CN101368208B - Ground cover chrysanthemum strain type stoloniferous numerator mark auxiliary selection method - Google Patents
Ground cover chrysanthemum strain type stoloniferous numerator mark auxiliary selection method Download PDFInfo
- Publication number
- CN101368208B CN101368208B CN2008101561722A CN200810156172A CN101368208B CN 101368208 B CN101368208 B CN 101368208B CN 2008101561722 A CN2008101561722 A CN 2008101561722A CN 200810156172 A CN200810156172 A CN 200810156172A CN 101368208 B CN101368208 B CN 101368208B
- Authority
- CN
- China
- Prior art keywords
- primer
- chrysanthemum
- ground
- dna
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an auxiliary selecting method of a ground-cover chrysanthemum plant type creeping molecule mark, which belongs to the technical field of biology and which can be used for auxiliary selecting and breeding for the ground-cover chrysanthemum plant type creeping molecule mark. RAPD primer A-10 or an SCAR primer is used to augment ground-cover chrysanthemum or the breeding material DNA; if the fragment of 555bp can be augmented, the existence of a ground-cover chrysanthemum creeping is proofed. The method takes 152 plants of F1 segregation population obtained by taking 'early red Italy' (P1) as a female parent and takes 03(6)-12 as a male parent (P2) as the testing materials to build a plant type creeping/vertical gene pool to carry out screening on the RAPD and SCAR molecule marks, which can effectively develop the auxiliary breeding for the ground-cover chrysanthemum plant type creeping molecule mark and greatly improve the selecting efficiency, thereby quickening the breeding process.
Description
One, technical field
The invention discloses a kind ofly by crawling property of chrysanthemum plant type molecular marker-assisted selection method, belong to biological technical field, be used for by the molecular marker assisted selection breeding of crawling property of chrysanthemum plant type.
Two, background technology
Ground is chrysanthemum new product population (Wang Pengwei etc., 1990 that last century, the eighties was at first proposed by the pleased academician of Chen Jun by chrysanthemum; Chen JY et al.1995).Have plant type short or crawl, multi-branched, strong resistance, wide adaptability, moulding is fast, covering power is strong, the characteristics such as dense of blossoming, possess greening simultaneously, beautify, coloured silkization and sweetening treatment comprehensive function, Landscape Application prospect very wide (Yu Zhongxiang, 2004).Plant type be by one of important character of chrysanthemum, creeping type ground-cover chrysanthemum is little because of the branch crotch angle, the aerial growth of crawling is built by view with being more suitable for.
At present, plant type Genetic Control and molecule marking research mainly concentrate on the model plant Arabidopis thaliana, and (Ji Yi etc., 2006 on field crop such as paddy rice, wheat, corn and the vegetable crops such as tomato, Kidney bean; Zhang Peitong etc., 2006; Li Peijin etc., 2003), heredity of ornamental plant plant type and molecule marker rarely have research, and ground is not appeared in the newspapers by the molecule marker of crawling property of chrysanthemum plant type as yet.
The SCAR mark is the fragment sequence according to the RAPD mark, and synthetic a pair of Auele Specific Primer increases to genome, and long primer has reduced non-specific amplification effectively, has improved the stability of SCAR technology.So, in the molecular marker assisted selection breeding practice, usually the RAPD mark is converted into more stable SCAR mark (Xu Yong etc., 2000; Ma Shaoqin etc., 2006; Kingly way outstanding person etc., 2006).What this research will obtain is converted into more stable and effective SCAR mark with ground by the chrysanthemum linked molecule marker of proterties controlling gene of crawling, for the clone of creeping type ground-cover chrysanthemum breeding of new variety, molecular mark and crawling property genes involved lays a good foundation.
Three, summary of the invention
Technical problem the objective of the invention is: filter out one or several with ground by the closely linked molecule marker of crawling property of chrysanthemum plant type gene; Set up ground by the chrysanthemum plant type molecular marker assisted selection system of crawling; Thereby improve ground by the crawl efficiency of selection of plant type of chrysanthemum, for the creeping type ground-cover chrysanthemum breeding of new variety lays the foundation.
