CN101363061B - Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food - Google Patents
Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food Download PDFInfo
- Publication number
- CN101363061B CN101363061B CN2008101971708A CN200810197170A CN101363061B CN 101363061 B CN101363061 B CN 101363061B CN 2008101971708 A CN2008101971708 A CN 2008101971708A CN 200810197170 A CN200810197170 A CN 200810197170A CN 101363061 B CN101363061 B CN 101363061B
- Authority
- CN
- China
- Prior art keywords
- concentration
- salmonellas
- probe
- salmonella
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a fluorescence quantitative polymerase chain reaction (PCR) method with a Taqman probe for detecting salmonella in foodstuff. A primer, the Taqman probe and the fluorescence quantitative PCR are designed in allusion to fimY gene. Under optimal reaction procedures and reaction system, genomic DNA of a series of 10 times reference culture diluents of salmonella enteritidis extracted through poaching cracking process is taken as a template to carry through fluorescence quantitative PCR , and then specification curve is drawn. Based on linear relation R<2> and augmentation efficiency E, whether the repeated sample data are consistent and whether initial templates with different copy numbers have the same augmentation efficiency are judged. The method is used for detecting pork and egg specimens that are artificially polluted, and can check out the positive result under the inoculation concentration of 1-3cfu/10g even though interfering germ with top concentration of 14.8*10<8>cfu/ml exists. The method uses specific primers with the fimY gene and the Taqman probe for detecting infected salmonella in foodstuff under optimal reaction conditions, and has higher stability, specificity and sensitivity; therefore, the method is a fast and exact salmonella detection method.
Description
Technical field
The present invention relates to the method for quick of pathogenic bacteria in a kind of food, particularly a kind of Taqman fluorescence probe quantitative PCR detects the method for food Salmonellas, belongs to the food inspection biological technical field, is applicable to the detection by quantitative of salmonella in the food.
Background technology
Salmonellas is one of infecting both domestic animals and human cause of disease bacterium, can not only cause Animal diseases such as necrotic enteritis, miscarriage, can also make human typhoid fever, paratyphoid, septicemia, gastro-enteritis and the food poisoning of taking place, the morbidity patient shows as that diarrhoea, heating, stomachache or convulsion are twin, vomiting, headache and classical symptom such as feel sick, even dead.Countries in the world government all makes very strict regulation to the limit standard of Salmonellas in the animal product at present, the regulation of Salmonellas in meat, egg, the milk livestock product must not be detect.Salmonellas content in contaminated food products is low, and the character of food product bodies and the course of processing of food all can be disturbed the detection of pathogenic bacteria simultaneously.Therefore, need set up a kind of quick, accurate, reliable detection method.The country that China is existing and industry standard method of inspection effort, consuming time, from the preparation of sample, precedingly increase bacterium, increase bacterium to selective separation cultivations, biochemical identification etc., needs 4～7d just can finish.Therefore, set up a kind of quantitative detecting method of eating source property Salmonellas fast and effectively, to improve check speed, accuracy and lowest detectable limit, contaminated food is handled timely, to satisfy the needs of public health, food sanitation, animal and veterinary and port quarantine.
According to the literature, the oligogene that PCR-based technology for detection Salmonellas is adopted has: invA, stn, viaB, fimA, flic, 16S rRNA and viaB etc.But there are some problems in some gene, can cause false negative as adopting the invA gene, and omission Salmonella lichfield and Salmonella.senftenberg serotype, and its some non-Salmonellas of also can increasing cause false positive.In addition, above-mentioned some gene is a certain or the peculiar sequence of certain several Salmonellas, only be applicable to detect some Salmonellas, but not whole salmonella, omission easily.FimY is the specific gene of Salmonellas, and is conservative at the Salmonellas inner height, has high degree of specificity simultaneously for other species.Yeh etc. estimate as the specific detection index of Salmonellas fimY, the fimY gene-specific primer can all amplify 45 strain Salmonellass, and the non-Salmonellas result of 25 strains is negative, therefore the fimY gene can be used as index (the Yeh KS that identifies Salmonellas, Chen TH, Liao CW, Chang CS, Lo HC.PCR amplification of the Salmonella typhimurium fimY gene sequence to detect the Salmonella species.Int J Food Microbiol.2002,78 (3): 227-34.).
