-L3 sequences.

In an aspect there is provided a kind of antibody with the separation of antigenic determinant on any afore mentioned antibodies combination identical polyubiquitin, wherein the antibody is not specifically bound with single ubiquitin.In an aspect there is provided a kind of antibody that the separation combined with polyubiquitin is competed with any afore mentioned antibodies, the wherein antibody is not specifically bound with single ubiquitin.

In an aspect, any afore mentioned antibodies are combined with polyubiquitin protein-specific.In an aspect, antibody further suppresses the degraded of polyubiquitin albumen.In an aspect, antibody further adjusts the signal transduction path of at least one polyubiquitin mediation.In an aspect, antibody further suppresses the signal transduction path of at least one polyubiquitin mediation.In an aspect, antibody further stimulates the signal transduction path that at least one polyubiquitin is mediated.

There is provided a kind of nucleic acid molecules for the antibody for encoding the present invention in an aspect.There is provided a kind of carrier for including the nucleic acid in an aspect.There is provided a kind of host cell for including the carrier in an aspect.A kind of cell line for the antibody that can produce the present invention is provided in an aspect.In an aspect there is provided it is a kind of produce the present invention antibody method, be included therein produce the antibody under conditions of culture comprising encode the antibody nucleic acid molecules host cell.There is provided a kind of antibody of the invention comprising effective dose and the composition of pharmaceutically acceptable carrier in an aspect.

Polyubiquitin or the method for polyubiquitin albumen presence in sample are identified there is provided a kind of in an aspect, including sample is contacted with least one antibody of the invention.In an aspect there is provided a kind of method for being used to treat disease related to polyubiquitin imbalance in patient or illness, at least one of the invention antibody of this method including giving patient effective amounts.In an aspect, patient is mammalian subject.In an aspect, patient is people.In an aspect, disease is selected from the related hereditary conditions of cancer, disorder of muscle, ubiquitin-pathway, immune/inflammatory conditions and the nervous system disease.In an aspect, disease is selected from cancer (carcinoma), lymthoma (lymphoma), enblastoma (blastoma), sarcoma (sarcoma), leukaemia (leukemia), muscular dystrophy (muscular dystrophy), multiple sclerosis (multiple sclerosis), amyotrophic lateral sclerosis (amyotrophic lateral sclerosis), cystic fibrosis (cystic fibrosis), Angelman ' s syndromes (Angelman ' s syndrome), Liddle syndrome (Liddle syndrome), Alzheimer's (Alzheimer ' s disease), Parkinson's disease (Parkinson ' s disease), Pick disease (Pick ' s disease) and Paget disease (Paget ' s disease).

In an aspect, there is provided a kind of method for determining to suspect that polyubiquitin or polyubiquitin albumen are present in the sample containing polyubiquitin or polyubiquitin albumen, including expose the samples at least one antibody of the invention and determine the combination of polyubiquitin or polyubiquitin albumen at least one antibody and sample.

The method of polyubiquitin albumen and non-poly ubiquitination albumen in sample is separated there is provided a kind of in an aspect, including sample contacted with least one antibody of the invention.

The method of the function of polyubiquitin and/or activity in cell is determined there is provided a kind of in an aspect, including cell is contacted with least one antibody of the invention and influence of the contact procedure to the cell is assessed.

The method of the function of polyubiquitin and/or activity in sample is determined there is provided a kind of in an aspect, including sample is contacted with least one antibody of the invention and influence of the contact procedure to the sample is assessed.

There is provided a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -63, the wherein epitope in the polyubiquitin of the antibody binding lysine -63 connection in another embodiment.In an aspect, the epitope includes the residue in the first ubiquitin subunit and the second ubiquitin subunit of the polyubiquitin that lysine -63 is connected.In another above-mentioned aspect, the epitope includes the residue at least one first ubiquitin subunit selected from Glu-18, Pro-19, Ser-20, Asp-21, Thr-55, Leu-56, Ser-57, Asp-58, Asn-60, Ile-61 and Gln-62.In another above-mentioned aspect, the epitope includes the residue at least one second ubiquitin subunit selected from Leu-8, Thr-9, Glu-34, Gly-35, Ile-36, Pro-37, Asp-39, Gln-40, Leu-71, Arg-72, Leu-73, Arg-74 and Gly-75.In another above-mentioned aspect, epitope includes the residue at least one first ubiquitin subunit selected from Glu-18, Pro-19, Ser-20, Asp-21, Thr-55, Leu-56, Ser-57, Asp-58, Asn-60, Ile-61 and Gln-62, and the residue at least one second ubiquitin subunit selected from Leu-8, Thr-9, Glu-34, Gly-35, Ile-36, Pro-37, Asp-39, Gln-40, Leu-71, Arg-72, Leu-73, Arg-74 and Gly-75.

In one embodiment, a kind of antibody of the separation specifically bound there is provided the first polyubiquitin with the first lysine residue that is being bonded to comprising at least one isopeptide bond at the first amino acid position of ubiquitin molecule, second polyubiquitin of wherein the second lysine residue of the antibody not with being bonded to comprising at least one isopeptide bond at the second amino acid position of ubiquitin molecule is specifically bound, and wherein the first and second amino acid positions are different.The antibody of the present invention can exist in a variety of forms.For example, the antibody of the present invention can be chimeric antibody, humanized antibody or human antibody.In one embodiment, antibody of the invention is human antibody, and for example it is not the antibody produced in xenotypic mice (xenomouse) (as described in WO96/33735).The antibody of the present invention can be total length or its fragment (such as fragment comprising antigen-binding portion thereof).

In another embodiment, the invention provides a kind of antigen-binding fragment of any afore mentioned antibodies.

Brief description

Fig. 1 shows the primary structure of ubiquitin and the schematic diagram of some polyubiquitin isopeptide bonds (polyubiquitinisopeptide linkage).Fig. 1 a show amino acid sequence (the SEQ IDNO of people's ubiquitin:377), lysine residue is shown with runic, underlined text.Fig. 1 b show the schematic diagram of the key formed between the lysine -48 or lysine -63 of the first ubiquitin molecule (a first ubiquitin molecule) and the C- terminal glycine residues of the second ubiquitin molecule (a second ubiquitin molecule).

Fig. 2A -2C are shown as described in embodiment 1 (A), the heavy chain HVR ring sequences of the anti-polyubiquitin antibody molecule of the polyubiquitin of specific recognition K48 connections.Symbol " 48 " refers to the polyubiquitin of antibody molecule specific recognition K48 connections.Symbol " both " refers to antibody molecule identification K48 connections and K63 connections polyubiquitin.Symbol " all " refers to antibody molecule identification K48 connections and K63 connections polyubiquitin (polyubiquitin) and single ubiquitin (monoubiquitin).Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.The figure illustrates heavy chain HVR sequences, H1, H2 and H3.Amino acid position is numbered according to following Kabat numbering systems.

Fig. 3 A-3B are shown as described in embodiment 1 (A), the heavy chain HVR ring sequences of the anti-polyubiquitin antibody molecule of the polyubiquitin of specific recognition K63 connections.Symbol " 63 " refers to the polyubiquitin of antibody molecule specific recognition K63 connections.Symbol " both " refers to antibody molecule identification K63 connections and K48 connections polyubiquitin.Symbol " all " refers to antibody molecule identification K63 connections and K48 connections polyubiquitin and single ubiquitin.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.The figure illustrates heavy chain HVR sequences, H1, H2 and H3.Amino acid position is numbered according to following Kabat numbering systems.

Fig. 4 A and 4B and Fig. 5 depict the illustrative acceptor people being used for implementing the present invention with following sequence identifier and have framework sequence:

Weight chain variable district (VH) has framework region (Fig. 4 A and 4B)

The people's VH subgroups I for removing Kabat CDRs has framework region (SEQ ID NOs:111st, 839,858 and 877)

The people's VH subgroups I for removing the hypervariable region of extension has framework region (SEQ ID NOs:112-114,840-842,859-861 and 878-880)

The people's VH subgroups II for removing Kabat CDRs has framework region (SEQ ID NOs:115th, 843,862 and 881)

The people's VH subgroups II for removing the hypervariable region of extension has framework region (SEQ ID NOs:116-118,844-846,863-865 and 882-884)

The people's VH subgroups III for removing Kabat CDRs has framework region (SEQ ID NOs:119th, 847,866 and 885)

The people's VH subgroups III for removing the hypervariable region of extension has framework region (SEQ ID NOs:120-122,848-850,867-869 and 886-888)

Remove Kabat CDRs people VH acceptor frameworks (SEQ ID NOs:123rd, 851,870 and 889)

Remove people VH acceptor frameworks (the SEQ ID NOs of the hypervariable region of extension:124-125,852-853,871-872 and 890-891)

Remove the Kabat CDRs framework region of people VH acceptors 2 (SEQ ID NOs:126th, 854,873 and 892)

Remove the framework region of people VH acceptors 2 (the SEQ ID NOs of the hypervariable region of extension:127-129,855-857,874-876 and 893-895)

Light chain variable district (VL) has framework region (Fig. 5)

People's VL κ subgroups I has framework region (SEQ ID NOs:130th, 896,900 and 904)

People's VL κ subgroups II has framework region (SEQ ID NOs:131st, 897,901 and 905)

People's VL κ subgroups III has framework region (SEQ ID NOs:132nd, 898,902 and 906)

People's VL κ subgroups IV has framework region (SEQ ID NOs:133rd, 899,903 and 907)

Fig. 6 depicts the framework sequence of huMAb4D5-8 light chains and heavy chain.The numbering of subscript/runic indicates the amino acid position according to Kabat.

Fig. 7 depict huMAb4D5-8 light chains and heavy chain modified/framework sequence of variation.The numbering of subscript/runic indicates the amino acid position according to Kabat.

Fig. 8 A-8C are shown as described in embodiment 1A, the heavy chain HVR ring sequences of the anti-polyubiquitin antibody molecule of the polyubiquitin of specific recognition K48 connections.The figure illustrates heavy chain HVR sequences, H1, H2 and H3.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.Amino acid position is numbered according to following Kabat numbering systems.

Fig. 9 A-9B are shown as described in embodiment 1A, the heavy chain HVR ring sequences of the anti-polyubiquitin antibody molecule of the polyubiquitin of specific recognition K63 connections.The figure illustrates heavy chain HVR sequences, H1, H2 and H3.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.Amino acid position is numbered according to following Kabat numbering systems.

Figure 10 A-10C are shown as described in embodiment 1 (B), the polyubiquitin of specific recognition K48 connections and the anti-polyubiquitin antibody molecule apu01-apu15 recognized for specificity for the antibody of five histidines (pentahistidine) heavy chain and light chain HVR ring sequences.The figure illustrates heavy chain HVR sequences, H1, H2 and H3, and light chain HVR sequences, L3.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.Amino acid position is numbered according to following Kabat numbering systems.

Figure 11 A-11C are shown as described in embodiment 1 (B), the polyubiquitin of specific recognition K63 connections and the anti-polyubiquitin antibody molecule apu17-apu24 recognized for specificity for the antibody of five histidines heavy chain and light chain HVR ring sequences.The figure illustrates heavy chain HVR sequences, H1, H2 and H3, and light chain HVR sequences, L3.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.Amino acid position is numbered according to following Kabat numbering systems.

Figure 12 is depicted as described in embodiment 1 (C), is used

Binding interactions between the polyubiquitin of the anti-polyubiquitin Fab apu09 and K48 connection or K63 connections for the various concentrations that analysis and observation is arrived.

Figure 13 is depicted as described in embodiment 1 (C), is used

Binding interactions between the polyubiquitin of the anti-polyubiquitin Fab apu18 and K48 connection or K63 connections for the various concentrations that analysis and observation is arrived.

Figure 14 A-14F show as described in Example 2, the heavy chain HVR ring sequences of the anti-polyubiquitin antibody molecule of the second generation of the Fab apu05 of the polyubiquitin based on specific recognition K48 connections sequence.The figure illustrates heavy chain HVR sequences, H1, H2 and H3.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.Amino acid position is numbered according to following Kabat numbering systems.Draw shadow words and represent that the amino acid sequence of sequence HVR sequences corresponding with Fab apu05 is identical.Bold text represents the antibody for being proved to combine by force in the Phage-ELISA described by embodiment 2 is determined.

Figure 15 A-15C show as described in Example 2, the heavy chain HVR ring sequences of the anti-polyubiquitin antibody molecule of the second generation of the Fab apu18 of the polyubiquitin based on specific recognition K63 connections sequence.The figure illustrates heavy chain HVR sequences, H1, H2 and H3.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.Amino acid position is numbered according to following Kabat numbering systems.Draw shadow words and represent that the amino acid sequence of sequence HVR sequences corresponding with Fab apu18 is identical.Bold text represents the antibody for being proved to combine by force in the Phage-ELISA described by embodiment 2 is determined.

Figure 16 A and 16B show as described in Example 2, the amino acid sequence of the heavy chain hypervariable region of the polyubiquitin of specific recognition K48 connections and the Fab molecules (apu2.01-apu2.10) from the apu05 Jing Guo mutagenesis recognized for specificity for the antibody of five histidines.The figure illustrates heavy chain HVR sequences, H1, H2 and H3, and light chain HVR sequences, L3.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.Amino acid position is numbered according to following Kabat numbering systems.Draw shadow words and represent that the amino acid sequence of sequence HVR sequences corresponding with Fab apu05 is identical.

Figure 17 A and 17B show as described in Example 2, the amino acid sequence of the heavy chain hypervariable region of the polyubiquitin of specific recognition K63 connections and the Fab molecules (apu2.11-apu2.20) from the apu18 Jing Guo mutagenesis recognized for specificity for the antibody of five histidines.The figure illustrates heavy chain HVR sequences, H1, H2 and H3, and light chain HVR sequences, L3.Symbol " n.p. " refers to some be cloned in and indicates do not have amino acid at position.Amino acid position is numbered according to following Kabat numbering systems.Draw shadow words and represent that the amino acid sequence of sequence HVR sequences corresponding with Fab apu18 is identical.

Figure 18 depicts the result that Phage-ELISA as described in Example 2 is determined, wherein have evaluated the combination of polyubiquitin, the polyubiquitin of K63 connections, single ubiquitin and bovine serum albumin(BSA) that each second generation Fab apu2.01-2.20 and K48 are connected.

Figure 19 A and 19B depict the result of Western blot experiment as described in Example 1.Figure 19 A show the combination of four poly- ubiquitins of the K48 connections of the Fab for being produced from clone apu01-apu15 and immobilization.Figure 19 B show that polyubiquitins of the Fab for being produced from clone apu18-apu24 not with the K63 connections of immobilization is combined.

Figure 20 A and 20B depict the result of the Western blot experiment described in embodiment 2.Figure 20 A show the combination of four poly- ubiquitins of the K48 connections of apu2.01-apu2.10 and immobilization, but the dimerization ubiquitin with the K63 connections of immobilization is not combined.Figure 20 B show the combination of four poly- ubiquitins of the K63 connections of apu2.11-apu2.20 and immobilization, but the dimerization ubiquitin with the K48 connections of immobilization is not combined.

Figure 21 A and 21B are shown as described in Example 3, from the Western blotting for the immunoprecipitation experiment for detecting RIP ubiquitination active states.Trace in Figure 21 A is included with apu2.16IgG immunoprecipitations with the sample for the polyubiquitin albumen for catching K63 connections.Trace in Figure 21 B is included with apu2.07IgG immunoprecipitations with the sample for the polyubiquitin albumen for catching K48 connections.With this two parts of traces of anti-RIP antibody stainings.

Figure 22 depicts the result that the Phage-ELISA described in embodiment 4 is determined, wherein have evaluated the combination of polyubiquitin, the polyubiquitin of K63 connections, single ubiquitin and bovine serum albumin(BSA) that each third generation clone apu3.01-3.12 and K48 is connected.

Figure 23 A and 23B show as described in Example 4, the amino acid sequence of the heavy chain hypervariable region of the clone (apu3.01-apu3.12) from apu2.16 Jing Guo mutagenesis of the polyubiquitin of specific recognition K63 connections.The figure illustrates heavy chain HVR sequences, H1, H2 and H3.Symbol " ND. " represents that sequence is not detected among.Amino acid position is numbered according to following Kabat numbering systems.Draw shadow words and represent that the amino acid sequence of sequence HVR sequences corresponding with apu2.16 is identical.

Figure 24 A-24D depict the result of the Western blot experiment described in embodiment 4.Figure 24 A show the trimerization of the K48 connections of apu2.07IgG and immobilization to the combination of seven poly- ubiquitins, but are not combined with trimerization to the seven poly- ubiquitins or single ubiquitin of the K63 connections of immobilization.Figure 24 B show the trimerization of the K63 connections of apu3.07IgG and immobilization to the combination of seven poly- ubiquitins, but are not combined with trimerization to the seven poly- ubiquitins or single ubiquitin of the K48 connections of immobilization.Figure 24 C show that apu2.07IgG and the concentration dependent of four poly- ubiquitins of the K48 connections of immobilization are combined, but the four poly- ubiquitins with the K63 connections of immobilization are not combined.Figure 24 D show that apu3.07IgG and the concentration dependent of four poly- ubiquitins of the K63 connections of immobilization are combined, but the four poly- ubiquitins with the K48 connections of immobilization are not combined.

Figure 25 depicts the result of the Western blot experiment described in embodiment 4.Used by oneself the figure illustrates anti-ubiquitin polyclonal antibody, apu2.07 IgG and apu3.07 IgG and immobilization

Handle the combination of the 293T cell lysates of (+) or untreated (-).

Figure 26 A-26C show the interaction between the special fab of the polyubiquitin of the K63 connections of the invention determined by crystallographic analysis and the polyubiquitin of K63 connections.Figure 26 A depict the compound formed between the dimerization ubiquitin of special fab apu2.16 and the K63 connections of the polyubiquitin of K63 connections.Apu2.16 is shown in the strip-chart of the figure bottom, and the dimerization ubiquitin of at the same time K63 connections is then shown in the chondritic at the top of the figure.Figure 26 B depict the surface of the dimerization ubiquitin of K63 connections, and those are located at fab's

Within residue dark gray and marked residue interested.Figure 26 C depict apu2.16 surface, and those are located at the ubiquitin dimer of K63 connections

Within residue dark gray.It marked CDR.

Embodiments of the present invention

General technology

Unless otherwise indicated, implementation of the invention will use molecular biology (including recombinant technique), microbiology, cell biology, biochemistry and immunologic routine techniques, and these are all within the skill of the art.These technologies are very full in document, such as " Molecular Cloning:ALaboratory Manual ", the third edition (Sambrook et al., 2001)；" OligonucleotideSynthesis " (M.J.Gait, ed., 1984)；" Animal Cell Culture " (R.I.Freshney is compiled, 1987)；" Methods in Enzymology " (Academic Press, Inc.)；" Current Protocols inMolecular Biology " (F.M.Ausubel et al. are compiled, 1987, and periodic updates)；“PCR:The Polymerase Chain Reaction ", (Mullis et al. are compiled, 1994)；PCR 2:A PracticalApproach (M.J.MacPherson, B.D.Hames and G.R.Taylor compile (1995))；Harlowand Lane compile (1988) Antibodies, A Laboratory Manual；" A Practical Guide toMolecular Cloning " (Perbal Bernard V., 1988)；And " Phage Display:A LaboratoryManual " (Barbas et al., 2001).

Definition

As used herein, term " ubiquitin (ubiquitin) " (ubiquitin) and " single ubiquitin (monoubiquitin) " are used interchangeably, natural people's and synthesis the ubiquitin of all kinds is defined as, it is similar substantially to the protein of 76 amino acid with least one lysine residue at the 6th, the 22nd, the 27th, the 29th, the 33rd, the 48th, and/or the 63rd amino acids.

As used herein, term " polyubiquitin (polyubiquitin) " is defined as natural people's and synthesis the ubiquitin polymeric chain of all kinds, it falls into people's and synthesis the classification of ubiquitin difference polymerization connected mode, including, but it is not limited to, polyubiquitin, the polyubiquitin of K22- connections, the polyubiquitin of K27- connections, the polyubiquitin of K29- connections, the polyubiquitin of K33- connections, the polyubiquitin of K48- connections and the polyubiquitin of K63- connections of K6- connections.Polyubiquitin can be any length, including at least two ubiquitin modules (moity).Polyubiquitin is different from the ubiquitin tandem repeats initially as single protein expression.

As used herein, term " K^*The polyubiquitin of-connection " and " Lys^*The polyubiquitin of-connection " is used interchangeably, and refers to the polyubiquitin molecule for including at least one isopeptide bond between the * lysines in the C- ends and another ubiquitin module of a ubiquitin module.For example, " polyubiquitin of K63- connections " is used interchangeably with " polyubiquitin that Lys63- is connected ", and the two terms all refer in the C- ends of ubiquitin module in the molecule and molecule includes isopeptide bond polyubiquitin molecule between the 63rd lysine of another ubiquitin module.

As used herein, state the first lysine connection " difference " and connect second lysine connection that involved lysine residue (e.g., K6, K22, K27, K29, K33, K48, and/or K63) is different between a ubiquitin module and another ubiquitin module in first lysine that the connection of the second lysine refers between a ubiquitin module and another ubiquitin module.

As used herein, term " ubiquitin-pathway " refers to the biochemical route of in cell or rebuilding in vitro including ubiquitin and/or polyubiquitin.

" separation " antibody refers to the antibody that a kind of identified and from its natural surroundings composition is separated and/or reclaimed.The contaminant component of its natural surroundings refers to the material of the research that will disturb the antibody, diagnosis or therapeutical uses, it may include the solute of enzyme, hormone and other oroteins property or non-proteinaceous.In one embodiment, by measure of the antibody purification to (1) according to such as Lowry methods, antibody weight is more than 95%, weight is more than 99% in some embodiments, (2) the N- ends by using such as spinning cup sequenator at least 15 residues of acquisition or the degree of internal amino acid sequence are enough, or (3) are according to the SDS-PAGE under reproducibility or non-reducing conditions and use such as Coomassie blue or Silver stain, reach homogeneity.Since at least one composition of antibody natural surroundings is not in, then the antibody of separation includes the antibody iM situ in recombinant cell.However, the antibody of separation will generally be prepared by least one purification step.

As used herein, term " anti-ubiquitin antibody " and " anti-single ubiquitin antibody " are used interchangeably, and refer to specifically bind the antibody of ubiquitin molecule.

As used herein, term " anti-polyubiquitin antibody " refers to specifically bind the antibody of polyubiquitin molecule.

As used herein, term " the polyubiquitin antibody of anti-K48- connections " refers to specifically bind the antibody of the polyubiquitin of K48- connections.

As used herein, term " the polyubiquitin antibody of anti-K63- connections " refers to the antibody of the polyubiquitin with reference to K63- connections.

Phrase " essentially similar " " substantially (substantial) is identical ", " suitable " or " substantially (substantial) is suitable " represent two values (for example as used herein, one related to certain molecule, another to reference to/to compare molecule related) between sufficiently high similarity degree, so that those skilled in the art will be considered that with the numerical value (e.g., Kd values, antiviral effect, etc.) measured by biological characteristics background in difference between two values have very little or without biology and/or significance,statistical.Difference between described two numerical value is, for example, less than about 50%, less than about 40%, less than about 30%, less than about 20%, and/or less than about 10%, as with reference to/compare molecule numerical value function.

Phrase " substantial reduction (substantially reduced) " or " substantive difference (substantiallydifferent) " represent two values (generally as used herein, one related to certain molecule, another to reference to/to compare molecule related) between sufficiently high difference degree, so that those skilled in the art will be considered that the difference in the biological characteristics background measured by the numerical value (e.g., Kd values) between two values has significance,statistical.Difference between described two numerical value is, for example, greater than about 10%, greater than about 20%, greater than about 30%, greater than about 40%, greater than about 50%, as with reference to/compare the function of the antibody numerical value.

" binding affinity " is often referred to the intensity of whole noncovalent interaction summations between the single binding site gametophyte in connection (such as antigen) of molecule (such as antibody).Unless otherwise indicated, as used herein, " binding affinity " refer to reflection combine to member's (such as antibody and antigen) between 1:The inherent binding affinity of 1 interaction.Molecule X generally can use dissociation constant (Kd) to state its gametophyte Y affinity.Common method that affinity can be known by this area is measured, including described herein.Low-affinity antibody generally slowly combines antigen and tends to easily dissociation, and high-affinity antibody generally faster combines antigen and tends to keep the combination of longer time.A variety of methods of measurement binding affinity are known in this area, and any of which can be used in the purpose of the present invention.Specific exemplary is described below.

In one embodiment, " Kd " or " Kd values " according to the present invention is to be determined by the radio-labelled antigen binding assay (RIA) carried out described in method using the purpose antibody and its antigen of Fab patterns come what is measured:By under conditions of it there are the titration series of unlabelled antigen, with Cmin¹²⁵I labelled antigens are balanced, and then catch the antigen of combination to measure solution binding affinity (Chen, et al., J Mol Biols 293 of the Fab to antigen with the coated flat board of anti-Fab antibody:865-881(1999)).In order to determine condition determination, caught and stayed overnight with anti-Fab antibody (Cappel Labs) coating microtiter plate (Dynex) with 5 μ g/ml in 50mM sodium carbonate (pH 9.6), then closed 2-5 hours for (about 23 DEG C) in room temperature with 2% (w/v) bovine serum albumin in PBS.In non-adsorbed flat board (Nunc #269620), by 100pM or 26pM [¹²⁵I]-antigen mixes with the purpose Fab of serial dilution (such as with Presta et al., Cancer Res.57:Anti-VEGF antibody in 4593-4599 (1997), Fab-12 assessment is consistent).Then by purpose Fab incubated overnights；But, sustainable longer time (such as 65 hours) is incubated to ensure to reach balance.Hereafter, mixture is transferred into capture board to carry out incubation at room temperature (such as 1 hour).Then solution is removed, and with the PBS board-washings 8 times containing 0.1% Tween-20.After flat board is dried, 150 μ l/ holes scintillation solution (MicroScint-20 are added；Packard), then in Topcount gamma counters (Packard) to plate count 10 minutes.Each Fab is selected to provide 20% concentration less than or equal to maximum combined for competitive binding assay.According to another embodiment, Kd or Kd values are to use BIAcore by surface plasmon resonance determination method^TM- 2000 or BIAcore^TMWhat -3000 (BIAcore, Inc., Piscataway, NJ) were measured at 25 DEG C using immobilized antigen CM5 chips in about 10 response units (RU).In brief, specification according to supplier activates carboxy methylation dextran biosensor matrix chip (CM5, BIAcore Inc.) with hydrochloric acid N- ethyls-N '-(3- dimethylaminopropyls)-carbodiimides (EDC) and n-hydroxysuccinimide (NHS).With 10mM sodium acetates pH 4.8 by antigen diluent to 5 μ g/ml (about 0.2 μM), the coupling protein matter for obtaining about 10 response units (RU) is then injected into the 5 μ flow velocitys of l/ minutes.Inject after antigen, inject 1M monoethanolamines to close unreacted group.In order to carry out kinetic measurement, the Fab (0.78nM to 500nM) of twice of serial dilution in the PBS containing 0.05% Tween-20 (PBST) is infused in the about 25 μ flow velocitys of l/ minutes at 25 DEG C.Pass through fitting Combination and dissociation sensorgram calculations incorporated speed (k simultaneously using simple one-to-one Lang Gemiaoer (Langmuir) binding model (BIAcore Evaluation Software version 3.2)_on) and dissociation rate (k_off).Equilibrium dissociation constant (Kd) is with ratio k_off/k_onCalculate.See, for example, Chen, Y., et al., J Mol Biol 293:865-881(1999).If according to surface plasmon resonance determination method above, association rate is more than 10⁶M^-1S^-1So association rate can be used fluorescent quenching technology to determine, the measurement with stirring cuvette in the spectrophotometer of cut-off device (a stop-flow equipped spectrophometer) (Aviv Instruments) or 8000 series SLM-Aminco spectrophotometers (ThermoSpectronic) is such as equipped with according to spectrometer, under conditions of it there is the antigen of increasing concentration, the anti-antigen-antibodies of 20nM (Fab forms) measured in PBS, pH 7.2 (excite=295nm in 25 DEG C of fluorescent emission intensities；Transmitting=340nm, 16nm band logicals) be raised and lowered.

" association rate " (on-rate, rate of association, association rate) or " k according to the present invention_on" also BIAcore can be used by identical surface plasmon resonance technology described above^TM- 2000 or BIAcore^TM- 3000 (BIAcore, Inc., Piscataway, NJ) are determined using immobilized antigen CM5 chips at 25 DEG C in about 10 response units (RU).In brief, specification according to supplier activates carboxy methylation dextran biosensor matrix chip (CM5, BIAcoreInc.) with hydrochloric acid N- ethyls-N '-(3- dimethylaminopropyls)-carbodiimides (EDC) and n-hydroxysuccinimide (NHS).With 10mM sodium acetates pH 4.8 by antigen diluent to 5 μ g/ml (about 0.2 μM), the coupling protein matter for obtaining about 10 response units (RU) is then injected into the 5 μ flow velocitys of l/ minutes.Inject after antigen, inject 1M monoethanolamines to close unreacted group.In order to carry out kinetic measurement, the Fab (0.78nM to 500nM) of twice of serial dilution in the PBS containing 0.05% Tween-20 (PBST) is infused in the about 25 μ flow velocitys of l/ minutes at 25 DEG C.Pass through fitting Combination and dissociation sensorgram calculations incorporated speed (k simultaneously using simple one-to-one Lang Gemiaoer (Langmuir) binding model (BIAcoreEvaluation Software version 3.2)_on) and dissociation rate (k_off).Equilibrium dissociation constant (Kd) is with ratio k_off/k_onCalculate.See, for example, Chen, Y., et al., J Mol Biol 293:865-881(1999).If however, according to surface plasmon resonance determination method above, association rate is more than 10⁶M^-1S^-1So association rate can use fluorescent quenching technology to determine, the measurement with stirring cuvette in the spectrophotometer of cut-off device (AvivInstruments) or 8000 series SLM-Aminco spectrophotometers (ThermoSpectronic) is such as equipped with according to spectrometer, under conditions of it there is the antigen of increasing concentration, the anti-antigen-antibodies of 20nM (Fab forms) measured in PBS, pH 7.2 (excite=295nm in 25 DEG C of fluorescent emission intensities；Transmitting=340nm, 16nm band logicals) be raised and lowered.

Term " carrier " means that the nucleic acid molecules of connected other nucleic acid can be transported as used herein.One class carrier is " plasmid ", and the circular double stranded DNA ring of other DNA section can wherein be connected by referring to.Another kind of carrier is phage vector.Another kind of carrier is viral vector, wherein other DNA section can be connected in viral genome.Some carriers can in its host cell imported autonomous replication (such as bacteria carrier and episomal mammalian vectors with bacterial origin of replication).Other carriers (such as non-add type mammalian vector) can be incorporated into the genome of host cell after host cell is imported, thus as host genome is replicated together.In addition, some carriers can instruct the gene expression being operatively connected with it.Examples of such carriers is referred to herein as " recombinant expression carrier " (or being referred to as " recombinant vector ").Generally, expression vector useful in recombinant DNA technology is often plasmid form.In this manual, " plasmid " and " carrier " is used interchangeably, because plasmid is the most common form of carrier.

" polynucleotides " or " nucleic acid " are used interchangeably herein, and refer to the nucleotide polymer of any length, including DNA and RNA.Nucleotides can be deoxyribonucleotide, ribonucleotide, the nucleotides by modification or base, and/or its analog, or any substrate of polymer can be mixed by DNA or RNA polymerase or by synthetic reaction.Polynucleotides can include the nucleotides by modification, such as methylated nucleotide and the like.If any, the modification to nucleotide structure can be carried out before or after assembling polymer.Nucleotide sequence can be interrupted by non-nucleotide component.Polynucleotides can be modified further in post synthesis, such as by being coupled with label.Other types of modification includes such as " cap ", one or more naturally occurring nucleotides are substituted with analog, being modified between nucleotides such as there is neutral to connect (such as methyl-phosphonate, phosphotriester, phosphoramidate (phosphoamidate), carbamate etc.) and with electrically charged connection (such as thiophosphate, phosphorodithioate etc.) modification, contain pendency module (pendant moiety) such as protein (such as nuclease, toxin, antibody, signal peptide, polylysine etc.) modification, with intercalator (such as acridine, psoralen etc.) modification, contain chelating agent (such as metal, radioactive metal, boron, oxidisability metal etc.) modification, modification containing alkylating agent, with the modification through modification connection (such as α anomeric nucleic acids (anomeric nucleic acid)), and the polynucleotides of unmodified form.In addition; any hydroxyl being typically found in carbohydrate can be replaced with such as phosphonic acids (phosphonate) group, phosphoric acid (phosphate) group; protected with standard protecting group; or activate to prepare other connection with other nucleotides, or solid or semi-solid support can be coupled to.5 ' and 3 ' end OH are phosphorylatable or replaced with the organic capping group module of amine or 1-20 carbon atom.Other hydroxyls can also be derivatized to standard protecting group.Polynucleotides can also contain ribose as commonly known in the art or the analog form of deoxyribose carbohydrate, including such as 2 '-oxygen-methyl, 2 '-oxygen-pi-allyl, 2 '-fluoro- or 2 '-nitrine-ribose, carba sugars, α-anomeric sugar, epimerism sugar such as arabinose, xylose or lyxose, pyranose, furanose, sedoheptulose, acyclic analog and abasic nucleoside analog such as methylribonucleotide.One or more di-phosphate esters can be replaced with alternative linking group to connect.These alternative linking groups include but is not limited to embodiments below, wherein phosphate P (O) S (" thioester " (thioate)), P (S) S (" dithioester " (dithioate)), (O) NR₂(" carboxylic acid amide esters " (amidate)), P (O) R, P (O) OR ', CO or CH₂(" dimethoxym ethane " (formacetal)) is substituted, wherein R or R ' each stands alone as H or substituted or unsubstituted alkyl (1-20 C), optionally containing ether (- O-) connection, aryl, alkenyl, cycloalkyl, cycloalkenyl group or aralkyl (araldyl).Not all necessarily identicals of all connections in polynucleotides.It is described above to be applied to all polynucleotides mentioned in this article, including RNA and DNA.

" oligonucleotides " refers generally to short polynucleotides as used herein, usually single-stranded, usually synthesizes, and length is general but is not required to be less than about 200 nucleotides.Term " oligonucleotides " and " polynucleotides " are not mutually exclusive.Description equality above for polynucleotides and it is completely suitable for oligonucleotides.

" antibody " (Ab) and " immunoglobulin " (Ig) is the glycoprotein with identical architectural feature.Although antibody shows the binding specificity to specific antigen, immunoglobulin includes both other antibody sample molecules of antibody and general lack of antigentic specificity.Latter class polypeptide is for example by lymphatic system so that low-level is generated and is generated by myeloma with elevated level.

Term " antibody " and " immunoglobulin " are with broadest used interchangeably, including monoclonal antibody (such as total length or intact monoclonal antibodies), polyclonal antibody, unit price, multivalent antibody, multi-specificity antibody (such as bispecific antibody, as long as they show desired biological activity), but also some antibody fragments can be included (as being discussed in more detail herein).Antibody can be chimeric, people, humanization and/or affinity maturation.

" variable region " or " variable domain " of antibody refers to the amino terminal domain of heavy chain of antibody or light chain.These domains are usually the most variable portion of antibody and comprising antigen binding site.

Term " variable " refers to some of variable domain, and partly the difference between antibody sequence is extensive and for combination and specific truth of every kind of specific antibodies to its specific antigen.However, variability is not uniformly distributed in the whole variable domain of antibody.It concentrates in light chain and heavy chain variable domain three sections for being referred to as complementary determining region (CDR) or hypervariable region.More conservative part is referred to as framework region (FR) in variable domain.Each self-contained four FR of variable domain of native heavy and light chain, they take beta-pleated sheet conformation mostly, by forming loop connecting and forming three a part of CDR connections of beta-pleated sheet structure in some cases.CDR in every chain the keeping together closely by FR, and facilitate the formation of the antigen binding site of antibody together with the CDR of another chain (referring to Kabat et al., Sequences of Proteins ofImmunological Interest, 5th edition, National Institutes of Health, Bethesda, MD. (1991)).Constant domain does not participate in the combination of antibody and antigen directly, but shows the participation of antibody in a variety of effector functions, the cytotoxicity of such as antibody dependent cellular.

Two identical antigen-binding fragments are produced with Papain digestion of antibodies, are referred to as " Fab " fragment, each there is an antigen binding site, and remaining " Fc " fragment, its title reflects the ability that it is easy to crystallization.Pepsin produces a F (ab ')₂Fragment, it has two antigen binding sites and still is able to crosslinking antigen.

" Fv " is that the minimum antibody fragment with binding site is recognized comprising intact antigen.In two-chain Fv species, this area is made up of the dimer of close, Non-covalent binding a heavy chain variable domain and a light-chain variable domain.In single-chain Fv species, a heavy chain variable domain and a light-chain variable domain can be covalently attached to by flexible peptide linker so that light chain and heavy chain are combined with similar " dimer " structure of two-chain Fv species.Exactly in such configuration, each variable domain three CDR interaction and in V_H-V_LAntigen binding site is determined on dimer interface.Six CDR assign antibody with antigen-binding specificity jointly.However, even single variable domain (or only including half of Fv of three CDR to antigen-specific) also has the ability for recognizing and combining antigen, simply affinity is less than entire binding site.

The first constant domain (CH1) of Fab the fragments also constant domain comprising light chain and heavy chain.The difference of Fab ' fragments and Fab fragments is that the carboxyl terminal of heavy chain CH1 domains adds a small number of residues, including one or more cysteines from antibody hinge region.Fab '-SH are the appellations for the Fab ' that herein wherein constant domain cysteine residues are carried with free sulphur alcohol radical.F(ab′)₂Antibody fragment is generated as the paired Fab ' fragments for having hinge cysteine between Fab ' fragments.Also know other chemical couplings of antibody fragment.