Technical scheme embodiment of the present invention are following:
By crawling property of chrysanthemum plant type molecular marker-assisted selection method, it is characterized in that a kind ofly:
With RAPD primer A-10, sequence is 5 '-GTGATCGCAG-3 '
Amplification creeping type ground-cover chrysanthemum or breeding material DNA, if can amplify the fragment of 555bp, then sign lands by the crawl existence of gene of chrysanthemum;
Perhaps use SCAR primer SCA10,
Upstream primer sequence: 5 '-GTGATCGCAGGAACAACC-3 '
Downstream primer sequence: 5 '-GTGATCGCAGCCGCTTGA-3 '
Amplification creeping type ground-cover chrysanthemum or breeding material DNA, if can amplify the fragment of 555bp, then sign lands by the crawl existence of gene of chrysanthemum;
2, according to claim 1 a kind ofly by crawling property of chrysanthemum plant type molecular marker-assisted selection method, the RAPD primer A-10 that wherein adopts and two kinds of molecule marker primers of SCAR primer SCA10 obtain through following method screening:
1) adopt the CTAB micromethod to extract genomic dna;
2) according to BSA (Bulked Segregant Analysis) method principle, respectively from F
1Select in the plant type segregating population extremely to crawl and each 10 strain of axial individual plant, with the genomic dna of dilution respectively balanced mix constitute crawl gene pool and upright gene pool;
3) screening of labeled primer:
The PTC-100 that pcr amplification reaction is produced in MJ Research company
TMCarry out on the type PCR appearance.Reaction system is totally 20 μ L, comprising: 10 * Buffer2 μ L, 1.625mmolL
-1MgCl
2, 75 μ molL
-1DNTP, 40ng template DNA, 1.5U Taq polymerase (TaKaRa), 1.5 μ molL
-1RAPD primer (synthetic), use ddH by Nanjing Sheng Xing biotech company
2O polishing 20 μ L.
Response procedures is 94 ℃ of preparatory sex change 4min, gets into following circulation then: 94 ℃ of sex change 15s, and 35 ℃ of renaturation 15s, 72 ℃ are extended 1min15s, 3 circulations; 94 ℃ of sex change 30s, 40 ℃ of renaturation 30s, 72 ℃ are extended 1min15s, 40 circulations; Last 72 ℃ are extended 7min; 4 ℃ of insulations.
Get 7 μ L amplified productions electrophoresis in 2% sepharose, through EB dyeing, electrode buffer is 1 * TAE, voltage 5V/cm.Utilize JS-380 gel imaging analysis appearance (Shanghai Peiqing Science Co., Ltd) to observe and take pictures, the record polymorphic bands.Thereby obtain one with ground by the chrysanthemum linked molecule marker A-10555 of proterties controlling gene that crawls.
Utilize DNA purifying and recovering test kit (TaKaRa Agarose Gel DNAPurification Kit Ver.2.0) recovery, the purifying A-10 of the precious biotech firm in Dalian
555Specific DNA fragment (555bp).Transformed into escherichia coli DH5 α behind the connection pGEM-T EasyVector plasmid vector, screening, evaluation A-10
555The specific DNA fragment recombinant plasmid, and entrust the order-checking of Shanghai Ying Jun Bioisystech Co., Ltd.
According to A-10
555The specific DNA fragment sequencing result, special primer SCA10 (upstream primer sequence: 5 '-GTGATCGCAGGAACAACC-3 ', the downstream primer sequence: 5 '-GTGATCGCAGCCGCTTGA-3 ' of utilizing software Primer Premier to design; Entrust Shanghai Ying Jun Bioisystech Co., Ltd to synthesize), carry out the SCAR amplification, contain 2.5 μ L10 * Buffer in the reaction system of 25 μ L, 1.5 μ L25mM MgCl
2, 2.0 μ L2.5mMdNTP, 1U Taq archaeal dna polymerase, 1.5 μ molL
-1The SCAR primer, the 20ng template DNA is used ddH
2O polishing 25 μ L.
The PCR response procedures is 94 ℃ of preparatory sex change 5min, gets into following circulation then: 94 ℃ of sex change 1min, and 67 ℃ of renaturation 1min, 72 ℃ are extended 1min, 35 circulations; Last 72 ℃ are extended 10min; 4 ℃ of insulations.Get 7 μ L amplified productions electrophoresis in 2% sepharose, through EB dyeing, electrode buffer is 1 * TAE, voltage 5V/cm.Utilize JS-380 gel imaging analysis appearance (Shanghai Peiqing Science Co., Ltd) to observe and take pictures, record polymorphic bands 555bp.
