CN101372677B - Bacillus and use thereof in aromatic ketone unsymmetrical reduction - Google Patents

Abstract

The invention discloses a bacillus (Bacillus sp ECU0013) with the culture collection number being CGMCC No. 2549, and the application of the bacillus which is taken as a catalyst to reduce prochiral arone. The bacterial strain bacillus (Bacillus sp ECU0013) has the advantages that the selectivity is high, the substrate tolerance is high, the bacillus can help coenzyme to regenerate by glucose, thepreparation is easy, and the like, which is an efficient strain expected to be used in industrial production.

Description

Genus bacillus and the application in the aryl ketones asymmetric reduction thereof

Technical field

The present invention relates to bacillus and uses thereof, more particularly relate to the method that this genus bacillus catalytic asymmetric reduction prochirality aryl ketones obtains optical pure chiral aryl alcohol.

Background technology

Chirality is nature and organic important phenomenon, and along with to the going deep into of chirality phenomenon research, increasing single enantiomer is applied to medicine, essence and flavoring agent, agricultural chemicals and LCD product.The chiral centre of chiral alcohol is connected to an active functional group " OH ", makes such material become the key intermediate of many quiral products when synthetic.The aryl chiral alcohol be many medicines important chiral intermediate, for example: 2-chloro-1-phenylethyl alcohol is exactly synthetic fluoxetine (Fluoxetine), the important as precursors of tomoxetine (Tomoxetine) and nisoxetine (Nisoxetine).Fluoxetine (Fluoxetine) also is a kind of potent thymoleptic, and to many illnesss, as anxiety, alcoholism, chronic pain, obesity, gluttony, apocleisis better curative effect is arranged all.Tomoxetine (Tomoxetine) is the first NRI, with α-or β-adrenergic receptor do not have strong bonding force, be a kind of thymoleptic, the drug effect of its (R)-(-)-isomer is than 9 times of its mapping heights.By the asymmetric reduction of biocatalysis prochirality carbonyl compound, can obtain the chiral alcohol of theoretical yield 100%, have very important theory significance and application prospect.Though chemical catalysis has been obtained certain progress, biocatalysis has caused extensive concern with its highly selective, security and advantages of environment protection.But the reduction reaction of biocatalysis also exists in actual production challenges such as the substrate tolerance is low, regenerating coenzyme costliness, make present redox enzymes biological catalyst realize that the ratio of industrial application is less than 14%, the industrial application rate is very low, and the true tumor catalyzer of therefore seeking excellent performance is one of effective way of development biological reducing.

Summary of the invention

One of the object of the invention is, the bacterial strain of the multiple prochirality aryl ketones of a kind of energy asymmetric reduction is provided;

Two of the object of the invention is, a kind of method of using above-mentioned bacterial strains asymmetric reduction prochirality aryl ketones is provided.

The present inventor is from soil, through primary dcreening operation, multiple sieve and separation and purification, obtain the genus bacillus (Bacillus sp.ECU0013) of strain energy asymmetric reduction prochirality aryl ketones, this bacterial strain is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) on June 18th, 2008, and preserving number is: CGMCC No.2549.

Bacillus sp.ECU0013 (CGMCC No.2549) has following feature:

1. size and form

Shaft-like, size 2～3 μ m, Gram-negative;

2. be fit to growing environment

Can survive in pH5～9 environment 10～40 ℃ of temperature;

3. the dull and stereotyped colony characteristics of cultivating

Concentric circles; Prominent umbilical; Faint yellow.

The technical solution used in the present invention:

The screening method of catalysis aryl ketones asymmetric reduction bacterial classification may further comprise the steps: from gathering soil sample in the zone as far as possible widely, and the moistening soil layer collection that soil sample should be below underground 5cm; (2～10mM) substrate is as carbon source, and after the adding soil sample, in 30 ℃, 160rpm cultivates 1-6d for dress 50mL liquid nutrient medium A and finite concentration in the Erlenmeyer flask of 250mL.Afterwards this nutrient solution is coated on the solid medium B, cultivated 3d for 30 ℃, the single bacterium colony that grows carries out the plate streaking separation and purification.

Identify that through 16S rDNA confirm that this bacterial strain is genus bacillus (Bacillus sp.), label is Bacillus sp.ECU0013.