According to the amino acid sequence of its constant domain, " light chain " of the antibody (immunoglobulin) from any invertebrate species can be included into one kind in two kinds of completely different types, referred to as Kappa (κ) and lambda (λ).

According to the amino acid sequence of its heavy-chain constant domains, antibody (immunoglobulin) can be included into different classes.Immunoglobulin has five major classes:IgA, IgD, IgE, IgG and IgM, some of which can be further divided into subclass (isotype), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.Heavy-chain constant domains corresponding with inhomogeneous immunoglobulin are referred to as α, δ, ε, γ and μ.The subunit structure and three-dimensional construction of inhomogeneous immunoglobulin are it is well known that being typically recorded in such as Abbas et al., Cellular and Mol.Immunology, the 4th edition (2000).Antibody can be a part for bigger fusion molecule formed by antibody is covalently or non-covalently associated with one or more other oroteins or peptide.

Term " full length antibody " and " complete antibody " are used interchangeably herein, and refer to the antibody rather than antibody fragment as defined below of essentially completed form.The term refers specifically to the antibody that heavy chain includes Fc areas.

" antibody fragment " only include the part of complete antibody, wherein the part retain the part be present in when in complete antibody it is at least one of generally associated therewith, up to most of or it is functional.In one embodiment, antibody fragment includes the antigen binding site of complete antibody, so retains the ability for combining antigen.In another embodiment, antibody fragment, the antibody fragment in Fc areas is for example included, retains and is generally present at least one biological function generally associated therewith when in complete antibody with Fc areas, such as FcRn is combined, antibody half life regulates and controls, ADCC functions and complement are combined.In one embodiment, antibody fragment is Half-life in vivo and the essentially similar univalent antibody of complete antibody.For example, such antibody fragment can include an antigen binding arm and it is connected with that can assign the fragment with the Fc sequences of internal stability.

Term " monoclonal antibody " refers to the antibody obtained from the antibody of a group substantially homogeneity as used herein, that is, each antibody for constituting colony is identical, except that naturally occurring may become unusual with the possible of indivisible presence.In this way, modifier " monoclonal " indicates that antibody is not the feature of the mixture of discrete antibody.Such monoclonal antibody is typically include the antibody for including the peptide sequence for combining target, and wherein target Binding peptide sequence is by including selecting the process including single target Binding peptide sequence to obtain in many peptide sequences of comforming.For example, selection course can be comform polyclonal such as hybridoma clone, phage clone or recombinant DNA clone set in select Unique clones.It should be understood that, selected target binding sequence can further change, such as in order to improve affinity to target, by target binding sequence humanization, improve its yield in cell culture, reduce its immunogenicity in vivo, create multi-specificity antibody, and the antibody comprising the target binding sequence after change is also the monoclonal antibody of the present invention.From the typical polyclonal antibody preparations difference included for the different antibodies of different determinants (epitope), every kind of monoclonal antibody of monoclonal antibody preparations is for the single determinant on antigen.Outside their specificity, the advantage of monoclonal antibody preparations is that they are generally not affected by the pollution of other immunoglobulins.Modifier " monoclonal " indicate antibody basically homogeneity antibody population obtain feature, should not be construed as require antibody is produced by any ad hoc approach.For example, the monoclonal antibody used according to the present invention can be generated by multiple technologies, including such as hybridoma (such as Kohler et al., Nature 256:495(1975)；Harlow et al., Antibodies:A LaboratoryManual, Cold Spring Harbor Laboratory Press, second edition, 1988；Hammerling et al., in:Monoclonal Antibodies and T-Cell Hybridomas, 563-681, Elsevier, N.Y., 1981), recombinant DNA method is (see, for example, United States Patent (USP) No.4,816,567), display technique of bacteriophage is (see, for example, Clackson et al., Nature 352:624-628(1991)；Marks et al., J.Mol.Biol.222:581-597(1992)；Sidhu et al., J.Mol.Biol.338 (2):299-310(2004)；Lee et al., J.Mol.Biol.340 (5):1073-1093(2004)；Fellouse, Proc.Natl.Acad.Sci.USA101 (34):12467-12472(2004)；Lee et al., J.Immunol.Methods 284 (1-2):119-132 (2004)) and for generating the technology of people or human-like antibodies (see, for example, WO 98/24893 in the animal of the gene with part or whole human immunoglobulin gene's seat or encoding human immunoglobulin's sequence；WO 96/34096；WO 96/33735；WO 91/10741；Jakobovits et al., Proc.Natl.Acad.Sci.USA 90:2551(1993)；Jakobovits et al., Nature 362:255-258(1993)；Bruggemann et al., Year in Immunol.7:33(1993)；United States Patent (USP) No.5,545,807；5,545,806；5,569,825；5,625,126；5,633,425；5,661,016；Marks et al., Bio/Technology 10:779-783(1992)；Lonberg et al., Nature 368:856-859(1994)；Morrison, Nature 368:812-813(1994)；Fishwild et al., Nature Biotechnol.14:845-851(1996)；Neuberger, Nature Biotechnol.14:826(1996)；Lonberg andHuszar, Intern.Rev.Immunol.13:65-93(1995)).

Monoclonal antibody clearly includes " chimeric " antibody herein, a wherein part for heavy chain and/or light chain is identical or homologous with derived from particular species or the corresponding sequence belonged in the antibody of specific antibodies classification or subclass, and the remainder of chain is identical or homologous with derived from another species or the corresponding sequence belonged in the antibody of another antibody isotype or subclass, and the fragment of this antibody-like, as long as they show desired biological activity (United States Patent (USP) No.4,816,567；Morrison et al., Proc.Natl.Acad.Sci.USA 81:6851-6855(1984)).

" humanization " form of inhuman (such as mouse) antibody refers to the chimeric antibody that bottom line includes the sequence derived from non-human immunoglobulin.In one embodiment, some hypervariable region residues immunoglobulin that some hypervariable region residues with non-human species' (donor antibody) such as mouse, rat, rabbit or the non-human primate for expecting specificity, affinity and/or ability are replaced that humanized antibody refers in human immunoglobulin(HIg) (receptor antibody).In some cases, framework region (FR) residue of human immunoglobulin(HIg) is replaced with corresponding non-human residues.In addition, humanized antibody can be included in the residue not found in receptor antibody or in donor antibody.It is to further improve the performance of antibody to carry out these modifications.In general, humanized antibody will include at least one, usually two substantially whole following variable domains, wherein all or substantially all hypervariable loops correspond to the hypervariable loop of non-human immunoglobulin, and all or substantially all FR are the FR of human immunoglobulin sequence.Humanized antibody optionally will also include at least part constant region for immunoglobulin (Fc), the typically constant region of human immunoglobulin(HIg).More details are referring to Joneset al., Nature 321:522-525(1986)；Riechmann et al., Nature 332:323-329(1988)；Presta, Curr.Op.Struct.Biol.2:593-596(1992).Referring also to following summary and its bibliography quoted:Vaswani and Hamilton, Ann.Allergy, Asthma ＆ Immunol.1:105-115(1998)；Harris, Biochem.Soc.Transactions 23:1035-1038(1995)；Hurle and Gross, Curr.Op.Biotech.5:428-433(1994).

Term " hypervariable region ", " HVR " or " HV " refers in antibody variable domains alterable height in sequence and/or forms the region of the ring defined in structure as used herein.Generally, antibody includes six hypervariable regions:Three in VH (H1, H2, H3), three in VL (L1, L2, L3).Narration that is used herein and covering many hypervariable regions.Kabat complementary determining regions (CDR) are based on sequence variability, and be the most frequently used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed.Public Health Service, National Institutes of Health, Bethesda, MD. (1991)).Chothia is referred to as position (Chothia the and Lesk, J.Mol.Biol.196 of structure ring:901-917(1987)).AbM hypervariable regions represent compromise between Kabat CDR and Chothia structure rings, and obtain the use of Oxford Molecular AbM antibody modeling softwares." contact " hypervariable region is based on the analysis to obtainable complex crystal structure.It hereafter have recorded the residue of each in these hypervariable regions.

Ring Kabat AbM Chothia are contacted

---   -----------    -----------   -----------  ----------

L1     L24-L34          L24-L34       L26-L32    L30-L36

L2      L50-L56         L50-L56      L50-L52    L46-L55

L3      L89-L97         L89-L97      L91-L96    L89-L96

H1      H31-H35B        H26-H35B     H26-H32    H30-H35B

(Kabat numberings)

H1      H31-H35         H26-H35      H26-H32    H30-H35

(Chothia numberings)

H2      H50-H65         H50-H58      H53-H55    H47-H58

H3      H95-H102        H95-H102     H96-H101   H93-H101

Hypervariable region may include " hypervariable region of extension " as follows:24-36 or 24-34 (L1), 46-56 in VL or 26-35 (H1), 50-65 or 49-65 (H2) in 50-56 (L2) and 89-97 or 89-96 (L3) and VH and 93-102,94-102 or 95-102 (H3).For each in these definition, variable domain residue is, according to Kabat etc., to see above numbering.

" framework " or " FR " residue refers to those residues in variable domain in addition to some hypervariable region residues as defined herein.

Term " variable domain residue according to Kabat is numbered " or " amino acid position number according to Kabat " and its variant refer to Kabat et al., Sequences of Proteins of Immunological Interest, 5thEd.Public Health Service, National Institutes of Health, antibody editor in Bethesda, MD. (1991) is used for the numbering system of heavy chain variable domain or light-chain variable domain.Using this numbering system, actual linear amino acid sequence can include less or other amino acid, corresponding to variable domain FR or HVR shortening or insertion.For example, heavy chain variable domain can include the insertion residue after single amino acid insertion (being residue 52a according to Kabat) and heavy chain FR residue 82 after H2 residues 52 (such as being residue 82a, 82b and 82c according to Kabat).The Kabat residue numberings of given antibody can be determined by the way that antibody sequence is contrasted into homologous region with " standard " Kabat numbered sequences.

" scFv " or " scFv " antibody fragment includes the V of antibody_HAnd V_LDomain, wherein these domains are present on a polypeptide chain.In general, scFv polypeptides are in V_HWith V_LPeptide linker is also included between domain so that scFv can form the desired structure with reference to antigen.Summary on scFv referring to Pluckthun, in:The Pharmacology of Monoclonal Antibodies, vol.113, Rosenburg and Moore are compiled, Springer-Verlag, New York, pp.269-315 (1994).

Term " double antibody (diabody) " refers to the small antibody fragments with two antigen binding sites, and the fragment is in same polypeptide chain (V_H-V_L) in include connected heavy chain variable domain (V_H) and light-chain variable domain (V_L).Cause to match between two domains on same chain by using too short joint, force the complementary domain of these domains and another chain to match, so as to produce two antigen binding sites.Double antibody it is more complete be recorded in such as EP 404,097；WO 93/1161；Hollinger et al., Proc.Natl.Acad.Sci.USA 90:6444-6448(1993).

" human antibody ", which refers to, possesses amino acid sequence corresponding with the amino acid sequence of antibody generated by humans and/or the antibody using any technology generation for being disclosed herein for generating human antibody.This definition of human antibody clearly excludes the humanized antibody comprising non-human antigen-binding residues.

The antibody that " affinity maturation " antibody, which refers to, to be had one or more changes in one or more HVR of antibody, cause the antibody to improve to some extent the affinity of antigen compared with the parental antibody changed without these.In one embodiment, the antibody of affinity maturation has nanomole or the even affinity to target antigen of picomole magnitude.The antibody of affinity maturation can be generated by code known in the art.Marks et al., Bio/Technology 10:779-783 (1992) is described reorganizes the affinity maturation carried out by VH and VL domains.Documents below describes the random mutagenesis of CDR and/or Framework residues:Barbas et al., Proc.Nat.Acad.Sci.USA 91:3809-3813(1994)；Schier et al., Gene 169:147-155(1995)；Yelton et al., J.Immunol.155:1994-2004(1995)；Jackson et al., J.Immunol.154 (7):3310-9(1995)；Hawkins et al., J.Mol.Biol.226:889-896(1992).

" blocking property (blocking) " antibody or " Antagonism (antagonist) " antibody refer to the antibody for the biological activity for suppressing or reducing its antigen combined.Some blocking antibodies or antagonistic antibodies are substantive or completely inhibit the biological activity of antigen.

" agonistic antibody (agonist antibody) " refers to the antibody of at least one functional activity of simulation desired polypeptides as used herein.

" illness " refers to any illness that will benefit from the processing that the antibody using the present invention is carried out.This include chronic and acute disease, or including those make mammal be intended to discussed illness pathological condition disease.The non-limitative example of illness to be treated herein includes cancer, disorder of muscle, ubiquitin-pathway correlated inheritance illness, immune/inflammatory conditions, neurological disorders and other ubiquitin-pathway associated conditions.

Term " cell proliferative disorders " and " proliferative disorders " refer to the illness relevant with a certain degree of abnormal cell proliferation.In one embodiment, cell proliferative disorders refer to cancer.

" tumour " refers to the growth of all neoplastic cells and bred as used herein, either pernicious or benign, and (pre-cancerous) and cancerous cells and tissue before all cancers.Term " cancer ", " carcinous ", " cell proliferative disorders ", " proliferative disorders " and " tumour " is not mutually exclusive when mentioning herein.

Feature is usually the not modulated physiological decease of cell growth/propagation in term " cancer " and " carcinous " sensing or description mammal.The example of cancer includes but is not limited to cancer, lymthoma (such as He Jiejinshi (Hodgkin) lymthomas and non_hodgkin lymphoma), blastoma, sarcoma and leukaemia.The more specific example of such cancer includes squamous cell carcinoma, ED-SCLC, non-small cell lung cancer, the gland cancer of lung, the squamous carcinoma of lung, peritoneal cancer, hepatocellular carcinoma, human primary gastrointestinal cancers, cancer of pancreas, spongioblastoma (glioblastoma), cervical carcinoma, oophoroma, liver cancer (liver cancer), carcinoma of urinary bladder, hepatoma (hepatoma), breast cancer, colon cancer, colorectal cancer, carcinoma of endometrium or uterine cancer, salivary-gland carcinoma, kidney, prostate cancer, carcinoma of vulva, thyroid cancer, liver cancer (hepatic carcinoma), leukaemia and other lympho-proliferative illnesss, and various types of heads and neck cancer.

It is that skeletal muscle and/or smooth muscle decline or reduction cause the significantly reduced physiological decease of normal muscle function that term " disorder of muscle ", which points to or described characteristic feature in animal containing muscle,.The example of disorder of muscle includes, but it is not limited to, muscular dystrophy (muscular dystrophy), multiple sclerosis, ALS (amyotrophic lateral sclerosis), Isaac Cotard (Isaac ' s syndrome), stiff man syndrome (stiff-person syndrome), familial periodic paralysis (familiar periodicparalyses), myopathy (myopathy), myotonia (myotonia), rhabdomyolysis (rhabdomyolyses), muscular atrophy, and various types of myasthenias and muscle rigidity.

Term " ubiquitin-pathway correlated inheritance illness " is pointed to or description characteristic feature is or contributes to the illness based on heredity of the abnormal function of ubiquitin-pathway.The example of ubiquitin-pathway correlated inheritance illness includes, but it is not limited to, cystic fibrosis (cystic fibrosis), angel's syndrome (Angelman ' s syndrome) and Liddle syndrome (Liddle syndrome).

Term " neurological disorders " or " neurological disorder " are pointed to or description characteristic feature is nerve fiber decline or the cell-cell communication decline of nerve fiber mammalian central and/or peripheral nervous disease or illness.The example of neurological disorders includes, but not limited to neurodegenerative disease and (includes, but not limited to Lewy body diseases, post poliomyelitis syndrome, Shy-Draeger syndromes, olvopontocerebellar atrophy, Parkinson's disease, multi-system atrophy, striatum substantia nigra degeneration, τ diseases (including, but not limited to degenerative brain disorder and supranuclear paralysis), prion disease (includes, but not limited to bovine spongiform encephalopathy, scrapie, Creutz Fei Erte-jacob's syndrome, kuru, Gerstmann-Straussler-Scheinker diseases, chronic wasting disease, and fatal familial insomnia), bulbar paralysis, motor neuron disease, (include, but not limited to canavan's disease with the special-shaped degenerative disease of nervous system, Huntington disease, neuronal waxy lipofuscinosis, Ya Lishan great Shi diseases, Tourette's syndrome, Menkes Menkes Ⅱ syndromes, Cockayne syndrome, Halervorden-Spatz syndromes, Lafora disease, Rett syndromes, hepatolenticular degeneration, Lesch-Nyhan syndromes, with Unverricht-Lundborg syndromes), dementia (includes, but not limited to Pick's disease, and spinocebellar ataxia.

Term " inflammatory conditions " and " immune disorders " are pointed to or description illness as caused by abnormal immune mechanism and/or abnormal cytokine signal transduction.The example of inflammatory and immune disorders includes, but not limited to autoimmunity disease, immunologic defect syndrome and supersensitivity." autoimmunity disease " refers to herein to be come from and for the nonmalignant disease or illness of individual autologous tissue.Autoimmunity disease clearly excludes pernicious or Cancerous disease or illness herein, especially excludes B cell lymphoma, Acute Lymphoblastic Leukemia (ALL), chronic lymphocytic leukemia (CLL), hairy cell leukemia and chronic myeloblastic leukemia.The example of autoimmune disease or illness includes but is not limited to inflammatory response, such as inflammatory dermatosis, including psoriasis and dermatitis (such as atopic dermatitis)；Systemic scleroderma and hardening；The response (such as Chron (Crohn) disease and ulcerative colitis) relevant with inflammatory bowel disease；Respiratory Distress Syndrome(RDS) (including ARDS (ARDS))；Dermatitis；Meningitis；Encephalitis；Uveitis；Colitis；Glomerulonephritis；Allergic condition, such as eczema and asthma and the other situations for involving T cell infiltration and chronic inflammatory response；Atherosclerosis；Leucocyte adhesion defect；Rheumatoid arthritis；Systemic loupus erythematosus (SLE) (includes but is not limited to lupus nephritis, Cutaneous lupus)；Diabetes (such as type i diabetes or insulin-dependent diabetes mellitus)；Multiple sclerosis；Lei Nuoshi (Reynaud) syndrome；Autoimmune thyroiditis；Hashimoto (Hashimoto) thyroiditis；Allergic encephalitis；Siogren (Sjogren) syndrome；Young onset diabetes；Generally found in tuberculosis, sarcoidosis, polymyositis, granulomatosis and vasculitis with cell factor and the acute immune response relevant with delayed hypersensitivity (DH) of T- cell mediateds；Pernicious anaemia (A Disenshi (Addison) diseases)；Involve the disease of leukocyte infiltration；Central nervous system (CNS) inflammatory conditions；Multiple organ injury's syndrome；Hemolytic anemia (includes but is not limited to cryoglobulinemia or Ku Musishi (Coombs) positive anemia)；Myasthenia gravis；The disease of antigen-antibody complex mediation；Anti- glomerular basement membrane disease；Anti- phospholipid syndrome；Allergic neuritis；Graves (Graves) disease；Lang-her Er Shi (Lambert-Eaton) myasthenic syndrome；Bullous pemphigoid；Pemphigus；The a variety of endocrine adenopathies of LADA；Lay Te Shi (Reiter) diseases；Stiff people's syndrome；Bei Qieteshi (Behcet) diseases；Giant cell arteritis；Immune complex nephritis；IgA nephrosis；IgM polyneuropathies；Immunologic thrombocytopenic purpura (ITP) or autoimmune thrombocytopenia etc..

The example of immunologic defect syndrome includes, but it is not limited to, ataxia telangiectasia, leukaemia adhesion deficit syndrome, lymphocyte reduction, dysgammaglobulinemia, HIV or δ retroviral infections, common variable immunodeficiency, agammaglobulinemia, DiGeorge syndromes and Wiskott-Aldrich syndromes.The example of supersensitivity includes, but not limited to allergy, asthma, dermatitis, nettle rash, allergic reaction, Wissler Cotards and thrombocytopenic purpura.

As used herein, " treatment " or " processing " refers to the clinical intervention for attempting to change the nature process for treat individual or cell, can be to prevent or the progress in the process of clinicopathologia.The desired effects for the treatment of include prophylactic generation or recurrence, relief of symptoms, any direct or indirect pathological consequence for weakening disease, prevention or reduction inflammation and/or tissue/organ damage transfer, slow down the speed of progression of disease, improve or mitigate morbid state and exempt or improve prognosis.In some embodiments, the antibody of the present invention is used for the generation/development for postponing disease or illness.

" individual " refers to vertebrate.In certain embodiments, vertebrate refers to mammal.Mammal includes, but not limited to livestock (such as ox), motion and uses animal, pet (such as cat, dog and horse), primate, mouse and rat.In certain embodiments, vertebrate refers to people.

For the purpose for the treatment of, " mammal " aim enters mammiferous any animal, including people, domestic animal and livestock, and zoo, motion or pet animals, dog, horse, cat, ox etc..In certain embodiments, mammal refers to people.

" effective dose " refers in required dosage and effectively realized on the time amount of desired treatment or prevention effect.

" therapeutically effective amount " of substances/molecules of the present invention can trigger the factors such as the ability for expecting response according to morbid state, age, sex and the body weight and the substances/molecules of individual and change in individual.The treatment beneficial effect that therapeutically effective amount also refers to the substances/molecules surpasses any poisonous or detrimental consequences amounts." prevention effective dose " refers in required dosage and effectively realized on the time amount of desired preventive effect.Typically but not necessarily, because preventive dose is to be used for subject before seizure of disease or early stage disease, therefore prevention effective dose will be less than therapeutically effective amount.

Term " cytotoxic agent " refers to suppression or prevents the function of cell and/or cause the material of cytoclasis as used herein.The term is intended to include:Radio isotope, such as At²¹¹、I¹³¹、I¹²⁵、Y⁹⁰、Re¹⁸⁶、Re¹⁸⁸、Sm¹⁵³、Bi²¹²、P³²、Pb²¹²With Lu radio isotope；Chemotherapeutics, such as methotrexate (MTX) (methotrexate), adriamycin (adriamycin), vinca alkaloids (vinca alkaloids) (vincristine (vincristine), vincaleukoblastinum (vinblastine), Etoposide (etoposide)), Doxorubicin (doxorubicin), melphalan (melphalan), mitomycin (mitomycin) C, Chlorambucil (chlorambucil), daunorubicin (daunorubicin) or other intercalators；Enzyme and its fragment, such as nucleolytic enzyme；Antibiotic；And toxin, such as small molecule toxins or bacterium, fungi, the enzyme activity toxin of plant or animal origin, including its fragment and/or variant；And the various antineoplastics or anticarcinogen being disclosed below.Hereafter describe other cytotoxic agents.Kill the destruction that tumour efficacy-enhancing ingredient plays tumour cell.

" chemotherapeutics " refers to the chemical compound available for treating cancer.The example of chemotherapeutics includes alkylating agents (alkylating agents), such as phosphinothioylidynetrisaziridine (thiotepa) and CYTOXANEndoxan (cyclophosphamide)；Alkylsulfonates (alkyl sulfonates), such as busulfan (busulfan), Improsulfan (improsulfan) and piposulfan (piposulfan)；Aziridines (aziridines), such as Benzodepa (benzodepa), carboquone (carboquone), meturedepa (meturedepa) and uredepa (uredepa)；Ethylenimines (ethylenimines) and methylamelamines (methylamelamines), including hemel (altretamine), triethylenemelamine (triethylenemelamine), triethylphosphoramide (triethylenephosphoramide), triethylene thiophosphamide (triethylenethiophosphoramide) and trimethylolmelamine (trimethylolomelamine)；Annonaceousacetogenicompounds (acetogenin) (especially bullatacin (bullatacin) and bullatacinone (bullatacinone))；Delta-9-Tetrahydrocannabinol (tetrahydrocannabinol) (Dronabinol (dronabinol), MARINOL)；β-lapachol (lapachone)；Lapachol (lapachol)；Colchicines (colchicines)；Betulic acid (betulinicacid)；Camptothecine (camptothecin) (including synthetic analogues Hycamtin (topotecan) (HYCAMTIN

), CPT-11 (Irinotecan (irinotecan), CAMPTOSAR), acetyl camptothecine, scopoletin (scopoletin) and 9-aminocamptothecin)；Bryostatin (bryostatin)；callystatin；CC-1065 (including its Adozelesin (adozelesin), Carzelesin (carzelesin) and Bizelesin (bizelesin) synthetic analogues)；Podophyllotoxin (podophyllotoxin)；Podophyllic acid (podophyllinic acid)；Teniposide (teniposide)；Cryptophycins (cryptophycins) (particularly cryptophycin 1 and cryptophycin 8)；Dolastatin (dolastatin)；Duocarmycin (including synthetic analogues, KW-2189 and CB1-TM1)；Eleutherobin (eleutherobin)；pancratistatin；sarcodictyin；Spongistatin (spongistatin)；Nitrogen mustards (nitrogen mustards), such as Chlorambucil (chlorambucil), Chlornaphazine (chlornaphazine), cholophosphamide (cholophosphamide), Estramustine (estramustine), ifosfamide (ifosfamide), chlormethine (mechlorethamine), mustron (mechlorethamine oxide hydrochloride), melphalan (melphalan), novoembichin (novembichin), phenesterin (phenesterine), prednimustine (prednimustine), Trofosfamide (trofosfamide), uracil mastard (uracil mustard)；Nitrosourea (nitrosoureas), such as BCNU (carmustine), chlorozotocin (chlorozotocin), Fotemustine (fotemustine), lomustine (lomustine), Nimustine (nimustine) and Ranimustine (ranimustine)；Antibioticses, such as Enediyne Antibiotic (enediyne) (such as Calicheamicin (calicheamicin), especially Calicheamicin γ 1I and Calicheamicin ω I1 are (see, for example, Agnew, Chem.Intl.Ed.Engl.33:183-186(1994))；Anthracycline antibiotic (dynemicin), including dynemicin A；Ai sibo mycin (esperamicin)；And Neocarzinostatin (neocarzinostatin) chromophore and related chromoprotein Enediyne Antibiotic chromophore), aclacinomycin (aclacinomycin), D actinomycin D (actinomycin), anthramycin (anthramycin), azaserine (azaserine), bleomycin (bleomycin), act-C (cactinomycin), carabicin, carminomycin (carminomycin), cardinophyllin (carzinophilin), chromomycin (chromomycin), actinomycin D (dactinomycin), daunorubicin (daunorubicin), Detorubicin (detorubicin), 6- phenodiazine -5- oxygen-L- nor-leucines, ADRIAMYCIN

Doxorubicin (doxorubicin) (including morpholino Doxorubicin, Cyanomorpholino Doxorubicin, 2- pyrroles is for Doxorubicin and deoxydoxorubicin), epirubicin (epirubicin), esorubicin (esorubicin), idarubicin (idarubicin), marcellomycin (marcellomycin), mitomycin (mitomycins) such as mitomycin C, mycophenolic acid (mycophenolic acid), nogalamycin (nogalamycin), olivomycin (olivomycin), Peplomycin (peplomycin), potfiromycin, puromycin (puromycin), triferricdoxorubicin (quelamycin), rodorubicin (rodorubicin), streptonigrin (streptonigrin), streptozotocin (streptozocin), tubercidin (tubercidin), ubenimex (ubenimex), Zinostatin (zinostatin), zorubicin (zorubicin)；Antimetabolic species, such as methotrexate (MTX) and 5 FU 5 fluorouracil (5-FU)；Folacin, such as denopterin (denopterin), methotrexate (MTX), pteroyltriglutamic acid (pteropterin), Trimetrexate (trimetrexate)；Purine analogue, such as fludarabine (fludarabine), Ismipur (mercaptopurine), thiapurine (thiamiprine), thioguanine (thioguanine)；Pyrimidine analogue, such as ancitabine (ancitabine), azacitidine (azacitidine), 6- azauridines, Carmofur (carmofur), cytarabine (cytarabine), dideoxyuridine (dideoxyuridine), doxifluridine (doxifluridine), enocitabine (enocitabine), floxuridine (floxuridine)；Androgens, such as calusterone (calusterone), dromostanolone propionate (dromostanolone propionate), epitiostanol (epitiostanol), Mepitiostane (mepitiostane), Testolactone (testolactone)；Anti- adrenal gland class, such as aminoglutethimide (aminoglutethimide), mitotane (mitotane), Trilostane (trilostane)；Folic acid supplement, such as folinic acid (folinic acid)；Aceglatone (aceglatone)；Aldophosphamideglycoside (aldophosphamide glycoside)；Amino-laevulic acid (aminolevulinic acid)；Eniluracil (eniluracil)；Amsacrine (amsacrine)；bestrabucil；Bisantrene (bisantrene)；Edatrexate (edatraxate)；Defosfamide (defosfamide)；Demecolcine (demecolcine)；Diaziquone (diaziquone)；elfornithine；Elliptinium Acetate (elliptinium acetate)；Epothilones (epothilone)；Ethoglucid (etoglucid)；Gallium nitrate；Hydroxyurea (hydroxyurea)；Lentinan (lentinan)；Lonidamine (lonidamine)；Maytansinoids (maytansinoids), such as maytansine (maytansine) and maytansinol (maytansinol)；Ansamitocin (ansamitocin)；Mitoguazone (mitoguazone)；Mitoxantrone (mitoxantrone)；Mopidamol (mopidamol)；C-283 (nitracrine)；Pentostatin (pentostatin)；Phenamet (phenamet)；THP (pirarubicin)；Losoxantrone (losoxantrone)；2- ethylhydrazides (ethylhydrazide)；Procarbazine (procarbazine)；

Polysaccharide compound (JHS Natural Products, Eugene, OR)；Razoxane (razoxane)；Rhizomycin (rhizoxin)；Sizofiran (sizofiran)；Spirogermanium (spirogermanium)；Tenuazonic acid (tenuazonic acid)；Triethyleneiminobenzoquinone (triaziquone)；2,2 ', 2 ＂-trichlorotriethylamine；Trichothecin class (trichothecenes) (especially T-2 toxin, verrucarine (verrucarin) A, roridin (roridin) A and snake rhzomorph (anguidin))；Urethane (urethan)；Eldisine (vindesine) (

)；Dacarbazine (dacarbazine)；Mannomustin (mannomustine)；Dibromannitol (mitobronitol)；Mitolactol (mitolactol)；Pipobroman (pipobroman)；gacytosine；Cytarabine (arabinoside) (" Ara-C ")；Phosphinothioylidynetrisaziridine (thiotepa)；Taxoid (taxoids), for example

Taxol (paclitaxel) (Bristol-Myers Squibb Oncology, Princeton, N.J.), ABRAXANE^TMWithout cremophor (Cremophor), the nano particle formulation taxol (American Pharmaceutical Partners, Schaumberg, Illinois) of albumin transformation andTaxotere (doxetaxel) (

- Poulenc Rorer, Antony, France)；Chlorambucil (chlorambucil)；Gemcitabine (gemcitabine)

6- thioguanines (thioguanine)；Purinethol (mercaptopurine)；Methotrexate (MTX) (methotrexate)；Platinum analogs, such as cis-platinum (cisplatin) and carboplatin (carboplatin)；Vincaleukoblastinum (vinblastine)

Platinum；Etoposide (etoposide) (VP-16)；Ifosfamide (ifosfamide)；Mitoxantrone (mitoxantrone)；Vincristine (vincristine)Oxaliplatin (oxaliplatin)；Folinic acid (leucovorin)；Vinorelbine (vinorelbine)

NSC-279836 (novantrone)；Edatrexate (edatrexate)；Daunomycin (daunomycin)；Aminopterin (aminopterin)；Ibandronate (ibandronate)；Topoisomerase enzyme inhibitor RFS 2000；DFMO (DMFO)；Retinoids (retinoids), such as Tretinoin (retinoic acid)；Capecitabine (capecitabine)

Pharmaceutically acceptable salt, acid or the derivative of any of above material；And the combination of two or more above-mentioned substances, such as CHOP (endoxan, Doxorubicin, the abbreviation of vincristine and prednisolone conjoint therapy) and FOLFOX (oxaliplatin (ELOXATIN^TM) joint 5-FU and folinic acid therapeutic scheme abbreviation).

This definition also includes acting as adjusting, reduce, block or suppressing that the antihormone agent of the hormone effect of cancer growth, and the often form of system or whole body therapeutic can be promoted.Their own can be hormone.Example include anti-estrogens and SERM class (SERM), including for example TAM (tamoxifen) (includingTAM),

Raloxifene (raloxifene), Droloxifene (droloxifene), 4-hydroxytamoxifen, Trioxifene (trioxifene), that Lip river former times fragrant (keoxifene), LY117018, Onapristone (onapristone) and

Toremifene (toremifene)；Antiprogestin class；Estrogen receptor down agent class (ERD)；Function for suppress or close ovary medicament, such as luteinizing hormone releasing hormone (LHRH) activator, such asWith

Leuprorelin acetate (leuprolide acetate), goserelin acetate (goserelin acetate), buserelin acetate (buserelin acetate) and Triptorelin (triptorelin)；Other anti-androgenses, such as Drogenil (flutamide), Nilutamide (nilutamide) and bicalutamide (bicalutamide)；And suppress in adrenal gland adjust estrogen production aromatase enzyme aromatase inhibitor, such as 4 (5)-imidazoles, aminoglutethimide (aminoglutethimide),Megestrol acetate (megestrol acetate),

Exemestane (exemestane), formestane (formestane), Fadrozole (fadrozole),R 83842 (vorozole),

Letrozole (letrozole) and

Anastrozole (anastrozole).In addition, this definition of chemotherapeutics includes diphosphonates (bisphosphonates), such as clodronate (clodronate) (for example

Or

Etidronate (etidronate), NE-58095,Zoledronic acid/zoledronate (zoledronic acid/zoledronate),

Alendronate (alendronate),

Pamidronate (pamidronate),

Tiludronate (tiludronate) or

Risedronate (risedronate)；And troxacitabine (troxacitabine) (DOX nucleosides analogue of cytosine)；ASON, particularly suppresses to involve the ASON of gene expression of the signal of adhesive cell propagation in, such as PKC- α, Raf, H-Ras and EGF-R ELISA (EGF-R)；Vaccine, such as

Vaccine and gene therapy vaccine, for example

Vaccine,Vaccine and

Vaccine；

The inhibitor of topoisomerase 1；rmRH；Lapatinib ditosylate (ErbB-2 and EGFR dual tyrosine kinase micromolecular inhibitors, also referred to as GW572016)；And pharmaceutically acceptable salt, acid or the derivative of any of above material.

Composition and the method for preparing above-mentioned substance

The invention provides the antibody with polyubiquitin rather than single ubiquitin specific binding.More particularly there is provided can be from the polyubiquitin specific binding comprising the first lysine key without the antibody with the polyubiquitin specific binding comprising the second different lysine key.

In an aspect, included the invention provides one kind and contain at least one SEQ ID NOs:The antibody in the HVR-H1 areas of 1-25,81-89,151-175,229-239,265-279,329-336,392-459,599-629,695-704,739-748 and 789-799 sequence.In an aspect, included the invention provides one kind and be selected from SEQ ID NOs:26th, the antibody of 90,176,240,280,337,460,630,705,749 and 800 HVR-H1 areas consensus sequence.In an aspect, included the invention provides one kind and contain at least one SEQ ID NOs:The antibody in the HVR-H2 areas of 27-51,91-99,177-201,241-251,281-295,338-345,461-528,631-661,706-715,750-759 and 801-811 sequence.In an aspect, included the invention provides one kind and be selected from SEQ ID NOs:52nd, the antibody of 100,202,252,296,346,529,662,716,760 and 812 HVR-H2 areas consensus sequence.In an aspect, included the invention provides one kind and contain at least one SEQ ID NOs:The antibody in the HVR-H3 areas of 53-77,101-109,203-227,253-263,297-311,347-354,530-597,663-693,717-726,761-770 and 813-823 sequence.In an aspect, included the invention provides one kind and be selected from SEQ ID NOs:78th, the antibody of 110,228,264,312,355,598,694,727,771 and 824 HVR-H3 areas consensus sequence.

In an aspect, included the invention provides one kind and contain at least one SEQ ID NOs:The HVR-H1 areas of 1-26,81-90,151-176,229-240,265-280,329-337,392-460,599-630,695-705,739-749 and 789-800 sequence and contain at least one SEQ IDNOs:The antibody in the HVR-H2 areas of 27-52,91-100,177-202,241-252,281-296,338-346,461-529,631-662,706-716,750-760 and 801-812 sequence.In an aspect, included the invention provides one kind and contain at least one SEQ ID NOs:The HVR-H1 areas of 1-26,81-90,151-176,229-240,265-280,329-337,392-460,599-630,695-705,739-749 and 789-800 sequence and contain at least one SEQ ID NOs:The antibody in the HVR-H3 areas of 53-78,101-110,203-228,253-264,297-312,347-355,530-598,663-694,717-727,761-771 and 813-824 sequence.In an aspect, included the invention provides one kind and contain at least one SEQ ID NO:The HVR-H2 areas of sequence in 27-52,91-100,177-202,241-252,281-296,338-346,461-529,631-662,706-716,750-760 and 801-812 and contain at least one SEQ ID NOs:The antibody in the HVR-H3 areas of the sequence in 53-78,101-110,203-228,253-264,297-312,347-355,530-598,663-694,717-727,761-771 and 813-824.

In an aspect, included the invention provides one kind and contain at least one SEQ ID NOs:The antibody in the HVR-L3 areas of the sequence in 313-327,356-363,728-737 and 772-781.In an aspect, included the invention provides one kind and be selected from SEQ ID NOs:328th, the antibody of 364,738 and 782 HVR-L3 areas consensus sequence.In one embodiment, included the invention provides one kind and contain at least one SEQ ID NOs:The HVR-L3 areas of sequence in 313-328,356-364,728-738 and 772-782, and further it is respectively selected from SEQ ID NOs comprising at least one:1-26,81-90,151-176,229-240,265-280,329-337,392-460,599-630,695-705,739-749 and 789-800；SEQ ID NOs:27-52,91-100,177-202,241-252,281-296,338-346,461-529,631-662,706-716,750-760 and 801-812；And SEQ ID NOs:The antibody of 53-78,101-110,203-228,253-264,297-312,347-355,530-598,663-694,717-727,761-771 and 813-824 HVR-H1, HVR-H2 or HVR-H3 sequence.