Thereby obtain one with ground by the chrysanthemum linked molecule marker SCA10 of proterties controlling gene that crawls
555
Beneficial effect the present invention selects for use is be that female parent, 03 (6)-12 is the 152 strain F that male parent (P2) is hybridized acquisition (P1) with ' Italian red early '
1Segregating population is the examination material, make up plant type to crawl/upright gene pool carry out by the screening of crawling property of chrysanthemum plant type molecule marker and the foundation of molecular marker assisted selection system.With present compared with techniques, its advantage is:
(1) mark is stable.This research with plant type crawl/upright gene pool is a material, identifies 1 of RAPD mark, and is converted into more stable SCAR mark, with these marks offspring's individual plant is detected respectively, shows that this mark performance stablizes, and does not receive the influence of envrionment conditions.
(2) the molecular marker assisted selection system is easy to operate, can overcome by the chrysanthemum difficulty that the character gene type identifies of crawling.Range of choice is wider, and intensity is bigger.The conventional selection cycle of creeping type ground-cover chrysanthemum is long, time-consuming effort again.Explored simple and easy, rapid extraction ground by the method for chrysanthemum DNA through the present invention; Filtered out with ground and be used for assisted Selection, and set up the Fast Detection Technique of PCR product by crawl proterties controlling gene linked 1 RAPD mark and 1 SCAR molecule marker of chrysanthemum; The molecular marker-assisted selection method of setting up can be realized selecting ahead of time seedling stage, reduces workload, improves the efficiency of selection of creeping type ground-cover chrysanthemum greatly, thereby accelerates breeding process.
Four, description of drawings
Fig. 1 RAPD primer A-10 is at Liang Chi, two parents and F
1Middle part individual plant DNA cloning result
C: the gene pool of crawling; E: upright gene pool; P1: Italian red early; P2:03 (6)-12; 1-12: the individual plant of crawling; M:Ladder DNA; The upright individual plant of 13-24; 21: the reorganization individual plant
Fig. 2 RAPD primer A-10 is to the pcr amplification product of the intragroup part individual plant of F1 DNA
Fig. 3 SCAR primer SAC10 is at Liang Chi, two parents and F
1Middle part individual plant DNA cloning result
Fig. 4 SCAR primer SAC10 is to F
1The pcr amplification product of intragroup part individual plant DNA
Five, embodiment
(1) materials and methods
Supply the examination material for " ground that Chinese Chrysanthemum germ plasm resource is preserved " center " openly externally to be provided is that female parent, 03 (6)-12 is that 152 strains that male parent (P2) hybridization obtains comprise uprightly, crawl and osculant F by chrysanthemum kind 03 (6)-12 (P1) with potted plant little chrysanthemum kind ' Italian red early ' and with ' Italian red early '
1The plant type segregating population.(mensuration of crotch angle was carried out seedling stage, with the angle of protractor measurement one-level master's branch bearing of trend and ground level, averaged to adopt the method for surveying crotch angle.Crotch angle is divided into 9 rank differences, and 0～10 ° is 1 grade, and 11～20 ° is 2 grades, and by that analogy, 81～90 ° is 9 grades.The regulation crotch angle is in the plant type of crawling that is of 1,2,3 grade of scope; 4,5,6 grades is osculant; 7,8,9 grades are upright plant type) the individual plant plant type is identified carry out the screening and the linkage analysis of molecule marker, the recombination fraction calculation formula is: recombination fraction=recombinant type plant number/total strain number * 100%.Utilize the Kosambi function with recombination fraction be converted into genetic distance (Centimorgan, cM).
(2) the molecular marker screening analysis mainly utilizes RAPD mark and SCAR mark.
The CTAB micromethod is adopted in the extraction of this test DNA, and (Science Press 2001:9-17), Lambda DNA agarose gel electrophoresis detection DNA concentration and quality, transfers to 20ng μ L with concentration at last for Zou Yuping etc., the molecule marker in system and the theory of evolution [M]
-1
According to BSA (Bulked Segregant Analysis) method principle, respectively from F
1Select in segregating population 152 strains extremely to crawl and each 10 strain of axial individual plant, with the genomic dna of dilution respectively balanced mix constitute crawl gene pool and upright gene pool.