Bacterial strain of the present invention can be used as catalyzer, asymmetric reduction prochirality aryl ketones, and production method comprises the following steps:

1. the cultivation of bacterial strain

With the method for described bacillus sp.ECU0013 employing this area routine, in fermention medium, carry out amplification cultivation 8～24h, 20～40 ℃ of temperature; Again with this nutrient solution as seed, be 1～10% (v/v) based on the inoculum size of fermention medium volume, be seeded in the fermention medium, cultivate 24～48h, the centrifugal resting cell that obtains on the shaking table of 100～160rpm down at 20～40 ℃;

Described fermention medium can adopt conventional substratum, and its components contents is as follows: dextrin 10～50g, yeast extract paste 5g/L, peptone 1～20g, KH ₂PO ₄1～10g, K ₂HPO ₄1～10g, NaCl0.1～2g, MgSO ₄0.1～2g, water 1000ml, pH3～8.

Resting cell with results, be suspended in pH and be in 6.0～9.0 the phosphate buffer solution, add prochiral substrate aryl ketones, concentration is 1～200mM, constant temperature shaking table oscillatory reaction 3～96h at 20～50 ℃ and 100～160rpm collects product then from reaction system.The content of resting cell in phosphoric acid buffer is 10～500g (weight in wet base)/L.

Beneficial effect of the present invention: the present invention's screening obtains a bacillus as catalyzer, asymmetric reduction prochirality aryl ketones, have the stereoselectivity height, the substrate tolerance is strong, and can be by advantages such as cheap glucose realization regenerating coenzymes, biological catalyst is easy to preparation in addition, the reaction conditions gentleness has certain industrial application DEVELOPMENT PROSPECT.The 2-chloro-1-methyl phenyl ketone that reducible in an embodiment concentration is 50mM, the transformation efficiency of reaction reaches more than 90%, enantiomeric excess value (e.e.) still keeps〉99%.

Embodiment

By the following examples technology contents of the present invention is further described.Its purpose only is to understand content of the present invention better, and unrestricted protection scope of the present invention.

Embodiment 1

The screening of bacterial strain

Bacillus cell of the present invention (Bacillus sp.ECU0013) is a kind of bacterial strain that belongs to the bacterium Bacteroides, and this bacterial strain system separates from soil, obtains through behind the multi-turns screen.According to 16S rDNA molecular biology identification result, the homology of this bacterium and genus bacillus (Bacillus sp.) is 99%.

The method of screening above-mentioned aryl ketones asymmetric reduction bacterial strain is: from gathering soil sample in the zone as far as possible widely, and the moistening soil layer collection that soil sample should be below underground 5cm; (2～10mM) substrate is as carbon source, and after the adding soil sample, in 30 ℃, 160rpm cultivates 1-6d for dress 50mL liquid nutrient medium A and finite concentration in the Erlenmeyer flask of 250mL.Afterwards this nutrient solution is coated on the solid medium B, cultivated 3d for 30 ℃, the single bacterium colony that grows carries out the plate streaking separation and purification.The culture medium A of using is: (NH ₄) ₂SO ₄2g/L, KH ₂PO ₄2g/L, yeast extract paste 2g/L, NaCl1g/L, MgSO ₄0.2g/L, mixed trace elements (CoCl ₂0.28g/L, ZnSO ₄7.0g/L, MnSO ₄H ₂O1.1g/L, CuSO ₄0.48g/L, EDTANa ₂2H ₂O15.8g/L, FeSO ₄7H ₂O1.6g/L, Na ₂MoO ₄2H ₂O0.34g/L, pH7.2); Substratum B is: glucose 15g/L, Na ₂HPO ₄0.5g/L, peptone 5g/L, NaH ₂PO ₄0.5g/L, yeast extract paste 5g/L, MgSO ₄0.5g/L, NaCl1g/L, pH7.0; The substrate aryl ketones is a 2-chloro-1-methyl phenyl ketone.

With single colony inoculation of obtaining in liquid nutrient medium B, at 30 ℃, after 160rpm cultivated 48h, (0.1～0.5g) was suspended in 1mL phosphoric acid buffer (PBS, 50mM to get a certain amount of wet cell, pH7.0) in, add substrate 2-chloro-1-methyl phenyl ketone (10mM is with the ethanol hydrotropy) and 5% glucose, at 30 ℃, 1, react 24h under the 100rpm condition.After reaction finishes, use thin plate chromatography (TLC) assay products/substrate ratio, select the high bacterial strain of proportion of products to carry out multiple sieve.

In the multiple sieve, the cultural method and the reaction conditions of thalline are the same, centrifugal after the reaction end (12,000rpm, 5min), the supernatant liquor of collection is got upper organic phase with ethyl acetate extraction twice, uses anhydrous Na ₂SO ₄Dried overnight is carried out gas chromatographic analysis, measures product content and enantiomeric excess (e.e.) value.