At fimY gene design primer, the report of utilization real time fluorescence quantifying PCR method rapid detection Salmonellas, Zheng You limit etc. for example, the discussion of TaqMan probe method real-time fluorescence quantitative PCR rapid detection salmonella. Chinese food health magazine, 2006,18:311-313; Guangwei LI etc., the development and the application of Salmonellas fluorescence real-time quantitative PCR detection reagent. microbiology circular, 2007,34:496-499.These two pieces of articles do not detect fresh pork and the fresh hen egg of artificial contamination Salmonellas, and lowest detectable limit and quantitative limit are than higher.Up to now, do not see have publish with the similar patent of invention of the present invention.
Summary of the invention
The objective of the invention is to overcome the prior art defective, the method for Salmonellas in a kind of fluorescence quantitative PCR detection food be provided, this method can be fast, accurately, stable and detect Salmonellas in the food with sensitivity.
The present invention is achieved by the following technical solutions:
The method of Salmonellas in a kind of fluorescence quantitative PCR detection food, adopting the GeneBank number of landing is the Salmonellas fimY gene order of M90677, design special primer and Taqman probe, the Salmonella enteritidis genomic dna that extracts with conventional poach cracking process is that template is carried out quantitative fluorescent PCR, and its step is as follows:
A. described special primer to sequence is:
F1?GCGCTACCTGTCTCCTGTATTGA，
F2?ACGCCCAGCCATACGGATA；
Described Taqman probe sequence is:
FP3?AGCTACGCGCGCTCAGTTGGCA
Wherein: 5 ' end of FP3 probe is marked with FAM fluorescence report group, and 3 ' end is marked with the TAMRA group;
The B.PCR response procedures is: 94 ℃ of sex change 3min, with 40 circulations of 95 ℃ of 5s56 ℃ of 20s amplifications, last 25 ℃ of 3min protect
Temperature is carried out the single-point fluoroscopic examination at 56 ℃;
C. reaction system is made as 25 μ l, and system is formed: reaction buffer is 10 * Taq PCR buffer, Mg
2+Concentration is 3.5mM, and dNTPs concentration is 0.2mM, Taq enzyme 2.5U, and the concentration of primers F 1 and F2 is 0.1 μ M, and probe FP3 concentration is 0.4 μ M, Salmonella enteritidis genomic dna 5 μ l, sterilized water 9 μ l;
D. described poach cracking process step is: get bacteria suspension 1ml in the centrifugal 5min of 10000rpm, precipitation is resuspended in the aseptic tri-distilled water of 300 μ l, and mixing is put cracking 20min in the boiling water bath; Put-20 ℃ of freezing 5min then, the centrifugal 5min of 10000rpm, gained supernatant liquor are described Salmonella enteritidis genome DNA sample, get described supernatant liquor 5 μ l and make reaction template.
More detailed technical scheme is:
The present invention adopts Salmonellas fimY gene order (the GeneBank number of landing: M90677) of report, design special primer and Taqman probe, under response procedures of optimizing and reaction system, the genomic dna of the Salmonella enteritidis serial dilutions of extracting with the poach cracking process is a template, carry out quantitative fluorescent PCR, the drawing standard curve is according to linear relationship R
2Whether whether an original template of making peace different copy numbers has identical amplification efficiency to weigh the repeat samples data with amplification efficiency E.
This Taqman fluorescence probe quantitative PCR method bacterial detection concentration is 9.9 * 10
0-9.9 * 10
7Be the favorable linearity scope in the cfu/ml scope, R
2=0.998, amplification efficiency E=109.3%; 9.9 * 10
2-9.9 * 10
7Good reproducibility in the cfu/ml, Ct value standard deviation (StD): 0.02-0.55 in crowd, the variation coefficient (CV): 0.09-1.67; Ct value standard deviation (StD): 0.17-1.29 between crowd, the variation coefficient (CV): 1.05-4.63; Have very strong specificity (5 strain positive bacterias, detected result is all positive; 8 strain negative bacterium, detected result is all negative); In the fresh pork of artificial contamination Salmonellas and the detection of fresh hen egg, the initial bacteria containing amount of Salmonellas is respectively 1～3cfu/10g (fresh pork) and 1～3cfu/10g (fresh hen egg in sample, comprise the full egg and the egg that shells), through 24h increase bacterium after, detected result is all positive.