In an aspect, the invention provides a kind of antibody for including at least one, at least two, at least three or all four following sequences:

(i) at least one SEQ ID NOs are included:The HVR-H1 sequences of sequence in 1-26,81-90,151-176,229-240,265-280,329-337,392-460,599-630,695-705,739-749 and 789-800,

(ii) at least one SEQ ID NOs are included:The HVR-H2 sequences of sequence in 27-52,91-100,177-202,241-252,281-296,338-346,461-529,631-662,706-716,750-760 and 801-812；

(iii) at least one SEQ ID NOs are included:The HVR-H3 sequences of sequence in 53-78,101-110,203-228,253-264,297-312,347-355,530-598,663-694,717-727,761-771 and 813-824；

(iv) at least one SEQ ID NOs are included:The HVR-L3 sequences of sequence in 313-328,356-364,728-738 and 772-782.

In an aspect, the invention provides a kind of polyubiquitin being connected with K48 for including at least one, at least two, at least three or all four following sequences have high-affinity specific binding but and combination of the polyubiquitins that be connecteds of K63 then with the affinity for substantially reducing (substantially reduced) antibody:

(i) at least one SEQ ID NOs are included:The HVR-H1 sequences of sequence in 1-26,151-176,265-280,392-460 and 695-705；

(ii) at least one SEQ ID NOs are included:The HVR-H2 sequences of sequence in 27-52,177-202,281-296,461-529 and 706-716；

(iii) at least one SEQ ID NOs are included:The HVR-H3 sequences of sequence in 53-78,203-228,297-312,530-598 and 717-727；With

(iv) at least one SEQ ID NOs are included:The HVR-L3 sequences of sequence in 313-328 and 728-738.

In an aspect, the invention provides a kind of polyubiquitin being connected with K63 for including at least one, at least two, at least three or all four following sequences have high-affinity specific binding but and combination of the polyubiquitins that be connecteds of K48 then with the affinity substantially reduced antibody:

(i) at least one SEQ ID NOs are included:The HVR-H1 sequences of sequence in 81-90,229-240,329-337,599-630,739-749 and 789-800；

(ii) at least one SEQ ID NOs are included:The HVR-H2 sequences of sequence in 91-100,241-252,338-346,631-662,750-760 and 801-812；

(iii) at least one SEQ ID NOs are included:The HVR-H3 sequences of sequence in 101-110,253-264,347-355,663-694,761-771 and 813-824；

(iv) at least one SEQ ID NOs are included:The HVR-L3 sequences of sequence in 356-364 and 772-782.

As shown in Fig. 2,3,8,9,10,11,14,15,16,17 and 22, SEQ ID NOs:1-78,81-106-149,151-364,392-782 and 789-824 amino acid sequence are numbered relative to single HVR (i.e. H1, H2, H3, L3), and the numbering is consistent with following Kabat numbering systems.In one embodiment, antibody of the invention includes above-mentioned (i)-(iv) of one, two, three or all HVR sequences, and HVR-L1 and/or HVR-L2 includes Kabat consensus sequences (such as SEQ ID NO:79 (HVR-L1) and 80 (HVR-L2)).

In an aspect, the invention provides the antibody for including the heavy chain HVR sequences as shown in Fig. 2,3,8,9,10,11,14,15,16,17 and 22.In one embodiment, antibody is further comprising the light chain HVR sequences as shown in Figure 10,11,16 and 17.

Some embodiments of the antibody of the present invention include such as following SEQ ID NO:The 4D5 antibody (huMAb4D5-8) of humanization shown in 783

Genentech, Inc., South SanFrancisco, CA, USA) (referring also to U.S. Patent number 6,407,213 and Lee etc., J.Mol.Biol. (2004), 340 (5):Light chain variable district 1073-93).

1 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asp Val

Asn Th rAla Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala

Pro Lys Leu Leu Ile Tyr Ser Ala Ser Phe Leu Tyr SerGly Val

Pro Ser Arg Phe Ser Gly Ser Arg Ser Gly Thr Asp Phe Thr

Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr

Cys Gln Gln His Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly

Thr Lys Val Glu Ile Lys 107(SEQ ID NO:783) (HVR residues are underlined)

In one embodiment, huMAb4D5-8 light-chain variable sequences the 28th, the one or more positions of 30,31,53,66 and 91 (Asp, Asn, Thr, Phe, Arg and His as shown in above bold Italic respectively) are modified.In one embodiment, the huMAb4D5-8 sequences of modification include Ser at the 28th, and Ser is included at the 30th, and Ser is included at the 31st, and Ser is included at the 53rd, and Gly is included at the 66th and/or Ser is included at the 91st.Therefore, in one embodiment, antibody of the invention, which is included, contains following SEQ ID NO:The light chain variable district of sequence shown in 784:

1 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser

Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val

Ser Ser Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro

Lys Leu Leu Ile Tyr Ser Ala Ser Ser Leu Tyr Ser Gly Val Pro

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu

Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys

Gln Gln Ser Tyr Thr Thr Pro Pro Thr Phe Gly Gln Gly Thr

Lys Val Glu Ile Lys 107(SEQ ID NO:784) (HVR residues are underlined)

Relative to huMAb4D5-8, substituted residue is indicated with bold Italic as above.

The antibody of the present invention can include any suitable framework variable region sequence, and precondition is substantially to remain the binding activity with the polyubiquitin including specific lysine key.For example, in certain embodiments, antibody of the invention includes people subgroup III heavy chain framework regions consensus sequence.In an embodiment of these antibody, framework region consensus sequence is included in the 71st, substitution of 73 and/or 78.In some embodiments of these antibody, the 71st is A, the 73rd to be T and/or the 78th be A.In one embodiment, these antibody comprising huMAb4D5-8 (Genentech, Inc., South San Francisco, CA, USA) (referring also to U.S. Patent number 6,407,213 and 5,821,337, and Lee etc., J.Mol.Biol. (2004), 340 (5):Weight chain variable district framework sequence 1073-93).In one embodiment, these antibody further include people κ I light chain framework regions consensus sequence.In one embodiment, these antibody comprising at least one, two or all SEQ IDNOs:79th, 80,313-328,356-364,728-738 and 772-78 light chain HVR sequences.In one embodiment, these antibody include such as the ＆ 5 of U.S. Patent number 6,407,213, the light chain HVR sequences of the huMAb4D5-8 described in 821,337.In one embodiment, these antibody comprising huMAb4D5-8 (, Genentech, Inc., South San Francisco, CA, USA) light-chain variable sequence (SEQ ID NO:783 and 784) (referring also to the ＆5 of U.S. Patent number 6,407,213,821,337, and Lee etc., J.Mol.Biol. (2004), 340 (5):1073-93).

In one embodiment, antibody of the invention includes weight chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 111-129,138-141,146-149 and 839-895, and HVR H1, H2 and H3 sequences are respectively selected from least one in following three groups:SEQ ID NOs:1-26,81-90,151-176,229-240,265-280,329-337,392-460,599-630,695-705,739-749 and 789-800；27-52,91-100,177-202,241-252,281-296,338-346,461-529,631-662,706-716,750-760 and 801-812；And 53-78,101-110,203-228,253-264,297-312,347-355,530-598,663-694,717-727,761-771 and 813-824.In one embodiment, antibody of the invention includes light chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 130-133,134-137,142-145 and 896-907, HVR-L1 sequences are SEQ ID NO:79, HVR-L2 sequences are SEQ IDNO:80 and HVR-L3 sequences are selected from following at least one:SEQ ID NOs:313-328,356-364,728-738 and 772-782.

In one embodiment, antibody of the invention includes weight chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 111-129 and 839-895, and HVR H1, H2 and H3 sequences are respectively SEQ ID NO:1st, 27 and 53 (clone 48-1).Similarly, in other embodiments, antibody in each clone 48-2 to 48-118, clone 63-1 to 63-51, Fabapu01-apu24, Fab apu2.01-apu2.20 and clone apu3.01-3.11 includes weight chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 111-129 and 839-895, and HVR-H1, HVR-H2 and HVR-H3 sequence is for the clone of each in Fig. 2,3,8-11,14-17 and 22 or those sequences for clearly enumerating of Fab.In one embodiment, antibody of the invention includes light chain variable district, and wherein framework sequence includes at least one SEQ IDNOs:Sequence in 130-133 and 896-907, and HVR L1, L2 and L3 sequences are respectively SEQID NOs:79th, 80 and 313 (Fab apu01).Similarly, in other embodiments, each antibody in Fabapu01-apu24 and Fabapu2.01-apu2.20 includes light chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 130-133 and 896-907, and HVR-L1 are SEQ ID NO:79, HVR-L2 be SEQ ID NO:80 and HVR-L3 sequences are those sequences for clearly being enumerated for each Fab in Figure 10,11C, 16B and 17B.

In one embodiment, antibody of the invention includes weight chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 138-141, and HVR H1, H2 and H3 sequences are respectively SEQ ID NO:1st, 27 and 53 (clone 48-1).Similarly, in other embodiments, clone each antibody in 48-2 to 48-118, clone 63-1 to 63-51, Fab apu01-apu24, Fabapu2.01-apu2.20 and clone apu3.01-3.11 and include weight chain variable district, wherein framework sequence includes SEQ ID NOs:138-141 at least one sequence, and HVR-H1, HVR-H2 and HVR-H3 sequence is for the clone of each in Fig. 2,3,8-11,14-17 and 22 or those sequences for clearly enumerating of Fab.In one embodiment, antibody of the invention includes light chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 134-137, and HVR L1, L2 and L3 sequences are respectively SEQ ID NOs:79th, 80 and 313 (Fab apu01).Similarly, in other embodiments, each antibody in Fab apu01-apu24 and Fab apu2.01-apu2.20 includes light chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 134-137, and HVR-L1 are SEQ ID NO:79, HVR-L2 be SEQ ID NO:80 and HVR-L3 sequences are those sequences for clearly being enumerated for each Fab in Figure 10,11C, 16B and 17B.

In one embodiment, antibody of the invention includes weight chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 146-149, HVR H1, H2 and H3 sequences are respectively SEQ ID NO:1st, 27 and 53 (clone 48-1).Similarly, in other embodiments, antibody in each clone 48-2 to 48-118, clone 63-1 to 63-51, Fab apu01-apu24, Fabapu2.01-apu2.20 and clone apu3.01-3.11 includes weight chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 146-149, and HVR-H1, HVR-H2 and HVR-H3 sequence is for the clone of each in Fig. 2,3,8-11,14-17 and 22 or those sequences for clearly enumerating of Fab.In one embodiment, antibody of the invention includes light chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 142-145, and HVR L1, L2 and L3 sequences are respectively SEQ ID NOs:79th, 80 and 313 (Fab apu01).Similarly, in other embodiments, each antibody in Fab apu01-apu24 and Fab apu2.01-apu2.20 includes light chain variable district, and wherein framework sequence includes at least one SEQ ID NOs:Sequence in 142-145, and HVR-L1 are SEQ ID NO:79, HVR-L2 be SEQ ID NO:80 and HVR-L3 sequences are those sequences for clearly being enumerated for each Fab in Figure 10,11C, 16B and 17B.

In one embodiment, antibody of the invention has carried out affinity maturation to obtain desired target binding affinity.In one example, the polyubiquitin being connected with K48 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K63 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H1 the 29th, 30,33 and 34 amino acids.In another example, the polyubiquitin being connected with K48 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K63 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H2 the 52nd and 52a amino acids.In another example, the polyubiquitin being connected with K48 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K63 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H3 the 99th, 100,100a and 100b amino acids.In another example, the polyubiquitin being connected with K48 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K63 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H3 95-100,100a and 100b amino acids.In another example, the polyubiquitin being connected with K48 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K63 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-L3 the 91st and 96 amino acids.In another example, the polyubiquitin being connected with K63 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K48 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H1 29-34 amino acids.In another example, the polyubiquitin being connected with K63 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K48 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H2 the 50th, 52,52a, 53-56 and 58 amino acids.In another example, the polyubiquitin being connected with K63 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K48 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H3 95-100,100a, 100b and 100c amino acids.In another example, the polyubiquitin being connected with K63 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K48 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-L3 91-95,95a and 95b amino acids.

In another example, the polyubiquitin being connected with K63 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K48 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H1 29-34 amino acids.In another example, the polyubiquitin being connected with K63 have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K48 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H2 the 50th, 52,54,56 and 58 amino acids.In another example, the polyubiquitins of K63 connections have the specific binding of high-affinity but and the polyubiquitins that be connecteds of K48 then there is substitution of the antibody of the affinity maturation of the present invention of the combination of the affinity substantially reduced at HVR-H3 95-100,100a, 100b and 100c amino acids.

In one embodiment, antibody of the invention, which is included, contains SEQ ID NOs:265th, the weight chain variable district of 281 and 297 sequence.In one embodiment, antibody of the invention, which is included, contains SEQID NOs:79th, the light chain variable district of 80 and 313 sequence.In one embodiment, antibody of the invention, which is included, contains SEQ ID NOs:265th, the weight chain variable district of 281 and 297 sequence, and also include contain SEQ ID NOs:79th, the light chain variable district of 80 and 313 sequence.In other embodiments, included corresponding to the antibody of the invention that specific cloning is numbered containing the weight chain variable district that HVR-H1, HVR-H2 and the HVR-H3 sequence as shown in Fig. 2,3,8,9,10,11,14-17 and 22 are numbered for the clone.In other embodiments, included corresponding to the antibody of the invention that specific cloning is numbered and contain SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80HVR-L2 sequences and the light chain variable district that the HVR-L3 sequences as shown in Figure 10,11,16 and 17 are numbered for the clone.In other embodiments, included corresponding to the antibody of the invention that specific cloning is numbered containing the weight chain variable district that HVR-H1, HVR-H2 and HVR-H3 sequence as shown in Fig. 2,3,8,9,10,11,14-17 and 22 is numbered for the clone, and also comprising containing SEQ ID NO:79 HVR-L1 sequences, SEQ ID NO:80HVR-L2 sequences and the light chain variable district that the HVR-L3 sequences as shown in Figure 10,11,16 and 17 are numbered for the clone.

In an aspect, the invention provides a kind of antibody combined with the competition of any afore mentioned antibodies with polyubiquitin.In an aspect, the invention provides a kind of antibody with antigenic determinant on any afore mentioned antibodies combination identical polyubiquitin.

As shown in this article, antibody of the invention and the polyubiquitin of the separation with specific lysine key are specifically bound.As shown in this article, antibody of the invention is also with having the specific binding of the polyubiquitin of specific lysine key when the polyubiquitin is connected with heterologous protein (referring to such as embodiment 3 and 4).

There is provided the composition of the polynucleotides of the sequence comprising at least one anti-polyubiquitin antibody or comprising at least one anti-polyubiquitin antibody of coding.In certain embodiments, said composition can be pharmaceutical composition.As used herein, polynucleotides of the composition comprising one or more antibody combined with one or more polyubiquitins and/or one or more sequences comprising the one or more antibody combined with one or more polyubiquitins of coding.These compositions can further include suitable carrier, such as pharmaceutically acceptable excipient well-known in the art including buffer.

Additionally provide the antibody and polynucleotides of separation.In certain embodiments, the antibody and polynucleotides of separation are substantially pure.

In one embodiment, anti-polyubiquitin antibody is monoclonal antibody.There is provided the fragment of anti-polyubiquitin antibody (such as Fab, Fab '-SH and the fragments of F (ab ') 2) in another embodiment.These antibody fragments can be produced by such as enzymic digestion of traditional method or by recombinant technique.Above-mentioned antibody fragment can be chimeric, humanization or people.These fragments have following diagnosis and therapeutical uses.

Anti- polyubiquitin antibody is produced using phage display library

A variety of methods for being used to produce the phage display library that can obtain purpose antibody are known in the art.A kind of method for producing purpose antibody is by using such as Lee etc., J.Mol.Biol. (2004), 340 (5):Phage antibody library described in 1073-93.

The antibody cloning with the synthesis for expecting activity can be screened by using combinatorial libraries to prepare the anti-polyubiquitin antibody of the present invention.In principle, the antibody cloning of synthesis is selected by the phage library of the bacteriophage for the different fragments for screening the antibody variable region (Fv) that bacteriophage coat protein is fused to containing displaying.Pass through the above-mentioned phage library of affinity chromatography elutriation for expecting antigen.The clone that expression can combine the Fv fragments for expecting antigen is adsorbed by the antigen, and is therefore separated with non-binding clone in library.Then under combining clone elutes from antigen, and further it is enriched with by extra Antigen adsorption/elution cycles.Purpose phage clone can be selected by designing suitable antigen selection method, then Fv sequences and Kabat from purpose phage clone etc. are used, Sequences of Proteinsof Immunological Interest, 5th edition, NIH publications 91-3242, Bethesda MD (1991), the anti-polyubiquitin antibody cloning of suitable constant region (Fc) sequence construct total length described in vols.1-3, so as to obtain the anti-polyubiquitin antibody of any present invention.

The antigen binding domain of antibody is made up of about 110 amino acid for coming from two variable (V) areas (respectively from light chain (VL) and heavy chain (VH)), and described two variable regions all have 3 hypervariable loops or complementary determining region (CDRs).Such as Winter, Ann.Rev.Immunol., 12:Described in 433-455 (1994), variable region can functionally be shown as wherein VH and VL scFv (scFv) fragments being covalently attached by short, flexible peptide or as the wherein VH and VL Fab fragments for being each fused to constant region and noncovalent interaction on bacteriophage.As used herein, scFv encodes phage clone and Fab coding phage clones are collectively known as " Fv phage clones " or " Fv clones ".

VH and VL gene pools can be cloned respectively by polymerase chain reaction (PCR) and be recombinated at random in phage library, then can such as Winter, Ann.Rev.Immunol., 12:Search antigen binding clone described in 433-455 (1994).The library of immune origin provides the high-affinity antibody for immunogene, without building hybridoma.Alternatively, natural storehouse can be cloned and be directed to the human antibody of various non-self and autoantigen single source to provide, without any such as Griffiths, EMBO J, 12:Immunity inoculation described in 725-734 (1993).Finally, the V- constant gene segment Cs that can not reset by being cloned from stem cell also simultaneously encode Gao Bian CDR3 areas using the PCR primer containing random sequence and such as Hoogenboom and Winter, J.Mol.Biol., 227:Completion described by 381-388 (1992) is reset in vitro, so that synthesis of natural library.

Filobactivirus is used to show antibody fragment by merging with minor coat protein pIII.Such as Marks, J.Mol.Biol., 222:Described by 581-597 (1991), antibody fragment can be shown as Single-Chain Fv Fragment of Murine, and wherein VH and VL areas are connected on same polypeptide chain by flexible spacer polypeptide, or such as Hoogenboom, Nucl.Acids Res., and 19:Described in 4133-4137 (1991), antibody can be shown as Fab fragments, wherein one chain is fused to pIII, another chain is then secreted into bacterial host cell pericentral siphon, herein by replacing some wild type coat proteins, the Fab- coat protein Standard body displays are on phage surface.

In general, the nucleic acid of encoding antibody genes fragment is to be obtained from harvest from the immunocyte of human or animal.If it is desire to anti-polyubiquitin clone is inclined in library, then it is used for library construction with polyubiquitin immunizing subjects to produce antibody response, and reclaim the B cell or other PBLCs (PBLs) of splenocyte and/or circulation.In one embodiment, by producing anti-human polyubiquitin antibody response in the transgenic mice for carrying feature human immunoglobulin gene array (and lacking functional endogenous antibody generation system), so that polyubiquitin immunity inoculation causes the B cell for producing the human antibody for polyubiquitin, so as to obtain the human immunoglobulin gene frag-ment libraries for being inclined to anti-human polyubiquitin clone.The generation for producing the transgenic mice of human antibody is described in following (III) (b) section.

The B cell of expression polyubiquitin specific membrane binding antibody can be separated by using suitable screening technique, cell is such as separated by using polyubiquitin affinity chromatography or with fluorochrome label polyubiquitin then by fluorescence-activated cell sorting (FACS) come adherent cell, so as to obtain the enrichment of the reactive cell colony of extra anti-polyubiquitin.

Alternatively, the use of splenocyte and/or B cell or other PBLs from non-immunized donor provides preferably possible antibody library, and also allows for building antibody library using any wherein polyubiquitin for the animal species (people is inhuman) of nonantigenic.Library construction for integrating antibody gene in vitro, from subject harvest stem cell encodes the nucleic acid of non-rearranged antibody constant gene segment C to provide.Purpose immunocyte is available from many animals species, such as people, mouse, rat, rabbit, luprine, dog, cat, pig, ox, horse and birds species.

Nucleic acid and the amplification of encoding antibody variable constant gene segment C (including VH and VL sections) are reclaimed from aim cell.In the case where resetting VH and VL gene libraries, such as Orlandi etc., Proc.Natl.Acad.Sci. (USA), 86 can be passed through:Described in 3833-3837 (1989), pass through the isolated genes group DNA or mRNA from lymphocyte, then use the primer of 5 ' and 3 ' ends match with recombinating VH and VL genes to carry out polymerase chain reaction (PCR) and obtain desired DNA, different V gene pools is expressed.Such as Orlandi (1989) and Ward etc., Nature, 341:Described in 544-546 (1989), the reverse primer of the end of extron 5 ' in the V- areas in encoding mature can be used and based on the forward primer in J- areas from cDNA and genomic DNA amplification V genes.However, for being expanded from cDNA, reverse primer can also be based on such as Jones, Biotechnol., 9:Leader exon described in 88-89 (1991), and forward primer are such as Sastry, Proc.Natl.Acad.Sci. (USA), 86:Being in constant region described in 5728-5732 (1989).In order that complementary maximize, can degeneracy be incorporated in primer as described in (1989) such as Orlandi etc. (1989) or Sastry.In certain embodiments, such as Marks, J.Mol.Biol., 222:581-597 (1991) method or Orum etc., Nucleic Acids Res., 21:Described in 4491-4498 (1993) method, library diversity is maximized by using the PCR primer for targetting every V- gene families, so as to expand all available to the VH being present in immunocyte nucleic acid samples and VL arrangements.In order to which the DNA clone of amplification is entered in expression vector, as described in Orlandi etc. (1989), rare restriction site can be imported in PCR primer as the label in an end, or such as Clackson, Nature, 352:Described in 624-628 (1991), further PCR amplifications are carried out by using the primer of mark.

The V gene pools that synthesis is reset can derive from V constant gene segment Cs in vitro.Most people VH- constant gene segment Cs, which have been cloned and have been sequenced, (is reported in Tomlinson etc., J.Mol.Biol., 227:In 776-798 (1992)), and mapped and (be reported in Matsuda etc., Nature Genet., 3:In 88-94 (1993))；Such as Hoogenboom and Winter, J.Mol.Biol., 227:Described in 381-388 (1992), using the PCR primer for the H3 rings for encoding different sequences and length, the section (all major confonnationals for including H1 and H2 rings) of these clones can be used for producing different VH gene pools.Such as Barbas, Proc.Natl.Acad.Sci.USA, 89:Described in 4457-4461 (1992), it is possible to use the long H3 rings that all sequence polymorphisms all concentrate on single length prepare VH storehouses.People's V κ and V λ sections, which have been cloned and have been sequenced, (is reported in Williams and Winter, Eur.J.Immunol., 23:In 1456-1461 (1993)) and available for the light chain storehouse for preparing synthesis.The V gene pools of the synthesis of (fold) and L3 and H3 length are folded based on different VH and VL can encode the antibody for having sizable structure diversity., can be according to Hoogenboom and Winter, J.Mol.Biol., 227 after V- gene codes DNAs amplifications:381-388 (1992) method resets germline V-gene section in vitro.

Can be in several ways by the way that VH and VL gene pools be combined into structure antibody fragment storehouse.Each storehouse, and such as Hogrefe, Gene, 128 can be created in different carriers:Recombinant vector in vitro described in 119-126 (1993), or such as Waterhouse, Nucl.Acids Res., 21:LoxP systems described in 2265-2266 (1993) are in vivo by combining infection recombinant vector.The In vivo recombination method make use of the characteristic of two chains of Fab fragments to overcome the limitation to library size caused by Escherichia coli transformation efficiency.Natural VH and VL storehouses are cloned respectively, and a storehouse is cloned into phasmid, and another storehouse is cloned into phage vector.Then the two libraries of phage-infect bacteria combination containing phasmid are passed through so that each cell is limited solely by the number (about 10 of existing cell containing different combinations and library size¹²Individual clone).The two carriers all contain In vivo recombination signal so that VH and VL genes are recombinated on single replicon and packed altogether into phage particle.These huge libraries, which are provided, largely has good affinity (about 10^-8M K_d ^-1) different antibodies.

Alternatively, such as Barbas, Proc.Natl.Acad.Sci.USA, 88:Described in 7978-7982 (1991), storehouse order can be cloned into identical carrier, or such as Clackson, Nature, 352:Described in 624-628 (1991), it is assembled together and is then cloned by PCR.PCR assemblings can also be used to VH and VL DNAs being connected to form scFv (scFv) storehouse with encoding the DNA of flexible spacer peptide.In another technology, such as Embleton, Nucl.Acids Res., 20:Described in 3831-3837 (1992), " PCR is assembled in cell " is used to combine VH the and VL genes in lymphocyte by PCR, and then clones the storehouse of connected gene.

The screening in library can be completed by any techniques known in the art.For example, the hole that polyubiquitin can be used on coating absorption flat board, express or used in cell sorting being attached on the host cell of absorption flat board, or biotin is conjugated to for the coated pearl seizure of streptavidin, or in the method for any other elutriation phage display library known in the art.

Suitable at least a portion of phage particle with adsorbent conjugation condition, phage library sample is contacted with the polyubiquitin of immobilization.Usually, selection includes the condition of pH, ionic strength, temperature etc. to simulate physiological status.Washing and solid phase binding bacteriophage, then such as Barbas, Proc.Natl.Acad.Sci USA, 88:Pass through acid or such as Marks, J.Mol.Biol., 222 described in 7978-7982 (1991):Described in 581-597 (1991) by alkali, or such as similar to Clackson, Nature, 352:Eluted in the method for 624-628 (1991) antigenic competition method by polyubiquitin antigenic competition.20-1,000 times can be enriched with single-wheel selection pnagus medius.In addition, the bacteriophage of enrichment can grow and receive the selection of more wheels in bacterial cultures.

Whether the Dissociation that the validity of selection is depended in many factors, including washing process and multiple antibody fragments on single bacteriophage can be while and antigen bindings.By using antigen coat density high in short washing, multivalent bacteriophage display and solid phase, so that the antibody with fast Dissociation (and weak binding affinity) can be retained.High density not merely by multivalence interaction phagus durabilis, also helps the bacteriophage for recombining and having dissociated.Can be by using long washing and such as Bass, Proteins, 8:Monovalent phages and such as Marks, Biotechnol., 10 described in 309-314 (1990) and WO 92/09690:Low antigen coat density displaying described in 779-783 (1992) promotes antibody of the selection with slow Dissociation (and good binding affinity).

Even if to the affinity slightly difference of polyubiquitin, being also possible to select the phage antibody of different affinity.However, the random mutation (as conducted in above-mentioned some affinity maturation technologies) of chosen antibody may produce many mutant, most of binding antibodies, and small part has more high-affinity.Because polyubiquitin is limited, therefore rare high-affinity bacteriophage can show one's talent.To retain the mutant of all more high-affinities, bacteriophage can be incubated with excessive biotinylation polyubiquitin, but biotinylation polyubiquitin is then in the concentration of the molar concentration lower than the target mole affinity costant of polyubiquitin.Then the bacteriophage that high-affinity is combined can be caught by the coated paramagnetic beads of streptavidin.Above-mentioned " balance is caught " enables antibody to be chosen according to their binding affinity, with the sensitivity for allowing only there is the mutant clone of 2 times of higher affinity to be separated with a large amount of bacteriophages with more low-affinity.The condition of bacteriophage of the washing combination in solid phase is also can be controlled for make a distinction based on Dissociation.

Can be based on the anti-polyubiquitin clone of activity selection.In one embodiment, combined the invention provides blocking polyubiquitin part with polyubiquitin, but do not block polyubiquitin part and second of protein bound anti-polyubiquitin antibody.It can be selected corresponding to the Fv clones of above-mentioned anti-polyubiquitin antibody by following steps:(1) anti-polyubiquitin is separated by saving described phage library such as above-mentioned B (I) (2) to clone, and optionally by cultivating separated phage clone colony in suitable bacterial host so as to expand the colony；(2) desired blocking and non-blacked activity selection polyubiquitin and second of albumen are respectively relative to；(3) anti-polyubiquitin phage clone is adsorbed onto on the polyubiquitin of immobilization；(4) any unexpected identification is eluted using excessive second of the albumen and the combination of second of albumen determines that area overlaps or the shared polyubiquitin for having the combination to determine area combines the clone for determining area；(5) clone still adsorbed after elution step (4).Optionally, further it can be enriched with the clone for expecting blocking/non-blacked characteristic by being repeated one or more times selection step described herein.

The DNA (such as by using be designed to expand purpose heavy chain and the Oligonucleolide primers of light chain coding region by hybridoma or phage DNA template specificity) of the Fv clones of the coding present invention is easily isolated and is sequenced using routine techniques.Once separation, DNA can be placed in expression vector, then expression vector is transfected into the host cell such as Bacillus coli cells, ape COS cells, Chinese hamster ovary (CHO) cell or the myeloma cell that do not produce immunoglobulin in addition, to obtain the synthesis for expecting monoclonal antibody in the host cell of restructuring.For recombinantly expressing antibody coding DNA Review literature in bacterium including Skerra etc., Curr.Opinion in Immunol., 5:256 (1993) and Pluckthun, Immunol.Revs, 130:151(1992).

The DNA and known encoding heavy chain and/or constant region of light chain (being such as available from Kabat, appropriate DNA sequence dna ibid) that can will encode Fv clones of the present invention DNA sequence dna are combined to form the heavy chain of encoding full leng or partial-length and/or the clone of light chain.It should be understood that the constant region of any isotype can be used in the purpose, including IgG, IgM, IgA, IgD and IgE constant region, and above-mentioned constant region is available from anyone or animal species.A kind of Fv Clone Origins are in a kind of variable region DNA of animal (such as people) species, and the constant region DNA to another animal species is then fused to form the coded sequence of " hybrid " antibody, total length heavy chain and/or light chain are included in " chimeric " as used herein and the definition of " hybrid " antibody.In one embodiment, the Fv clones from people variable region DNA are fused to human constant region DNA to form the heavy chain and/or the coded sequence of light chain of full people's total length or partial-length.

Moderate affinity (about 10 can be had by being produced from the antibody in natural (naive) library (natural or synthetic)⁶-10⁷M^-1K_d ^-1), but can also such as Winter (1994), ibid described pass through in vitro build and affinity maturation is simulated in the library of reselection procedure second.For example, in Hawkins etc., J.Mol.Biol., 226:In 889-896 (1992) method or in Gram etc., Proc.Natl.Acad.Sci USA, 89:In 3576-3580 (1992) method, Leung etc., Technique, 1 (are reported in by using fallibility polymerase:In 11-15 (1989)) mutation can be imported at random in vitro.In addition, such as in chosen single Fv clones and the clone of screening more high-affinity, using the PCR with the primer for carrying the random sequence across purpose CDR, affinity maturation can be carried out by the one or more CDRs of random mutation.WO 9607754 (being disclosed on March 14th, 1996) describes a kind of for method of the induced mutation to create light chain gene library in the complementary determining region of light chain immunoglobulin.Another effective method is such as Marks, Biotechnol., 10:Described in 779-783 (1992), recombinate and screened by using the naturally occurring V region variants storehouse for being derived from non-immunized donor through phage display, and in the reorganization of several endless chains according to the selected VH or VL areas of more high-affinity.The technology makes have 10^-9The antibody and antibody fragment of affinity in the range of M can be produced.

Produce other methods of anti-polyubiquitin antibody

The other methods for producing antibody and assessment affinity of antibody are well-known in the art, and are described in such as Kohler, Nature 256:495(1975)；U.S. Patent number 4,816,567；Goding, Monoclonal Antibodies:Principles and Practice, pp.59-103 (Academic Press, 1986；Kozbor, J.Immunol., 133:3001(1984)；Brodeur etc., Monoclonal AntibodyProduction Techniques and Applications, pp.51-63 (Marcel Dekker, Inc., NewYork, 1987；Munson etc., Anal.Biochem., 107:220(1980)；Engels etc., Agnew.Chem.Int.Ed.Engl., 28:716-734(1989)；Abrahmsen etc., EMBO J., 4:3901(1985)；Methods in Enzymology, vol.44 (1976)；Morrison etc., Proc.Natl.Acad.Sci.USA, 81:In 6851-6855 (1984).

Conventional method

In general, the invention provides the anti-polyubiquitin antibody of the disease purposes with the treatment polyubiquitin mediation for wherein expecting the one or more polyubiquitin activity of partly or entirely closing.In one embodiment, anti-polyubiquitin antibody of the invention is used for treating cancer.In another embodiment, anti-polyubiquitin antibody is used to treat disorder of muscle provided herein, those illnesss as escribed above.In another embodiment, anti-polyubiquitin antibody is used to treat the nervous system disease provided herein, those diseases as escribed above.In another embodiment, anti-polyubiquitin antibody is used to treat genetic disease provided herein.In another embodiment, anti-polyubiquitin antibody is used to treat immune/inflammatory conditions provided herein.

The unique property of the anti-polyubiquitin antibody of the present invention causes its different lysine type of attachment that can be especially used to distinguish polyubiquitin in cell system, without by means of trouble and expensive genetic manipulation or bio-physical method such as mass spectrography.The anti-polyubiquitin antibody of the present invention can be used for the function and activity for identifying the polyubiquitin of specific lysine connection in vitro and in vivo.The anti-polyubiquitin antibody of the present invention can also be used to determine that the polyubiquitin of specific lysine connection develops and the effect in pathogenesis in disease.The anti-polyubiquitin antibody of the present invention can be further used for treating the disease of polyubiquitin regulation or the abnormal function extremely of the specific lysine connection of one or more of which, the normal activity without disturbing non-specific polyubiquitin for the anti-polyubiquitin antibody.

In another aspect, the anti-polyubiquitin antibody of the present invention has the effectiveness as the polyubiquitin for detecting and separating specific lysine key, for example detect the polyubiquitin in different cell types and tissue, including determining polyubiquitin density and the distribution in cell colony and given cell, and based on the presence or amount of cell sorting of polyubiquitin.

In another aspect, anti-polyubiquitin antibody of the invention is used to develop the polyubiquitin antagonist with the blocking activity pattern similar to Subject antibodies of the present invention.For example, the antibody of the polyubiquitin of the anti-K48 connections of the present invention can be used for determining and identify other polyubiquitin binding characteristics with identical K48 connections and/or block the antibody of the approach ability of the polyubiquitin mediation of K48 connections.Similarly, the polyubiquitin antibody of anti-K63 connections of the invention can be used for determining and identify other polyubiquitin binding characteristics with identical K63 connections and/or block the antibody of the approach ability of the polyubiquitin mediation of K63 connections.

It is used as further example, the anti-polyubiquitin antibody of the present invention can be used for identifying the other anti-polyubiquitin antibody for substantially being combined identical polyubiquitin antigenic determinant with this paper antibody illustrated, and the antigenic determinant includes linear and comformational epitope.

The anti-polyubiquitin antibody of the present invention can be used for the determination method based on physiological routes, wherein polyubiquitin is related to the small molecular antagonists of polyubiquitin of the screening with one or more specific lysine keys, and the small molecular antagonists are in blocking one or more binding partners to be combined with the polyubiquitin with those one or more lysine keys by with similar pharmacological effect.For example, as it is known that the targeting proteins enzyme body that the polyubiquitin of K48 connections is related to some albumen is degraded (referring to such as Chau etc., Science 243:1576-1583(1989)；Finley etc., Mol.Cell.Biol.14:5501-5509(1994)；Flick etc., Nat.Cell.Biol.6:634-641(2004))；Therefore activity of the polyubiquitin antibody being connected by relatively more one or more possible small molecular antagonists with anti-K48 in the approach, the polyubiquitin antibody of anti-K48 connections can be used for the small molecular antagonists of the targeting proteins enzyme body degraded of the polyubiquitin mediation of Screening and Identification K48 connections.Similarly, in another example, it is known that the polyubiquitin of K63 connections is related to DNA and repaired (referring to such as Pickart and Fushman, Curr.Opin.Chem.Biol.8:610-616 (2004)), therefore active being compared with the activity of one or more possible small molecular antagonists of the polyubiquitin of K63 connections in identical DNA reparation approach for the polyubiquitin Antibodies Against DNA reparation approach that anti-K63 can be connected.Similarly, in another example, it is known that the polyubiquitin of K63 connections is related to the formation of Lewy corpusculums in Parkinson's disease (referring to such as Lim etc., J.Neurosci.25 (8):2002-9 (2005)), thus anti-K63 can be connected polyubiquitin Antibodies Against Lewy corpusculums formation activity in being formed in antagonism Lewy corpusculums the activity of one or more possible small molecular antagonists of the polyubiquitin of K63 connections compare.

This area routine techniques can be used to obtain candidate antibodies, including those technology described herein such as hybridoma technologies and use binding molecule (binder molecules) screening phage display library.These methods are well-known in the art.