The selection result is that the bacterial strain catalysis biological when reduction product that is numbered ECU0013 has high enantiomeric excess value.

Determine that through gramstaining selected bacterial strain is a gram negative bacterium, use 16S rDNA method to carry out strain identification.

Bacterial strain ECU0013 is carried out single bacterium colony cultivate, extract total DNA afterwards, electrophoresis detection.

With total DNA is template pcr amplification goal gene: 30 μ L systems, dna profiling 4 μ L, each 1 μ L of universal primer, Buffer3 μ L, dNTP2 μ L (2.5mM), Taq enzyme 1 μ L, distilled water 18 μ L.

Electrophoresis determines that carrying out goal gene after the amplification gene size correctly reclaims, and electrophoresis confirms that the gene that reclaims is correct.

Connect: 10 μ L systems connect liquid 5 μ L, T carrier (pUC18) 1 μ L, PCR product 4 μ L.16 ℃ connect 16h.

Transform: goal gene is transformed into bacillus coli DH 5 alpha.

The Lan Bai screening is selected white single bacterium and is cultivated, and the bacterium liquid that obtains carries out bacterium colony PCR as template, and condition is the same.Send to order-checking after the gene electrophoresis detection that obtains.

Sequencing result is

CGGTACCCGGGGATCCTCTAGAGATTAGAGTTTGATCCTGGCTCAGG

ACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGGACAGATGGG

AGCTTGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACC

TGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGT

TGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTAC

AGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGG

CAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAG

ACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATG

GACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGAT

CGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTA

CCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCC

GCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGG

CTCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGG

AGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATT

CCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGA

AAGCGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGAAAGCGTGGGGAG

CGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAA

GTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTC

CGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGGG

CCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAAC

CTTACCAGGTCTTGACATCCTCTGACAATCCTAGAGATAGGACGTCCCCTTC

GGGGGCAGAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAG

ATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGC

ATTCAGTTGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAGGT

GGGGATGACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGTGCT

ACAATGGACAGAACAAAGGGCAGCGAAACCGCGAGGTTAAGCCAATCCC

ACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGAAGC

TGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCGG

GCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGT

CGGTGAGGTAACCTTTTAGGAGCCAGCCGCCGAAGGTGGGACAGATGATT

GGGGTGAAGTCGTAACAAGGTAGCCGTAAATCGTCGACCTGCAGGCATGC

AAGCTtG

Through sequence alignment, the homology of this bacterium and genus bacillus (Bacillus sp.) is 99%.Name the sp.ECU0013 for Bacillus, and be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) on June 18th, 2008, preserving number is: CGMCC No.2549.

Embodiment 2

With the method for described bacillus sp.ECU0013 employing this area routine, in fermention medium, carry out amplification cultivation 8～24h, 20～40 ℃ of temperature;

Again with this nutrient solution as seed, be 1～10% (v/v) based on the inoculum size of fermention medium volume, be seeded in the fermention medium, cultivate 24～48h, the centrifugal resting cell that obtains on the shaking table of 100～160rpm down at 20～40 ℃;

Said fermention medium can adopt conventional substratum, and its components contents is as follows: dextrin 10～50g, yeast extract paste 5g/L, peptone 1～20g, KH ₂PO ₄1～10g, K ₂HPO ₄1～10g, NaCl0.1～2g, MgSO ₄0.1～2g, water 1000ml, pH3～8.

Embodiment 3～14

Get a certain amount of above-mentioned cultivation the genus bacillus wet cell (0.1～0.5g) be suspended in the 1mL phosphoric acid buffer (PBS, 50mM, pH7.0) in, add the substrate methyl phenyl ketone (10 of 5% glucose and different concns, 30,50,100,150,200mM is with the ethanol hydrotropy) or 2-chloro-1-methyl phenyl ketone (10,30,50,100,150,200mM is with the ethanol hydrotropy), at 30 ℃, 1, react certain hour under the 100rpm condition.Centrifugal after the reaction end (12,000rpm, 5min), the supernatant liquor of collection adds ethyl acetate extraction twice, gets upper organic phase, uses anhydrous Na ₂SO ₄Dried overnight is carried out gas-chromatography (adopting island functional activities of the body fluid chromatography GC-14, chiral capillary column SUPCOL DEX β-120) and is analyzed, and measures the content and enantiomeric excess (e.e.) value of product.