The Taqman fluorescence probe quantitative PCR detects the method for Salmonellas in the food, and concrete steps are as follows:
1, design, synthetic primer and Taqman probe
The fimY gene order of search salmonella compares its homology in GeneBank, and its homology is more than 99%.According to (the GeneBank number of landing: M90677),, design a pair of primer, and in the amplification region of this primer, design 1 fluorescent probe of Salmonella typhimurium fimY gene order according to primer and probe design principle.The fluorescence report group of probe 5 ' end mark is FAM, and the fluorescent quenching group of 3 ' end mark is TAMRA.
2, the optimization of quantitative fluorescent PCR response procedures and reaction system and foundation
By to Mg
2+The selection of concentration, primer concentration and probe concentration ratio and annealing temperature (Tm) is a screening index with minimum Ct value and the highest relative intensity of fluorescence value (RFU), determines optimum response system and response procedures.
3, set up typical curve
Set up typical curve with the genomic dna that 8 dilution Salmonella enteritidis bacteria suspensions extract as standard model.Simultaneously 6 extent of dilution bacteria suspension genomic dnas are carried out independent experiment three times, each three repetition of each concentration come the stable or repeatable of evaluation method by the mean value and the variation coefficient to experimental result Ct value.
4, the sensitivity of artificial contamination Salmonellas
Press the method artificial inoculation food samples (fresh pork and fresh hen egg) of U.S. FDA and USDA/FSIS MLG4.02, by the quantifying PCR method of setting up the bacteria suspension that 24h increases the bacterium cultivation is detected, determine the detection sensitivity of the food samples of artificial contamination Salmonellas.
Described primer to sequence is:
F1?GCGCTACCTGTCTCCTGTATTGA
F2?ACGCCCAGCCATACGGATA
Described probe sequence is:
FP3?AGCTACGCGCGCTCAGTTGGCA
Wherein: 5 ' end of FP3 probe is marked with FAM fluorescence report group, and 3 ' end is marked with the TAMRA group.
The PCR response procedures is:
94 ℃ of sex change 3min, with 40 circulations of 95 ℃ of 5s56 ℃ of 20s amplifications, last 25 ℃ of 3min insulation is carried out the single-point fluoroscopic examination at 56 ℃.
The total reaction system is made as 25 μ l, and system consists of:
Reaction buffer is 10 * Taq PCR buffer, Mg
2+Concentration is 3.5mM, and dNTPs concentration is 0.2mM, Taq enzyme 2.5U, and the concentration of primers F 1 and F2 is 0.1 μ M, and probe FP3 concentration is 0.4 μ M, Salmonella enteritidis genomic dna 5 μ l, sterilized water 9 μ l.
Described sample when to be checked, adopts the poach cracking process to extract genomic dna, and concrete steps are as follows:
The cultivation bacteria suspension 1ml that absorption shakes up in the 1.5ml Eppendorf tube, the centrifugal 5min of 10000rpm under the normal temperature, careful abandoning supernatant, precipitation is resuspended in the aseptic tri-distilled water of 300 μ l, turns upside down to mix 5s, puts cracking 20min in the boiling water bath.Bacterial lysate is in-20 ℃ of freezing placement 5min, and the centrifugal 5min of 10000rpm discards cell debris, gets 5 μ l supernatant liquors as reaction template.
Compared with prior art, the present invention has the following advantages and effect:
1, highly sensitive, high specificity;
2, simple to operate, repeatable high;
3, detection time short, from sample DNA extract machine examination measure the result only need about 2h (do not comprise and increase bacterium and pre-treatment)
4, applied widely, can be used for the detection of Salmonellas in food samples such as pig muscle, the egg etc., its lowest detection is limited in bright pig muscle of every 10g and the fresh hen egg can detect Salmonellas 1～3cfu.