In short, the antibody cloning with the synthesis for expecting activity can be screened by using combinatorial libraries, the anti-polyubiquitin antibody of the present invention is prepared.In principle, by the phage library for the bacteriophage for screening different antibody variable region (Fv) fragments that bacteriophage coat protein is fused to containing displaying, the antibody cloning of synthesis is selected.Pass through the above-mentioned phage library of affinity chromatography elutriation for expecting antigen.It can adsorb on antigen, and be therefore separated with non-binding clone in library with the clone for the expression Fv fragments for expecting antigen binding.Then from antigen elution of bound clone, and can be further enriched with by extra Antigen adsorption/elution cycles.Purpose phage clone can be screened by designing suitable antigen selection method, then Fv sequences and Kabat from purpose phage clone etc. are used, Sequences of Proteinsof Immunological Interest, 5th edition, NIH publications 91-3242, Bethesda MD (1991), the anti-polyubiquitin antibody cloning of suitable constant region (Fc) sequence construct total length described in vols.1-3, so as to obtain the anti-polyubiquitin antibody of any present invention.Referring further to PCT Publication WO03/102157 and document cited therein.

In one embodiment, anti-polyubiquitin antibody of the invention is monoclonal antibody.Be additionally included in the scope of the invention be anti-polyubiquitin antibody provided in this article antibody fragment such as Fab, Fab ', Fab '-SH and F (ab ')₂Fragment and its variant.It can produce by conventional method such as enzymic digestion or by recombinant technique these antibody fragments.Above-mentioned antibody fragment can be it is chimeric, people's or humanization.These fragments have experiment, diagnosis and the therapeutical uses listed by this paper.

Monoclonal antibody is available from the antibody of a group substantially homogeneous, i.e., in addition to naturally occurring a small amount of mutation is possible to, and the individual antibody that this colony is included is identical.Therefore, modifier " monoclonal " refers to the antibody characteristic of the mixture of same antibody.

It a variety of means known in the art can be used to prepare the anti-polyubiquitin monoclonal antibody of the present invention, including be Kohler etc., Nature, 256:The hybridoma that 495 (1975) are described first, or alternatively they can be prepared by recombinant DNA method (such as U.S. Patent number 4,816,567).

Carrier, host cell and recombination method

For the antibody of the recombinant production present invention, separation encodes its nucleic acid, and is inserted into replicable vector, for further cloning (DNA cloning) or expressing.Usable old process is readily separated the DNA of encoding antibody and sequencing (as using the oligonucleotide probe that can be combined with the gene specific of encoding antibody heavy and light chain).Using many carriers.The selected section of carrier depends on the host cell that will be used.Host cell includes but is not limited to protokaryon or eucaryon (being typically mammal) origin.It will be appreciated that the constant region of any isotype can be used for this purpose, including IgG, IgM, IgA, IgD and IgE constant region, and such constant region can be obtained from anyone or animal species.

Antibody is generated using prokaryotic host cell:

Vector construction

Standard recombinant techniques can be used and encode the polynucleotide sequence of antibody polypeptides component of the present invention to obtain.Desired polynucleotide sequence can be separated from antibody-producting cell such as hybridoma and is sequenced.Or, nucleotide synthesizer or round pcr synthetic polyribonucleotides can be used.Once obtaining, the sequence insertion of coded polypeptide can be replicated into the recombinant vector of simultaneously expressing heterologous polynucleotides in prokaryotic hosts.For the present invention, many carriers that this area is obtainable and knows can be used.The selection of appropriate carrier will primarily depend upon will insertion vector nucleic acid size and the specific host cell that will be converted with carrier.According to its function (amplification or expressing heterologous polynucleotides, or the two is furthermore) and its compatibility for the specific host cell being resident wherein with it, every kind of carrier contains a variety of components.Support element typically includes, but not limited to replication orgin, selected marker gene, promoter, ribosome bind site (RBS), signal sequence, heterologous nucleic acids Insert Fragment and transcription terminator.

In general, being included with the plasmid vector that host cell is used together derived from the replicon and control sequence with these host compatibility species.Carrier generally carries replication site, and the flag sequence of Phenotypic Selection can be provided in transformed cells.For example, generally with the pBR322 plasmid conversion Escherichia coli derived from species Escherichia coli.Genes of the pBR322 comprising encoding ampicillin (Amp) and tetracycline (Tet) resistance, thus provides the means of light identification of transformed cell.PBR322, its derivative or other microorganism plasmids or bacteriophage can also include or through modification comprising the promoter that can be used to express endogenous protein by microorganism organism.The example of the pBR322 derivatives for expressing specific antibodies is described in Carter et al., United States Patent (USP) 5,648,237 in detail.

In addition, the phage vector comprising the replicon and control sequence compatible with host microorganism can be used as to the conversion carrier of these hosts.For example, bacteriophage such as λ GEM.TM.-11 can be used to build the recombinant vector that can be used for converting susceptible host cell such as Escherichia coli LE392.

The expression vector of the present invention can include two or more promoter-cistrons pair, and they encode each polypeptide component.Promoter is the untranslated regulating and controlling sequence positioned at cistron upstream (5 '), and it regulates and controls the expression of cistron.Prokaryotic promoter generally falls into two classes, induction type and composition.Inducible promoter refers to the change (presence or absence of such as nutrients or temperature change) in response to condition of culture and starts the promoter that the elevated levels for the cistron being controlled by it are transcribed.

It is known that by a large amount of promoters of a variety of potential host cell identifications.Promoter in source DNA is cut by limiting enzymic digestion and the promoter sequence of separation is inserted to the carrier of the present invention, thus the promoter of selection can be operatively connected with encoding the cistron DNA of light chain or heavy chain.Native promoter sequence and many allogeneic promoters can be used in instructing the amplification and/or expression of target gene.In some embodiments, using allogeneic promoter, because compared with native target polypeptide promoter, they generally allow for higher transcription and the higher yield of expressed target gene.

Promoter suitable for prokaryotic hosts includes PhoA promoters, beta galactosidase and lactose promoter system, tryptophan (trp) promoter systems and hybrid promoter such as tac or trc promoters.However, the other promoters of functional (such as other known bacterium or phage promoter) are also suitable in bacterium.Their nucleotide sequence has been delivered, and thus skilled work personnel can use the joint or adapter that provide any required restriction site that they are operatively connected into (Siebenlist et al., Cell 20 with encoding the cistron of target light chain and heavy chain:269(1980)).

In one aspect of the invention, each cistron in recombinant vector includes the secretory signal sequence component for instructing expressed polypeptide to wear film transhipment.In general, signal sequence can be the component of carrier, or it can be the target polypeptide DNA of an insertion vector part.The signal sequence selected for the present invention should be by the signal sequence that host cell is recognized and is processed and (is cut off by signal peptidase).For nonrecognition and process heterologous polypeptide signal sequences native prokaryotic host cell, by signal sequence use selected from such as the following group prokaryotic signal sequence substitute:Alkaline phosphatase, penicillase, Ipp or heat-staple enterotoxin 1s I (STII) targeting sequencing, LamB, PhoE, PelB, OmpA and MBP.In one embodiment of the invention, the signal sequence all used in two cistrons of expression system is STII signal sequences or its variant.

On the other hand, the generation according to the immunoglobulin of the present invention can occur in the cytoplasm of host cell, therefore need not have secretory signal sequence in each cistron.In that, light chain immunoglobulin and heavy chain express in cytoplasm, fold and assemble and form Functional immunoglobulin.Some host strains (such as Escherichia coli trxB- bacterial strains) are provided with the cytoplasm condition beneficial to disulfide formation, so as to allow the correct folding and assembling of expressed protein subunit.Proba and Pluckthun, Gene 159:203(1995)).

The antibody of the present invention can be used the system of being expressed as below to generate, wherein the quantity ratios of expressed polypeptide component can be regulated and controled, so that by the maximum production for the antibody of the present invention secreted and correctly assembled.This regulation and control are at least partially by while regulating and controlling the translation intensity of polypeptide component and realizing.

A kind of technology for regulating and controlling translation intensity is disclosed in Simmons et al., United States Patent (USP) 5,840,523.It utilizes the variant of Translation initiator (TIR) in cistron.For specifying TIR, a series of amino acid or nucleotide sequence variants that intensity is translated with certain limit can be created, thus provides and facilitates means for what the expectation expression of specific chain adjusted this factor.The codon that can change amino acid sequence can be caused to change to generate TIR variants by conventional mutagenesis techniques.In certain embodiments, the change in nucleotide sequence is silence.Change in TIR may include the change of the number or spacing of such as Shine-Dalgarno sequences, and the change in signal sequence.A kind of method for generating mutant signal sequences is that " password word bank " (i.e. change is silence) that does not change signal sequence amino acid sequence is generated at the beginning of coded sequence.This can be realized by changing the 3rd nucleotide position of each codon；In addition, some amino acid, such as leucine, serine and arginine, with a variety of first and second position, this can increase complexity in storehouse is built.Yansura et al., METHODS:A Companion toMethods in Enzymol.4:151-158 describes this method of mutagenesis in detail in (1992).

In one embodiment, for each cistron in carrier, one group carrier of the generation with certain limit TIR intensity.This finite aggregate provides the comparison of the expression of every chain and the yield of expectation antibody product under the combination of various TIR intensity.It can be determined and be had a detailed description in TIR intensity, Simmons et al., United States Patent (USP) 5,840,523 by quantifying the expression of reporter.According to the comparison of translation intensity, desired indivedual TIR are selected to be combined in the expression vector establishment thing of the present invention.

Prokaryotic host cell suitable for expressing antibody of the present invention includes archeobacteria (Archaebacteria) and eubacteria (Eubacteria), such as Gram-negative or gram-positive organism.The example of useful bacterium includes Escherichia (Escherichia) (such as ETEC E.coli), bacillus (Bacillus) (such as bacillus subtilis B.subtilis), Enterobacter (Enterobacteria), pseudomonas (Pseudomonas) (such as pseudomonas aeruginosa P.aeruginosa) species, salmonella typhimurium (Salmonella typhimurium), serratia marcescens (Serratia marcescans), Klebsiella (Klebsiella), proteus (Proteus), Shigella (Shigella), rhizobium (Rhizobium), Vitreoscilla (Vitreoscilla), or paracoccus (Paracoccus).In one embodiment, using gram-negative cells.In one embodiment, the host of the present invention is used as using Bacillus coli cells.The example of coli strain includes bacterial strain W3110 (Bachmann, Cellular and Molecular Biology, volume 2, Washington, D.C., American Academy Of Microbiology, 1987, the 1190-1219 pages；ATCC preserving numbers 27, and its derivative 325), including the bacterial strain 33D3 (U.S. Patent number 5,639,635) with genotype W3110 Δs fhuA (Δ tonA) ptr3 lac Iq lacL8 Δ ompT Δ (nmpc-fepE) degP41 kanR.Other bacterial strains and its derivative, such as Escherichia coli 294 (ATCC 31,446), Escherichia coli B, Escherichia coli λ 1776 (ATCC31,537) and Escherichia coli RV308 (ATCC 31,608) are also suitable.These examples be illustrate and it is unrestricted.Know for building the method with any of above bacterial derivation thing for specifying genotype, see, for example, Bass et al., Proteins 8 this area:309-314(1990).It is typically required to consider reproducibility of the replicon in bacterial cell to select suitable bacterium.For example, using well-known plasmid such as pBR322, pBR325, pACYC177 or pKN410 are to provide replicon when, Escherichia coli, Serratia or Salmonella ssp may be suitable for use as host.Generally, host cell should secrete the proteolytic enzyme of minimum, and may want to mix extra protease inhibitors in cell culture.

Antibody tormation

Host cell is converted with above-mentioned expression vector, and is cultivated in for evoked promoter, the conventional nutrient culture for selecting transformant or the gene of amplification coding expectation sequence and suitably changing.

DNA is imported prokaryotic hosts by conversion so that DNA can be replicated, and as extra-chromosomal element or passes through chromosomal composition.According to host cell used, converted using the standard technique suitable for these cells.Bacterial cell with firm cell-wall barriers is generally used for using the Calcium treatment of calcium chloride.Another method for transformation uses polyethylene glycol/DMSO.What is used also has a kind of technology to be electroporation.

The prokaryotic for generating polypeptide of the present invention is cultivated in culture medium know in this area and suitable for the selected host cell of culture.The example of suitable culture medium includes the LB culture mediums (Luria broth) that with the addition of required nutritional supplement.In some embodiments, the selective agent that culture medium also contains the structure of with good grounds expression vector and selected, allows that the prokaryotic comprising expression vector grows with selectivity.For example, adding ampicillin into the culture medium for cultivating the cell for expressing ampicillin resistance gene.

In addition to carbon, nitrogen and inorganic phosphate sources, can also any required supplement containing debita spissitudo, be individually added into or as the mixture with another supplement or culture medium, such as compound nitrogen source.It is optional that, culture medium can contain one or more reducing agents being selected from the group:Glutathione, cysteine, cystamine, thioglycolate salt/ester, dithioerythritol and dithiothreitol (DTT).

In suitable temperature culture prokaryotic host cell.For example, for culture Escherichia coli, the temperature range cultivated includes but is not limited to about 20 DEG C to about 39 DEG C, about 25 DEG C to about 37 DEG C and about 30 DEG C.Host organisms are depended primarily on, the pH of culture medium can be any pH that scope is about 5 to about 9.For Escherichia coli, pH can be about 6.8 to about 7.4 or about 7.0.

If using inducible promoter in the expression vector of the present invention, then inducible protein is expressed under conditions of suitable for activation promoter.In one aspect of the invention, the transcription of polypeptide is controlled using PhoA promoters.Therefore, in order to induce, host cell of the culture by conversion in phosphate limits culture medium.In one embodiment, phosphate limitation culture medium is C.R.A.P culture mediums (see, for example, Simmons et al., J.Immunol.Methods 263:133-147(2002)).According to the vector construct used, a variety of other inducers can be used, as is known in the art.

In one embodiment, expressed polypeptide of the present invention is secreted into the pericentral siphon of host cell and therefrom reclaimed.Protein Recovery generally involves destruction microorganism, generally passes through the means such as osmotic shock (osmotic shock), ultrasonically treated or cracking., can be by centrifuging or filtering clear cell debris or whole cell once cell is destroyed.Protein can be further purified for example, by affine resin chromatography.Or, protein may be transported in nutrient solution and therefrom separate.It can filter and concentrate from nutrient solution scavenger-cell, and by culture supernatants, for generated protein to be further purified.Commonly known method such as polyacrylamide gel electrophoresis (PAGE) and Western blot analysis further separation and the expressed protein of identification can be used.

In one aspect of the invention, antibody producing is largely carried out by fermentation process.A variety of extensive fed-batch fermentation flows can be used for production recombinant protein.Large scale fermentation has at least 1000 liters of capacity, e.g., from about 1,000 to 100,000 liter of capacity.These fermentation tanks distribute oxygen and nutrient, especially glucose (conventional carbon source/energy) using agitator paddle.Small-scale fermentation is often referred to the fermentation carried out in the fermentation tank that volume capacity is no more than about 100 liters, can range from about 1 and rises to about 100 liters.

During the fermentation, generally cell is cultivated under suitable conditions to expected density (such as OD550 about 180-220, this phase cell be in stationary phase early stage) afterwards start protein expression induction.According to the vector construct used, a variety of inducers can be used, it is knowing as this area and above-described.Can be before induction by time that cell culture is shorter.Generally by cell induction about 12-50 hours, but longer or shorter induction time can be used.

In order to improve the yield and quality of polypeptide of the present invention, multinomial fermentation condition can be changed.For example, in order to improve the correct assembling and folding of secreted antibody polypeptides, the additional carrier of overexpression chaperone such as Dsb albumen (DsbA, DsbB, DsbC, DsbD and/or DsbG) or FkpA (a kind of peptidyl prolyl-cis, the trans-isomerase with Chaperone Activity) can be used to carry out cotransformation host prokaryotic cell.Verified chaperone promotes correct folding and the solubility of the heterologous protein generated in bacterial host cell.Chen et al., J.Biol.Chem.274:19601-19605(1999)；Georgiou et al., United States Patent (USP) 6,083,715；Georgiou et al., United States Patent (USP) 6,027,888；Bothmann andPluckthun, J.Biol.Chem.275:17100-17105(2000)；Ramm and Pluckthun, J.Biol.Chem.275:17106-17113(2000)；Arie et al., Mol.Microbiol.39:199-210(2001)).

In order to which the proteolysis of expressed heterologous protein (the especially heterologous protein sensitive to proteolysis) are minimized, some host strains of proteolysis enzyme defect can be used for the present invention.For example, host cell strains can be modified, genetic mutation, such as proteinase II I, OmpT, DegP, Tsp, protease I, protease Mi, protease V, protease VI and combinations thereof are carried out in the gene of the known bacterialprotease of coding.Some e. coli protein enzyme defect bacterial strains can be obtained, see, for example, Joly et al., (1998) are seen above；Georgiou et al., United States Patent (USP) 5,264,365；Georgiou et al., United States Patent (USP) 5,508,192；Hara et al., Microbial Drug Resistance 2:63-72(1996).

In one embodiment, proteolysis enzyme defect is used in the expression system of the present invention and passes through the coli strain of the plasmid conversion of the one or more chaperones of overexpression as host cell.

Antibody purification

In one embodiment, the antibody protein generated herein is further purified to obtain the product of substantially homogeneity, for further determining and using.The Standard protein purification method that can be known using this area.Following flow is the illustration of appropriate purification flow:Fractionation, ethanol precipitation, reversed-phase HPLC, tripoli in affine in immunity or ion exchange column or the chromatography on cationic ion-exchange resin such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation and the gel filtration using such as Sephadex G-75.

In one aspect, the albumin A being fixed in solid phase is used for the immunoaffinity purification of antibody products of the present invention.Albumin A is the 41kD cell wall proteins from staphylococcus aureus (Staphylococcus aureas), and it is with high-affinity binding antibody Fc areas.Lindmark et al., J.Immunol.Meth.62:1-13(1983)).The solid phase that albumin A is fixed thereon can be the pillar with glass or quartz surfaces, or controlled pore glass post or silicic acid post.In some applications, pillar is coated with reagents such as glycerine, the non-specific adhesion to be possible to prevent pollutant.

As the first step of purifying, the prepared product derived from cell culture as described above can be applied in albumin A immobilization solid phase so that purpose antibody Specific binding proteins A.Then solid phase is cleaned to remove the pollutant with solid phase non-specific binding.Finally by elution purpose antibody is reclaimed from solid phase.

Antibody is generated using eukaryotic host cell:

Support element typically includes, but not limited to following one or more:Signal sequence, replication orgin, one or more marker gene, enhancer element, promoter and transcription terminator.

(i) signal sequence component

The carrier used in eukaryotic host cell can also include signal sequence or other polypeptides with special cleavage site in the N-terminal of purpose mature protein or polypeptide.It is typically chosen by the Heterologous signal sequences that host cell is recognized and is processed and (is cut off by signal peptidase).It is leading using mammalian signal sequences and viral secretory in mammalian cell expression, such as herpes simplex gD signal.

In the reading frame that the DNA of these prosomas is connected to the DNA of encoding antibody.

(ii) replication orgin

Generally, mammalian expression vector does not need replication orgin component.For example, SV40 starting points generally may be only because just using comprising early promoter.

(iii) Select gene component

Expression and cloning vector can include Select gene, also referred to as selection marker.Typical Select gene encodes following protein:(a) resistance to antibiotic or other toxin, such as ampicillin, neomycin, methotrexate (MTX) or tetracycline are assigned；(b) corresponding auxotrophy is supplied；Or (c) provides the critical nutrients that can not be obtained from complex medium.

One example of selection scheme blocks the growth of host cell using medicine.Those Hemapoiesis through heterologous gene successful conversion assign the protein of drug resistance, thus survive selection scheme.The example of such dominant selection uses drug neomycin, mycophenolic acid and hygromycin.

Another example suitable for the selection marker of mammalian cell is the selection marker for the cell that can identify intake antibody nucleic acids of having the ability, DHFR, thymidine kinase, metallothionein I and II (such as primate metallothionein's gene), adenosine deaminase, ornithine decarboxylase.

For example, the cell converted through DHFR Select genes can be identified by the way that all transformants are cultivated in the culture medium containing methotrexate (MTX) (Mtx, DHFR a kind of competitive antagonist) first.When using wild type DHFR, suitable host cell includes Chinese hamster ovary (CHO) cell line (such as ATCC CRL-9096) of such as DHFR active defects.

Or, the DNA sequence dna conversion of encoded antibody, wild type DHFR protein and another selection marker such as aminoglycoside 3 '-phosphotransferase (APH) or the host cell (wild-type host for particularly including endogenous DHFR) of cotransformation can be selected by cultivating cell in the culture medium containing the selective agent for selection marker such as aminoglycoside antibiotics such as kanamycins, neomycin or G418.Referring to United States Patent (USP) 4,965,199.

(iv) promoter component

Expression and cloning vector generally comprise the promoter recognized by host organisms, and are operatively connected with the nucleic acid of encoding polypeptides of interest (such as antibody).The promoter sequence of known eukaryotic.In fact, all eukaryotic genes, which all have, is rich in AT areas, it is located at about 25 to 30 bases of site upstream of starting transcription.Another sequence found at the base of transcriptional start point upstream 70 to 80 of many genes is CNCAAT areas, and wherein N can be any nucleotides.It is AATAAA sequences at 3 ' ends of most of eukaryotic genes, it is probably the signal of 3 ' end addition polyadenylic acid (polyA) tails to coded sequence.All these sequences are suitably inserted in carrier for expression of eukaryon.

Can be by for example from the viral acquisition of (such as polyomavirus, fowlpox virus, adenovirus (such as 2 type adenovirus), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, retrovirus, hepatitis B and simian virus 40 (SV40)) genome, promoters from heterologous mammal promoter (such as actin promoter or immunoglobulin promoter) or from heat-shock promoters control, if if these promoters are compatible with host cell systems by carrier Antibody transcription polypeptide in mammalian host cell.

The early and late promoter of SV40 viruses is easily obtained in the form of SV40 restriction fragments, the fragment also includes SV40 virus origin of replication.The immediate early promoter of human cytomegalovirus is easily obtained in the form of HindIIIE restriction fragments.The system for using bovine papilloma virus as carrier DNA being expressed in mammalian hosts is disclosed in United States Patent (USP) 4,419,446.A kind of modification of the system has been recorded in United States Patent (USP) 4,601,978.On in mouse cell the thymidine kinase promoter from herpes simplex virus control following table intelligent's beta-interferon cDNA referring also to Reyes et al., Nature297:598-601(1982).Or, it Rous sarcoma virus LTR can be used to be used as promoter.

(v) enhancer element component

Transcription of the higher eucaryotic cells to the DNA of coding antibody polypeptides of the present invention can be usually improved by inserting enhancer sequence in the carrier.Many enhancer sequences from mammalian genes (globulin, elastoser, albumin, α-fetoprotein and insulin) that it is now know that.However, usually using the enhancer from eukaryotic cell virus.Example includes enhancer (bp100-270), the sub- enhancer of cytomegalovirus early promoter, the enhancer and adenovirus cancers of polyomavirus replication orgin late period side of SV40 replication orgins late period side.On activating the reinforcing element of eukaryotic promoter referring also to Yaniv, Nature 297:17-18(1982).Enhancer can montage into carrier, positioned at 5 ' or 3 ' positions of antibody polypeptides coded sequence, but be normally at 5 ' sites of promoter.

(vi) tanscription termination component

The expression vector used in eukaryotic host cell is generally also comprising termination transcription and sequence necessary to stable mRNA.Such sequence can generally be obtained from 5 ' ends of eucaryon or viral DNA or cDNA non-translational regions with 3 ' ends once in a while.These regions are included in the nucleotide segment that polyadenylated fragments are transcribed into the mRNA of encoding antibody non-translational region.A kind of useful tanscription termination component is bovine growth hormone polyadenylation area.Referring to WO94/11026 and its disclosed in expression vector.

(vii) selection and conversion of host cell

Include higher eucaryotic cells described herein, including vertebrate host cell suitable for cloning or expressing the host cell of the DNA in this paper carriers.Breeding of the vertebrate cells in culture (tissue cultures) has become old process.The example of useful mammalian host cell line has the monkey kidney CV1 system (COS-7 converted through SV40, ATCC CRL 1651), (293 cells are 293 cells that are subcloned of culture that suspend to human embryonic kidney cell line, Graham et al., J.Gen.Virol.36:59 (1977)), baby hamster kidney cell (BHK, ATCC CCL 10), Chinese hamster ovary cell/- DHFR (CHO, Urlaub et al., Proc.Natl.Acad.Sci.USA 77:4216 (1980)), mouse Sai Tuoli (Sertoli) cells (TM4, Mather, Biol.Reprod.23:243-251 (1980)), MK cells (CV1, ATCC CCL 70), African green monkey kidney cell (VERO-76, ATCC CRL 1587), human cervical carcinoma cell (HELA, ATCC CCL 2), MDCK (MDCK, ATCC CCL 34), ox mouse (buffalo rat) liver cell (BRL 3A, ATCC CRL 1442), human pneumonocyte (W138, ATCC CCL 75), human liver cell (Hep G2, HB 8065), mouse mammary tumor (MMT 060562, ATCC CCL 51), TRI cells (Mather et al., Annals N.Y.Acad.Sci.383:44-68 (1982)), MRC5 cells, FS4 cells and human hepatoma (hepatoma) system (Hep G2).

In order to generate antibody, host cell is converted with expression described above or cloning vector, and cultivated in for evoked promoter, the conventional nutrient culture for selecting transformant or the gene of amplification coding expectation sequence and suitably changing.

(viii) culture of host cell

The host cell for generating antibody of the present invention can be cultivated in a variety of culture mediums.Commercially available culture medium such as HamShi F10 (Sigma), minimum essential medium (MEM, Sigma), RPMI-1640 (Sigma) and DulbeccoShi modification EagleShi culture mediums (DMEM, Sigma) are suitable to culture host cell.In addition, any culture medium described in following documents can be used as the culture medium of host cell:Ham et al., Meth.Enz.58:44(1979)；Barnes et al., Anal.Biochem.102:255(1980)；United States Patent (USP) 4,767,704；4,657,866；4,927,762；4,560,655；5,122,469；WO90/03430；WO 87/00195；Or United States Patent (USP) review 30,985.These any culture mediums can hormone supplemented and/or other growth factors (such as insulin, transferrin or EGF), salt (such as sodium chloride, calcium, magnesium and phosphate), buffer (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotic (such as GENTAMYCIN as needed^TMMedicine), trace element (being defined as the inorganic compound generally existed with the final concentration of micro-molar range) and glucose or the equivalent energy.Can be contained with suitable concentration those skilled in the art will know that any other required supplement.Condition of culture temperature, pH etc. are that the host cell expressed and selected is previously used, and this is obvious for those of ordinary skill.

(ix) purifying of antibody

When using recombinant technique, antibody can be generated in the cell, or be directly secreted into culture medium.If generating antibody in the cell, then general first to remove particle debris, host cell or crack fragment for example, by centrifugation or ultrafiltration.If antibody-secreting is into culture medium, then generally concentrate the supernatant from these expression systems first by commercialization protein concentration filter (such as Amicon or Millipore Pellicon ultra filtration units).Protease inhibitors such as PMSF can be included in any above-mentioned steps to suppress proteolysis, and may include antibiotic to prevent the growth of external contaminant.

Such as hydroxyapatite, gel electrophoresis, dialysis and affinity chromatography (general acceptable purification technique is affinity chromatography) can be used to purify the antibody compositions prepared from cell.Affinity reagent such as albumin A depends on the species and isotype of any immunoglobulin Fc domain present in antibody as the suitability of affinity ligand.Albumin A can be used for antibody (Lindmark et al., J.Immunol.Meth.62 of the purifying based on people γ 1, γ 2 or the heavy chains of γ 4:1-13(1983)).Protein G recommends to be used for all mouse isotypes and people γ 3 that (Guss et al., EMBO are J.5:1567-1575(1986)).Matrix accompanying by affinity ligand is most commonly used that agarose, but other matrix can be used.The matrix of physically stable such as controlled pore glass or poly- (styrene divinyl) benzene can obtain flow velocity more faster than agarose and shorter process time.If antibody includes CH3 domains, Bakerbond ABX can be used^TMResin (J.T.Baker, Phillipsburg, NJ) is purified.According to antibody to be recycled, it is possible to use fractionation, ethanol precipitation on other oroteins purification technique such as ion exchange column, reversed-phase HPLC, the chromatography on tripoli, heparin SEPHAROSE^TMOn chromatography, anion or cationic ion-exchange resin (such as poly-aspartate post) on chromatography, chromatofocusing, SDS-PAGE and ammonium sulfate precipitation.

After any any preliminary purification step, mixture containing purposeful antibody and pollutant can be subjected to further purification step when necessary, such as low pH hydrophobic interaction chromatographies, using pH about 2.5-4.5 elution buffer, are typically carried out in low salt concn (such as from about 0-0.25M salt).

It should be noted that in general, technology and method for preparing for the antibody of research, test and Clinical practice are this areas improves and set up, with being consistent above and/or those skilled in the art think that for specific antibody interested be suitable.

Activation measurement

Identification of the antibodies their physical/chemical properties and biological function of many measure method that can be known by this area to the present invention.

The antibody of purifying, including but not limited to N-terminal sequencing, amino acid analysis, non denatured size exclusion high pressure liquid chromatography (HPLC), mass spectrum, ion-exchange chromatography and papain digestion can be further characterized by a series of determination methods.

When necessary, to their biological activity of antibody analysis.In some embodiments, to their antigen-binding activity of the antibody test of the present invention.Antigen binding assay that this area is known and available for this paper includes but is not limited to any direct or competitive binding assay using technologies such as western blot, radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), " sandwich " immunoassay, immunoprecipitation assay, fluorescence immunoassay and protein A immunoassays.

In one embodiment, present invention contemplates the improvement antibody with some but not all effector functions, this causes it to be that important but some effector functions (such as complement and ADCC) are to turn into desired candidate in unnecessary or harmful many applications in antibody Half-life in vivo.In certain embodiments, the Fc activity of antibody is measured to ensure only to remain desired characteristic.External and/or in vivo cytotoxicity determination method can be carried out to confirm CDC and/or ADCC activity reduction/abatement.For example, Fc acceptors (FcR) binding assay can be carried out to confirm that antibody deficiency Fc γ R combine (it is therefore possible to lack ADCC activity) but reservation FcRn binding abilities.Mediation ADCC main cell, NK cells, an expression Fc γ RIII, and monocytes Fc γ RI, Fc γ RII and Fc γ RIII.Ravetch and Kinet, Annu.Rev.Immunol.9:The page tables 3 of 457-92 (1991) the 464th summarize the FcR expression on hematopoietic cell.The example of the vitro assay for the ADCC activity for being used for purpose of appraisals molecule has been recorded in United States Patent (USP) 5,500,362 or 5,821,337.Effector cell available for such determination method includes PMBC (PBMC) and natural killer (NK) cell.Or can purpose of appraisals molecule in vivo ADCC activity, such as in animal model, such as Clynes et al., PNAS (USA) 95:Disclosed in 652-656 (1998).C1q binding assays can be also carried out to confirm that antibody can not combine C1q and therefore shortage CDC activity.In order to assess complement activation, CDC determination methods can be carried out, such as such as Gazzano-Santoroet al., J.Immunol.Methods 202:Described in 163 (1996).The method progress FcRn known this area is it is also possible to use to combine and internal removing/half-life period measure.

Antibody fragment

The present invention covers antibody fragment.In some cases, it is advantageous using antibody fragment, rather than complete antibody.The reduced size of fragment allows quick removing, and can cause to be more easily accessible to solid tumor.

The multiple technologies for generating antibody fragment are developed.Traditionally, these fragments are derived by proteolytic digestion complete antibody (see, for example, Morimoto et al., Journal of Biochemicaland Biophysical Methods 24:107-117(1992)；Brennan et al., Science 229:81(1985)).However, these fragments directly can be generated by recombinant host cell now.Fab, Fv and scFv antibody fragment all can so be allowed readily to generate these substantial amounts of fragments in expression in escherichia coli and by E. coli secretion.Can from phage antibody library discussed above isolated antibody fragment.Or, directly it can reclaim Fab '-SH fragments and chemical coupling to form the fragments of F (ab ') 2 (Carter etal., Bio/Technology 10 from Escherichia coli:163-167(1992)).According to another method, F (ab ') 2 fragment directly can be separated from recombinant host cell culture.The fragment of Fab and F (ab ') 2 of Half-life in vivo comprising salvage receptor binding epitope residue, with extension is recorded in United States Patent (USP) No.5,869,046.Other technologies for generating antibody fragment will be apparent for skilled practitioner.In other embodiments, the antibody of selection is Single-Chain Fv Fragment of Murine (scFv).Referring to WO 93/16185；United States Patent (USP) No.5,571,894；And 5,587,458.Fv and sFv are with entire binding site, lack the unique type of constant region；In this way, they are suitable to reduce non-specific binding when using in vivo.SFv fusion proteins can be built to generate fusion of the effector protein in sFv amino or carboxyl terminal.Compiled referring to Antibody Engineering, Borrebaeck, supra.Antibody fragment can also be " linear antibodies ", such as such as United States Patent (USP) No.5, described in 641,870.Such linear antibody fragments can be monospecific or bispecific.

Humanized antibody

The present invention covers humanized antibody.Know a variety of methods for humanizing non-human antibodies in this area.For example, humanized antibody can have one or more amino acid residues introduced from non-people source.These non-human amino acid residues usually referred to as " input " residue, and they are normally taken from " inputting " variable region.The method that Winter and its colleague can substantially be followed carries out humanization (Jones et al., Nature 321:522-525(1986)；Riechmann et al., Nature 332:323-327(1988)；Verhoeyen et al., Science239:1534-1536 (1988)), i.e., the corresponding sequence of human antibody is substituted with inhuman hypervariable region sequence.Therefore, such " humanization " antibody is chimeric antibody (United States Patent (USP) 4,816,567), wherein being substituted considerably less than complete people variable region with the corresponding sequence of non-human species.In practice, humanized antibody is typically following human antibody, and some of which some hypervariable region residues and some possible FR residues are substituted with the residue in the similar site of rodent antibodies.

It is probably very important for reduction antigenicity for preparing people's light chain of humanized antibody and the selection of weight chain variable district.According to so-called " most suitable (best-fit) " method, the whole library of known people's variable region sequences is screened with the variable region sequences of rodent antibodies.Then people's framework (Sims the et al., J.Immunol.151 with the immediate human sequence of rodent as humanized antibody are selected:2296(1993)；Chothia et al., J.Mol.Biol.196:901(1987)).Another method uses the specific frame as derived from specific light chain or the consensus sequence of all human antibodies of heavy chain subclass (subgroup).Identical frames can be used for several different humanized antibody (Carter et al., Proc.Natl.Acad.Sci.USA 89:4285(1992)；Presta et al., J.Immunol.151:2623(1993)).

The general antibody that is further desirable to retains high-affinity and other favourable biological characteristicses to antigen after humanization.In order to reach this purpose, according to a kind of method, analyze the process of parental array and various conceptual humanized products to prepare humanized antibody by using parental array and the threedimensional model of humanized sequence.Generally can adaptive immune globulin threedimensional model, this is familiar to those skilled in the art.It can also be illustrated and be shown the computer program of the possibility three-dimensional conformation structure of selected candidate immunoglobulin sequences sequence.Acted on by checking that these display images can analyze possibility of the residue in candidate immunoglobulin sequences sequence function, i.e., analyzing influence candidate immunoglobulin sequences combine the residue of the ability of its antigen.So, FR residues can be selected from receptor sequence and list entries and are combined, so as to obtain desired antibody characteristic, such as the affinity to target antigen is raised.In general, the direct and most substantive influence involved to antigen binding of some hypervariable region residues.

Human antibody

The anti-polyubiquitin antibody of people of the present invention can show that the Fv in storehouse clones variable domain sequence and built with known people's constant domain sequence by combining as described above selected from people's charon phages.Or, the anti-polyubiquitin antibody of human monoclonal of the present invention can be generated by hybridoma method.Human myeloma and mouse-people's heteromyeloma cell lines for generating human monoclonal antibodies have been described, such as KozborJ.Immunol., 133:3001(1984)；Brodeur et al., Monoclonal Antibody ProductionTechniques and Applications, pp.51-63 (Marcel Dekker, Inc., New York, 1987)；And Boerner et al., J.Immunol., 147:86(1991).

For example, it is now possible to which the transgenic animals (such as mouse) of human antibody full repertoire can be generated in the case where lacking endogenous immunoglobulin generation after immune by generating.For example, the homozygosis for having described antibody heavy chain joining region (JH) gene in chimeric and germ line mutant mice, which is deleted, causes the complete inhibition of endogenous antibody tormation.A large amount of human germline immunoglobulin's genes are shifted in such germ line mutant mice will cause to generate human antibody after antigen is attacked.See, for example, Jakobovits et al., Proc.Natl.Acad.Sci.USA 90:2551(1993)；Jakobovits et al., Nature 362:255-258(1993)；Bruggermann et al., Year in Immunol.7:33(1993).

Gene shuffling can also be used for deriving human antibody from inhuman (such as rodent) antibody in vitro, and wherein human antibody has the affinity and specificity similar to starting non-human antibody.According to the method, it is also referred to as " the epitope marking " (epitope imprinting), the heavy chain of the non-human antibody fragment obtained as described above by display technique of bacteriophage or light chain variable district employment V structure domain gene complete or collected works replace, and produce non-human chain-human chain scFv or Fab block polymer group.The selection carried out with antigen causes the chimeric scFv or Fab of non-human chain/human chain separation, wherein human chain has recovered antigen binding site after corresponding non-human chain is eliminated in one-level phage display clone, i.e. epitope determines the selection of (marking, imprint) human chain gametophyte.When repeating the process to replace remaining non-human chain, human antibody (referring to PCT WO 93/06213, being disclosed on April 1st, 1993) is obtained.Different from the humanization of traditional non-human antibody that progress is transplanted by CDR, this technology provides the antibody of complete people, and they are free of FR framves or CDR residues of non-human origins.