With 200 RAPD primers (synthetic) by Nanjing Sheng Xing biotech company to the screening of increasing of crawl gene pool and upright gene pool.
The PTC-100 that pcr amplification reaction is produced in MJ Research company
TMCarry out on the type PCR appearance.Reaction system is totally 20 μ L, comprising: 10 * Buffer2 μ L, 1.625mmolL
-1MgCl
2, 75 μ molL
-1DNTP, 40ng template DNA, 1.5U Taq polymerase (TaKaRa), 1.5 μ molL
-1RAPD primer (synthetic), use ddH by Nanjing Sheng Xing biotech company
2O polishing 20 μ L.
Response procedures is 94 ℃ of preparatory sex change 4min, gets into following circulation then: 94 ℃ of sex change 15s, and 35 ℃ of renaturation 15s, 72 ℃ are extended 1min15s, 3 circulations; 94 ℃ of sex change 30s, 40 ℃ of renaturation 30s, 72 ℃ are extended 1min15s, 40 circulations; Last 72 ℃ are extended 7min; 4 ℃ of insulations.
Get 7 μ L amplified productions electrophoresis in 2% sepharose, through EB dyeing, electrode buffer is 1 * TAE, voltage 5V/cm.Utilize JS-380 gel imaging analysis appearance (Shanghai Peiqing Science Co., Ltd) to observe and take pictures, the record polymorphic bands.
Wherein A-10 (5 '-GTGATCGCAG-3 ') primer detects polymorphum between two gene pools, promptly in the gene pool of crawling, amplifies special 555bp dna fragmentation, and in upright gene pool, is not amplifying corresponding D NA fragment.
Thereby obtain one with ground by the chrysanthemum linked molecule marker A-10 of proterties controlling gene that crawls
555(Fig. 1).
Utilize DNA purifying and recovering test kit (TaKaRa Agarose Gel DNAPurification Kit Ver.2.0) recovery, the purifying A-10 of the precious biotech firm in Dalian
555Specific DNA fragment (555bp).Transformed into escherichia coli DH5 α behind the connection pGEM-T EasyVector plasmid vector, screening, evaluation A-10
555The specific DNA fragment recombinant plasmid, and entrust Shanghai Ying Jun Bioisystech Co., Ltd to check order, obtain A-10
555Fragment sequence is (the italic thickened portion is the RAPD primer sequence, and underscore partly is the SCAR primer sequence) as follows:
5’-
GTGATCGCAGGAACAACCTCGGAGACAATCCACTGACCAGAGTAGCAACCGTA
ACAACAACTACCGCGGCCAGGGGAGCGGACGGGATAATGACAGATATACCCACTA
ACCAAGACTCCAAAGGAGATATTCGCGACGGAAGGCGCGAACTTCCCAAGACCC
CCACCAATGCGCACCCCAGAGGATCGACGCGTGGGGAGTAGATACTGTGACTATC
ATGGGAAGAAGGGCCACACCACCAATGAATGTTTCCAATTGCGCCAGTTAATTGAT
AAACTAGTAAAAGAAGGCAGATTGGACCATCTGGTCAAGAACATCAAGGAGGGA
AAAGATAGGCAGAAAATTGGGAGAAAAAAAGAGGCACACAAAGATAAGGCCAA
CACCATCTACATGATACAATCATGGTAGCGAGTAACTAGGCAGAAGATCAGCCAGA
AGTTTTCCCGTGGAAGTGAAATTTCTTTCCCCACATTGACTGCGGACAACGCAGT
GGTTGAACCGCTCACCATTGAAATTAATGCAGGGGGTCACGATATCCACCGCATGT
ATGTTGATGGAGGAGCATATGCAGACATAATGTACGAAC
ATTGTTTCAAGCGGCTG
CGATCAC-3’
According to sequencing result, utilize special primer SCA10 (the upstream primer sequence: 5 '-GTGATCGCAGGAACAACC-3 ' of software Primer Premier design; Downstream primer sequence: 5 '-GTGATCGCAGCCGCTTGA-3 '; Entrust Shanghai Ying Jun Bioisystech Co., Ltd to synthesize) carry out the SCAR amplification, contain 2.5 μ L10 * Buffer in the reaction system of 25 μ L, 1.5 μ L25mM MgCl
2, 2.0 μ L2.5mM dNTP, 1U Taq archaeal dna polymerase, 1.5 μ molL
-1The SCA10 primer, the 20ng template DNA is used ddH
2O polishing 25 μ L.