Embodiment 15～23

Get a certain amount of above-mentioned cultivation the genus bacillus wet cell (0.01～0.5g) be suspended in the 1mL phosphoric acid buffer (PBS, 50mM, pH7.0) in, add 5% glucose and different substrates (10mM is with the ethanol hydrotropy), at 30 ℃, 1, react certain hour under the 100rpm condition.Centrifugal after the reaction end (12,000rpm, 5min), the supernatant liquor of collection is got upper organic phase with ethyl acetate extraction twice, uses anhydrous Na ₂SO ₄Dried overnight is carried out gas-chromatography (adopting island functional activities of the body fluid chromatography GC-14, chiral capillary column SUPCOL DEX β-120) and is analyzed, and measures the content and enantiomeric excess (e.e.) value of product.

Embodiment 24

The genus bacillus wet cell of getting the above-mentioned cultivation of 10g be suspended in the 100mL phosphoric acid buffer (PBS, 50mM, pH8.0) in, add 5% glucose and 1g2-chloro-1-methyl phenyl ketone (with the ethanol hydrotropy), at 30 ℃, reaction is 24 hours under the mechanical stirring condition.Reaction finish the back centrifugal (8,000rpm, 10min), the supernatant liquor of collection with ethyl acetate extraction three times after, add saturated NaCl solution again and wash once.Get upper organic phase, use anhydrous Na ₂SO ₄Dried overnight, use silica gel column chromatography (eluent is: petrol ether/ethyl acetate: 2:1～10:1, v/v) after, vacuum-drying product (R)-2-chloro-1-phenylethyl alcohol.Product can be used gas-chromatography (adopting island functional activities of the body fluid chromatography GC-14, chiral capillary column SUPCOL DEX β-120) assay determination enantiomeric excess (e.e.) value.

Yield: 71.8%; Ee:〉99.9%; [α] _D ²⁵=-48.8 (c1.00, CHCl ₃).

Claims (10)

1. a plant height is imitated catalysis aryl ketones asymmetric reduction bacterial classification, and genus bacillus (Bacillussp.) ECU0013 is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC), and preserving number is CGMCC No.2549.

2. a bacterial strain as claimed in claim 1 is as the application of catalyzer in the asymmetric reduction aryl ketones.

3. bacterial strain as claimed in claim 2 is characterized in that comprising the step of following biological reducing prochirality aryl ketones as the application of catalyzer in the asymmetric reduction aryl ketones:

A. the fermentation culture preserving number is the genus bacillus (Bacillus sp.) of CGMCC No.2549, centrifugal acquisition resting cell; Resting cell is suspended in the buffered soln that has added glucose;

B. in above-mentioned buffered soln, add the prochirality aryl ketones, add the organic cosolvent of reaction system volume 1%～20%, produce corresponding optical pure chiral aryl alcohol through asymmetric reduction reaction;

C. reaction solution through separate, purifying obtains target product optical purity (S)-or (R)-aryl alcohol.

4. application according to claim 3 is characterized in that: described fermention medium component of step a and content are as follows: dextrin 10～50g, peptone 1～20g, KH ₂PO ₄1～10g, K ₂HPO ₄1～10g, NaCl 0.1～2g, MgSO ₄0.1～2g, water 1000ml, pH 3～8.

5. application according to claim 3 is characterized in that: the resting cell concentration of genus bacillus described in the step a is counted 10～500g/L with weight in wet base.

6. application according to claim 3 is characterized in that: the concentration of prochirality aryl ketones is 1～200mM described in the described reaction system of step b.

7. application according to claim 3 is characterized in that: the described asymmetric reduction reaction temperature of step b is 20～50 ℃, and the reaction times is 3～96 hours.

8. application according to claim 3 is characterized in that: the described buffered soln of step a is the phosphate buffer solution of pH 6～9, and the addition of glucose is 1～10% mass concentration.

9. application according to claim 3 is characterized in that: the described organic cosolvent of step b is selected from one or more the mixture in methyl alcohol, ethanol, dimethyl sulfoxide (DMSO) or the dimethyl formamide.

10. application according to claim 3 is characterized in that: the structural formula of described prochirality aryl ketones is:

(1) R in ₁Elect as-Cl ,-Br or-OCH ₃R ₂Elect as-CH ₃,-C ₂H ₅,-CH ₂Cl or-CH ₂Br;

(2) Ar elects 2-pyridyl, 3-pyridyl, 4-pyridyl or 2-thienyl as in.