5, the detection method of the alternative traditional food microorganisms of present method.
Description of drawings
Sequence table SEQ ID NO:1 is the Salmonellas fimY gene fragment order (length is 135bp) with primers F 1 and F2 amplification.
Fig. 1: the amplification that is Salmonellas Real-time PCR detection sensitivity.Be successively from top to bottom: 9.9 * 10
7Cfu/ml, 9.9 * 10
6Cfu/ml, 9.9 * 10
5Cfu/ml, 9.9 * 10
4Cfu/ml, 9.9 * 10
3Cfu/ml, 9.9 * 10
2Cfu/ml, 9.9 * 10
1Cfu/ml and 9.9 * 10
0Cfu/ml.
Fig. 2: be the typical curve that Salmonellas Real-Time PCR detects.X-coordinate is represented the log value of original template amount, and ordinate zou is represented the Ct value of each dilute sample.
Fig. 3: the pcr amplification electrophorogram that is Salmonellas regular-PCR detection sensitivity.M:DNA Marker DL2000 is followed successively by 2000bp from top to bottom, 1000bp, 750bp, 500bp, 250bp, 100bp.1-8 is respectively 9.9 * 10
7Cfu/ml, 9.9 * 10
6Cfu/ml, 9.9 * 10
5Cfu/ml, 9.9 * 10
4Cfu/ml, 9.9 * 10
3Cfu/ml, 9.9 * 10
2Cfu/ml, 9.9 * 10
1Cfu/ml and 9.9 * 10
0Cfu/ml.
Fig. 4: the amplification that is Salmonellas Real-time PCR detection specificity.Be followed successively by Salmonella enteritidis, white dysentery Salmonellas, Salmonella choleraesuls, Salmonella enteritidis (its DNA extracts with bacterial genomes DNA extraction test kit, and the Shanghai outstanding person is auspicious), clinical separation Salmonellas S28, Salmonella typhimurium from top to bottom.The following sample of baseline is Escherichia coli O 157: H7, intestinal bacteria ATCC25922, streptococcus aureus, bifidus bacillus, bacteroides fragilis, campylobacter jejuni, faecalis, clinical separating Escherichia coli E26 and negative control.
Fig. 5: the amplification that is Salmonellas Real-time PCR duplicate detection 3 times.
Fig. 6: be the Salmonellas fimY gene fragment order (length is 135bp) that the present invention increases, underscore is a probe sequence among the figure.
Embodiment
1, design, synthetic primer and Taqman probe
From GenBank, obtain the fimY gene order of the Salmonellas of various different sourcess, use Primer Express software analysis gene order, according to primer and probe design principle, conservative region in these sequences screens a pair of primer that the target fragment length that can increase is 135bp, and designs 1 fluorescent probe in the amplification region of this primer.The fluorescence report group of probe 5 ' end mark is FAM, and the fluorescent quenching group of 3 ' end mark is TAMRA, and is synthetic by last sea base health biotechnology Services Co., Ltd.
The right sequence of primer is
F1 (forward primer): GCGCTACCTGTCTCCTGTATTGA;
F2 (reverse primer): ACGCCCAGCCATACGGATA;
Probe sequence is
FP3 AGCTACGCGCGCTCAGTTGGCA；
Wherein: 5 ' end of FP3 probe is marked with FAM fluorescence report group, and 3 ' end is marked with the TAMRA group.
2, the optimization of quantitative fluorescent PCR response procedures and reaction system and foundation
The optimization of reaction conditions mainly comprises Mg
2+The selection of concentration, primer concentration and probe concentration ratio and annealing temperature (Tm).In the Real-TimePCR response procedures, the fixation reaction system is adjusted different annealing temperature (55 ℃～65 ℃), is that template detects with same concentrations Salmonella enteritidis DNA, with minimum Ct value and the highest relative intensity of fluorescence value (RFU) is that standard is screened, and determines optimum annealing temperature.Under optimum annealing temperature, select Mg for use
2+Concentration is respectively 1 μ M, 1.5 μ M, 2.5 μ M, 3.5 μ M, 4.5 μ M, 6 μ M, under best primer concentration and probe concentration proportioning, and preferred best Mg
2+Concentration.Test is a template with same concentrations Salmonella enteritidis reference culture DNA, at best Mg
2+Under the concentration, primer concentration is respectively 0.1 μ M, 0.2 μ M, 0.4 μ M, 0.6 μ M, 0.8 μ M, 1.0 μ M, concentration and probe concentration is respectively 0.1 μ M, 0.2 μ M, 0.3 μ M, 0.4 μ M, with minimum Ct value and the highest relative intensity of fluorescence value (RFU) is screening index, preferred primer and probe optimum concn.
3, the preparation of standard bacterium liquid
With the enteritis Salmonella standard bacterium 50040 of glycerine cryopreservation (available from Nat'l Pharmaceutical ﹠ Biological Products Control Institute, strain number is 50040) put on ice and thaw, be inoculated into enrichment culture medium buffered peptone water (prescription: Tryptones 10g, sodium-chlor 5g, 12 water Sodium phosphate dibasic 9g, potassium primary phosphate 1.5g replenishes distilled water to 1000mL, transfers pH to 7.2) interior cultivation recovery.Enteritis Salmonella standard bacterium bacterial classification 50040 for the normal temperature preservation, direct inoculation is cultivated recovery in above-mentioned buffered peptone water, the enteritis Salmonella standard bacterium bacterial classification 50040 after the recovery is scoring to propagation on SS agar (dehydrated medium of SS agar is available from the Qingdao GaoKeYuan Hai Bo Bioisystech Co., Ltd) flat board.Get single colony inoculation in above-mentioned buffered peptone water water culture 24h, pure bacterium liquid is diluted to the bacteria suspension of 0.5 Maxwell concentration with buffered peptone water.Getting 0.1ml increases progressively dilution method by 10 times and is diluted to 10
-1～10
-7Concentration, and select 10
-4, 10
-5, 10
-63 each 0.1ml of extent of dilution on ready-made counting culture dish, same extent of dilution do three parallel, evenly put into behind the bed board and take out the count enable culture dish after 37 ℃ of thermostat containers are cultivated 24h, calculate the bacterium colony mean number on three flat boards of same extent of dilution.And calculate: colony-forming unit in every milliliter (cfu)=three the average colony number * extension rate of multiple * 10 of same extent of dilution by following formula.Stipulate that 30～300 bacterium colonies are OK range.With the counting after bacteria suspension be diluted to 1～3,4～10 and 11～100cfu/100 μ l concentration bacterium liquid be used for artificial inoculation.
4, method stability and sensitivity examination
Behind the incubated overnight liquid abundant mixing of aseptic technique, increase progressively by 10 times and to be diluted to 10 Salmonellas
-1～10
-7Concentration is extracted nucleic acid DNA respectively, detects with fluorescence quantitative PCR detection system of the present invention, investigates and detects lower limit, and susceptibility is estimated; The enteron aisle bacterioid of selecting to identify through traditional method relevant with Salmonellas (referring to the explanation of Fig. 4 of description of drawings) extracts nucleic acid DNA respectively and carries out Real-time PCR detection, to examine the specificity of this system; In addition, carry out independent experiment three times, each concentration repeats for each three times, comes the stable or repeatable of evaluation method by the mean value and the variation coefficient to experimental result Ct value.
The result shows that method of the present invention is 9.9 * 10
0Cfu/ml～9.9 * 10
7In the cfu/ml scope, typical curve is good linear relationship, R
2=0.998, amplification efficiency E=109.3%.To the bacterium liquid duplicate detection of 6 kinds of different concns 3 times, the Ct value that amplification obtains sees Table 1, and the Ct value variation coefficient (is 1.67% to the maximum, all less than 5%) in the reasonable scope.Three times separately each three reproducible results of experiment see Table 2, the variation coefficient is all less than 5%, at extent of dilution more than or equal to 10
-5The time repeatability relatively good, illustrate that present method is in Jun liquid Nong Du ≧ 9.9 * 10
2Good stability during cfu/ml.
1, the artificial inoculation Salmonellas is to the quantitative PCR detection of food samples
(1) preparation of artificial inoculation sample
A. egg with shell sample preparation not: under current, scrub egg with hard brush.Clean egg is soaked 30min in containing the 200ppm chlorion solution of 0.1% sodium laurylsulfonate (SDS).Add the 8mL5.25% clorox in the 992mL distilled water that contains 1g SDS, preparation 200ppm cl
-/ 0.1%SDS solution.This sterilizing agent needs before use preparation temporarily.Egg is opened in aseptic technique, homogenate.Aseptic technique takes by weighing the 10g homogenate in the 250ml Erlenmeyer flask of sterilization.Add the 90ml buffered peptone water, and the abundant mixing that vibrates.
Table 1 TaqMan PCR detects the Detection of Stability of Salmonellas
Table 2 TaqMan PCR detects the variation coefficient in the daytime of Salmonellas
B. egg shell egg sample preparation: the egg shell egg is with homogenizer homogenate 1min, and aseptic technique takes by weighing egg egg liquid 10g and places aseptic 250ml erlenmeyer flask, adds the described buffered peptone water of 90ml and the abundant mixing that vibrates.
C. pig muscle sample preparation: aseptic technique shreds pig muscle with scissors, puts tissue homogenizer 8000rpm homogenate 1min, takes by weighing the 250ml Erlenmeyer flask that 10g homogenate sample is put into sterilization.The buffered peptone water that adds the 90ml sterilization, and the abundant mixing that vibrates.
Artificial adding 0,1～3,4～10 and 11～100cfu Salmonellas in above-mentioned each homogenate, three of each inoculation levels are parallel, cultivate 20～24h in 37 ℃ of thermostat containers.Be provided with simultaneously and do not inoculate sample in contrast.Experiment repeats twice.It is standby to get enrichment liquid.Sample enrichment liquid that to not inoculate Salmonellas is done 10 times of serial dilutions in addition, carries out plate count, calculates the average colony number on three parallel plates, to determine the quantity of background interference bacterium in the food samples.
(2) detection of artificial inoculation sample
The situation that detects of full egg, liquid egg and the pig muscle of the artificial inoculation Salmonellas of employing fluorescence quantitative PCR method is as table 3-5, and this method all can detect the positive on the inoculum density of 1～3cfu/10g, 4～10cfu/10g, 11～100cfu/10g.The count results of background interference bacterium is not as shown in table 6 in the food samples of inoculated bacteria, and this quantifying PCR method is 14.8 * 10 at maximum concentration
8Cfu/ml disturbs under the existence of bacterium, still can detect object bacteria, and this method strong interference immunity is described.
The detected result of the full egg of table 3 different vaccination bacterial concentration
The detected result that does not contain the shell egg of table 4 different vaccination bacterial concentration
The pig muscle detected result of table 5 different vaccination bacterial concentration
2, template DNA preparation
Adopt the poach cracking process, draw the cultivation bacteria suspension 1ml that shakes up in the 1.5ml Eppendorf tube, the centrifugal 5min of 10000r/min under the normal temperature, careful abandoning supernatant, precipitation is resuspended in the aseptic tri-distilled water of 300 μ l, turns upside down to mix 5s, puts cracking 20min in the boiling water bath.Bacterial lysate is in-20 ℃ of freezing placement 5min, and the centrifugal 5min of 10000r/m discards cell debris, gets 5 μ l supernatant liquors as reaction template.