The PCR response procedures is 94 ℃ of preparatory sex change 5min, gets into following circulation then: 94 ℃ of sex change 1min, and 67 ℃ of renaturation 1min, 72 ℃ are extended 1min, 35 circulations; Last 72 ℃ are extended 10min; 4 ℃ of insulations.Get 7 μ L amplified productions electrophoresis in 2% sepharose, through EB dyeing, electrode buffer is 1 * TAE, voltage 5V/cm.Utilize JS-380 gel imaging analysis appearance (Shanghai Peiqing Science Co., Ltd) to observe and take pictures, the record polymorphic bands, the specific fragment size is 555bp.
Thereby obtain one with ground by the chrysanthemum linked molecule marker SCA10 of proterties controlling gene that crawls
555(Fig. 3).
(3) application result and analysis
With the A10 primer to remove making up 24 F of gene pool
1128 F outside the individual plant
1Individual plant carries out RAPD amplification checking (Fig. 2), and the separation case of mark is seen table 1, finds mark A-10
555Have or not at 152 F
1The middle separation,, wherein there are 12 individual plants that exchange has taken place near 3:1 than being 2.70:1.Adopt Mapmaker/Exp3.0 software that the genetic affinity between gained RAPD mark and crawling property of the plant type gene is carried out linkage analysis, the result shows: mark A-10
555Have linkage relationship with crawling property gene, recombination fraction is 7.89%, and linkage distance is 7.96cM.
The special primer SCA10 that utilizes design is to two parents and 152 F
1Individual plant carry out the SCAR analysis verification (Fig. 3, Fig. 4), its amplification and RAPD mark A-10
555At parents and 152F
1Separation in the individual plant is consistent, and the specific fragment size is 555bp, called after SCA10
555, show that this RAPD mark successfully is converted into SCAR mark more stable and that be convenient to use.
The molecular marker-assisted selection method of setting up can overcome by the crawl difficulty of characters with plant genotype identification of chrysanthemum.Range of choice is wider, and intensity is bigger.Can realize selecting ahead of time seedling stage, reduce workload, improve the efficiency of selection of creeping type ground-cover chrysanthemum greatly, thereby accelerate breeding process.
Table 1RAPD is marked at F
1Separation in the colony
Sequence table
< 110>Agricultural University Of Nanjing
< 120>a kind ofly by crawling property of chrysanthemum plant type molecular marker-assisted selection method
< 130>specification sheets
<140>00
<141>2008-09-18
<160>4
<170>PatentIn?version3.1
<210>1
<211>10
<212>DNA
< 213>synthetic
<220>
< 221>RAPD primer A-10
<222>(1)..(10)
<223>
<400>1
<210>2
<211>18
<212>DNA
< 213>synthetic
<220>
< 221>SCAR primer SCA10 goes up primer sequence
<222>(1)..(18)
<223>
<400>2
<210>3
<211>18
<212>DNA
< 213>synthetic
<220>
< 221>person is with SCAR primer SCA10 downstream primer sequence
<222>(1)..(18)
<223>
<400>3
<210>4
<211>610
<212>DNA
< 213>chrysanthemum
<220>
<221>Molecule marker A-10
555Fragment sequence
<222>(1)..(610)
<223>
<400>4
Claims (2)
1. a ground is characterized in that by the crawl detection method of gene of chrysanthemum plant type:
With RAPD primer A-10:5 '-GTGATCGCAG-3 '
Amplification creeping type ground-cover chrysanthemum kind or breeding material DNA, if can amplify the fragment of 555bp, then sign lands by the crawl existence of gene of chrysanthemum;
Perhaps use SCAR primer SCA10,
Upstream primer sequence: 5 '-GTGATCGCAGGAACAACC-3 '
Downstream primer sequence: 5 '-GTGATCGCAGCCGCTTGA-3 '
Amplification creeping type ground-cover chrysanthemum kind or breeding material DNA, if can amplify the fragment of 555bp, then sign lands by the crawl existence of gene of chrysanthemum;
2. detection method according to claim 1 is characterized in that, the primer obtains through following method screening:
1) adopt the CTAB micromethod to extract ground by the chrysanthemum genomic dna;