Bispecific antibody

Bispecific antibody refer to at least two not synantigen there is the monoclonal antibody of binding specificity.In certain embodiments, bispecific antibody is human antibody or humanized antibody.In certain embodiments, one of binding specificity is directed to the polyubiquitin connected comprising specific lysine, and the another of binding specificity is directed to any other antigen.In certain embodiments, bispecific antibody can combine the two kinds of different polyubiquitins connected with different lysines.Bispecific antibody can be prepared into full length antibody or antibody fragment (such as F (ab ')₂Bispecific antibody).

Method for building bispecific antibody is known in the art.Traditional, coexpression of the recombinant production based on two pairs of heavy chain immunoglobulin-light chains of bispecific antibody, two of which heavy chain has different specificity (Millstein and Cuello, Nature 305:537(1983)).Due to being randomly assigned for heavy chain immunoglobulin and light chain, these hybridomas (four source hybridomas (quadroma)) generate the potential mixture of 10 kinds of different antibodies molecules, wherein only a kind of have correct bispecific structure.The purifying of the correct molecule generally carried out by affinity chromatography step is fairly cumbersome and Product yields are low.Similar code is disclosed in WO 93/08829 disclosed in 13 days Mays in 1993 and Traunecker et al., EMBOJ.10:3655(1991).

According to a kind of different embodiment, there will be the antibody variable domains for expecting binding specificity (antibody-antigen binding site) to be merged with immunoglobulin constant domain sequence.For example, being merged with the heavy chain immunoglobulin constant domain comprising at least part hinge, CH2 and CH3 areas.In certain embodiments, there is the first heavy chain constant region (CH1) that necessary site is combined comprising light chain at least one fusions.By encoding immune immunoglobulin heavy chain fusions thing and, when needed, the DNA of light chain immunoglobulin inserts separated expression vector, and cotransfection is into suitable host organisms.There is provided when not waited for the three of structure kind polypeptide chain ratio in the embodiment of optimum point of production, this provides great flexibility to adjust the mutual ratio of three kinds of polypeptide fragments.However, when at least two polypeptide chains cause high yield with same ratio expression or when there is no special meaning in the ratio, it is possible to which the coded sequence of two kinds or all three polypeptide chains is inserted into an expression vector.

In an embodiment of this method, bispecific antibody has the hybrid immunoglobulin heavy chain of the first binding specificity on an arm, and hybrid immunoglobulin heavy chain-light chain on another arm is constituted to (providing the second binding specificity).Due to the separating pathway that presence of the light chain immunoglobulin only in half of bispecific molecule is provided convenience, consequently found that this dissymmetrical structure is easy to separate desired bispecific compound with undesired immunoglobulin chain combinations.This method is disclosed in WO94/04690.On generating the further details of bispecific antibody see, for example, Suresh et al., Methods in Enzymology 121:210(1986).

According to another method, the interface between a pair of antibody molecules can be transformed, by the percent maximum of the heterodimer reclaimed from recombinant cell culture thing.Interface includes at least part antibody constant domain CH3 domains.In the method, one or more small amino acid side chains of first antibody molecular interface are replaced with larger side chain (such as tyrosine or tryptophan).By the way that big amino acid side chains are replaced with compared with small amino acid side chains (such as alanine or threonine), compensatory " cavity " with the same or similar size of bulky side chain is produced on the interface of secondary antibody molecule.This provides the mechanism that heterodimer yield is improved than other undesired end-products such as homodimer.

Bispecific antibody includes crosslinking or " Heteroconjugate " antibody.For example, a kind of antibody in Heteroconjugate thing can be coupled with avidin, another antibody is coupled with biotin.For example, this antibody-like by immune system cell it has been proposed that for targetting undesired cell (United States Patent (USP) No.4,676,980), and for treating HIV (WO 91/00360, WO 92/00373 and EP03089).Any easily cross-linking method can be used to prepare Heteroconjugate antibodies.Suitable crosslinking agent is well-known in the art, and United States Patent (USP) No.4,676,980 are disclosed in together with many crosslinking technologicals.

The technology that bispecific antibody is generated by antibody fragment is also described in document.It is connected chemically to prepare bispecific antibody for example, can be used.Brennan et al., Science 229:81 (1985) are described cuts complete antibody to generate the code of the fragments of F (ab ') 2 by proteolysis.These fragments are reduced in the case where there are two mercaptan complexing agent sodium arsenites, to stablize two neighbouring mercaptan and prevent the formation of intermolecular disulfide bond.Then Fab ' the fragments of generation are changed into thionitrobenzoate ester (TNB) derivative.Then one of Fab '-TNB derivatives are reverted into Fab '-mercaptan by the reduction of mercaptoethylmaine again, and mixed with another Fab '-TNB derivatives of equimolar amounts, to form bispecific antibody.The bispecific antibody of generation can be used as the selective immobilized reagent of enzyme.

Most new progress is easy to directly reclaim Fab '-SH fragments from Escherichia coli, and these fragments are chemically coupled to form bispecific antibody.Shalaby et al., J.Exp.Med.175:217-225 (1992) describes the generation of bispecific antibody F (ab ') 2 molecule of full-length human.Every kind of Fab ' fragments are separately secreted by Escherichia coli, and are oriented chemical coupling in vitro to form bispecific antibody.The bispecific antibody being thusly-formed can combine cell and the normal human T cells for being overexpressed HER2 acceptors, and triggering people's cell Cytotoxic Lymphocytes for the dissolving activity of people's lacteal tumor target.

Also describe the multiple technologies for directly generating and separating bispecific antibody fragment from recombinant cell culture thing.For example, generating bispecific antibody using leucine zipper.Kostelny et al., J.Immunol.148 (5):1547-1553(1992).Leucine zipper peptide from Fos and Jun albumen is connected by Gene Fusion with the Fab ' parts of two kinds of different antibodies.Antibody homodimer is reduced to form monomer in hinge area, then reoxidized to form antibody heterodimer.This method can also be used for generating antibody homodimer.Hollinger et al., Proc.Natl.Acad.Sci.USA 90:" double antibody " technology that 6444-6448 (1993) is recorded provides the replacement mechanism for building bispecific antibody fragment.The fragment is included can not match between the heavy chain variable domain (VH) and light-chain variable domain (VL) being connected by joint, too short two domains caused on same chain of the joint.Therefore, force VH the and VL domains in a fragment to be matched with the complementary VL and VH domains in another fragment, be consequently formed two antigen binding sites.It is also reported that building another strategy of bispecific antibody fragment by using scFv (sFv) dimer.Referring to Gruber et al., J.Immunol.152:5368(1994).

Contemplate the antibody with more than two potency.For example, three-specific antibody can be prepared.Tutt etal., J.Immunol.147:60(1991).

Multivalent antibody

Multivalent antibody can the internalization (and/or alienation) by the cell for expressing the antibody combination antigen more faster than bivalent antibody.The present invention antibody can be readily can be generated by the recombination expression of the nucleic acid of encoding antibody polypeptide chain, the multivalent antibody with three or more antigen binding sites (such as tetravalent antibody) (beyond IgM classifications).Multivalent antibody can include dimerization domain and three or more antigen binding sites.Dimerization domain includes (or being made from it) such as Fc areas or hinge area.In this case, antibody is by three or more antigen binding sites comprising Fc areas and Fc areas amino terminal.In one embodiment, multivalent antibody includes (or being made from it) such as three to about eight, or four antigen binding sites.Multivalent antibody includes at least one polypeptide chain (such as two polypeptide chains), wherein the polypeptide chain includes two or more variable domains.For example, polypeptide chain can be the first variable domain comprising VD1- (X1) n-VD2- (X2) n-Fc, wherein VD1, VD2 is the second variable domain, and Fc is a polypeptide chain in Fc areas, X1 and X2 represented amino acids or polypeptide, and n is 0 or 1.For example, polypeptide chain can be included:VH-CH1- flexible joint-VH-CH1-Fc areas chain；Or VH-CH1-VH-CH1-Fc areas chain.Multivalent antibody herein can further include at least two (such as four) light chain variable domain polypeptides.Multivalent antibody herein can include e.g., from about two to about eight light chain variable domain polypeptides.The light chain variable domain polypeptide contemplated herein includes light-chain variable domain, and optionally further includes CL domains.

Antibody variants

In some embodiments, it is contemplated to the amino acid sequence modifications of antibody described herein.For example, it may be desirable to improve the binding affinity and/or other biological characteristicses of antibody.The amino acid sequence variation of antibody is by the way that suitable nucleotides change is introduced into antibody nucleic acids or prepared by peptide symthesis.The residue that such modification is included in such as antibody amino acids sequence is deleted and/or insertion and/or replacement.Any deletion, insertion and alternative combinations can be carried out to obtain final construction, if final construction has desired feature.Can be when preparing sequence by amino acid change introducing theme antibody amino acids sequence.

Available for as some residues of preferred mutagenesis position or the method in region having " alanine scanning mutagenesis " in identification antibody, such as Cunningham and Wells, Science 244:Described in 1081-1085 (1989).Here, identify a residue or one group of target residue (such as electrically charged residue, such as arginine, aspartic acid, histidine, lysine and glutamic acid) and substituted with neutral or negatively charged amino acid (such as alanine or Polyalanine), to influence the interaction of amino acid and antigen.Then by introducing more or other variants or to alternate site, the amino acid position that function sensitive is shown to substituting is weighed.Thus, although the site for introducing variant amino acid sequence is pre-determined, but the essence of mutation itself need not be predetermined.For example, in order to analyze the consequence being mutated at specified site, carrying out Alanine-scanning or random mutagenesis in target codon or region, and desired activity is screened to expressed immunoglobulin.

Amino acid sequence insertion includes the fusion of amino and/or carboxyl terminal, and length range is inserted in a residue to the polypeptide for including residues up to a hundred or more, and the sequence of single or multiple amino acid residues.The example of end insertion includes the antibody with N-terminal methionyl residue or the antibody merged with cytotoxic polypeptide.Other insertion variants of antibody molecule are included the N or C-terminal of antibody and enzyme (as being used for ADEPT) or the peptide fusion of extension antibody serum half-life period.

Another kind of variant is amino acid substitution variant.These variants have at least one amino acid residue to be substituted with different residues in antibody molecule.The most interesting site for substitute mutagenesis includes hypervariable region, but also contemplates FR changes.Column " is preferably substituted " in Table A and shows conservative replacement.If such replacement causes biological activity to change, then can import in Table A and be referred to as the more substantial variations of " illustrate substitute ", or referring below to Amino Acid Classification it is further described that and screening product.

Table A

 

Original Residue	Illustrate and substitute	It is preferred that substituting
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Asp, Lys；Arg	Gln
Asp(D)	Glu；Asn	Glu
			Cys(C)	Ser；Ala	Ser
Gln(Q)	Asn；Glu	Asn
			Glu(E)	Asp；Gln	Asp
Gly(G)	Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe；Nor-leucine	Leu
			Leu(L)	Nor-leucine；Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Trp；Leu；Val；Ile；Ala；Tyr	Tyr
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Val；Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala；Nor-leucine	Leu

Can be by selecting to realize to maintaining the difference on effect of following aspect significantly to substitute to the substantive sex modification of antibody biological characteristics:(a) in replacement area polypeptide backbone structure, for example (fold) piece or helical conformation, the electric charge or hydrophobicity of (b) target site punishment, or (c) side chain volume.According to the similitude of its side chain properties, amino acid can be grouped as follows (A.L.Lehninger,《Biochemistry》, second edition, the 73-75 pages, Worth Publishers, New York, 1975):

(1) it is nonpolar:Ala(A)、Val(V)、Leu(L)、Ile(I)、Pro(P)、Phe(F)、Trp(W)、Met(M)

(2) neutral, polarity:Gly(G)、Ser(S)、Thr(T)、Cys(C)、Tyr(Y)、Asn(N)、Gln(Q)

(3) it is acid:Asp(D)、Glu(E)

(4) it is alkaline:Lys(K)、Arg(R)、His(H)

Or, according to common side chain properties, natural generation residue can be grouped as follows:

(1) it is hydrophobic:Nor-leucine, Met, Ala, Val, Leu, Ile；

(2) it is neutral, hydrophilic:Cys、Ser、Thr、Asn、Gln；

(3) it is acid:Asp、Glu；

(4) it is alkaline:His、Lys、Arg；

(5) residue of chain orientation is influenceed:Gly、Pro；

(6) it is aromatic:Trp、Tyr、Phe.

Non-conservative replacement needs to replace another classification with the member of one of these classifications.Such replacement residue can also be introduced to conservative substitution sites, or introduce remaining (non-conservative) site.

One class alternative variations involve the one or more some hypervariable region residues for substituting parental antibody (such as humanization or human antibody).The biological characteristics for changing (such as improve) will be had by being typically chosen for the gained variant further developed relative to their parental antibody is produced.Involve the affinity maturation of use phage display for generating a kind of facilitated method of such alternative variations.In brief, several hypervariable region sites (such as 6-7 site) are mutated, all possible amino acid replacement is produced in each site.The antibody display so generated is used as the fusions of at least part bacteriophage coat protein (such as M13 gene III products) with each particle inner packing on filamentous phage particle.Then its biological activity (such as binding affinity) is screened to the variant of phage display as disclosed herein.In order to identify the candidate hypervariable region site for modification, (such as Alanine-scanning) mutagenesis can be scanned to identify some hypervariable region residues that there is antigen binding significant contribution.Or the crystal structure of analysis antigen-antibody complex is probably beneficial with the contact point identified between antibody and antigen.The contact residues and neighbouring residue are the candidate locus substituted according to techniques known in the art (including technology detailed in this article).Once producing such variant, this group of variant is screened using techniques known in the art (including the techniques described herein), the antibody with good characteristic in one or more relevant assays, which may be selected, to be used to further develop.

It is prepared by a variety of methods that the nucleic acid molecules of encoding antibody amino acid sequence variation can be known by this area.These methods include but is not limited to from natural origin separation (in the case of naturally occurring amino acid sequence variation), or carry out oligonucleotide mediated (or fixed point) mutagenesis, PCR mutagenesis and cassette mutagenesis to prepare by the antibody to the relatively early variant prepared or unmanifest pattern.

It may want to introduce one or more in the Fc areas of antibody of the present invention amino acid modified, thus generate Fc region variants.Fc region variants may include the people Fc region sequences (such as human IgG1, IgG2, IgG3 or IgG4Fc area) for including amino acid modified (as substituted) in one or more amino acid positions (including hinge cysteine).

According to this description and the teaching of this area, it is contemplated in some embodiments, antibody of the invention can include one or more changes compared with wild type correspondence antibody in such as Fc areas.Compared with their wild type counterparts, these antibody will substantially retain the identical characteristic required for therapeutic efficiency.For example, it is believed that carry out that some changes that Clq is combined and/or complement-dependent cytotoxicity (CDC) changes and (strengthens or weaken) will be caused in Ke Fc areas, such as described in WO99/51642.Referring also to Duncan the and Winter, Nature 322 of the concern other examples of Fc region variants:738-40(1988)；United States Patent (USP) 5,648,260；United States Patent (USP) 5,624,821；And WO94/29351.

On the one hand, the invention provides the antibody that modification is included in the interface of Fc polypeptides in Fc areas is constituted, wherein Heterodimerization is easy to and/or promoted in the modification.These modifications, which are included in the first Fc polypeptides, introduces protuberance (protuberance), and hole (cavity) is introduced in the 2nd Fc polypeptides, wherein the protuberance can be located in the hole, so as to promote the compound of the first and second Fc polypeptides.Method for generating the antibody with these modifications is described in known in the art, such as United States Patent (USP) No.5,731,168.

Immune conjugate

On the one hand, the invention provides the immune conjugate or antibody-drug conjugates (ADC) for the antibody for having cytotoxic agent comprising coupling, the cytotoxic agent such as chemotherapeutics, medicine, growth inhibitor, toxin (such as bacterium, fungi, plant or the enzyme activity toxin of animal origin or its fragment) or radio isotope (radiating conjugate).

Antibody-drug conjugates are used for the agent of topical delivery Cytotoxic in treatment of cancer or suppress purposes (Syrigos and Epenetos, the Anticancer Research 19 of cell reagent (medicine i.e. for killing or suppressing tumour cell):605-614(1999)；Niculescu-Duvaz and Springer, Adv.Drg.Del.Rev.26:151-172(1997)；United States Patent (USP) 4,975,278) allow drug moiety targeting Delivery to tumour, and intracellular accumulation is carried out there, and systemic application these pharmaceutical agents without coupling may cause unacceptable toxic level (Baldwin et al., the Lancet 603-05 (on May 15th, 1986) to normal cell beyond the tumour cell that attempting to eliminate；Thorpe, " Antibody CarriersOf Cytotoxic Agents In Cancer Therapy:A Review ",《Monoclonal Antibodies′84:Biological And Clinical Applications》In, A.Pinchera et al. is compiled, the 475-506 pages, 1985).Thus attempt to obtain maximum effect and minimum toxicity.Polyclonal antibody and monoclonal antibody are all had been reported that available for these strategies (Rowland et al., Cancer Immunol.Immunother.21:183-87(1986)).Medicine used in these methods includes daunomycin (daunomycin), Doxorubicin (doxorubicin), methotrexate (MTX) (methotrexate) and eldisine (vindesine) (Rowland etal., 1986, see above).Toxin used in Antibody-toxin conjugate includes bacteriotoxin such as diphtheria toxin, phytotoxin such as ricin, small molecule toxins such as geldanamycin (geldanamycin) (Mandler et al., Jour.of the Nat.Cancer Inst.92 (19):1573-1581(2000)；Mandler et al., Bioorganic ＆ Med.Chem.Letters 10:1025-1028(2000)；Mandler et al., Bioconjugate Chem.13:786-791 (2002)), maytansinoids (EP1391213；Liu et al., Proc.Natl.Acad.Sci.USA 93:8618-8623 (1996)) and Calicheamicin (Lode et al., Cancer Res.58:2928(1998)；Hinman et al., CancerRes.53:3336-3342(1993)).Toxin can pass through its Cytotoxic of mechanisms play and the effect of suppression cell including tubulin binding, DNA combinations or topoisomerase enzyme level.Some cell toxicity medicaments tend to inactivation or activity when with big antibody or protein receptor ligand coupling to be reduced.

(ibritumomab tiuxetan, Biogen/Idec) it is the antibody-radioisotope element conjugate (Wiseman the et al., Eur.Jour.Nucl.Med.27 (7) that are made up of the mouse IgG1 κ monoclonal antibodies and 111In the or 90Y radio isotopes that are combined by thiourea linker-chelator of the CD20 antigens for being found on normal and malignant B surface:766-77(2000)；Wiseman et al., Blood 99 (12):4336-42(2002)；Witzig et al., J.Clin.Oncol.20 (10):2453-63(2002)；Witzig et al., J.Clin.Oncol.20 (15):3262-69(2002)).Although ZEVALIN has the activity for B cell non-Hodgkin's (Hodgkin) lymthoma (NHL), but dispenser causes serious and prolonged haemocyte to reduce in Most patients.MYLOTARG^TM(gemtuzumabozogamicin, Wyeth Pharmaceuticals), the antibody-drug conjugates for being connected and being constituted with Calicheamicin by people's CD33 antibody, ratified to be used for through injection treatment acute myelogenous leukemia (Drugs of the Future 25 (7) in 2000:686(2000)；United States Patent (USP) 4970198；5079233；5585089；5606040；5693762；5739116；5767285；5773001).Cantuzumabmertansine (Immunogen Inc.), the antibody-drug conjugates for being connected and being constituted with maytansinoid drugs part DM1 through disulfde linker SPP by huC242 antibody, cancer such as colon cancer, cancer of pancreas, stomach cancer and the other cancers for treating expression CanAg are used in test.MLN-2704 (Millennium Pharm., BZL Biologics, Immunogen Inc.), the antibody-drug conjugates for being connected and being constituted with maytansinoid drugs part DM1 by anti-prostatic specific membrane antigen (PSMA) monoclonal antibody, are used for the potential treatment of tumor of prostate in test.By the synthetic analogues auristatin peptides, auristatin E (AE) and monomethyl auristatin (MMAE) of dolastatin (dolastatin) and chimeric mAb cBR96 (special to the Lewis Y in cancer) and cAC10 coupling (Doronina et al., Nature Biotechnology 21 (7) (special to the CD30 on Hematological malignancies):778-784 (2003)), and carrying out therapeutic exploitation.

Describe (above) available for the chemotherapeutics for generating immune conjugate herein.Workable enzyme activity toxin and its fragment include diphtheria toxin A chains, the nonbinding active fragments of diphtheria toxin, exotoxin A chain (comes from pseudomonas aeruginosa Pseudomonas aeruginosa), ricin (ricin) A chains, abrin (abrin) A chains, capsule lotus root toxalbumin (modeccin) A chains, α-broom aspergillin (sarcin), tung oil tree (Aleutites fordii) toxalbumin, carnation (dianthin) toxalbumin, dyers' grapes (Phytolacaamericana) toxalbumin (PAPI, PAPII and PAP-S), balsam pear (Momordica charantia) mortifier, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonaria officinalis) mortifier, gelonin (gelonin), morphine (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).See, for example, WO 93/21232 disclosed in 28 days October in 1993.A variety of radionuclides can be used for generation radiation coupled antibody.Example includes 212Bi, 131I, 131In, 90Y and 186Re.A variety of bifunctional protein coupling agents can be used to prepare for the conjugate of antibody and cytotoxic agent, such as N- succinimides base -3- (2- pyridine radicals two is thio) propionic ester (SPDP), iminothiolane (IT), imino-ester (such as hydrochloric acid adipyl imido dimethyl phthalate), active esters (such as succinimide base ester of suberic acid two), aldehydes (such as glutaraldehyde), double azido compound (such as double (p- azido benzoyl base) hexamethylene diamines), dual azepine derivatives (such as double (p- diazoniumbenzoyl) hexamethylene diamines), diisocyanate (such as toluene 2, 6- diisocyanate), with double activated fluorine compounds (such as 1, 5- bis- fluoro- 2, 4- dinitro benzenes) dual-function derivative.For example, can be such as Vitetta et al., Science 238:Ricin immunotoxin is prepared described in 1098 (1987).The 1- isothiocyanic acid benzyl -3- methyl diethylene-triamine pentaacetic acids (MX-DTPA) of carbon-14 mark are for by the exemplary chelating agent of radioactive nucleotides and antibody coupling.Referring to WO 94/11026.

Antibody, which has been contemplated herein, has the conjugate of fragment of neurotoxin active with one or more small molecule toxins such as Calicheamicin (caiicheamicin), maytansinoids (maytansinoids), dolastatin class (dolostatins), aurostatins, trichothecin (trichothecene) and CC1065 and these toxin.

Maytansine and maytansinoids

In some embodiments, immune conjugate has the antibody of the present invention of one or more maytansinoid molecules comprising coupling.

Maytansinoids are the mitotic inhibitors played a role by suppressing tubulin polymerization.Maytansine is initially isolated (United States Patent (USP) 3,896,111) from East Africa shrub tingia Caulis Mayteni (Maytenus serrata).It is subsequently found certain micro-organisms and also generates maytansinoids, such as maytansinol and C-3 maytansinols ester (United States Patent (USP) 4,151,042).Such as following U.S. Patent Publication synthesis maytansinol and its derivative and analog:4,137,230；4,248,870；4,256,746；4,260,608；4,265,814；4,294,757；4,307,016；4,308,268；4,308,269；4,309,428；4,313,946；4,315,929；4,317,821；4,322,348；4,331,598；4,361,650；4,364,866；4,424,219；4,450,254；4,362,663；And 4,371,533.

Maytansinoids drug moiety is attractive drug moiety in antibody drug conjugates, because they:(i) it is relatively easy to prepare by fermentation or the chemical modification of tunning, derivatization；(ii) it is easy to use the functional group's derivatization for being suitable to the coupling by non-disulfde linker；(iii) it is stable in blood plasma；And (iv) is effectively directed to kinds of tumor cells system.

The exemplary embodiment of maytansinoids drug moiety includes DM1, DM3 and DM4.Such as following patent discloses immune conjugate comprising maytansinoids and preparation method thereof and therapeutical uses:United States Patent (USP) 5,208,020；5,416,064；And the B1 of European patent EP 0 425 235, clearly the disclosure of which is collected herein by reference.Liu et al., Proc.Natl.Acad.Sci.USA 93:8618-8623 (1996) describes the immune conjugate for including the maytansinoid for being referred to as DM1 being connected with the monoclonal antibody C242 for human colorectal cancer.It was found that the conjugate has the high cell toxicity of the colon cancer cell for culture, and show antitumor activity in tumour growth measurement method in vivo.Chari et al., Cancer Research 52:127-131 (1992) describes wherein maytansinoid through disulfde linker and the immune conjugate for combining another mouse monoclonal antibody TA.1 couplings of the mouse antibody A 7 of antigen or combination HER-2/neu oncogenes in human colon cancer cell line.The cytotoxicity of TA.1- maytansinoid conjugates, each cell expression 3 x, the 105 HER-2 surface antigens of the cell line are tested on human breast cancer cell system SK-BR-3 in vitro.Drug conjugates have reached a certain degree of cytotoxicity similar to free maytansinoid drugs, and this can be improved by increasing the maytansinoid molecule amount of each antibody molecule coupling.A7- maytansinoid conjugates show low systemic cellular toxicity in mouse.

Antibody can be by being connected and not significantly attenuating antibody or prepared by the biological activity of maytansinoid molecule by antibody-maytansinoid conjugate with maytansinoid molecular chemistry.See, for example, United States Patent (USP) No.5,208,020, clearly the disclosure of which is collected herein by reference.Each average 3-4 maytansinoid molecule of antibody molecule coupling shows effect in the cytotoxicity that enhancing is directed to target cell, and the function or solubility of antibody are had no adverse effect, although it is expected that toxin/antibody of even one molecule also will strengthen cytotoxicity than the use of exposed antibody.Maytansinoids are well known in the art, and can be synthesized or be separated from natural origin by known technology.For example in United States Patent (USP) 5,208,020 and other patents mentioned above and non-Patent Publication thing disclose suitable maytansinoids.Maytansinoids include but is not limited to the maytansinol analog of the aromatic rings or other positions of maytansinol and maytansinol molecule by modification, such as various maytansinol esters.

Know that many linking groups can be used for preparing antibody-maytansinoid conjugate, including such as United States Patent (USP) 5,208,020 or the B1 of European patent 0 425 235 in this area；Chari et al., CancerResearch 52:127-131(1992)；The disclosure of which, disclosed in 602, is clearly collected herein by reference by the U.S. Patent application No.10/960 that on October 9th, 2004 submits.Antibody comprising joint member SMCC-maytansinoids conjugate can as disclosed in U.S. Patent application No.10/960,602 that on October 8th, 2004 submits prepare.Linking group includes disulphide group, sulfide group, acid-unstable group, photo-labile group, the unstable group of peptase or the unstable group of esterase, as mentioned previously disclosed in patent.It is described herein and exemplified with other linking group.

A variety of bifunctional protein coupling agents can be used to prepare the conjugate of antibody and maytansinoid, such as N- succinimides base -3- (2- pyridine radicals two is thio) propionic ester (SPDP), succinimide base -4- (N- Maleimidomethyls) hexamethylene -1- carboxylates (SMCC), iminothiolane (IT), imino-ester (such as hydrochloric acid adipyl imido dimethyl phthalate), active esters (such as succinimide base ester of suberic acid two), aldehydes (such as glutaraldehyde), double azido compound (such as double (p- azido benzoyl base) hexamethylene diamines), dual azepine derivatives (such as double (p- diazoniumbenzoyl)-ethylenediamines), diisocyanate (such as toluene 2, 6- diisocyanate), with double activated fluorine compounds (such as 1, 5- bis- fluoro- 2, 4- dinitro benzenes) dual-function derivative.Coupling agent includes but is not limited to N- succinimide bases -3- (2- pyridine radicals two is thio) propionic ester (SPDP) (Carlsson et al., Biochem.J.173:723-737 (1978)) and N- succinimide bases -4- (2- pyridylthios) valerate (SPP), thus disulfide bond is provided.

According to the type of connection, joint can be attached to multiple positions of maytansinoid molecule.For example, conventional coupling techniques can be used to pass through the reaction with hydroxyl to form ester bond.Reaction can occur in the C-3 positions with hydroxyl, C-14 positions, the C-15 positions through hydroxyl modified and the C-20 positions with hydroxyl modified through methylol.In one embodiment, key connection is formed in the C-3 positions of maytansinol or maytansinol analog.

Auristatin and dolastatin

In some embodiments, immune conjugate includes antibody of the present invention (the United States Patent (USP) No.5,635,483 with dolastatin class (dolastatins) or dolastatin peptide analogues and derivative, the coupling of auristatin classes；5,780,588).Dolastatin class and auristatin classes have shown that interference microtubule dynamics, GTP hydrolysis and core and cell division (Woyke et al (2001) Antimicrob.Agents andChemother.45 (12):3580-3584) and with anticancer (US 5,663,149) and antifungal activity (Pettitet al (1998) Antimicrob.Agents Chemother.42:2961-2965).Dolastatin or auristatin drug moieties can be attached to antibody (WO 02/088172) via N (amino) ends or C (carboxyl) end of peptide medicine module.

Exemplary auristatin embodiments include monomethyl auristatin the drug moieties DE and DF that N- ends are connected, it is disclosed in " Monomethylvaline Compounds Capable of Conjugation toLigands ", U.S.Ser.No.10/983,340, filed Nov.5,2004, clearly the disclosure of which is completely collected herein by reference.

Exemplary auristatin embodiments include MMAE and MMAF.Other exemplary embodiment comprising MMAE or MMAF and various terminal component (described further herein) includes Ab-MC-vc-PAB-MMAF, Ab-MC-vc-PAB-MMAE, Ab-MC-MMAE and Ab-MC-MMAF.

Typically, the drug moiety based on peptide can be prepared by forming peptide bond between two or more amino acid and/or fragments of peptides.Such peptide bond can be prepared (referring to E. according to such as well-known liquid phase synthesizing method in chemistry of peptides field

And K.L ü ibke, The Peptides, volume 1, pp 76-136,1965, Academic Press).Auristatin/ dolastatins drug moiety can be prepared according to the method in documents below:US 5,635,483；US 5,780,588；Pettit et al(1989)J.Am.Chem.Soc.111:5463-5465；Pettit et al(1998)Anti-Cancer Drug Design 13:243-277；Pettit, GR., et al.Synthesis, 1996,719-725；Pettit et al(1996)J.Chem.Soc.PerkinTrans.1 5:859-863；And Doronina (2003) Nat Biotechnol 21 (7):778-784；" Monomethylvaline Compounds Capable of Conjugation to Ligands ", U.S. Serial No.10/983,340, on November 5th, 2004 submit, it is completely collected herein by reference (disclose for example prepare such as MMAE and MMAF be coupled to joint monomethyl valine compound joint and method).

Calicheamicin

In other embodiments, immune conjugate has the antibody of the present invention of one or more calicheamicin molecules comprising coupling.Calicheamicin antibiotic family can generate double-strand DNA cleavage in sub- picomolar concentrations.Preparation on Calicheamicin family conjugate is referring to United States Patent (USP) 5,712,374；5,714,586；5,739,116；5,767,285；5,770,701；5,770,710；5,773,001；With 5,877,296 (all authorizing Cyanamid companies of the U.S.).Available Calicheamicin analogue includes but is not limited to γ 1I, α 2I, α 3I, N- acetyl group-γ 1I, PSAG and θ I1 (Hinman et al., Cancer Research 53:3336-3342(1993)；Lode et al., Cancer Research 58:2925-2928(1998)；And the above-mentioned United States Patent (USP) for authorizing Cyanamid companies of the U.S.).Can be QFA with another antineoplastic of antibody coupling, it is a kind of antifolic thing.Calicheamicin and QFA have intracellular action site, and are difficult through plasma membrane.Therefore, these reagents greatly strengthen their cytotoxic effect via the cellular uptake of antibody-mediated internalization.

Other cytotoxic agents

BCNU, streptozotocin (streptozoicin), vincristine (vincristine), 5 FU 5 fluorouracil, United States Patent (USP) 5 can be included with other antitumor agents of antibody coupling of the present invention, 053,394th, 5,770, the reagent family for being referred to as LL-E33288 compounds and ai sibo mycin class (esperamicins) (United States Patent (USP) 5 described in 710,877,296).

Available enzyme activity toxin and its fragment include diphtheria toxin A chains, the nonbinding active fragments of diphtheria toxin, exotoxin A chain (comes from pseudomonas aeruginosa Pseudomonas aeruginosa), ricin (ricin) A chains, abrin (abrin) A chains, capsule lotus root toxalbumin (modeccin) A chains, α-broom aspergillin (sarcin), tung oil tree (Aleutites fordii) toxalbumin, carnation (dianthin) toxalbumin, dyers' grapes (Phytolaca americana) toxalbumin (PAPI, PAPII and PAP-S), balsam pear (Momordicacharantia) mortifier, curcin (curcin), crotin (crotin), Saponaria officinalis (sapaonaria officinalis) mortifier, gelonin (gelonin), morphine (mitogellin), restrictocin (restrictocin), phenomycin (phenomycin), enomycin (enomycin) and trichothecin (trichothecenes).The WO 93/21232 announced see, for example, on October 28th, 1993.

Present invention further contemplates antibody and with nucleolysis active compound (such as ribalgilase or DNA endonucleases, such as deoxyribonuclease；DNA enzymatic) between the immune conjugate that is formed.

For selective destruction tumour, antibody can include high radioactive atom.A variety of radio isotopes can be used for generation radiation coupled antibody.Example includes At²¹¹、I¹³¹、I¹²⁵、Y⁹⁰、Re¹⁸⁶、Re¹⁸⁸、Sm¹⁵³、Bi²¹²、P³²、Pb²¹²With Lu radio isotope.When conjugate to be used to detect, it can be studied comprising radioactive atom for scitiphotograph, such as Tc^99mOr I¹²³, or being used for nuclear magnetic resonance (NMR) comprising spin label is imaged (also referred to as magnetic resonance imaging, MRI), such as iodo- 123, iodine -131, indium -111, fluoro- 19, carbon -13, nitrogen -15, oxygen -17, gadolinium, manganese or iron.

Radioactivity or other labels can be mixed into conjugate in a known way.For example, can biosynthesis peptide, or by chemical amino acid synthetic method synthetic peptide, involve for example fluoro- 19 suitable amino group acid precursors for replacing hydrogen wherein using.Label, such as Tc can be adhered to through the cysteine residues in peptide^99mOr I¹²³、Re¹⁸⁶、Re¹⁸⁸And In¹¹¹.Yttrium-90 can be adhered to through lysine residue.IODOGEN methods (Fraker etal. (1978) Biochem.Biophys.Res.Commun.80:It 49-57) can be used for mixing iodo- 123.《Monoclonal Antibodies in Immunoscintigraphy》(Chatal, CRC Press, 1989) describes other methods in detail.

A variety of bifunctional protein coupling agents can be used to prepare the conjugate of antibody and cytotoxic agent, such as N- succinimides base -3- (2- pyridine radicals two is thio) propionic ester (SPDP), succinimide base -4- (N- Maleimidomethyls) hexamethylene -1- carboxylates (SMCC), iminothiolane (IT), imino-ester (such as hydrochloric acid adipyl imido dimethyl phthalate), active esters (such as succinimide base ester of suberic acid two), aldehydes (such as glutaraldehyde), double azido compound (such as double (p- azido benzoyl base) hexamethylene diamines), dual azepine derivatives (such as double (p- diazoniumbenzoyl)-ethylenediamines), diisothio-cyanate (such as toluene 2, 6- diisocyanate), with double activated fluorine compounds (such as 1, 5- bis- fluoro- 2, 4- dinitro benzenes) dual-function derivative.For example, can be such as Vitetta et al., Science 238:Ricin immunotoxin is prepared described in 1098 (1987).The 1- isothiocyanic acid benzyl -3- methyl diethylene-triamine pentaacetic acids (MX-DTPA) of carbon-14 mark are for by the exemplary chelating agent of radioactive nucleotides and antibody coupling.Referring to WO94/11026.Joint can be easy for discharging " the cleavable joint " of cell toxicity medicament in cell.For example, sour unstable joint, peptidase-sensitive linker, photo-labile joint, dimethyl linker or containing disulfde linker (Chari et al., Cancer Research 52 can be used:127-131(1992)；United States Patent (USP) 5,208,020).

The compound of the present invention clearly covers but is not limited to the ADC prepared with following crosslinking agent:Commercialization is (as being purchased from Pierce Biotechnology Inc., Rockford, IL, U.S.A.) BMPS, EMCS, GMBS, HBVS, LC-SMCC, MBS, MPBH, SBAP, SIA, SIAB, SMCC, SMPB, SMPH, sulfo-EMCS, sulfo-GMBS, sulfo-KMUS, sulfo-MBS, sulfo-SIAB, sulfo-SMCC and sulfo-SMPB and SVSB (succinimido-(4- vinyl sulfones) benzoic ether).See the 467-498 pages of the annual application manuals of 2003-2004 and catalogue (ApplicationsHandbook and Catalog).

The preparation of antibody-drug conjugates

In the antibody-drug conjugates (ADC) of the present invention, antibody (Ab) is conjugated through joint (L) and one or more drug moieties (D), such as each about 1 to about 20 drug moiety of antibody coupling.Can using those skilled in the art will know that organic chemical reactionses, condition and reagent formula I ADC is prepared by several paths, including:(1) nucleophilic group of antibody forms Ab-L through covalent bond and bivalent linker reagent reacting, is then reacted with drug moiety D；(2) nucleophilic group of drug moiety forms D-L through covalent bond and bivalent linker reagent reacting, and then the nucleophilic group with antibody reacts.There is described herein the method for distinguishing for preparing ADC.

Ab-(L-D)_p             I

Joint can be made up of one or more joint members.Exemplary joint member includes 6- maleimidocaproyls (＂ MC ＂), maleimide propiono (＂ MP ＂), valine-citrulline (＂ val-cit ＂), alanine-phenylalanine (＂ ala-phe ＂), to aminobenzyloxycarbonyl (＂ PAB ＂), 4- (2- pyridylthios) valeric acid N- succinimides base ester (＂ SPP ＂), 4- (N- maleimidomehyls) carboxylic acid N- succinimides base ester of hexamethylene -1 (＂ SMCC '), (the iodo- acetyl group of 4-) aminobenzoic acid N- succinimides base ester (＂ SIAB ＂).Other joint member is known in this area, and some have been also described herein.Referring also to " Monomethylvaline Compounds Capable of Conjugation to Ligands " are submitted, its complete content is collected herein by reference U.S. Serial No.10/983, on November 5th, 340,2004.

In some embodiments, joint can include amino acid residue.Exemplary Amino acid linker component includes dipeptides, tripeptides, tetrapeptide or pentapeptide.Exemplary dipeptides includes:Valine-citrulline (vc or val-cit), alanine-phenylalanine (af or ala-phe).Exemplary tripeptides includes:Glycine-valine-citrulline (gly-val-cit) and Gly-Gly-Gly (gly-gly-gly).Constituting the amino acid residue of Amino acid linker component includes those naturally occurring amino acid, and secondary amino acid and non-naturally occurring amino acid analogue, such as citrulling.Amino acid linker component can be designed and optimize in terms of the selectivity of the enzymatic cutting of their certain enzyme (such as tumor correlated albumen enzyme, cathepsin B, C and D, or fibrinolytic enzyme enzyme).

Exemplary joint member structure is shown (wherein wave indicates covalent attachment to the site of the other components of ADC) as follows:

Other exemplary joint member and abbreviation include (wherein depicting antibody (Ab) and joint, and p is 1 to about 8):

The nucleophilic group of antibody includes but is not limited to:(i) N-terminal amino；(ii) side-chain amino group, such as lysine；(iii) side chain thiol, such as cysteine；Sugared hydroxyl or amino in (iv) glycosylated antibodies.Amino, sulfydryl and hydroxyl are nucleophilics, can be reacted with the electrophilic group on junction portion and form covalent bond, and linker reagents include:(i) active esters, such as NHS esters, HOBt esters, haloformate and acid halide；(ii) alkyl and benzyl halide, such as Haloacetamide；(iii) aldehydes, ketone, carboxyl and maleimide base group.Some antibody have reducible interchain disulfide bond, i.e. cysteine bridge.Can be handled by reducing agent such as DTT (dithiothreitol (DTT)) makes antibody have the reactivity being conjugated with linker reagents.Each cysteine bridge will form two reactive nucleophilic thiol bodies in theory.Can via lysine and 2- iminothiolanes (TrautShi reagents) reaction, cause amine to be changed into mercaptan, so that extra nucleophilic group is introduced into antibody.Can by import one, two, three, four, or more cysteine residues (for example preparing the Mutant Antibodies for including one or more non-natural cysteine aminos) and reactive mercapto is imported into antibody (or its fragment).

The antibody-drug conjugates of the present invention can be also generated by modified antibodies, that is, introduce the electrophilic subdivision that can be reacted with the nucleophilic displacement of fluorine base on linker reagents or medicine.The sugar of such as periodate oxidation agent oxidative glycosylation antibody can be used, so as to form the aldehydes or ketones group that can be reacted with the amine groups of linker reagents or drug moiety.Gained imines Schiff base can form stable key, or available such as borohydride reagent reduces and forms stable amine connection.In one embodiment, the reaction of the carbohydrate portions of glycosylated antibodies and galactose oxidase or sodium metaperiodate can generate carbonyl (aldehyde and ketone) group in protein, it can react (Hermanson, BioconjugateTechniques) with the suitable groups on medicine.In another embodiment, the protein comprising N-terminal serine or threonine residues can react with sodium metaperiodate, cause to generate aldehyde (Geoghegan ＆ Stroh, Bioconjugate Chem.3 at first amino acid:138-146(1992)；US 5362852).Such aldehyde can be with drug moiety or joint nucleophilic precursor reactant.

Equally, the nucleophilic group on drug moiety includes but is not limited to:Amine, mercaptan, hydroxyl, hydrazides, oxime, hydrazine, thiosemicarbazones, hydrazinecarboxylate and aryl hydrazide group, they can react with the electrophilic group on junction portion and form covalent bond, and linker reagents include:(i) active esters, such as NHS esters, HOBt esters, haloformate and acid halide；(ii) alkyl and benzyl halide, such as Haloacetamide；(iii) aldehydes, ketone, carboxyl and maleimide base group.

Or, the fusion protein comprising antibody and cytotoxic agent can be prepared for example, by recombinant technique or peptide symthesis.DNA length can include the region of each two parts of own coding conjugate, abut one another or separated by the region of encoding linker peptide, the joint peptide does not destroy the desired characteristic of conjugate.

In still another embodiment, antibody can be coupled with " acceptor " (such as Streptavidin) to target in advance for tumour, wherein to patient's administration of antibodies-receptor conjugate, then uncombined conjugate is removed in circulation using scavenger, then using " part " (such as avidin) being coupled with cytotoxic agent (such as radioactive nucleotides).

Antibody (Ab)-MC-MMAE is prepared by being coupled any antibody provided herein with MC-MMAE as follows.500mM Boratexes and 500mM sodium chloride pH8.0 antibody are dissolved in excessive 100mM dithiothreitol (DTT)s (DTT) processing.After 37 DEG C incubate about 30 minutes, buffer solution is changed by the elution on SephadexG25 resins and eluted with the PBS of the DTPA containing 1mM.The antibody concentration reduced by absorbance measurement of the solution at 280nm, and by the absorbance measurement concentrations of mercaptans at the reaction with DTNB (Aldrich, Milwaukee, WI) and 412nm, thus check mercaptan/value for antibody.The antibody for making to be dissolved in the reduction in PBS turns cold on ice.Medicine linker reagents maleimidocaproyl-monomethyl auristatin E (MMAE) the i.e. MC-MMAE for being dissolved in DMSO is diluted to concentration known, and the antibody 2H9 of the reduction added in the PBS of cooling in acetonitrile and water.After about 1 hour, add excessive maleimide reaction is quenched and any unreacted antibody thiol group is covered.Reaction mixture is concentrated by centrifugal ultrafiltration, 2H9-MC-MMAE is purified and desalination by the elution of the G25 resins in PBS, aseptically filtered by 0.2 μm of filter, and is freezed for storage.

Antibody-MC-MMAF can follow the scheme provided to prepare Ab-MC-MMAE and be prepared by using MC-MMAF couplings any antibody provided herein.

Antibody-MC-val-cit-PAB-MMAE can follow the scheme provided to prepare Ab-MC-MMAE and be prepared by using MC-val-cit-PAB-MMAE couplings any antibody provided herein.

Antibody-MC-val-cit-PAB-MMAF can follow the scheme provided to prepare Ab-MC-MMAE and be prepared by using MC-val-cit-PAB-MMAF couplings any antibody provided herein.

As follows antibody-SMCC-DM1 is prepared with SMCC-DM1 by being coupled any antibody provided herein.By the antibody of purifying with 4- (N- maleimidomehyls) hexamethylene -1- carboxylic acid succinimides base ester (SMCC, Pierce Biotechnology, Inc) derivatization to introduce SMCC joints.Specifically, with the 20mg/ml antibody in the SMCC of 7.5 molar equivalents (20mM, in DMSO, 6.7mg/ml) processing 50mM potassium phosphates/50mM sodium chloride/2mM EDTA, pH 6.5.Under argon gas after environment temperature is stirred 2 hours, by Sephadex G25 post filtering of the reaction mixture by using 50mM potassium phosphates/50mM sodium chloride/2mM EDTA, pH6.5 balances.Merge and determine the fraction containing antibody.

Thus prepared antibody-SMCC 50mM potassium phosphates/50mM sodium chloride/2mMEDTA, pH 6.5 are diluted to final concentration about 10mg/ml, and the 10mM solution reactions with DM1 in dimethyl acetamide.Reaction solution is stirred 16.5 hours in environment temperature under argon gas.Then Sephadex G25 solvent resistant columns (1.5 x 4.9cm) filtering coupling reaction mixed liquor balanced by using 1x PBS pH6.5.According to the measurement of the absorbance at 252nm and 280nm, DM1 medicines/antibody ratio (p) can be about 2-5.

As follows Ab-SPP-DM1 is prepared with SPP-DM1 by being coupled any antibody provided herein.By the antibody of purifying with 4- (2- pyridylthios) valeric acid N- succinimide base ester derivatizations to introduce dithiopyridines base.The antibody (376.0mg, 8mg/mL) in 50mM kaliumphosphate buffers (pH 6.5) of the 44.7ml containing NaCl (50mM) and EDTA (1mM) is handled with SPP (5.3 molar equivalents in 2.3ml ethanol).Under argon gas after environment temperature is incubated 90 minutes, by reaction mixture by using 35mM sodium citrates, the Sephadex G25 post gel filtrations of 154mM NaCl and 2mM edta buffers liquid balance.It is then combined with and determines the fraction containing antibody.The degree of modification of antibody is determined as described above.

Antibody-SPP-Py (about 10 μm of releasable 2- thiopyridines groups of ol) is diluted to final concentration about 2.5mg/ml with 35mM sodium citrate buffer solutions pH6.5 above.Then the DM1 (1.7 equivalents, 17 μm of ol) added into antibody-solutions in 3.0mM dimethyl acetamides (DMA is 3%v/v in final reaction mixture).Reaction is allowed to be carried out about 20 hours in environment temperature under argon gas.Reaction solution is loaded onto and uses 35mM sodium citrates, the Sephacryl S300 solvent resistant columns (5.0cm x 90.0cm, 1.77L) that 154mM NaCl, pH 6.5 is balanced.Flow velocity can be about 5.0ml/min, have collected 65 parts of fractions (each 20.0ml).Merge and detect each fraction, can be each about 2-4 DM1 drug moiety of 2H9 antibody wherein determining the number (p ') of the DM1 drug molecules of each antibody molecule connection by measuring the absorbance at 252nm and 280nm.

As follows antibody-BMPEO-DM1 is prepared with BMPEO-DM1 by being coupled any antibody provided herein.BMI reagent BM (PEO) 4 (Pierce Chemical) modified antibodies can be used, unreacted maleimide base group is left on the surface of antibody.This realization that can such as get off, BM (PEO) 4 is dissolved to concentration 10mM in 50% ethanol/water mixed liquor, the solution that antibody is contained with about 1.6mg/ml (10 micromole) concentration in phosphate buffered saline (PBS) is added to 10 times of molar excess, and allow it to react 1 hour to form antibody-linker intermediate, 2H9-BMPEO.By in 30mM citrates pH 6 and 150mM NaCl buffer solutions gel filtration (HiTrap column, Pharmacia) remove excessive BM (PEO) 4.The DM1 of about 10 times of molar excess is dissolved in dimethyl acetamide (DMA) and 2H9-BMPEO intermediates are added to.Also drug moiety reagent can be dissolved using dimethylformamide (DMF).Allow reaction mixture reaction to stay overnight, then gel filtration or dialysed in PBS to remove unreacted DM1.High molecular weight aggregates are removed by gel filtration on the S200 posts in PBS and the 2H9-BMPEO-DM1 of purifying is supplied.

Antibody derivatives

The antibody of the present invention can further be modified with extra non-proteinaceous part that is knowing comprising this area and being easily obtained.In one embodiment, the part suitable for antibody derivatization is water-soluble polymer.The non-limiting examples of water-soluble polymer include but is not limited to polyethylene glycol (PEG), ethylene glycol/propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinylpyrrolidone, poly- 1, 3- dioxolanes, poly- 1, 3, 6- trioxanes, ethene/copolymer-maleic anhydride, polyaminoacid (homopolymer or randomcopolymer), with dextran or poly- (n-VP) polyethylene glycol, propropylene glycol homopolymers, expoxy propane/ethylene oxide copolymer, polyoxyethylated polyols (such as glycerine), polyvinyl alcohol and its mixture.Due to its stability in water, methoxy PEG-propionaldehyde may have advantage in production.Polymer can be any molecular weight, and can be branch or unbranched.The polymer number being attached on antibody can change, and if being attached to more than one polymer, then they can be identical or different molecule.In general, the number and/or type of the polymer for derivatization can be determined according to following consideration, whether the concrete property or function, antibody derivatives of antibody including but not limited to be modified are by for treatment under specified requirements etc..

In another embodiment there is provided antibody with the conjugate exposed to the selective non-proteinaceous module heated of radiation can be passed through.In one embodiment, the non-proteinaceous module is CNT (Kam et al., Proc.Natl.Acad.Sci.102:11600-11605(2005)).Radiation can be any wavelength, include but is not limited to harmless to ordinary cells but non-proteinaceous module is heated into the wavelength close to the killed temperature of cell of antibody-non-proteinaceous module.

Medicinal proportional preparation

The treatment preparaton for including antibody of the present invention can be prepared by the way that the antibody with expectation purity is mixed with optional physiology acceptable carriers, excipient or stabilizer, stored in the form of the aqueous solution, lyophilized or other dry formulations (《Remington′s Pharmaceutical Sciences》, the 16th edition, Osol, A. is compiled, and 1980).Acceptable carrier, excipient or stabilizer are nontoxic to recipient in the dosage and concentration used, and including buffer, such as phosphate, citrate and other organic acids；Antioxidant, including ascorbic acid and methionine；Preservative (such as octadecyl dimethyl benzyl ammonium chloride；Hexamethonium chloride；Benzalkonium chloride, benzethonium chloride；Phenol, butanol or phenmethylol；Alkyl paraben, such as methyl p-hydroxybenzoate or propyl ester；Catechol；Resorcinol；Cyclohexanol；3- amylalcohols；And metacresol)；Low molecule amount (less than about 10 residues) polypeptide；Protein, such as serum albumin, gelatin or immunoglobulin；Hydrophilic polymer, such as polyvinylpyrrolidone；Amino acid, such as glycine, glutamine, asparagine, histidine, arginine or lysine；Monose, disaccharides and other carbohydrate, including glucose, mannose or dextrin；Chelating agent, such as EDTA；Carbohydrate, such as sucrose, mannitol, trehalose or sorbierite；Into salt counter ion, such as sodium；Metal composite (such as Zn- protein complexes)；And/or nonionic surfactant, such as TWEEN^TM、PLURONICS^TMOr polyethylene glycol (PEG).

Preparaton herein, which can also contain, to be had more than one kind and treats reactive compound necessary to specific indication, including but not limited to those complementary activities and is not adversely affected each other.Suitably, this quasi-molecule is with for the combination of predetermined purpose effective amount.

Active component can also contain in the microcapsules prepared for example by condensation technique or by interfacial polymerization (being for example hydroxymethyl cellulose or gelatin-microcapsule and poly- (methyl methacrylate) microcapsules respectively), in colloidal drug delivery systems (such as liposome, albumin microspheres, microemulsion, nano particle and Nano capsule) or in macro emulsion.Such technology is disclosed in for example《Remington′sPharmaceutical Sciences》, the 16th edition, Osol, A. is compiled, and 1980.

Preparaton for applying in vivo must be sterile.This readily can be realized by using sterilised membrane filter filtering.

Sustained release preparaton can be prepared.The suitable example of sustained release preparaton includes the solid hydrophobic polymers semipermeable matrices containing immunoglobulin of the present invention, and the matrix exists in the form of approved product, such as film or microcapsules.The example of sustained-release matrix includes polyester, hydrogel (such as poly- (2- ethoxys-methacrylate) or poly- (vinyl alcohol)), polyactide (United States Patent (USP) 3,773,919), the copolymer of Pidolidone and γ-ethyl-L-glutamate ester, nondegradable ethane-acetic acid ethyenyl, degradable lactic acid-ethanol copolymer such as LUPRON DEPOT^TM(the Injectable microspheres body being made up of lactic acid-ethanol copolymer and leuprorelin acetate) and poly- D- (-) -3-hydroxybutyrate.Although the polymer such as ethane-acetic acid ethyenyl and lactic acid-ethanol can sustained release molecule more than 100 days, the time of some hydrogel release proteins is shorter.When encapsulated antibodies are maintained for a long time in vivo, they may be denatured or assemble by exposure to 37 DEG C of wet environment, cause loss of biological activity and immunogenicity to change.Can be according to related mechanism come stabilisation strategy reasonable in design.For example, if it find that aggregation of multiple is to be exchanged via thio-disulfide and form intermolecular S -- S, then can be by modifying sulfhydryl residue, by acid solution is lyophilized, control humidity, realize stabilization using suitable additive and the specific polymer matrix composition of exploitation.

Purposes

The antibody of the present invention can be used for for example external, in vitro and interior therapeutic method.The antibody of the present invention can be used as a kind of antagonist with vitro, in vitro and/or internal body portion or completely enclosed specific antigen activity.In addition, at least some of antibody of the invention can neutralize the antigen active from other species.Therefore, antibody of the invention can be used for for example in the cell culture containing antigen, suppress specific antigen activity in the people experimenter or other mammalian subjects (such as chimpanzee, baboon, marmoset, macaque and rhesus macaque, pig or mouse) with the antigen of the antibody cross reaction of the present invention.In one embodiment, by by antibody with antigen contact so that antigen active is suppressed, antibody of the invention can be used for suppressing antigen active.In one embodiment, the antigen is people's protein molecular.

In one embodiment, antibody of the invention can be used for suppressing to suffer from the method for the antigen in the subject that wherein antigen active is harmful illness, and methods described includes giving subject the antibody of the present invention so that the antigen active of this in subject is suppressed.In one embodiment, antigen is people's protein molecular and subject is people experimenter.Alternatively, subject can be the mammal of the antibody combination antigen of the expression present invention.Further, subject can be the mammal that a kind of antigen has imported (such as by giving antigen or by expressing antigen transgenosis).People experimenter can be given by the antibody of the present invention for therapeutic purposes.In addition, the antibody of the present invention can be given to the non-human mammal (such as primate, pig or mouse) for the antigen for expressing the antibody cross reaction is used for animal doctor's purpose or the animal model as human disease.On the latter, above-mentioned animal model can be used for the therapeutic effect for evaluating the antibody of the present invention (such as test dosage and time-histories).The antibody of the present invention can be used for treating, suppressing, postpone progress, prevention/delay recurrence, improves or prevent disease, illness or the situation relevant with polyubiquitin and the expression of polyubiquitin abnormal protein and/or activity, including but not limited to the related hereditary conditions of cancer, disorder of muscle, ubiquitin-pathway, immune/inflammatory conditions, the nervous system disease and other ubiquitin-pathway associated conditions.

In an aspect, the blocking antibody of the present invention is specific to the polyubiquitin with specific lysine key, and by closing or disturbing the polyubiquitin with specific lysine key and the interaction between the albumen of polyubiquitin interaction to suppress normal polyubiquitin activity, thus suppress corresponding signal transduction path and other related molecules or cell event.

In certain embodiments, the immunoconjugates that patient includes the antibody for being conjugated with cytotoxic agent are given.In certain embodiments, immunoconjugates and/or its antigen combined be the internalization of cell institute, so as to enhance the therapeutic efficacy of the immunoconjugates in the target cell that is combined of the kill immunoconjugates.In one embodiment, cytotoxic agent targets or disturbed the nucleic acid in target cell.The example of above-mentioned cytotoxic agent includes any chemotherapeutant (such as maytansine (maytansinoid) or calicheamycin (calicheamicin)) mentioned in this article, radio isotope or ribalgilase or DNA endonucleases.

Antibody of the invention can be used in combination individually or with other compositions in the treatment.For example, the antibody of the present invention can be with another antibody and/or adjuvant/therapeutic agent (such as steroids) administering drug combinations.For example, any disease described herein such as is being treated including in the related hereditary conditions of cancer, disorder of muscle, ubiquitin-pathway, immune/inflammatory conditions, the nervous system disease illness related to other ubiquitin-pathways, antibody of the invention can be with antiinflammatory and/or bactericide administering drug combinations in therapeutic scheme.Marking includes administering drug combinations (two of which or more is planted medicine and is included in same or different preparation) in upper such therapeutic alliance and is administered alone, in this case, the antibody of the present invention can be given before or after additional treatment is given.

The antibody (and additional therapeutic agent) of the present invention can be administered by any suitable mode, including parenteral, subcutaneous, intraperitoneal, intrapulmonary and intranasal administration, and be needed regarding local treatment, damage zone administration.Parenteral infusions include intramuscular, intravenous, intra-arterial, intraperitoneal or subcutaneous administration.In addition, antibody is suitable to be administered by pulsatile infusion, especially with the antibody of attenuated dosage.Whether depend in part on administration is short-term or long-term, can be any suitable approach such as by injecting, such as vein or hypodermic injection.Whether be short-term or long-term, dosage can be given by any suitable approach, such as by injecting such as intravenous or subcutaneous injection if depending in part on administration.

The position of the combination target of the antibody of the present invention is considered in preparing and giving antibody.When it is intracellular molecules to combine target, certain embodiments of the present invention are provided for the antibody or its antigen-binding fragment that be imported into the cell wherein with reference to residing for target.In one embodiment, antibody of the invention can in the cell be expressed as intracellular antibody.As used herein, term " intracellular antibody " refers to such as Marasco, Gene Therapy 4:11-15(1997)；Kontermann, Methods 34:163-170(2004)；U.S. Patent number 6,004,940 and 6,329,173；Described in U.S. Patent Application Publication No. 2003/0104402 and PCT Publication WO2003/077945, a kind of expression in the cell and antibody or its antigen-binding portion thereof that can be with target molecule selective binding.The cell inner expression of intracellular antibody by by encode expectation antibody or its antigen-binding portion thereof nucleic acid (lack wild-type leader sequence and generally with encoding antibody or the secretion signal of the gene-correlation of antigen-binding fragment) influenceed in importing target cell.Any standard method by nucleic acid into cells can be used, including but not limited to microinjection, ballistic injects (ballistic injection), electroporation, calcium phosphate precipitation, liposome and is transfected using retrovirus, adenovirus, adeno-associated virus and the vaccinia virus vector for carrying purpose nucleic acid.Can be by all or part of delivery of nucleic acids of one or more anti-polyubiquitin antibody for encoding the present invention to target cell, so that one or more intracellular antibodies (intrabody) are expressed, so as to be combined and adjusted the cellular pathways of one or more polyubiquitin mediation with polyubiquitin in the cell.

There is provided the antibody of internalization in another embodiment.Antibody can have some enhancings that antibody delivery is entered to the characteristic in cell, or can be modified with above-mentioned characteristic.For realizing that its technology is known in the art.For example, as it is known that the cationization of antibody can promote it by cellular uptake (referring to such as U.S. Patent number 6,703,019).Lipofection or liposome can also be used for entering antibody delivery in cell.In the case of using antibody fragment, the minimum inhibition fragment specifically bound with target protein binding domain is typically favourable.For example, the variable region sequences based on antibody, can design the peptide molecule retained with target protein sequence binding ability.Above-mentioned peptide is chemically synthesized and/or produced by recombinant DNA technology.Referring to such as Marasco etc.,Proc.Natl.Acad.Sci.USA,90:7889-7893(1993)。

Target cell can be entered by methods known in the art increase regulation polypeptide.For example, some sequences sequence energy guidance of heterologous protein as from HIV Tat or feeler foot (Antennapedia) homeodomain protein passes through cell membrane effectively to take in.Referring to such as Chen etc., Proc.Natl.Acad.Sci.USA (1999), 96:4325-4329.

When the target of combination is located in brain, some embodiment of the present invention are provided through the antibody of blood-brain barrier or its antigen-binding fragment.Some neurodegenerative diseases are relevant with increased blood-brain barrier permeability so that antibody or antigen-binding fragment can be imported easily in brain.When blood-brain barrier keeps complete, there are some is used for the methods known in the art that transport molecule passes through the blood-brain barrier, including but not limited to physical method, the method based on lipid and the method based on acceptor and passage.

Antibody or antigen-binding fragment transhipment are included but is not limited to completely around blood-brain barrier or by producing opening in blood-brain barrier through the physical method of blood-brain barrier.The method of bypassing includes but is not limited to be injected directly into brain (referring to such as Papanastassiou etc., Gene Therapy 9:398-406 (2002)), interstitial infusion/convection current it is enhanced delivering (convection-enhanced delivery) (referring to such as Bobo etc., Proc.Natl.Acad.Sci.USA 91:2076-2080 (1994)) and in brain insert delivery apparatus (referring to such as Gill etc., Nature Med.9:589-595(2003)；With Gliadel Wafers^TM, GuildfordPharmaceutical).The method that opening is produced in barrier includes but is not limited to ultrasonic wave (referring to such as U.S. Patent Publication No. 2002/0038086), osmotic pressure is (such as by giving hypertonic mannitol (Neuwelt, E.A., Implication of the Blood-Brain Barrier and its Manipulation, the ＆ 2 of Vols 1, PlenumPress, N.Y. (1989))), by such as bradykinin or permeabilization agent A-7 permeabilizations (referring to such as U.S. Patent number 5, 112, 596, 5, 268, 164, 5, 506, 206 and 5, 686, 416) and with the carrier transfection containing encoding antibody or the gene of antigen-binding fragment cross over the nerve cell of blood-brain barrier (referring to such as U.S. Patent Publication No. 2003/0083299).

Antibody or antigen-binding fragment transhipment are included but is not limited to enter antibody or antigen-binding fragment packing are connected with the blood vessel endothelium with blood-brain barrier in the liposome for the antibody binding fragment that acceptor is combined (referring to such as U.S. Patent Application Publication No. 20020025313) through the method for blood-brain barrier based on lipid, and antibody or antigen-binding fragment are coated in low-density lipoprotein particle (referring to such as U.S. Patent Application Publication No. 20040204354) or apo E (referring to such as U.S. Patent Application Publication No. 20040131692).

The method transported antibody or antigen-binding fragment through blood-brain barrier based on acceptor and passage includes but is not limited to the permeability for increasing blood-brain barrier using glucocorticoid blocking agent (referring to such as U.S. Patent Application Publication No. 2002/0065259,2003/0162695 and 2005/0124533)；Activating potassium channel (referring to such as U.S. Patent Application Publication No. 2005/0089473), suppresses abc drug carrier (referring to such as U.S. Patent Application Publication No. 2003/0073713)；With transferrins coated antibody and adjust the activity (referring to such as U.S. Patent Application Publication No. 2003/0129186) of one or more TfRs, and cationized antibodies (referring to such as U.S. Patent number 5,004,697).

The antibody compositions of the present invention should by it is a kind of meet good medical practice in the way of prepare, determine dosage and administration.The factor considered on this point is included in particular condition, the specific mammal in treatment, the clinical state of individual patients, the cause of disease, medicine delivery position, medication, administration schedule and the other factors known to practitioner for the treatment of.Antibody without but optionally with one or more currently used for preventing or prepare together with treating the medicine of the illness.The effective dose of above-mentioned other medicines depend on formula in the presence of antibody of the invention amount, sanatory type and other factors discussed above.These medicines are generally used with identical dosage and have method of administration described herein, or used with about 1-99% dosage described herein, or used with any dosage and by any approach, the dosage and approach be empirically determine/it is suitable through clinical assays.

In order to prevent or treat disease, antibody of the invention (when individually or with other medicines for example chemotherapeutant is used in combination when) suitable dose type, the species of antibody, the seriousness of disease and the course of disease that should depend on the disease to be treated, the prevention or therapeutic purposes, treatment before, the clinical history of patient and response and the consideration decision of attending doctor to antibody of giving antibody.Antibody is suitable for once or in a series for the treatment of giving patient.Depending on the type and seriousness of disease, about 1 μ g/kg-15mg/kg (such as 0.1mg/kg-10mg/kg) antibody can give patient as candidate's consumption first, either for example by one or many single administrations or pass through continuous infusion.Depend on the above-mentioned factor referred to of giving, a typical daily dose can be in the range of about 1 μ g/kg-100mg/kg or more.For several days or the repeat administration of longer time, depending on the state of an illness, untill treatment should be typically continue until that illness occur obtains desired suppression.One illustrative dosage of antibody should be about 0.05mg/kg- about 10mg/kg.Therefore, patient can be given by the dosage of one or more about 0.5mg/kg, 2.0mg/kg, 4.0mg/kg or 10mg/kg (or any combination of them).Above-mentioned dosage can intermittently be given, such as weekly or give once within every three weeks (as so that patient obtains about 2- about 20, or e.g., from about 6 dosage antibody).Initial higher loading dose can be given, one or more relatively low dosage are then given.One illustrative dosage regimen includes giving about 4mg/kg initial loading dose, is followed by all maintenance doses of about 2mg/kg antibody.However, other dosage regimens can be used.It is easy to monitor the progress of the treatment by routine techniques and assay method.

Product

In another aspect of the present invention, there is provided comprising available for the product for treating, preventing and/or diagnosing disorderly material described above.Product include container and label on the container or it is associated therewith company or package insert.Suitable container is included such as bottle, tubule, syringe.Container can be made from a variety of materials, such as glass or plastics.The composition of illness is effectively treated, prevented and/or diagnosed in container equipped with its own or when combining other compositions, and there can be sterile access port (such as container can be the intravenous solution bag or tubule for the plug that can pierce with hypodermic needle).At least one of composition activating agent is the antibody of the present invention.Label or package insert indicate that said composition is used for the illness of therapeutic choice.In addition, product may include that (a) is wherein equipped with the first container of composition, wherein the composition includes the antibody of the present invention；The second container of composition be wherein housed, wherein the composition include other cytotoxic agents or other types of therapeutic agent (b).Product in this embodiment of the invention, which may also include, indicates that said composition can be used for the package insert for treating specific illness.Or/in addition, product may also include second (or 3rd) container, the acceptable buffer of pharmaceutics, such as injection bacteriostatic water (BWFI), phosphate buffered saline (PBS), woods grignard (Ringer) solution and dextrose solution are wherein housed.It may also include the other materials needed in business and user's position, including other buffers, diluent, filter, syringe needle and syringe.

The following is the embodiment of the method and composition of the present invention.It should be appreciated that according to general description provided above, it is possible to implement various other embodiments.

Embodiment

Embodiment 1:Separate and identify the anti-polyubiquitin antibody of the first generation

A) library is sorted

Allow from it is natural (

) body library bacteriophage be subjected to for immobilization simulation K48 connections polyubiquitin or K63 connections polyubiquitin the synthetic peptide including isopeptide bond combination select.Enrichment is not observed after 6 wheel selections.Lengthen synthetic peptide, and screening natural antibody library again.Again, enrichment is not observed in the combination selection of 6 wheels.

The bacteriophage from natural YS-B antibody libraries is allowed to be subjected to the combination selection that 4 wheels are directed to the polyubiquitin chain with different known ubiquitin isopeptide bonds.YS-B antibody libraries contain in all three heavy chains CDR and light chain CDR3 randomization and be the amino acid based on humanized antibody 4D5 (referring to U.S. Patent Application Publication No. 2005-0106667).

Total length K48 connections or K63 connections polyubiquitin chain (Boston Biochem) by length for the enzymatic synthesis of 3-7 units is fixed on the Maxisorp immuno plates of 96- holes (NUNC).Stayed overnight with the polyubiquitin coating flat board of K48 or the K63 connection for 5 μ g/ml being dissolved in 50mM carbonate buffer solutions, pH 9.6.Coated flat board is washed with phosphate buffered saline solution (PBS) and closed with 0.2% bovine serum albumin(BSA) (BSA) or casein in PBS.Then at 25 DEG C with PBS (PBST) washing flat board containing 0.05% Tween 20.In room temperature, the 10 of each μ l of Kong Douyong 100¹²Individual bacteriophage/ml sorting buffer solution (0.2%BSA or casein PBST solution) is incubated 2 hours.Wash 8 times to remove uncombined bacteriophage in each Kong Douzai PBST.By incubating the bacteriophage that extracting in 10 minutes is combined with 0.1M HCl, and with 2M Tris alkali and extract.The bacteriophage extracted is bred in the E.colistrain XL1 blue (Stratagene) of addition M13-KO7 helper phages (New England Biolabs).

The bacteriophage of amplification is used for the selection for the identical target used in round before of additional rounds.Selection is taken turns for 2-4,10 μ g/ml ubiquitins are included in sorting buffer solution also to be used or sorted without using extra counter-selection as the wheel of counter-selection (counterselection) the 3rd and 4 simultaneously:With the polyubiquitin counter-selection of 10 μ g/ml K63 connections in the polyubiquitin selection of K48 connections, or the polyubiquitin counter-selection in the polyubiquitin selection of K63 connections with 10 μ g/ml K48 connections.

For taking turns those clones in selection in the 2-4 for wherein lacking polyubiquitin counter-selection, single clone is cultivated in being supplemented with the 2YT meat soups of carbenicillin and M13-KO7 helper phages for 400 μ l of 96- orifice plates.Supernatant from those cultures is used to high flux Phage-ELISA screen the clone combined with the polyubiquitin of K48 connections, polyubiquitin, ubiquitin and the BSA of K63 connections.DNA sequence analysis is carried out to all clones.A part to the heavy chain including HVR is sequenced, and is used for the analysis of heavy chain hypervariable region.Recognize the polyubiquitin of K48 connections or both recognize the polyubiquitin of K48 connections or recognize that the heavy chain hypervariable region of the clone of the polyubiquitin of K63 connections is shown in Fig. 2A-C.Recognize the polyubiquitin of K63 connections or both recognize the polyubiquitin of K48 connections or recognize that the heavy chain hypervariable region of the clone of the polyubiquitin of K63 connections is shown in Fig. 3 A and 3B.It is not sequenced for the light chain HVR of each clone, but based on the characteristic in YS-B libraries, it is contemplated that HVR-L1 and HVR-L2 sequence is constant, and it is that clone is special that HVR-L3 sequences are then estimated.According to library designs, HVR-L1 sequences are RASQSVSSAVA (SEQ ID NO:79), HVR-L2 sequences are SASSLYS (SEQ ID NO:80).All clones have identical heavy chain and light chain framework region sequence (referring to Fig. 6).

A different set of clone includes the counter-selection carried out in 2-4 takes turns selection with the polyubiquitin (polyubiquitin of K48 connections or the polyubiquitin of K63 connections) of the different lysine keys of 10 μ g/ml.10 μ l are eluted to the bacteriophage selected from fourth round to be used to infect the Escherichia coli grown CJ23620 minutes, then the overnight incubation on the solid agar containing carbenicillin.The 15ml 2YT meat soups for being supplemented with carbenicillin and chloramphenicol are added in flat board so that the CJ236 cells containing phasmid are resuspended.Add M13-KO7 helper phages.After 37 DEG C of stirrings are incubated 1 hour, 2.5ml suspension is added into the 2YT meat soups for the 250ml for being supplemented with carbenicillin and kanamycins.Allow suspension overnight incubation.

Bacteriophage is harvested by polyethylene glycol precipitation, and uses M13spin kits (Qiagen) separation Kunkel DNA.Use oligonucleotides F1560-2 (TCTTGTGACAAAACTCACCATCACCATCACCATCACTAGGGCGGTGGCTCTGGTTC CGGTGATTTT) (SEQ ID NO:150) 1 μ g Kunkel templates, are used for Kunkel mutagenic treatments (referring to Kunkel, Proc.Natl.Acad.Sci.USA82:488(1985)).Mutagenesis reaction thing is transformed into E.colistrain XL1 blue and the overnight incubation on the solid agar containing carbenicillin.Then as above select and cultivate single clone, and screen the clone of polyubiquitin, single ubiquitin, BSA and anti-five polyhistidine antibodies (anti-pentaHis antibody) (Qiagen) of anti-K48 and K63 connections in Phage-ELISA as described above.The clone that the polyubiquitin of K48 connections or the polyubiquitin of K63 connections are specific to being accredited as carries out DNA sequence analysis.Hypervariable region HVR-H1, HVR-H2 and HVR-H3 amino acid sequence are shown in Fig. 8 A-C (being specific to the polyubiquitin of K48 connections) and 9A and 9B (being specific to the polyubiquitin of K63 connections).It is not sequenced for the light chain HVR of each clone, but based on the characteristic in YS-B libraries, it is contemplated that HVR-L1 and HVR-L2 sequence is constant, and it is that clone is special that HVR-L3 sequences are then estimated.According to library designs, HVR-L1 sequences are RASQSVSSAVA (SEQ ID NO:79), HVR-L2 sequences are SASSLYS (SEQ ID NO:80).All clones have identical heavy chain and light chain framework region sequence (referring to Fig. 6).

(B) Fab is produced

In order to produce Fab, ehec infection FF34B8 (a kind of wherein to be cultivated by using XL1 mating and in Selective solid culture medium so that F ' episomes to be added to the cell line in 34B8 bacterial strains) will be used for from the phage supernatants for five histidine-tagged positive Unique clones.The cell of infection is rule and overnight incubation on the solid agar containing carbenicillin.Choose the monospecific polyclonal of the FF34B8 containing phasmid from flat board and in the LB containing carbenicillin in 37 DEG C of overnight incubations.Then those cultures are used to be inoculated with complete CRAP culture mediums (3.57g (NH of the 500ml containing carbenicillin₄)₂SO₄, 0.71g sodium citrates 2H₂O, 1.07g KCl, 5.36g yeast extracts (certified), 5.36g Hycase SF (Sheffield), by adding KOH tune pH to 7.3 and adjusting volume to 872mL with ultra-pure water, high steam processs, is cooled to 55 DEG C, to its (per L) addition 110mL 1MMOPS pH 7.3, the glucose of 11mL 50% and 7mL 1M MgSO₄), and in 30 DEG C of stir cultures 24 hours.By centrifuging harvesting and cell precipitation being stored in into -20 DEG C.By the way that each cell precipitation is resuspended in into purifying Fab in the cold lysozymes containing 0.2mg/ml of 35ml and 0.3U/mL DNA enzymatics I lavation buffer solution (PBS+150mM NaCl).The cell precipitation of resuspension is transferred in 50ml centrifuge tubes and is quickly vortexed 45 minutes at 25 DEG C.Lysate is simultaneously loaded into 1ml in 4 DEG C of protein G-Sepharose posts with lavation buffer solution pre-equilibration by centrifugation.Pillar is washed with the cold lavation buffer solutions of 50ml, is eluted with 3ml 0.1M acetic acid, and is neutralized with 150 μ l 2M Tris alkali.The Fab buffer-exchangeds of elution are entered in PBS and concentrated using the centrifugal filters of Centriprep 10 (Millipore).Pass through the Fab concentration (1OD obtained by spectrophotometry_280nm=1.55mg/mL).The Fab of concentration is stored in 4 DEG C.

As described above, each Fab is embraced within ELSA protein determinations to determine its relative affinity to K48 connections and K63 connections polyubiquitin, and to confirm that Fab does not react with single ubiquitin or BSA.Compared with the polyubiquitin connected to K63, Fab apu01-15 have higher specificity to the polyubiquitin of K48 connections.Fab apu17-apu24 are proved have higher specificity to the polyubiquitin of K63 connections compared with the polyubiquitin connected to K48 in ELISA.Apu16 is produced not as Fab.

DNA sequence analysis is carried out to all Fab.The Fab for the polyubiquitin specific binding being each connected with K48 hypervariable region HVR-H1, HVR-H2, HVR-H3 and HVR-L3 amino acid sequence are shown in Figure 10 A-C.The Fab for the polyubiquitin specific binding being each connected with K63 hypervariable region HVR-H1, HVR-H2, HVR-H3 and HVR-L3 amino acid sequence are shown in Figure 11 A-C.For each Fab, heavy chain and light chain framework region sequence are shown in Figure 6.It is identical (referring to above SEQID NOs for each clone first two light chain hypervariable regions HVR-L1 and HVR-L2 according to library designs:79 and 80).

(C) Fab of separation affinity analysis

Use

3000 systems (Biacore) determine the affinity for the form that chosen Fab (being saved referring to above-mentioned (B)) is connected to ubiquitin and its lysine by surface plasmon resonance.The amine coupling scheme provided using manufacturer, the polyubiquitin (chain length 3-7) of the ubiquitin of about 100 resonance units, K48 or K63 connections dimerization ubiquitin or K48 or K63 connections is fixed on the different flow cells of CM5 chips (flow cell).In each experiment, activate and close the flow cell 1 without ankyrin with monoethanolamine, be used as referring to and deduct.The Fab albumen (1.6-100nM) of each in the apu01-apu24 of serial dilution is injected each flow cell (flow cell) is overflowed (with total μ l of co-injection 50 of 25 μ l/min flow velocity).Record the signal of each flow cell and deduct reference signal.After dissociation phase (5 minutes), with 13 μ l 20mM HCl regeneration chips surface.Illustrative Fab apu09 and apu18 binding curve is shown in Figure 12 and 13.As shown in Figure 12, Apu09 is combined with the polyubiquitin of K48 connections, but the polyubiquitin with K63 connections is not combined.Figure 13 A show the binding curve for the polyubiquitin that apu18 is connected with K48.Although observed some combinations, it is substantially less than to the combination (Figure 13 B) observed by the polyubiquitin of K63 connections.Similar analysis is carried out to each Fab.

The software provided using manufacturer passes through nonlinear regression analysis computational dynamics constant and binding constant, and be shown in table B simultaneously.Word " NB " refers in table B does not detect combination for indicated interaction.Word " nd " refers to for the indicated no measurement data of interaction in table B.As a result show that specific Fab and the kinetic constant that dimerization ubiquitin is combined are very similar to those kinetic constants combined with polyubiquitin.Therefore, Fab appears to recognize the specific isopeptide bond (isopeptide linkage) between two ubiquitin parts.

Table B:Pass through

Analyze the anti-polyubiquitin Fab determined kinetic constant

^*The kinetic constant for the dimerization ubiquitin interaction to K63 connections that Apu18 second of Biacore analyses are obtained before confirming.

(D) Western blotting

Separation four poly- ubiquitin (in the appropriate case K48 connections or K63 connections) and dimerization ubiquitin (K48 connections or K63 connections) (Boston Biochem) and it is transferred in polyacrylamide gel by electroblotting on nitrocellulose membrane.By the way that the nonspecific binding site in close membrane is stayed overnight in 4 DEG C of incubation films in 0.5% Qiagen closed reagents (Qiagen).The film of closing is positioned in miniblotter devices.Fab is cloned into (1 μ g/ml) to put in the film serial section in 0.5% Qiagen closed reagents (Qiagen).After incubating 1 hour, film is washed.According to manufacturers instruction, the conjugated HRP conjunctival anti-ubiquitin antibody of anti-five polyhistidine antibodies (Qiagen) development is used.

The four poly- ubiquitins that the polyubiquitin specificity Fab for the K48 connections that clone apu01-apu15 is produced is connected with the K48 being fixed on nitrocellulose membrane are specifically bound (referring to Figure 19 B).The combination for the polyubiquitin that the K63 for cloning the polyubiquitin specificity Fab for the K63 connections that apu17-apu24 is produced and being fixed on nitrocellulose membrane is connected is not observed (referring to Figure 19 A).

Embodiment 2:Separate and identify the anti-polyubiquitin antibody of the second generation

The clone apu05 (the polyubiquitin selectivity of K48 connections) and apu18 (the polyubiquitin selectivity of K63 connections) phasmid identified before coding builds the second generation library shown for Fab (referring to Figure 10 and 11).It will be used to infect CJ236 cells to prepare Kunkel DNA profilings from those bacteriophages cloned.Then, those templates of mutagenic treatment are to insert terminator codon, and the template containing terminator codon is used for into following library construction.

According to two different schemes mutagenic treatment Fab apu05 with library derived from creating two different apu05.In first library, only mutagenic treatment HVR-H3.Modification HVR-H3 first carries out mutagenesis so that terminator codon is included in Kunkel templates followed by the oligonucleotides of four mutagenesis.In all cases, terminator codon oligonucleotides coding is CGTCTATTATTGTGCTCGCTAATAAGACTACTGGGGTCAAGG (SEQ IDNO:365).The oligonucleotides of first three mutagenesis is three kinds of identical expectation sequence and changes (permutation), one of tyrosine residue is fixed, and utilize each remaining tyrosine residue of NNS mixed ciphers subgroup (wherein N corresponds to G, C, A or T, and S-phase should be in G or C) randomization；The amino acid of 100b is selected from phenylalanine, methionine, leucine and isoleucine；The amino acid of 100a is selected from glycine and alanine；And remaining amino acid is subjected to gentle randomization.Gentle randomization refers to the time of some nucleotide positions 70% occupied by indicated base within a context, and each of other three kinds of bases then occupies for 10% time.Include those oligonucleotides of above-mentioned gentle randomization wherein at particular bases for those, the presence of gentle randomization is indicated by the presence of the numeral at the base positions.Digital " 5 " refer to the time that the bases adenine at the position occupies 70%, and base guanine, cytimidine and thymidine then occupy for 10% time respectively.Similarly, digital " 6 " refer to guanine, and " 7 " refer to cytimidine, and " 8 " refer to thymidine, in all cases, and each in other three kinds of bases only occupies for 10% time.The oligonucleotide sequence of first three mutagenesis is:CGTCTATTATTGTGCTCGC567TAC567NNSNNS567GSTWTSGACTACTGGGGTCAAGG(SEQ ID NO:367)、CGTCTATTATTGTGCTCGC567NNS567TACNNS567GSTWTSGACTACTGGGGTCAAGG(SEQ ID NO:368) with CGTCTATTATTGTGCTCGC567NNS567NNSTAC567GSTWTSGACTACTGGGGTC AAGG (SEQ ID NO:369).The oligonucleotides of Article 4 mutagenesis using NNS mixed ciphers subgroup to the 96th, the randomization of 98 and 99 tyrosine；The amino acid of 100b is selected from phenylalanine, methionine, leucine and isoleucine；Select the amino acid of 100a from glycine and alanine, and consistent with above-mentioned gentle randomization nomenclature carry out gentle randomization in each other positions.The sequence of Article 4 oligonucleotides is CGTCTATTATTGTGCTCGC567NNS567NNSNNS567GSTWTSGACTACTGGGGTC AAGG (SEQ ID NO:370).

In second apu05 library, mutagenic treatment HVR-H1, HVR-H2, HVR-H3 and HVR-L3.Using NNS mixed ciphers subgroup (wherein N corresponds to G, C, A or T, and S-phase should be in G or C) modification HVR-H1 the serine of the 30th and 33 is randomized；The amino acid of selection the 29th from amino acid phenylalanine, leucine, isoleucine and valine；And the amino acid of the 34th is selected from isoleucine and methionine.Oligonucleotides for mutagenic treatment apu05HVR-H1 is GCAGCTTCTGGCTTCAACTAATAACACTGGGTGCGTCAGG (SEQ ID NO:371) with GCAGCTTCTGGCTTCAACNTCNNSTACTCTNNSATSCACTGGGTGCGTCAGG (SEQ ID NO:372).Using NNS mixed ciphers subgroup modification HVR-H2 the tyrosine of the 52nd is randomized, and selects from proline and serine the amino acid of 52a.Oligonucleotides for mutagenic treatment HVR-H2 is:GGCCTGGAATGGGTTGCATAATAATATGCCGATAGCGTCAAGG(SEQ IDNO:373) with GGCCTGGAATGGGTTGCATCTATCNNSYCTTACTACTCTTACACCTCTTATGCCGA TAGCGTCAAGG (SEQ ID NO:374).Using NNS mixed ciphers subgroup modification HVR-H3 the tyrosine of the 99th and the serine of the 100th are randomized；The amino acid of 100a is selected from glycine and alanine；And the amino acid of 100b is selected from phenylalanine, methionine, leucine and isoleucine.Oligonucleotides for mutagenic treatment HVR-H3 is:CGTCTATTATTGTGCTCGCTAATAAGACTACTGGGGTCAAGG(SEQ IDNO:365) with CGTCTATTATTGTGCTCGCTCTTACTCTTACNNSNNSGSTWTSGACTACTGGGGTC AAGG (SEQ ID NO:375).HVR-L3 is modified according to NNS mixed ciphers subgroup and make it that S91 are randomized, and I96 are selected from phenylalanine, isoleucine and valine.Oligonucleotides for mutagenic treatment HVR-L3 is:CGCAACTTATTACTGTCAGCAATAATAAACGTTCGGACAGGGTACC(SEQ ID NO:376) with CGCAACTTATTACTGTCAGCAANNSTCTTACTCTTCTCTGDTTACGTTCGGACAGG GTACC (SEQ ID NO:378).

Library derived from six different apu18- is prepared by six different apu18 mutagenesis programs.In first library, only mutagenic treatment HVR-H3.Modification HVR-H3 first carries out mutagenesis so that terminator codon to be included in Kunkel templates followed by the oligonucleotides of seven mutagenesis.In all cases, terminator codon oligonucleotides coding is CGTCTATTATTGTGCTCGCTAATAAGACTACTGGGGTCAAGG (SEQ IDNO:366).The oligonucleotides of first six mutagenesis is six kinds of changes of identical expectation sequence, two of which tyrosine or trp residue are fixed, and utilize NNS mixed ciphers subgroup (wherein N corresponds to G, C, A or T, and S-phase should be in G or C) randomization each remaining tyrosine and trp residue；The amino acid of 100c is selected from phenylalanine, methionine, leucine and isoleucine；The amino acid of 100b is selected from glycine and alanine；And the remaining amino acid of the gentle randomization in ground consistent with above-mentioned gentle randomization nomenclature.The oligonucleotide sequence of first six mutagenesis is:CGTCTATTATTGTGCTCGC655TACTAC565NNSNNS577GSTWTSGACTACTGGGGTCAAGG(SEQ ID NO:379)、CGTCTATTATTGTGCTCGC655NNSNNS565TGGTAC577GSTWTSGACTACTGGGGTCAAGG(SEQ ID NO:380)、CGTCTATTATTGTGCTCGC655TACBBS565NNSTAC577GSTWTSGACTACTGGGGTCAAGG(SEQ ID NO:381)、CGTCTATTATTGTGCTCGC655NNSTAC565TGGNNS577GSTWTSGACTACTGGGGTCAAGG(SEQ ID NO:382)、CGTCTATTATTGTGCTCGC655TACNNS565TGGNNS577GSTWTSGACTACTGGGGTCAAGG(SEQ ID NO:383) with CGTCTATTATTGTGCTCGC655NNSTAC565NNSTAC577GSTWTSGACTACTGGG GTCAAGG (SEQ ID NO:384).The oligonucleotides of Article 7 mutagenesis is using NNS mixed cipher subgroups randomization the 96th, the tyrosine and the tryptophan of the 99th of 97 and 100；The amino acid of 100b is selected from phenylalanine, methionine, leucine and isoleucine；The amino acid of 100c is selected from phenylalanine, methionine, leucine and isoleucine；Select the amino acid of 100b from glycine and alanine, and consistent with above-mentioned gentle randomization nomenclature gentle randomization is carried out at each other positions.The sequence of Article 7 oligonucleotides is:CGTCTATTATTGTGCTCGC655NNSNNS565NNSNNS577GSTWTSGACTACTGGGGTCAAGG(SEQ ID NO:385).

In second apu18 library, only mutagenic treatment HVR-H2.Modification HVR-H2 first carries out mutagenesis so that terminator codon to be included in Kunkel templates followed by the oligonucleotides of four mutagenesis.In all cases, terminator codon oligonucleotides coding is GGCCTGGAATGGGTTGCATAATAATATGCCGATAGCGTCAAGG (SEQ IDNO:373).The oligonucleotides of first three mutagenesis is three kinds of changes of identical expectation sequence, one of tyrosine residue is fixed, and utilize the NNS mixed ciphers subgroup each remaining tyrosine of (wherein N corresponds to G, C, A or T, and S-phase should be in G or C) randomization and the serine of the 52nd；The amino acid of 52a is selected from proline and serine；The amino acid of selection the 55th from glycine and serine；Fix the isoleucine and the threonine of the 57th of the 51st；And the remaining amino acid of the gentle randomization in ground consistent with above-mentioned gentle randomization nomenclature.The oligonucleotide sequence of first three mutagenesis is:GGCCTGGAATGGGTTGCATACATCNNSYCTNNSNNSRGC567ACC567TATGCCGATAGCGTCAAGG(SEQ ID NO:386)、GGCCTGGAATGGGTTGCANNSATCNNSYCTTACNNSRGC567ACC567TATGCCGATAGCGTCAAGG(SEQ ID NO:387) with GGCCTGGAATGGGTTGCANNSATCNNSYCTNNSTACRGC567ACC567TATGCCGA TAGCGTCAAGG (SEQ ID NO:388).The oligonucleotides of Article 4 mutagenesis is using NNS mixed cipher subgroups randomization the 50th, the tyrosine of 53 and 54；The amino acid of 52a is selected from phenylalanine and serine；The amino acid of selection the 55th from glycine and serine；Isoleucine and the threonine residues of the 51st and 57 are fixed respectively；And consistent with above-mentioned gentle randomization nomenclature gentle randomization is carried out at each other positions.The sequence of Article 4 oligonucleotides is:GGCCTGGAATGGGTTGCANNSATCNNSYCTNNSNNSRGC567ACC567TATGCCGATAGCGTCAAGG(SEQ ID NO:389).

In the 3rd apu18 library, mutagenic treatment HVR-H2 and HVR-H3.As the modification carried out in second apu18 library to HVR-H2, the oligonucleotides-modified HVR-H2 of four mutagenesis of identical is utilized.As the modification carried out in first apu18 library to HVR-H3, the oligonucleotides-modified HVR-H3 of first six mutagenesis of identical is utilized.

In the 4th apu18 library, mutagenic treatment HVR-H3 and HVR-L3.As the modification carried out in first apu18 library to HVR-H3, the oligonucleotides-modified HVR-H3 of first six mutagenesis of identical is utilized.Modification HVR-L3 is so that terminator codon to be included in Kunkel templates first, followed by the carry out mutagenesis of mutagenic oligonucleotide.In HVR-L3, the NNS mixed cipher subgroups randomization tyrosine and the serine of 95a of the 91st and 94 is utilized；The leucine of 95b is selected from phenylalanine, isoleucine and valine；And consistent with above-mentioned gentle randomization nomenclature ground gentle randomization the 92nd, the serine of 93 and 95.Oligonucleotides for HVR-L3 mutagenic treatments is CGCAACTTATTACTGTCAGCAATAATAAACGTTCGGACAGGGTACC (SEQ ID NO:376) with CGCAACTTATTACTGTCAGCAANNS567567NNS567NNSCTGDTTACGTTCGGAC AGGGTACC (SEQ ID NO:390).

In the 5th apu18 library, mutagenic treatment HVR-H1 and HVR-H2.As the modification carried out in second apu18 library to HVR-H2, the oligonucleotides-modified HVR-H2 of four mutagenesis of identical is utilized.HVR-H1 is modified with including terminator codon；Utilize the NNS mixed cipher subgroups randomization serine and the tyrosine of the 33rd of the 30th；The amino acid of selection the 29th from phenylalanine, leucine, isoleucine and valine；Select the amino acid of the 34th from isoleucine and methionine, and the gentle randomization the 31st and 32 in ground consistent with above-mentioned gentle randomization nomenclature amino acid.Oligonucleotides for HVR-H1 mutagenic treatments is:GCAGCTTCTGGCTTCAACTAATAACACTGGGTGCGTCAGG(SEQ ID NO:371) with GCAGCTTCTGGCTTCAACNTCNNS567567NNSATSCACTGGGTGCGTCAGG (SEQ ID NO:391).

In the 6th apu18 library, mutagenic treatment HVR-H1, HVR-H2 and HVR-L3.As the modification carried out in the 5th apu18 library to HVR-H1, the oligonucleotides-modified HVR-H1 of identical mutagenesis is utilized.As the modification carried out in second apu18 library to HVR-H2, the oligonucleotides-modified HVR-H2 of four mutagenesis of identical is utilized.As the modification carried out in the 4th apu18 library to HVR-L3, the oligonucleotides-modified HVR-L3 of identical mutagenesis is utilized.

The mutagenesis reaction of each in library derived from library derived from two apu5 and six apu18 will be transformed into by electroporation in the Escherichia coli XL-1 of Electrocompetent.Cell is allowed to be restored 30 minutes in 37 DEG C of stirrings in SOC culture mediums.Retain the number that the celliferous SOC culture mediums of 20 μ L are used to determine transformant, remaining SOC media transfers to 500ml are then contained into carbenicillin and every milliliter 10¹⁰In the 2YT of individual M13K07 helper phages.After 37 DEG C are stirred 45 minutes, supplement kanamycins to meat soup and stayed overnight in 37 DEG C of stir cultures.Each the transformant number in library is>10⁹.Harvested by centrifugation and PEG precipitations from meat soup and concentrate bacteriophage, and in subsequent selection cycles.

As described in above example 1 (A), the polyubiquitin of the K48 polyubiquitins connected and K63 connections is fixed on different Maxisorp flat boards (NUNC).Each library is respectively for its corresponding target (for the polyubiquitin that library derived from two apu05 is K48 connections, for the polyubiquitin that library derived from six apu18 is K63 connections) wheel of sorting one, additional 3 μM single ubiquitins in sorting buffer solution.The bacteriophage (two storehouses, the polyubiquitin target of every kind of lysine connection distinguishes one) for expanding and collecting elution is used to further sort round.

Subsequent selection cycles are solution sortings.Phage library and biotinylated (sulfo-NHS-biotin, Pierce) polyubiquitin chain are incubated 1-2 hours in room temperature sorts buffer solution (PBST for containing 0.5%Superblock (Pierce)) in solution.Mixture is diluted 5-10 times in solution sorts buffer solution and is added in neutravidin (neutravidin) coated hole and was caught for of short duration (5 minutes) of biotinylated polyubiquitin.Reaction containing not biotinylated polyubiquitin chain is used as control and combined to monitor background phage.Eluted 10 minutes with PBST washing flat boards and with 0.1M HCl.

Stringency is adjusted in three kinds of modes:Pass through the concentration of biotinylated polyubiquitin；Before being to catch on the coated hole of neutravidin, by the not biotinylated polyubiquitin of excessive addition come competition binding；And the duration for passing through competition.For every wheel sorting, single ubiquitin with other keys and polyubiquitin are added into sorting buffer solution with 30 μ g/ml concentration during first time incubation step.The sorting of first round solution has used the biotinylated polyubiquitins of 20nM and bacteriophage in incubation at room temperature 1 hour.Then mixture is diluted 10 times in solution sorting buffer solution, and caught 5 minutes using the coated hole of neutravidin.For the second wheel, with the biotinylated polyubiquitin balance bacteriophages of 20nM as in the first round, but the not biotinylated polyubiquitin containing 30 μ g/ml (selects what is connected with K48 for K48, select to be connected with K63 for K63) solution sorting buffer solution in 10 times of dilution be used for the dissociation rates of 15 minutes and select, then catch on the coated hole of neutravidin.The sorting of third round solution further comprises the biotinylated polyubiquitins of 5nM and the selection of the dissociation rate of 30 minutes as described by the second wheel.After a wheel flat board sorting and the sorting of three-wheel solution, each selected from the second generation is cloned in 96 described orifice plates and cultivated.Each is screened by Phage-ELISA to clone and be sequenced.

After the sorting of first round solution, it observed up to 40 times and up to 7 times of enrichment respectively for the library based on apu05 and the library based on apu18 (referring to table C).After the second wheel selection (being sorted to the solution of slow dissociation rate), 11 times of extra enrichments are obtained for K48 specificity clones, 3 times of extra enrichments are then obtained (referring to table C) for K63 specificity clones.Third round selection (affinity is sorted and dissociation rate (off-rate) sorting) produces 18 times of enrichments to K48 specificity clones, and 4 times of enrichments are then produced (referring to table C) to K63 specificity clone.

Table C:The anti-polyubiquitin antibody library solution separation results of the second generation

Identification obtains the different clones of the polyubiquitin of 68 specific binding K48 connections；DNA sequence analysis also is carried out to those clones.HVR-H1, HVR-H2 and HVR-H3 sequence of those clones is shown in Figure 14 A-F.Identification obtains the different clones of the polyubiquitin of 31 specific binding K63 connections；Sequence analysis also is carried out to those clones.HVR-H1, HVR-H2 and HVR-H3 sequence of those clones is shown in Figure 15 A-C.The polyubiquitin specificity clone of polyubiquitin and K63 connections for each K48 connections, light chain HVR is not sequenced, but for apu05 and apu18, HVR-L1 and HVR-L2 sequence are contemplated to be constant, is cloned specifically while HVR-L3 sequences are contemplated to be.According to library designs, HVR-L1 sequences are RASQSVSSAVA (SEQ ID NO:79) and HVR-L2 sequences be SASSLYS (SEQ ID NO:80).All clones have identical heavy chain and light chain framework region sequence (referring to Fig. 6).

As described in Example 1,20 there is the clone (specific and 10 K63 connections the polyubiquitin of the polyubiquitin of 10 K48 connections is specific) for observing maximum combined to be produced as Fab.DNA sequence analysis is carried out to Fab apu2.01-apu2.20.HVR-H1, HVR-H2, HVR-H3 and HVR-L3 sequence of those clones is shown in Figure 16 A and B (Fab special K48) and Figure 17 A and B (Fab special K63).

Fab apu2.01-apu2.20 are included in ELISA protein determinations to determine their relative affinities to K48 connections and K63 connections polyubiquitin, and to confirm Fab not with single ubiquitin or BSA reactions (referring to Figure 18).In the measure, compared with Apu clones 2.11 and 2.12 are proved the polyubiquitin with being connected to K48 respectively, there is high about 300 times of affinity to the polyubiquitin of K63 connections.To in the affinity of the polyubiquitin of K63 connections, Apu2.20 and 2.16 has less, but still significant difference (being respectively high about 30 times and high about 10 times) compared with the polyubiquitin that K48 is connected.Do not detect the combination of polyubiquitin or dimerization ubiquitin that clone apu2.01-apu2.10 and K63 is connected.

Each Fab is also analyzed by the BIAcore described in the embodiment 1 (C) as before.Resulting kinetic constant and binding constant is shown in table D.Word " NB " refers in table D does not detect combination for indicated interaction.

Table D:The anti-polyubiquitin Fab determined kinetic constant is analyzed by BIAcore

Several Fab based on apu05 have relatively corresponding to K lower apu05 Fab to the dimerization ubiquitin of K48 connections_d, show to be combined with polyubiquitin closer.The polyubiquitin of each in apu2.11-2.20Fab not only with K63 connections is combined, and the dimerization ubiquitin with K48 connections also in lesser degree is combined.Although only apu2.13 has lower Kd compared with apu18, the Kd compared with apu18 its dimerization ubiquitin to K48 connections will be greatly.Each in apu 2.11,2.12,2.16 and 2.20 all has the Kd for the dimerization ubiquitin being preferably connected to the Kd of the polyubiquitin of K63 connections with to K48 ratio compared with apu18.For the kinetic constant observed by the combination of Fab and K63 based on the apu18 polyubiquitin being connected be similar to for and the combinations of dimerization ubiquitin that are connected of K63 observed by those kinetic constants.

The ability that each Fab specific bindings are fixed on the polyubiquitin on nitrocellulose membrane also have rated by the Western blotting described in the embodiment 1 (D) as before.Dimerization ubiquitin (the dimerization ubiquitin for example connected when four poly- ubiquitins of K48 connections are used with K63 by the four poly- ubiquitins containing K48 keys or K63 keys, containing the lysine key opposite with four poly- ubiquitins, or the dimerization ubiquitin connected when four poly- ubiquitins of K63 connections are used with K48) and single ubiquitin be fixed on nitrocellulose membrane, and evaluate the ability (Figure 20 A and 20B) that Fab apu2.01-2.20 recognize the molecule of all three immobilizations.There is no a kind of Fab specific recognitions list ubiquitin.The four poly- ubiquitins of each all K48 connection of specific recognition immobilization in Apu2.01-apu2.10, but the dimerization ubiquitin of the K63 connections of all nonrecognition immobilizations (referring to Figure 20 A).Some seen other bands represent pollutant trimerization, the five poly- and eight poly- ubiquitin materials in four poly- ubiquitin prepared products of K48 connections on trace.Four poly- ubiquitins of the K63 connections of the equal specific recognition immobilizations of Apu2.11-apu2.20, and the dimerization ubiquitin of the K48 connections of all nonrecognition immobilizations (referring to Figure 20 B).

Embodiment 3:The combination of anti-polyubiquitin antibody and endogenous polyubiquitin albumen

Previous experiment has had proven to the activity of receptor interacting protein (RIP) (a kind of required medium of neighbouring TNF acceptors 1 (TNFR1) signal transduction compound of 140kD) by polyubiquitinization effect regulation (Wertz etc., Nature 430:694-699(2004)).When polyubiquitin chain institute polyubiquitins of the RIP for K63 connections, the signal transduction by TNFR1 is promoted.The polyubiquitin chain of K63 connections is removed from RIP by going to ubiquitination A20 N- ends, and the polyubiquitin chain connected by the ubiquitin protein ligase functions of A20C ends with K48 replaces, so as to inactivate RIP and its targeting proteins enzyme body is degraded.The cell line for the mutation ubiquitin that the mechanism can only form K48 connections or K63 connections polyubiquitin by using expression is illustrated.

It has rated in TNF processing at different time points, two kinds of anti-K48 of the invention and the polyubiquitin associated proteins specific recognition of anti-K63 connections are present in the RIP of the different polyubiquitin forms in HeLa S3 cells ability.4 liters of about 1.5x10 are handled with 21 μM of MG-132⁶The HeLa S3 cells of individual cells/ml.After treatment, 1 liter of cell is pipetted from total culture immediately, by being harvested by centrifugation, is washed with 200mL PBS, and centrifuge again.The sample is used as time zero time point.Remaining 3 liters of cell cultures are handled with 100ng/mL TNF.Pipette, harvest 1 liter of cell and washed with 200mL PBS, and after being handled with TNF each again centrifugation 5,15 and 25 minutes.In 30mL IP lysis buffers (LB) (20mM Tris pH 7.5,150mM NaCl, 1% Triton x-100,1mM EDTA, 25 μM of MG-132,10mM NEM, 30 μ L every kind of protease inhibitor cocktail 1 and 2 (Sigma) and 1 adequate proteins enzyme inhibitor (Complete proteaseinhibitor) (Roche)) in cracking the cell from each time point and at 4 DEG C rotation incubate 20-60 minutes.Every kind of lysate is transferred in 50mL centrifuge tubes and centrifuged under 10,000xg and is precipitated again within 5 minutes.Estimate the protein concentration of the lysate from each time point.Every kind of lysate (30mL with normalized protein concentration is used for each time point) is incubated 1.25-1.5 hours with albumin A unclosed 1mL/G pearls at 4 DEG C.Pearl and chip are separated with lysate by centrifuging 5 minutes under 2000rpm.Sample for direct western blot analysis, and freezed remaining at -80 DEG C from every kind of lysate.

Gather four parts of 16mL samples of every kind of lysate.25mM MG-132 and 20 μ L NEM are added to every kind of sample.By the anti-TNFR1 Antibody Combinations of two parts of samples each with 2.4 μ g/mL.Other two parts of samples are each combined with 2.4 μ g/mL control antibodies (anti-myc).All samples rotate incubation 2 hours all at 4 DEG C, then add 150 μ L 50% unclosed albumin A pearl slurry.Rotary sample is incubated into extra 5 hours at 4 DEG C.By centrifugation sample, pearl washed once with 15mL LB, be washed twice and be washed twice with 10mL LB with 10mL NaCl containing 1M LB.The pearl of washing is resuspended in 1.25mL LB, and is transferred in microcentrifugal tube.To every kind of sample drawing liquid so that cumulative volume of the pipe containing 950 μ L, and add 360mg solid ureas and make the final concentration of 6M of urea in every kind of sample into every kind of sample.In room temperature gentle agitation sample incubation 15 minutes.Pass through the pearl in the every kind of sample of centrifugation.Retaining a part for every kind of supernatant is used for western blot analysis, and with dissociation dilution buffer (1% Triton-X100,0.5% dexycholate, 120mMNaCl, 50mM HEPES pH 7.2 and adequate proteins Protease Inhibitor Cocktail (Complete proteaseinhibitor cocktail) (Roche)) the remaining supernatant (about every kind of sample 1mL) from every kind of sample is diluted to 10mL.

Every kind of sample is divided into two 5mL part.One part is with the 2.5 μ g apu2.16 processing for being rearranged to IgG forms from fab forms, and another part is with the 2.5 μ g apu2.07 processing for being rearranged to IgG forms from fab forms.50 μ L albumin A pearls, and incubated samples 5 hours at 4 DEG C are added into the two samples.Precipitate and albumin A pearl is washed in TNFR1 LB 3 times, pearl is transferred in microcentrifugal tube in carrying out washing treatment process.Sample buffer is added in all samples, every kind of sample (including the sample preserved before by western blot analysis) is all reduced and in 10% tris/gly 1.5mm 10- holes

Glue is run on gel (Invitrogen).Run after glue, according to the operation instructions of manufacturer by the protein delivery in gel to Invitrolon^TMOn pvdf membrane (Invitrogen).Stayed overnight in room temperature with 5% PBS-T close membranes and with anti-RIP monoclonal antibodies (Becton Dickinson) detection.Trace is washed out, is detected with conjugated HRP goat anti-mouse secondary antibody (Cappel), washing exposed to reagent to excite chemiluminescence, and is exposed to film.As a result it is shown in Figure 21 A and 21B.

Figure 21 A are depicted containing first with TNFR1 or anti-myc immunoprecipitations and then with the trace of the sample of apu2.16IgG polyubiquitin of K63 connections (selective) immunoprecipitation.As shown in figure 21 a, RIP is had not seen in anti-myc control samples or time zero sample.RIP bands are most strong in 5 minutes samples, are then obviously reduced at 15 and 25 minutes in sample.Figure 21 B are depicted containing first with TNFR1 or anti-myc immunoprecipitations and then with the trace of the sample of apu2.07 IgG the polyubiquitin of K48 connections (selective) immunoprecipitation.As shown in figure 21b, RIP is not observed in anti-myc control swimming lanes.RIP levels increase in the past with the time in the trace, and most strong in 25 minutes point samples.The data are related to being the discovery that earlier, described to be the discovery that upon by TNFR1 conducted signals, the polyubiquitin that RIP is just connected by K63 first then removes ubiquitination and the polyubiquitin connected by A20 by K48.Therefore, antibody of the invention can specifically bind and distinguish the polyubiquitin polypeptide and the polyubiquitin polypeptide of K48 connections of the K63 connections of the polyubiquitin in cell.

Embodiment 4:Separate and identify the anti-polyubiquitin antibody of the third generation

The clone apu2.16 (the polyubiquitin selectivity of K63 connections) identified before coding phasmid builds the third generation library shown for Fab (referring to embodiment 2 and Figure 17 A and 17B).Bacteriophage from the clone is used to infect CJ236 cells to prepare Kunkel DNA profilings.Template containing terminator codon is used for following library construction by subsequent mutagenic treatment template to insert terminator codon.

According to three different scheme mutagenic treatment Fab apu2.16 with library derived from creating three different apu2.16-.In first library, mutagenic treatment HVR-H1 and HVR-H2.Then mutagenic treatment HVR-H1 carries out mutagenic treatment so that terminator codon to be included in Kunkel templates using the oligonucleotides of a mutagenesis.Terminator codon encoded oligonucleotide acid sequence is:GCAGCTTCTGGCTTCAACTAATAACACTGGGTGCGTCAGG(SEQ ID NO:371).The oligonucleotides of mutagenesis causes the isoleucine of the 29th to may be selected from phenylalanine, leucine, isoleucine and valine；Using NNS mixed ciphers subgroup (wherein N corresponds to G, C, A or T, and S-phase should be in G or C), the isoleucine of the 34th may be selected from methionine and isoleucine；And gentle randomised amino acid K30, T31, G32 and L33.Gentle randomization refers to the time of some nucleotide positions 70% occupied by indicated base within a context, and each in other three kinds of bases then occupies for 10% time.Include those oligonucleotides of above-mentioned gentle randomization wherein at particular bases for those, the presence of gentle randomization is indicated by the presence of the numeral at the base positions.Digital " 5 " refer to the time that the bases adenine at the position occupies 70%, and base guanine, cytimidine and thymidine then occupy for 10% time respectively.Similarly, digital " 6 " refer to guanine, and " 7 " refer to cytimidine, and " 8 " refer to thymidine, in all cases, and each in other three kinds of bases only occupies for 10% time.Oligonucleotide sequence for mutagenic treatment apu3.16HVR-H1 is:GCAGCTTCTGGCTTCAACNTC556577668788ATSCACTGGGTGCGTCAGG(SEQ ID NO:785).

Then also modification HVR-H2 carries out mutagenesis so that terminator codon to be included in Kunke templates using the oligonucleotides of three mutagenesis.In all cases, terminator codon oligonucleotides coding is GGCCTGGAATGGGTTGCATAATAATATGCCGATAGCGTCAAGG (SEQID NO:373).The oligonucleotides of three mutagenesis is two kinds of first expectation sequence and changes (permutation), and a kind of of Article 2 expectation sequence changes (permutation).First desired sequence includes:The the 50th and 54 any tyrosine residue is fixed, another tyrosine residue of NNS mixed ciphers subgroup (above-mentioned) randomization is utilized；Residue is fixed in the 51st (isoleucine), 52a (proline), 53 (tyrosine), 55 (glycine) and 57 (threonine) positions；And gentle randomization S52, S56 and S58 (according to above-mentioned gentle randoming scheme).The desired sequence of Article 2 includes:In the residue that the 51st (isoleucine), 52a (proline), the 53rd (tyrosine), the 55th (glycine) and the 57th (threonine) is fixed；Utilize the tyrosine of the fierce mutagenesis the 50th and 54 of NNS mixed ciphers subgroup (above-mentioned), and gentle randomization S52, S56 and S58 (according to above-mentioned gentle mutagenesis program).Oligonucleotides for mutagenic treatment apu2.16HVR-H2 is:GGCCTGGAATGGGTTGCANNSATC567CCGTACTACGGT567ACC567TATGCCGATAGCGTCAAGG(SEQ ID NO:786)、GGCCTGGAATGGGTTGCATACATC567CCGTACNNSGGT567ACC567TATGCCGATAGCGTCAAGG(SEQ ID NO:787) with GGCCTGGAATGGGTTGCANNSATC567CCGTACNNSGGT567ACC567TATGCCGA TAGCGTCAAGG (SEQID NO:788).

In second apu2.16 library, mutagenic treatment HVR-H2 and HVR-H3.As the modification carried out in first apu2.16 library to HVR-H2, the oligonucleotides mutagenic treatment HVR-H2 of three mutagenesis of oligonucleotides of the identical containing terminator codon and identical is utilized.(it is described in as the modification carried out in first apu18 library to HVR-H3 in embodiment 2), utilizes the oligonucleotides mutagenic treatment HVR-H3 of six mutagenesis of oligonucleotides of the identical containing terminator codon and identical.

In the 3rd apu2.16 library, mutagenic treatment HVR-H1 and HVR-H3.As the modification carried out in first apu2.16 library to HVR-H1, oligonucleotides of the identical containing terminator codon and the oligonucleotides mutagenic treatment HVR-H1 of identical mutagenesis are utilized.(it is described in as the modification carried out in first apu18 library to HVR-H3 in embodiment 2), utilizes six mutagenic oligonucleotide mutagenic treatment HVR-H3 of oligonucleotides of the identical containing terminator codon and identical.

The mutagenesis reaction of each in library derived from three apu2.16 will be transformed into by electroporation in the Escherichia coli XL-1 of Electrocompetent.Cell is allowed to be restored 30 minutes in 37 DEG C of stirrings in SOC culture mediums.Retaining the SOC culture mediums that 20 μ l contain cell is used to determine transformant quantity, then by remaining media transfer to 500ml containing carbenicillin and every milliliter 10¹⁰In the 2YT of individual M13K07 helper phages.After stirring is incubated 45 minutes at 37 DEG C, supplement kanamycins to meat soup and stir culture is stayed overnight at 37 DEG C.Each the transformant number in library is>10⁹.Harvested by centrifugation and PEG precipitations from meat soup and concentrate bacteriophage, and in subsequent selection cycles.

As described in embodiment 1 (A), the polyubiquitin of the K63 connections for being fixed on Maxisorp flat boards (NUNC) is each sorted to three third generation libraries respectively.Stringency is adjusted in three kinds of modes:Pass through the concentration of biotinylated polyubiquitin；Before being to catch on the coated hole of neutravidin, by the not biotinylated polyubiquitin of excessive addition come competition binding；And the duration for passing through competition.During incubation step, the solution of each round, which is sorted on, all includes the polyubiquitin of 3 μM of single ubiquitins and 30 μ g/mL K48 connections in sorting buffer solution.The bacteriophage for expanding and collecting elution is used to further sort round.Subsequent selection cycles are solution sortings.The sorting of first round solution is included in room temperature and incubates biotinylated (sulfo-NHS-biotin, the Pierce) polyubiquitins of 100nM and phage library 1 hour.Then mixture is diluted 10 times in solution sorts buffer solution (PBST for containing 0.5%Superblock (Pierce)), and caught 5 minutes using the coated hole of neutravidin.Reaction containing not biotinylated polyubiquitin chain is used as control and combined to monitor background phage.Eluted 10 minutes with PBST washing flat boards and with 0.1M HCl.For the 2nd wheel solution sorting, such as the biotinylated polyubiquitin balance bacteriophages of use 30nM in the 1st wheel, but it is to dilute 10 times in the solution of the not biotinylated polyubiquitin (K63 connections) containing 30 μ g/mL sorts buffer solution for the dissociation rate selections of 5 minutes, is then caught on the coated hole of neutrophilous organism fibroin.

After the first round molten sorting, 6.5 times of enrichments are observed for the combinatorial libraries based on apu2.16 (referring to table E).For slow dissociation rate, 10 times of extra enrichments are obtained after the second wheel solution sorting (referring to table E).

Table E:The anti-polyubiquitin antibody library solution separation results of the third generation

After a wheel flat board sorting and the sorting of two-wheeled solution, the single clone selected from the third generation is cultivated in 96- orifice plates and is screened by the Phage-ELISA as described in above-mentioned embodiment 2.72 different clones by sequencing identification.In those clones, there are 12 specificity (Figure 22) for cloning the polyubiquitin for K63 connections for being proven to have highest level in Phage-ELISA measure.Those 12 clones are named as apu3.01-3.12, and their HVR-H1, HVR-H2 and HVR-H3 sequence is shown in Figure 23 A and 23B.It is not sequenced for the light chain HVR of the polyubiquitin specificity clone of each K63 connection, but HVR-L1 and HVR-L2 sequences should be constant, while HVR-L3 sequences should be and apu2.16 identicals.According to library designs, HVR-L1 sequences are RASQSVSSAVA (SEQ ID NO:79), HVR-L2 sequences are SASSLYS (SEQ ID NO:80).All clones have identical heavy chain and light chain framework region sequence (referring to Fig. 6).

Using Apu2.07 (referring to embodiment 2 and Figure 16 A and 16B) in CHO or 293 cells) and apu3.07 (more than and Figure 23 A and 23B) expressed as human IgG.Expression construct (Gorman etc., DNA Prot.Eng.Tech.2 is prepared by the Kunkel mutagenesis of suitable encoding human IgG heavy chain and the pRK mammalian expression vectors of light chain:3-10(1990)).Pass through affinitive layer purification IgG using standard method.

The ability that the polyubiquitin for evaluating tool suitable keys of each IgG with being fixed on nitrocellulose membrane by Western blotting is specifically bound.The polyubiquitin of K48 or K63 connections and single ubiquitin (Boston Biochem) are subjected to race glue on 4-20%Tris- Glycine polyacrylamide gels (Invitrogen).Gel inclusion is transferred to by nitrocellulose membrane by electroblotting.Nonspecific binding site 1 hour on closing nitrocellulose membrane in the Tris- buffered salines (TBST) containing 0.1% Tween-20 for dissolving 5% skimmed milk power.Then K48 specificity or K63 specific antibodies are added in trace with 2 μ g/mL (apu 2.07IgG) or 1 μ g/mL (apu3.07 IgG) concentration, and incubated 1 hour so that with reference to being occurred.As positive control, a trace is incubated with rabbit-anti ubiquitin antibody (Sigma).In TBST wash trace and by the TBST containing 5% skimmed milk power with 1:The antibody that the Goat anti human Ig Fc (ICN) or conjugated peroxidase of the conjugated peroxidase of 10,000 dilutions anti-rabbit Ig (Amersham) detections are combined.After 1 hour, trace is washed in TBST and develops to disclose peroxidase activity using Super Signal West Dura reagents (Pierce).As a result it is shown in Figure 24 A-24D.

As expected, the trimerization of the four of the K48 connections of apu2.07 IgG specific recognitions immobilization poly- ubiquitin and K48 connections is to seven poly- ubiquitins (Figure 24 A), but the polyubiquitin sample with the K63 connections of any immobilization is not combined.Similarly, the trimerization of the four of the K63 connections of apu3.07 IgG specific recognitions immobilization poly- ubiquitin and K63 connections is to seven poly- ubiquitins (Figure 24 B), but the polyubiquitin sample with the K48 connections of any immobilization is not combined.Both IgG are not combined with single ubiquitin of immobilization.To evaluate every kind of IgG sensitivity, additional protein engram analysis (Figure 24 C and 24D) have been carried out using four poly- ubiquitins (25-1000ng/ swimming lanes) of the K48 connections and K63 connections of the immobilization of various concentrations.Apu2.07 IgG detect four poly- ubiquitins of the K48 connections of only 50ng immobilization, and the poly- ubiquitin specific binding (Figure 24 C) of four not be connected again with the K63 of immobilization.Apu3.07 IgG detect four poly- ubiquitins of the K63 connections of only 50ng immobilization, and the poly- ubiquitin specific binding (Figure 24 D) of four not be connected again with the K48 of immobilization.In both cases, the quantity of four poly- ubiquitins of increase immobilization has resulted in the increase of observed combination.

To determine whether IgG can detect endogenic polyubiquitin albumen, by using or being not used 20 μM of proteasome inhibitors

(bortezomib) the human embryonic kidney cell line 293T for handling 4 hours prepares albumen lysate.Lysate is differentiated by SDS-PAGE in 4-20% Tris- Glycine polyacrylamide gels (Invitrogen), and carries out Western blotting as described above.As a result it is shown in Figure 25.Exist and be not present

In the case of processing, Anti-TNF-α ubiquitin antibody (Sigma) all detects a large amount of high-molecular-weight proteins (most left swimming lane).Apu2.07 IgG combine numerous albumen (most right swimming lane) with different molecular weight, and compared with the untreated lysate of immobilization, it is more for the combination observed by the lysate of the velcade processing of immobilization.Generally significantly less combination (middle swimming lane) is observed using the apu3.07 IgG that should can combine K63- polyubiquitin albumen, and does not have significant difference between velcade processing and untreated swimming lane.The polyubiquitinization effect of known K48 connections makes intracellular protein targeting proteins hydrolytic degradation (Chau etc., Science 243:1576-1583(1989)；Finley etc., Mol.Cell.Biol.14:5501-5509(1994)；Flick etc., Nat.Cell.Biol.6:634-641(2004)).Therefore, a kind of explanation for apu2.07 IgG results is that the K48- polyubiquitin albumen of incrementss is retained in lysate when proteolysis processing is prevented from, and causes the increased apu2.07IgG more than untreated samples to combine.Being not aware that the polyubiquitin targeting proteins of K63 connections is used for degrade (Pickart and Fushman, Curr.Opin.Chem.Biol.8:610-616(2004)；Hicke and Dunn, Annu.Rev.Cell Dev.Biol.19:141-172(2003)；Spece etc., Mol.Cell Biol.15:1265-1273(1995)；Ulrich, Eukaryot.Cell 1:1-10(2002)；Spence etc., Cell 102:67-76(2000)；Seibenhener etc., Mol.Cell.Biol.24 (18):8055-8068(2004)).Therefore, a kind of explanation for apu3.07 IgG results is that the suppression of proteasome does not cause the accumulation of K63- polyubiquitin albumen.

Embodiment 5:The FAB combined with the polyubiquitin of anti-K63- connections structural analysis

In order to more fully understand the interaction between the polyubiquitin fab and polyubiquitin of anti-K63 connections, the dimerization ubiquitin cocrystallization that the polyubiquitin fab apu2.16 that anti-K63 is connected are connected with K63.Use 1 μ L apu2.16 solution (15mg/mL, it is dissolved in 10mM Tris, 75mM NaCl pH8.0) and 1 μ L ponds liquid (cell solution) (0.1M LiCl, 0.1M Tris pH 8.2,1M citrates), crystal is grown in hanging drop.0.5 μ L 0.1M copper chlorides are added to every drop hanging drop, and and each drop was streak seeded. grew druse during several days and operated to obtain diffraction monocrystalline into every drop hanging drop.Structure is determined by molecular replacement.Natural data are collected under 100K and with HKL2000 processing.Crystal belongs to C2 space groups, with unit cell dimension

B=94.9

With β=107, two compounds (complexes) are contained in an asymmetry unit.Using the 4d5fab fragment variants of program Phaser and humanization (for the 4d5 in PDB:DB code1FVE) coordinate pass through molecular replacement analytic structure.Mould is carried out in program Coot to build and use Refmac5 refined structures.The resolution ratio of the structure isThe compound is by the R of refine to 24.5% and 30.4% R_free。

Interaction between the dimerization ubiquitin of apu2.16 and K63 connections is shown in Figure 26 A-26C.Structure epi-position is that at least 25% its Solvent accessible surface and/or the heavy chain or light chain in fab are embedded in the case where being combined with fab

Within have more than one atom residue combination.It is chain B that contribution K63 ubiquitin chain, which is chain A and contributes the ubiquitin chain of C- ends,.Fab light chain residues belong to chain L and fab heavy chain residues and belong to chain H.Numbered in the following table before residue numbering for chain, and fab residue serial numbers.

Table F:Residue in the dimerization ubiquitin combination interface of apu2.16-K63 connections

 

Ubiquitin residue	Fab residues
		A 18 Glu
A 19 Pro	L			31 Ser
		A 20 Ser	L		49 Tyr
A 21 Asp	L			50 Ser
		A 55 Thr	L		51 Ala
A 56 Leu	L			52 Ser
		A 57 Ser	L		53 Ser
A 58 Asp	L			66 Arg
		A 60 Asn	L		98 Phe
A 61 Ile
		A 62 Gln	H	30 Lys
	H
		31 Thr
B
	8 Leu	H	32 Gly
B
	9 Thr	H	33 Leu
B
	34 Glu	H	50 Tyr
B
	35 Gly	H	52 Ser
B
	36 Ile	H	54 Tyr
B
	37 Pro	H	55 Tyr
B
	39 Asp	H	99 Glu
B
	40 Gln	H	100 Tyr
B
	71 Leu	H	101 Tyr
B
	72 Arg	H	102 Arg

 

B 73 Leu	H	104 Tyr
			B
74 Arg	H	105 Thr
			B
75 Gly

As shown in dark gray region in table F and Figure 26 B, when being combined with apu2.16, positioned at apu2.16's

Within there is residue in residue and 13 K63- dimerization ubiquitin B chains in 11 K63- dimerization ubiquitin A chains.As shown in table F, and as shown in dark gray region in Figure 26 C, when the dimerization ubiquitin connected with K63 is combined, in the dimerization ubiquitin connected positioned at K63

Within there is residue in residue and 14 apu2.16 heavy chains in 8 apu2.16 light chains.Based on the data, the residue that the possibility on the dimerization ubiquitin of K63 connections adjusts the interaction of the dimerization ubiquitin of apu2.16 and K63 connections between the two includes Glu-18, Ser-20, Leu-57 and Asp-58 in A chains and Pro-37, Arg-74 and Gly-75 in B chains.It is interesting that the antibody does not interact nearly with K63-Gly76 keys, but specificity is obtained by the interaction with the dimerization ubiquitin composite surface of the adjacent key.

Claims (67)

1. a kind of antibody of the separation specifically bound with polyubiquitin, the wherein antibody are not specifically bound with single ubiquitin.

2. a kind of antibody with the separation of the first polyubiquitin specific binding comprising the first lysine key, wherein the antibody is not specifically bound with the second polyubiquitin comprising the second lysine key, and wherein the first lysine key is different from the second lysine key.

3. the polyubiquitin that polyubiquitin or lysine 63 that the polyubiquitin that the polyubiquitin that the polyubiquitin that the polyubiquitin that the polyubiquitin of the antibody of claim 2, wherein the antibody specificity lysine binding 6 connection, lysine 11 are connected, lysine 27 are connected, lysine 29 are connected, lysine 33 are connected, lysine 48 are connected are connected.

4. the antibody of claim 2, is connected wherein the first polyubiquitin is lysine -48

5. the antibody of claim 4, is connected wherein the second polyubiquitin is lysine -63.

6. the antibody of claim 2, is connected wherein the first polyubiquitin is lysine -63.

7. the antibody of claim 6, is connected wherein the second polyubiquitin is lysine -48.

8. a kind of antibody of the separation all specifically bound with the first polyubiquitin comprising the first lysine key and the second polyubiquitin comprising the second lysine key, wherein the first lysine key is different from the second lysine key, wherein the antibody is not specifically bound with single ubiquitin, and wherein the antibody has the binding affinity substantially reduced compared with binding affinity of the antibody to the first polyubiquitin with the combination of the second polyubiquitin.

9. a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -48, wherein antibody is not specifically bound with single ubiquitin.

10. the antibody of claim 9, respectively SEQ ID NOs are selected from comprising at least one：1-25,151-175,265-279,392-459 and 695-704；SEQ ID Nos：27-51,177-201,281-295,461-528 and 706-715；SEQ ID Nos：53-77,203-227,297-311,530-597 and 717-726；And SEQ ID Nos：HVR-H1, HVR-H2, HVR-H3 and HVR-L3 any 313-327 and 728-737 hypervariable region (HVR) sequence.

11. the antibody of claim 9, comprising at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO：825), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is selected from valine, phenylalanine, leucine and isoleucine；Amino acid e is selected from serine and tyrosine；Amino acid f is tyrosine；Amino acid g is selected from serine and tyrosine；Amino acid h is selected from serine and tyrosine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p q r s t u v w x y z a ' (SEQ ID NO：826), wherein amino acid k is serine；Amino acid l is isoleucine；Amino acid m is selected from serine and tyrosine；Amino acid n is selected from proline and serine；Amino acid o is tyrosine；Amino acid p is tyrosine；Amino acid q is selected from serine and glycine；Amino acid r is selected from serine and tyrosine；Amino acid s is threonine, and amino acid t is selected from serine and tyrosine；Amino acid u is tyrosine；Amino acid v is alanine；Amino acid w is aspartic acid；Amino acid x is serine；Amino acid y is valine；Amino acid z is lysine；It is glycine with amino acid a '；And wherein HVR-H3 includes amino acid sequence b ' c ' d ' e ' f ' g ' h ' I ' j ' k ' l ', wherein amino acid b ' is selected from glutamic acid, serine, glycine and tyrosine；Amino acid c ' is selected from glycine, tyrosine, serine and asparagine；Amino acid d ' is selected from tyrosine, serine, lysine, phenylalanine and glutamic acid；Amino acid e ' is selected from serine, tyrosine, glycine and tryptophan；Amino acid f ' is selected from glutamine, tyrosine, serine and glycine；Amino acid g ' is selected from glycine, serine, tyrosine, methionine and alanine；Amino acid h ' is selected from glycine, alanine, proline and isoleucine；Amino acid i ' is selected from phenylalanine, isoleucine, methionine, alanine and leucine, or is not present；Amino acid j ' is phenylalanine or is not present；Amino acid k ' is aspartic acid；It is tyrosine with amino acid l '.

12. the antibody of claim 9, comprising at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO：827), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is isoleucine；Amino acid e is selected from serine and phenylalanine；Amino acid f is tyrosine；Amino acid g is selected from serine and glycine；Amino acid h is selected from serine and glycine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p q r s t u v w x y z a ' (SEQ ID NO：828), wherein amino acid k is serine；Amino acid l is isoleucine；Amino acid m is tyrosine；Amino acid n is serine；Amino acid o is tyrosine；Amino acid p is tyrosine；Amino acid q is serine；Amino acid r is tyrosine；Amino acid s is threonine, and amino acid t is serine；Amino acid u is tyrosine；Amino acid v is alanine；Amino acid w is aspartic acid；Amino acid x is serine；Amino acid y is valine；Amino acid z is lysine；It is glycine with amino acid a '；And wherein HVR-H3 includes amino acid sequence b ' c ' d ' e ' f ' g ' h ' i ' j ' k ' (SEQ ID NO：829), wherein amino acid b ' is selected from serine and glycine；Amino acid c ' is tyrosine；Amino acid d ' is serine；Amino acid e ' is selected from tyrosine and tryptophan；Amino acid f ' is selected from serine, tyrosine, arginine, phenylalanine and histidine；Amino acid g is selected from glutamic acid, serine, leucine, phenylalanine, methionine, asparagine and valine；Amino acid h ' is selected from alanine and glycine；Amino acid i ' is selected from leucine, methionine, phenylalanine and isoleucine；Amino acid j ' is aspartic acid；It is tyrosine with amino acid k '.

13. the antibody of claim 9, comprising containing amino acid sequence m ' n ' o ' p ' q ' r ' s ' t ' u ' v ' w ' (SEQ ID NO：830) HVR-L3 sequences, wherein amino acid m ' are glutamine；Amino acid n ' is glutamine；Amino acid o ' is selected from serine and tyrosine；Amino acid p ' is selected from serine and tyrosine；Amino acid q ' is selected from serine and tyrosine；Amino acid r ' is selected from serine and tyrosine；Amino acid s ' is selected from serine and tyrosine；Amino acid t ' is selected from leucine, serine, proline and tyrosine；Amino acid u ' is proline or is not present；Amino acid v ' is selected from phenylalanine, isoleucine, valine and leucine；It is threonine with amino acid w '.

14. the antibody of claim 9, comprising containing SEQ ID NO：The HVR-L3 sequences of 728 amino acid sequence.

15. the antibody of claim 11, comprising corresponding to HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding to those sequences listed by clone apu01, apu02, apu03, apu04, apu05, apu06, apu07, apu08, apu09, apu10, apu11, apu12, apu13, apu14 or apu15 in Figure 10 A and 10B.

16. the antibody of claim 12, comprising corresponding to HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding to those sequences listed by clone apu2.01, apu2.02, apu2.03, apu2.04, apu2.05, apu2.06, apu2.07, apu2.08, apu2.09 or apu2.10 in Figure 16 A.

17. the antibody of claim 13, includes SEQ ID NO：79 HVR-L1 sequences, SEQID NO：80 HVR-L2 sequences and corresponding in Figure 10 C correspond to clone apu01, apu02, apu03, apu04, apu05, apu06, apu07, apu08, apu09, apu10, apu11, apu12, apu13, apu14 or apu15 listed by HVR-L3 sequences HVR-L3 sequences.

18. the antibody of claim 14, includes SEQ ID NO：79 HVR-L1 sequences, SEQID NO：80 HVR-L2 sequences and corresponding in Figure 16 B correspond to clone apu2.01, apu2.02, apu2.03, apu2.04, apu2.05, apu2.06, apu2.07, apu2.08, apu2.09 or apu2.10 listed by HVR-L3 sequences HVR-L3 sequences.

19. the antibody of claim 9, includes SEQ ID NO：269 HVR-H1 sequences, SEQID NO：285 HVR-H2 sequences, SEQ ID NO：301 HVR-H3 sequences, SEQ ID NO：79 HVR-L1 sequences, SEQ ID NO：80 HVR-L2 sequences and SEQ ID NO：317 HVR-L3 sequences.

20. the antibody of claim 9, includes SEQ ID NO：701 HVR-H1 sequences, SEQID NO：712 HVR-H2 sequences, SEQ ID NO；723 HVR-H3 sequences, SEQ ID NO：79 HVR-L1 sequences, SEQ ID NO：80 HVR-L2 sequences and SEQ ID NO：734 HVR-L3 sequences.

21. a kind of antibody of the separation for the polyubiquitin specific binding being connected with lysine -63, wherein antibody is not specifically bound with single ubiquitin.

22. the antibody of claim 21, respectively SEQ IDNOs are selected from comprising at least one：81-89,229-239,329-336,599-629,739-748 and 789-799；SEQ ID Nos：91-99,241-251,338-345,631-661,750-759 and 801-811；SEQ ID Nos：101-109,253-263,347-354,663-693,761-770 and 813-823；And SEQ ID Nos：HVR-H1, HVR-H2, HVR-H3 and HVR-L3 any 356-363 and 772-781 hypervariable region (HVR) sequence.

23. the antibody of claim 21, comprising at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO：831), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is selected from valine, isoleucine and phenylalanine；Amino acid e is selected from serine and tyrosine；Amino acid f is selected from serine and tyrosine；Amino acid g is selected from serine and tyrosine；Amino acid h is selected from serine and tyrosine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p q r s t u v w x y z a ' (SEQ ID NO：832), wherein amino acid k is selected from serine and tyrosine；Amino acid l is isoleucine；Amino acid m is selected from serine and tyrosine；Amino acid n is selected from proline and serine；Amino acid o is selected from serine and tyrosine；Amino acid p is selected from serine and tyrosine；Amino acid q is selected from serine and glycine；Amino acid r is selected from serine and tyrosine；Amino acid s is threonine, and amino acid t is selected from serine and tyrosine；Amino acid u is tyrosine；Amino acid v is alanine；Amino acid w is aspartic acid；Amino acid x is serine；Amino acid y is valine；Amino acid z is lysine；It is glycine with amino acid a '；And wherein HVR-H3 includes amino acid sequence b ' c ' d ' e ' f ' g ' h ' i ' j ' k ' l ' m ' n ' o ' p ' q ' r ' s ' t ' u ' v ', wherein amino acid b ' is selected from serine, glutamic acid, glycine and tryptophan；Amino acid c ' is selected from glycine, tyrosine, isoleucine, glutamine and serine；Amino acid d ' is selected from tyrosine, methionine, glycine and isoleucine；Amino acid e ' is selected from tyrosine, arginine, phenylalanine, tryptophan, alanine and proline；Amino acid f ' is selected from tyrosine, tryptophan, serine and glycine；Amino acid g ' is selected from glutamine, tyrosine, serine, phenylalanine and valine；Amino acid h ' is selected from glycine, threonine, tryptophan, lysine and proline；Amino acid i ' is selected from tyrosine, alanine, tryptophan, glutamic acid, proline and serine；Amino acid j ' is selected from tryptophan, isoleucine, tyrosine and alanine；Amino acid k ' is selected from tryptophan, tyrosine, glycine and aspartic acid, or be not present；Amino acid l ' is selected from tyrosine, serine, phenylalanine and tryptophan, or is not present；Amino acid m ' is selected from tyrosine, aspartic acid and serine, or is not present；Amino acid n ' is selected from tyrosine and alanine, or is not present；Amino acid o ' is selected from threonine, serine, valine, glycine and tyrosine, or is not present；Amino acid p ' is selected from glycine, aspartic acid, serine, methionine and tyrosine, or is not present；Amino acid q ' is selected from tyrosine, alanine and glycine, or is not present；Amino acid r ' is selected from tyrosine, leucine and glycine, or is not present；Amino acid s ' is glycine or is not present；Amino acid t ' is selected from methionine and leucine, or is not present；Amino acid u ' is aspartic acid；It is tyrosine with amino acid v '.

24. the antibody of claim 21, comprising at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO：833), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is selected from isoleucine, valine and leucine；Amino acid e is selected from serine, lysine and valine；Amino acid f is selected from serine, tryptophan, glycine and threonine；Amino acid g is selected from serine, asparagine and glycine；Amino acid h is selected from tyrosine, isoleucine, leucine and phenylalanine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p q r s t u v w x y z a ' b ' (SEQ ID NO：834), wherein amino acid k is alanine；Amino acid l is selected from tyrosine, phenylalanine, aspartic acid, histidine and alanine；Amino acid m is isoleucine；Amino acid n is selected from serine, alanine and glutamine；Amino acid o is proline；Amino acid p is tyrosine；Amino acid q is selected from leucine, tyrosine and phenylalanine；Amino acid r is selected from serine and glycine；Amino acid s is selected from serine, threonine and tryptophan；Amino acid t is threonine, and amino acid u is selected from serine, asparagine, lysine and isoleucine；Amino acid v is tyrosine；Amino acid w is alanine；Amino acid x is aspartic acid；Amino acid y is serine；Amino acid z is valine；Amino acid a ' is lysine；It is glycine with amino acid b '；And wherein HVR-H3 includes amino acid sequence c ' d ' e ' f ' g ' h ' i ' j ' k ' l ' m ' n ' o ' (SEQ ID NO：837), wherein amino acid c ' is serine；Amino acid d ' is arginine；Amino acid e ' is glutamic acid；Amino acid f ' is tyrosine；Amino acid g ' is tyrosine；Amino acid h ' is arginine；Amino acid i ' is tryptophan；Amino acid j ' is tyrosine；Amino acid k ' is threonine；Amino acid l ' is alanine；Amino acid m ' is isoleucine；Amino acid n ' is aspartic acid；It is tyrosine with amino acid o '.

25. the antibody of claim 21, comprising the HVR-L3 sequences containing amino acid sequence w ' x ' y ' z ' A B C D E F G, wherein amino acid w ' is glutamine；Amino acid x ' is glutamine；Amino acid y ' is selected from serine and tyrosine；Amino acid z ' is selected from serine and tyrosine；Amino acid A is selected from serine and tyrosine；Amino acid B is selected from serine and tyrosine；Amino acid C is selected from proline, serine and leucine；Amino acid D is selected from serine, proline and tyrosine, or is not present；Amino acid E is selected from leucine and phenylalanine, or is not present；Amino acid F is selected from phenylalanine, valine, threonine and isoleucine；Arginine, threonine and phenylalanine are selected from amino acid G.

26. the antibody of claim 21, comprising containing amino acid sequence Q-Q-Y-S-S-Y-S-S-L-F-T (SEQ ID NO：772) HVR-L3 sequences.

27. the antibody of claim 23, comprising corresponding to HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding to those sequences listed by clone apu17, apu18, apu19, apu20, apu21, apu22, apu23 and apu24 in Figure 11 A and 11B.

28. the antibody of claim 24, comprising corresponding to HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding to those sequences listed by clone apu2.11, apu2.12, apu2.13, apu2.14, apu2.15, apu2.16, apu2.17, apu2.18, apu2.19 and apu2.20 in Figure 17 A.

29. the antibody of claim 25, includes SEQ ID NO：79 HVR-L1 sequences, SEQID NO：80 HVR-L2 sequences and corresponding in Figure 11 C correspond to clone apu17, apu18, apu19, apu20, apu21, apu22, apu23 and apu24 listed by HVR-L3 sequences HVR-L3 sequences.

30. the antibody of claim 26, includes SEQ ID NO：79 HVR-L1 sequences, SEQID NO：80 HVR-L2 sequences and corresponding in Figure 17 B correspond to clone apu2.11, apu2.12, apu2.13, apu2.14, apu2.15, apu2.16, apu2.17, apu2.18, apu2.19 and apu2.20 listed by HVR-L3 sequences HVR-L3 sequences.

31. the antibody of claim 21, includes SEQ ID NO：330 HVR-H1 sequences, SEQID NO：339 HVR-H2 sequences, SEQ ID NO：348 HVR-H3 sequences, SEQ ID NO：79 HVR-L1 sequences, SEQ ID NO：80 HVR-L2 sequences and SEQ ID NO：357 HVR-L3 sequences.

32. the antibody of claim 21, includes SEQ ID NO：739 HVR-H1 sequences, SEQID NO：750 HVR-H2 sequences, SEQ ID NO：761 HVR-H3 sequences, SEQ ID NO：79 HVR-L1 sequences, SEQ ID NO：80 HVR-L2 sequences and SEQ ID NO：772 HVR-L3 sequences.

33. the antibody of claim 21, includes SEQ ID NO：740 HVR-H1 sequences, SEQID NO：751 HVR-H2 sequences, SEQ ID NO：762 HVR-H3 sequences, SEQ ID NO：79 HVR-L1 sequences, SEQ ID NO：80 HVR-L2 sequences and SEQ ID NO：773 HVR-L3 sequences.

34. the antibody of claim 21, comprising at least one sequence for being selected from HVR-H1, HVR-H2, HVR-H3, wherein HVR-H1 includes amino acid sequence a b c d e f g h i j (SEQ ID NO：835), wherein amino acid a is glycine；Amino acid b is phenylalanine；Amino acid c is asparagine；Amino acid d is selected from isoleucine, valine and leucine；Amino acid e is selected from lysine and methionine；Amino acid f is selected from threonine, methionine, asparagine, arginine and isoleucine；Amino acid g is selected from glycine, valine and phenylalanine；Amino acid h is selected from tyrosine, isoleucine, leucine and phenylalanine；Amino acid i is selected from isoleucine and methionine；It is histidine with amino acid j；Wherein HVR-H2 includes amino acid sequence k l m n o p q r s t u v w x y z a ' b ' (SEQ ID NO：836), wherein amino acid k is alanine；Amino acid l is tyrosine；Amino acid m is isoleucine；Amino acid n is selected from serine, isoleucine and threonine；Amino acid o is proline；Amino acid p is tyrosine；Amino acid q is selected from leucine, tyrosine, aspartic acid, serine and tryptophan；Amino acid r is glycine；Amino acid s is selected from tryptophan, valine, serine, asparagine, arginine and tyrosine；Amino acid t is threonine, and amino acid u is selected from arginine, asparagine, valine, threonine, serine and lysine；Amino acid v is tyrosine；Amino acid w is alanine；Amino acid x is aspartic acid；Amino acid y is serine；Amino acid z is valine；Amino acid a ' is lysine；It is glycine with amino acid b '；And wherein HVR-H3 includes amino acid sequence c ' d ' e ' f ' g ' h ' i ' j ' k ' l ' m ' n ' o ' (SEQ ID NO：837), wherein amino acid c ' is serine；Amino acid d ' is arginine；Amino acid e ' is glutamic acid；Amino acid f ' is tyrosine；Amino acid g ' is tyrosine；Amino acid h ' is arginine；Amino acid i ' is tryptophan；Amino acid j ' is tyrosine；Amino acid k ' is threonine；Amino acid l ' is alanine；Amino acid m ' is isoleucine；Amino acid n ' is aspartic acid；It is tyrosine with amino acid o '.

35. the antibody of claim 34, comprising corresponding to HVR-H1, HVR-H2 and HVR-H3 sequence for corresponding to those sequences listed by clone apu3.01, apu3.02, apu3.03, apu3.04, apu3.05, apu3.06, apu3.07, apu3.08, apu3.09, apu3.10 and 3.11 in Figure 23 A and 23B.

36. the antibody of claim 34 or 35, includes SEQ ID NO：79 HVR-L1 sequences, SEQ ID NO：80 HVR-L2 sequences and corresponding to SEQ ID NO：The HVR-L3 sequences of 777 HVR-L3 sequences.

37. the antibody of claim 21, includes SEQ ID NO：744 HVR-H1 sequences, SEQID NO：755 HVR-H2 sequences, SEQ ID NO：766 HVR-H3 sequences, SEQ ID NO：79 HVR-L1 sequences, SEQ ID NO：80 HVR-L2 sequences and SEQ ID NO：777 HVR-L3 sequences.

38. the antibody of claim 21, includes SEQ ID NO：795 HVR-H1 sequences, SEQID NO：807 HVR-H2 sequences, SEQ ID NO：819 HVR-H3 sequences, SEQ ID NO：79 HVR-L1 sequences, SEQ ID NO：80 HVR-L2 sequences and SEQ ID NO：777 HVR-L3 sequences.

39. the antibody of claim 9, includes SEQ ID NO：701 HVR-H1 sequences, SEQID NO：712 HVR-H2 sequences, SEQ ID NO：723 HVR-H3 sequences, and SEQ IDNO：79 HVR-L1 sequences, and SEQ ID NO：80 HVR-L2 sequences, and SEQ IDNO：734 HVR-L3 sequences.

40. the antibody of the separation of antigenic determinant on a kind of antibody binding identical polyubiquitin with any one of claim 1-39, the wherein antibody are not specifically bound with single ubiquitin.

41. a kind of antibody of the separation combined with any one of claim 1-39 antibody competition with polyubiquitin, the wherein antibody are not specifically bound with single ubiquitin.

42. any one of claim 1-39 antibody, the wherein antibody are combined with polyubiquitin protein-specific.

43. the antibody of claim 42, the wherein antibody suppress the degraded of polyubiquitin albumen.

44. the antibody of claim 42, the wherein antibody adjust the signal transduction path of at least one polyubiquitin mediation.

45. the antibody of claim 42, the wherein antibody suppress the signal transduction path of at least one polyubiquitin mediation.

46. the antibody of claim 42, the wherein antibody stimulate the signal transduction path that at least one polyubiquitin is mediated.

47. a kind of nucleic acid molecules for the antibody for encoding any one of claim 1-39.

48. a kind of carrier of the nucleic acid comprising claim 47.

49. a kind of host cell of the carrier comprising claim 48.

50. a kind of cell line for the antibody that can produce any one of claim 1-39.

51. a kind of method for the antibody for producing any one of claim 1-39, it is included therein and produces the host cell that culture under conditions of the antibody includes the nucleic acid molecules for encoding the antibody.

52. a kind of any one of claim 1-39 comprising effective dose antibody and the composition of pharmaceutically acceptable carrier.

53. a kind of method for identifying that polyubiquitin or polyubiquitin albumen are present in sample, including sample is contacted with any one of at least one claim 1-39 antibody.

54. a kind of method for being used to treat disease related to polyubiquitin imbalance in patient or illness, antibody of this method including giving any one of at least one claim 1-39 of patient effective amounts.

55. the method for claim 54, wherein patient are mammalian subjects.

56. the method for claim 55, wherein patient are people.

57. the method for claim 54, wherein disease are selected from the related hereditary conditions of cancer, disorder of muscle, ubiquitin-pathway, immune/inflammatory conditions and the nervous system disease.

58. the method for claim 57, wherein disease are selected from cancer, lymthoma, enblastoma, sarcoma, leukaemia, muscular dystrophy, multiple sclerosis, amyotrophic lateral sclerosis, cystic fibrosis, Angelman ' s syndromes, Liddle syndrome, Alzheimer's, Parkinson's disease, Pick disease and Paget disease.

59. a kind of method for determining to suspect that polyubiquitin or polyubiquitin albumen are present in the sample containing polyubiquitin or polyubiquitin albumen, including expose the samples to any one of at least one claim 1-39 antibody and determine the combination of polyubiquitin or polyubiquitin albumen at least one antibody and sample.

The method of polyubiquitin albumen and non-poly ubiquitination albumen in sample is separated 60. a kind of, including sample is contacted with any one of at least one claim 1-39 antibody.

The method of the function of polyubiquitin and/or activity in cell is determined 61. a kind of, including cell is contacted with any one of at least one claim 1-39 antibody and influence of the contact procedure to cell is assessed.

The method of the function of polyubiquitin and/or activity in sample is determined 62. a kind of, including sample is contacted with any one of at least one claim 1-39 antibody and influence of the contact procedure to sample is assessed.The antibody for the separation that a kind of first polyubiquitin of the first lysine residue with being bonded to comprising at least one isopeptide bond at the first amino acid position of ubiquitin molecule is specifically bound, second polyubiquitin of wherein the second lysine residue of the antibody not with being bonded to comprising at least one isopeptide bond at the second amino acid position of ubiquitin molecule is specifically bound, and wherein the first and second amino acid positions are different.

63. the epitope in the polyubiquitin of the antibody of the separation of claim 21, wherein the antibody binding lysine -63 connection.

64. the antibody of the separation of claim 63, wherein the epitope includes the residue in the first ubiquitin subunit and the second ubiquitin subunit of the polyubiquitin that lysine -63 is connected.

65. the antibody of the separation of claim 64, wherein the epitope includes the residue at least one first ubiquitin subunit selected from Glu-18, Pro-19, Ser-20, Asp-21, Thr-55, Leu-56, Ser-57, Asp-58, Asn-60, Ile-61 and Gln-62.

66. the antibody of the separation of claim 64, wherein the epitope includes the residue at least one second ubiquitin subunit selected from Leu-8, Thr-9, Glu-34, Gly-35, Ile-36, Pro-37, Asp-39, Gln-40, Leu-71, Arg-72, Leu-73, Arg-74 and Gly-75.

67. the antibody of the separation of claim 64, wherein described epitope includes the residue at least one first ubiquitin subunit selected from Glu-18, Pro-19, Ser-20, Asp-21, Thr-55, Leu-56, Ser-57, Asp-58, Asn-60, Ile-61 and Gln-62, and the residue at least one second ubiquitin subunit selected from Leu-8, Thr-9, Glu-34, Gly-35, Ile-36, Pro-37, Asp-39, Gln-40, Leu-71, Arg-72, Leu-73, Arg-74 and Gly-75.

68. a kind of antigen-binding fragment of any one of claim 1-39 or 63-67 antibody.

Images