The count results of the background interference bacterium of table 6 different foods sample
Sequence table
＜110〉Hua Zhong Agriculture University
＜120〉the Taqman fluorescence probe quantitative PCR method of detection food Salmonellas
<130>
<141>2008-10-07
<160>1
<170>PatentIn?version3.1
<210>1
<211>135
<212>DNA
＜213〉Salmonellas (Salmonella)
<220>
<221>gene
<222>(1)..(135)
<223>
<220>
<221>primer_bind
<222>(117)..(135)
<223>
<220>
<221>primer_bind
<222>(1)..(23)
<223>
<400>1
Claims (1)
1. the method for Salmonellas in the fluorescence quantitative PCR detection food, its step is as follows:
A, extract the Salmonella enteritidis genomic dna with the poach cracking process: get bacteria suspension 1ml in the centrifugal 5min of 10000rpm, precipitation is resuspended in the aseptic tri-distilled water of 300 μ l, and mixing is put cracking 20min in the boiling water bath; Put-20 ℃ of freezing 5min then, the centrifugal 5min of 10000rpm, gained supernatant liquor are described Salmonella enteritidis genome DNA sample, get described supernatant liquor 5 μ l and make reaction template;
B, according to Salmonellas fimY gene order design synthetic primer and Taqman probe;
The nucleotide sequence of described primer is as follows:
F1 GCGCTACCTGTCTCCTGTATTGA，F2 ACGCCCAGCCATACGGATA；
The nucleotide sequence of described Taqman probe is as follows:
FP3 AGCTACGCGCGCTCAGTTGGCA；
Wherein:
5 ' the end of probe FP3 is marked with FAM fluorescence report group, and 3 ' end is marked with the TAMRA group;
C, with the described primer of step B and probe and reaction reagent combination, carry out the quantitative fluorescent PCR reaction,
Its reaction system is 25 μ l, and system is formed: reaction buffer is 10 * Taq PCR buffer, Mg
2+Concentration is 3.5mM, and dNTPs concentration is 0.2mM, Taq enzyme 2.5U, and the concentration of primers F 1 and F2 is 0.1 μ M, and probe FP3 concentration is 0.4 μ M, Salmonella enteritidis genomic dna 5 μ l, sterilized water 9 μ l;
Its PCR response procedures: 94 ℃ of sex change 3min, with 40 circulations of 56 ℃ of 20s amplifications of 95 ℃ of 5s, last 25 ℃ of 3min insulation is carried out the single-point fluoroscopic examination at 56 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101971708A CN101363061B (en) | 2008-10-07 | 2008-10-07 | Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101971708A CN101363061B (en) | 2008-10-07 | 2008-10-07 | Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101363061A CN101363061A (en) | 2009-02-11 |
| CN101363061B true CN101363061B (en) | 2011-08-10 |
Family
ID=40389663
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101971708A Expired - Fee Related CN101363061B (en) | 2008-10-07 | 2008-10-07 | Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101363061B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101857896B (en) * | 2010-02-25 | 2012-07-18 | 上海交通大学 | PCR (Polymerase Chain Reaction) detection method of salmonella enteritidis, nucleic acid and primer pair |
| CN102140519B (en) * | 2011-01-25 | 2013-06-05 | 四川农业大学 | Salmonella detection kit based on fimY gene |
| CN103243159A (en) * | 2013-04-11 | 2013-08-14 | 深圳职业技术学院 | Fluorescent PCR (polymerase chain reaction) detection probe, kit and detection method for Salmonella having virulence plasmids |
| CN103320507B (en) * | 2013-07-01 | 2015-01-07 | 黑龙江出入境检验检疫局检验检疫技术中心 | DPO primer sequences for salmonella detection by using DPO-PCR method, and detection kit thereof |
| CN109609604A (en) * | 2019-02-21 | 2019-04-12 | 郭会清 | Multiple IMS- fluorescence RPA detection method that is a kind of while detecting 3 kinds of zoonosis pathogens |
| CN110229920A (en) * | 2019-07-07 | 2019-09-13 | 福建省产品质量检验研究院 | The identification method of bifidobacterium bifidum in a kind of feed |
| CN111733266A (en) * | 2020-07-13 | 2020-10-02 | 扬州大学 | PCR detection kit for rapidly detecting salmonella and identifying pullorum/typhoid salmonella and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004046375A2 (en) * | 2002-11-20 | 2004-06-03 | Pharmacia Italia S.P.A. | Method for the detection of microorganisms in pharmaceutical products |
| CN101122563A (en) * | 2007-08-28 | 2008-02-13 | 浙江省医学科学院 | Hepatitis E virus fluorescent quantitative PCR detection method |
-
2008
- 2008-10-07 CN CN2008101971708A patent/CN101363061B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004046375A2 (en) * | 2002-11-20 | 2004-06-03 | Pharmacia Italia S.P.A. | Method for the detection of microorganisms in pharmaceutical products |
| CN101122563A (en) * | 2007-08-28 | 2008-02-13 | 浙江省医学科学院 | Hepatitis E virus fluorescent quantitative PCR detection method |
Non-Patent Citations (3)
| Title |
|---|
| Josefsen MH等.《Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat》.《Appl Environ Microbiol》.2007,第73卷(第9期),3040-48. * |
| 孔繁德等.《沙门菌实时荧光定量PCR检测试剂盒的研制与应用》.《中国兽医科学》.2006,第36卷(第8期),625-629. * |
| 郑友限等.《TaqMan探针法实时荧光定量PCR快速检测沙门菌的探讨》.《中国食品卫生杂志》.2006,(第4期),311-313. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101363061A (en) | 2009-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hein et al. | Real-time PCR for the detection of Salmonella spp. in food: an alternative approach to a conventional PCR system suggested by the FOOD-PCR project | |
| CN101363061B (en) | Fluorescent quantitative PCR method by using taqman probe for detecting salmonella in food | |
| CN102605055B (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
| CN103436626B (en) | A kind of chicken common food borne bacteria quadruple fluorescence PCR detection reagent kit and using method | |
| Zandi et al. | Typing of Toxigenic Isolates of Clostridium perfringens by Multiplex PCR in Ostrich. | |
| Singh et al. | Comparative analysis of cultural isolation and PCR based assay for detection of Campylobacter jejuni in food and faecal samples | |
| Macé et al. | Development of a rapid real-time PCR method as a tool to quantify viable Photobacterium phosphoreum bacteria in salmon (Salmo salar) steaks | |
| Ramya et al. | Study on the incidence of Salmonella enteritidis in poultry and meat samples by cultural and PCR methods | |
| Hong et al. | Quantification and differentiation of Campylobacter jejuni and Campylobacter coli in raw chicken meats using a real-time PCR method | |
| Rantsiou et al. | Prevalence of Shiga toxin-producing Escherichia coli in food products of animal origin as determined by molecular methods | |
| Afzal et al. | Molecular diagnostics for foodborne pathogen (Salmonella spp.) from poultry | |
| Jribi et al. | Isolation and identification of Campylobacter spp. from poultry and poultry by-products in Tunisia by conventional culture method and multiplex real-time PCR | |
| Peruzy et al. | Detection and quantification of Campylobacter in foods: New analytic approaches to detect and quantify Campylobacter spp. in food samples | |
| CN101967516B (en) | Vibrio cholerae typing and virulence gene detection kit and detection method | |
| Zang et al. | Can a visual loop-mediated isothermal amplification assay stand out in different detection methods when monitoring Campylobacter jejuni from diverse sources of samples? | |
| Kim et al. | Comparison of culture, conventional and real-time PCR methods for Listeria monocytogenes in foods | |
| Kot et al. | Application of multiplex PCR for monitoring colonization of pig tonsils by Yersinia enterocolitica, including biotype 1A, and Yersinia pseudotuberculosis | |
| CN102643919A (en) | Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food | |
| Sethulekshmi et al. | Occurrence and quantification of Shiga toxin-producing Escherichia coli from food matrices | |
| Dawson et al. | Effects of DNA extraction methods on the real time PCR quantification of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari in chicken feces and ceca contents | |
| Islam et al. | Evaluation of immunomagnetic separation and PCR for the detection of Escherichia coli O157 in animal feces and meats | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN103993072B (en) | The multiple PCR detection kit of the pathogenic sweetfish pseudomonas of a kind of Rapid identification and method thereof | |
| Saleh et al. | Isolation and identification of Salmonella typhimurium bacteria with detection of type-1 fimbriae coding gene by polymerase chain reaction (PCR) technique | |
| SALOMONSSON et al. | Salmonella detection by polymerase chain reaction after pre‐enrichment of feed samples |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110810 Termination date: 20201007 |