2) according to BSA method principle, respectively from F
1Select in the plant type segregating population extremely to crawl and each 10 strain of axial individual plant, with the genomic dna of dilution respectively balanced mix constitute crawl gene pool and upright gene pool;
3) screening of labeled primer:
The PTC-100 that pcr amplification reaction is produced in MJ Research company
TMCarry out on the type PCR appearance, reaction system is totally 20 μ L, comprising: 10 * Buffer, 2 μ L, 1.625mmolL
-1MgCl
2, 75 μ molL
-1DNTP, 40ng template DNA, 1.5U Taq polymerase, 1.5 μ molL
-1The RAPD primer, use ddH
2O polishing 20 μ L;
Response procedures is 94 ℃ of preparatory sex change 4min, gets into following circulation then: 94 ℃ of sex change 15s, and 35 ℃ of renaturation 15s, 72 ℃ are extended 1min 15s, 3 circulations; 94 ℃ of sex change 30s, 40 ℃ of renaturation 30s, 72 ℃ are extended 1min 15s, 40 circulations; Last 72 ℃ are extended 7min; 4 ℃ of insulations;
Get 7 μ L amplified productions electrophoresis in 2% sepharose; Through EB dyeing, electrode buffer is 1 * TAE, voltage 5V/cm; Utilizing JS-380 gel imaging analysis appearance to observe takes pictures; Record polymorphic bands 555bp, its RAPD primer is A-10:5 '-GTGATCGCAG-3 ', thereby obtain one with ground by the chrysanthemum linked molecule marker A-10 of proterties controlling gene that crawls
555, A-10
555Fragment sequence is following, and the italic thickened portion is the RAPD primer sequence, and underscore partly is the SCAR primer sequence:
5’-
GTGATCGCAGGAACAACCTCGGAGACAATCCACTGACCAGAGTAGCAACCGTAACAACAACTACCGCGGCCAGGGGAGCGGACGGGATAATGACAGATATACCCACTAACCAAGACTCCAAAGGAGATATTCGCGACGGAAGGCGCGAACTTCCCAAGACCCCCACCAATGCGCACCCCAGAGGATCGACGCGTGGGGAGTAGATACTGTGACTATCATGGGAAGAAGGGCCACACCACCAATGAATGTTTCCAATTGCGCCAGTTAATTGATAAACTAGTAAAAGAAGGCAGATTGGACCATCTGGTCAAGAACATCAAGGAGGGAAAAGATAGGCAGAAAATTGGGAGAAAAAAAGAGGCACACAAAGATAAGGCCAACACCATCTACATGATACAATCATGGTAGCGAGTAACTAGGCAGAAGATCAGCCAGAAGTTTTCCCGTGGAAGTGAAATTTCTTTCCCCACATTGACTGCGGACAACGCAGTGGTTGAACCGCTCACCATTGAAATTAATGCAGGGGGTCACGATATCCACCGCATGTATGTTGATGGAGGAGCATATGCAGACATAATGTACGAAC
ATTGTTTCAAGCGGCTGCGATCAC-3’
According to sequencing result, utilize the special primer SCA10 of software Primer Premier design
Upstream primer sequence: 5 '-GTGATCGCAGGAACAACC-3 ';
Downstream primer sequence: 5 '-GTGATCGCAGCCGCTTGA-3 '
Carry out SCAR amplification ground by the chrysanthemum genomic dna, contain 2.5 μ L10 * Buffer in the reaction system of 25 μ L, 1.5 μ L 25mM MgCl
2, 2.0 μ L 2.5mM dNTP, 1U Taq archaeal dna polymerase, 1.5 μ molL
-1The SCA10 primer, the 20ng template DNA is used ddH
2O polishing 25 μ L;
The PCR response procedures is 94 ℃ of preparatory sex change 5min, gets into following circulation then: 94 ℃ of sex change 1min, and 67 ℃ of renaturation 1min, 72 ℃ are extended 1min, 35 circulations; Last 72 ℃ are extended 10min; 4 ℃ of insulations;
Getting 7 μ L amplified productions is electrophoresis in 2% the sepharose at mass ratio; Dye through EB; Electrode buffer is 1 * TAE, and voltage 5V/cm utilizes JS-380 gel imaging analysis appearance to observe and takes pictures; Record polymorphic bands 555bp, thus obtain one with ground by the chrysanthemum linked molecule marker SCA10 of proterties controlling gene that crawls
555
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101561722A CN101368208B (en) | 2008-09-24 | 2008-09-24 | Ground cover chrysanthemum strain type stoloniferous numerator mark auxiliary selection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101561722A CN101368208B (en) | 2008-09-24 | 2008-09-24 | Ground cover chrysanthemum strain type stoloniferous numerator mark auxiliary selection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101368208A CN101368208A (en) | 2009-02-18 |
| CN101368208B true CN101368208B (en) | 2012-05-23 |
Family
ID=40412209
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101561722A Expired - Fee Related CN101368208B (en) | 2008-09-24 | 2008-09-24 | Ground cover chrysanthemum strain type stoloniferous numerator mark auxiliary selection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101368208B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102175554B (en) * | 2011-01-13 | 2012-07-04 | 南京农业大学 | Method for screening variety with highest nitrogen use ratio from various cut-flower chrysanthemum varieties |
| CN110592264A (en) * | 2019-10-17 | 2019-12-20 | 青岛农业大学 | Molecular marking method of peanut plant type related gene locus and application thereof |
| CN111455087B (en) * | 2020-05-12 | 2023-01-06 | 江苏省农业科学院 | Novel molecular marker, primer pair, molecular marker design method and application developed based on kidney bean CACTA transposon |
-
2008
- 2008-09-24 CN CN2008101561722A patent/CN101368208B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 钱金娥.矮生地被菊品种特性及栽培技术.《河北林业科技》.2006,(第1期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101368208A (en) | 2009-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102154281B (en) | Molecular marker SIsv0010 closely linked with heading-date gene of millet | |
| CN105063185B (en) | The close linkage mark of wheat spike length main effect QTL and its application | |
| US20210198756A1 (en) | Dna barcode for variety identification of wolfberry and identification method therefor | |
| CN102154471A (en) | Molecular marking method for major quantitative trait loci(QTL) for rice grain length | |
| CN104152446A (en) | SSR molecular markers cosegregated from cucumber powdery mildew-resistant major QTL | |
| CN101368208B (en) | Ground cover chrysanthemum strain type stoloniferous numerator mark auxiliary selection method | |
| CN104313155A (en) | Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method | |
| CN106434944A (en) | Application of SNP molecular marker closely linked to aphid resistance gene of prunus persica | |
| CN106521021B (en) | Gene marker for identifying haplotype of rice grain width and grain weight GS5 gene and application | |
| CN104328119A (en) | Microsatellite molecular marker related to growth character of megalobrama amblycephala and application of molecular marker | |
| CN106755359A (en) | A kind of screening or the method and its dedicated kit of assisting sifting difference plant height wheat | |
| CN102304587A (en) | Method for rapidly identifying erect panicle of rice | |
| CN102690812B (en) | Molecular marker SIsv0067 closely linked with millet Heading date gene | |
| CN112760402B (en) | KASP primer group for detecting wheat spike number and biomass density and application thereof | |
| CN103361340B (en) | Bay scallop thermostable related heat shock protein 70 gene marker and assistant breeding method thereof | |
| CN102690814B (en) | Molecule marker SIsv0491 closely linked with millet bristle color gene | |
| CN104087575B (en) | The molecular labeling of the anti-fall gene prl4 of the strong stalk of paddy rice and application | |
| CN102533745B (en) | Saline-alkaline-tolerance Fraxinus velutina sequence-characterized amplified region (SCAR) marker and applications in assistant selection breeding | |
| CN105586432A (en) | Set reagent for detecting whether wheat contains haynaldia villosa 6VS chromosome arms or not and molecular marker | |
| CN102690813B (en) | Molecule marker SIsv0701 closely linked with millet bristle color gene | |
| CN102690818B (en) | Molecular marker SIsv0832 closely linked with millet Heading date gene | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| CN108411026B (en) | Chrysanthemum cinnamon flower type molecular marker-assisted selection method | |
| CN110257545B (en) | Molecular marker for identifying hybrid paper mulberry and application thereof | |
| CN102154284B (en) | Molecular marker SIsv0408 capable of being closely linked to Setaria italica pollen color gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120523 Termination date: 20180924 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |