CN101358980A - Homotype cysteine detecting method - Google Patents

Abstract

The present invention relates to a method of producing homocysteine diagnostic kit, which is based on the small molecule capture technology. The method adopts the combination of gene mutation enzyme and small molecule substance to be detected; the gene mutation enzyme is named as small molecule capture enzyme; and the small molecule capture enzyme after mutation and modification maintain and even enhance the affinity to the substrate or the small molecule substance to be detected, but the catalytic capability and the decomposition capacity of the small molecule capture enzyme after mutation and modification to the substrate or the small molecule substance to be detected is weakened. The invention provides a method of researching and producing the homocysteine (HCY) diagnostic kit, which is based on the small molecule capture technology, and also provides mutated S-adenosine homocysteine hydrolase; and the specific S-adenosine homocysteine (SAH) capture enzyme can fully maintain and even enhance the affinity to the S-adenosine homocysteine (SAH), but the catalytic capability to the HCY or the S-adenosyl homocysteine (SAH) is weakened. The method is in particular suitable for small molecule substances, such as inorganic ions, amino acids, polypeptides, nucleotides, oligonucleotide, vitamins, monosaccharides, oligosaccharides, lipids and organic acids.

Description

A kind of homotype cysteine detecting method

Technical field

The present invention relates to composition and detection method, mainly be aimed at micromolecular thing to be detected.Detection method based on micromolecule capture technique development and production homocysteine, this method uses the gene mutation enzyme to combine with small-molecule substance to be measured, this gene mutation enzyme is called the micromolecule trapped enzyme, these are through sudden change, the micromolecule trapped enzyme reservation of modifying even strengthen its affinity to substrate or small-molecule substance to be measured, but weaken its catalysis to the affinity of substrate or small-molecule substance to be measured, capacity of decomposition.Method based on micromolecule capture technique development and production homocysteines (HCY) diagnostic kit provides this, the S-SAHH of sudden change also is provided, specificity S-adenosyl homocysteine (SAH) trapped enzyme can keep fully even strengthen its to or the affinity of S-adenosyl homocysteine (SAH), but weakened its catalytic capability to HCY or S-adenosyl homocysteine (SAH).

Background technology

The method of detection material has wide applications.Many detected materials comprise that the detected material of some small-molecular weights is basis or participants of biosome and biological operational process.Detecting these materials can be used for monitoring bio system and course of reaction thereof or is used to diagnose because these materials unbalanced or lack human body imbalance or disease and the prognosis that causes.For example, homocysteine Hcy, the amino acid of a band sulfenyl; Folic acid, a kind of organic acid; Cholesterol, a kind of for diagnosis with indicate the lipid that angiocardiopathy widely plays an important role.Vitamin is for diagnosis and indicate that hypovitaminosis or disorders are important.Blood sugar, a kind of monose is used to diagnose and indicate the blood sugar level of diabetes.Ethanol, monitoring abuse of alcohol and potential hepar damnification.Bile acid or cholate are a kind of important indicators of diagnosing and indicating some tumours such as colon cancer.The monitoring uric acid is very important, and is because the uric acid of abnormality high concentration is the index that the diagnosis hyperuricemia causes gout, harmful to kidney.The application of this in addition indication and diagnosis, this detection method also is applicable to agricultural, industry or environmental protection aspect, monitor present, the specific region and concentration detected material.

The detection of homocysteine

Homocysteine is a kind of amino acid that contains sulfenyl, derives from the transmethylation that methionine relies on by the S-Ademetionine.Intracellular homocysteine methylates to form methionine or carry out a series of kalabolism again and generates halfcystine.Intracellular homocysteine can overflow in cell the extracellular liquid as in blood and the urine, great majority are participated in circulation with the oxidation situation, protein combination (Refsumet al., Annu.Rev.Medicine, 49:31-62 (1998)) in majority and the blood plasma.Homocysteine content back in blood plasma and the urine is answered the generation of homocysteine and is utilized equilibrium state.This balance is destroyed may change sulfenyl and methylated again defective (for example cystathionine beta synzyme and N5 because the genetic defect of relevant enzyme comprise homocysteine, the N10 methylenetetrahydrofolate dehydrogenase) or in the vitamin diet of homocysteine metabolism needs (for example lack, vitamin B6, B12 and folic acid) (Baual, et al., Cleveland Clinic Journal of Medicine, 64:543-549 (1997)).In addition, the homocysteine level in the blood plasma is subjected to for example antifolic thing methylpterin (Foody, et al., Clinician Reviews, 8:203-210 (1998)) of some influences for the treatment of cancers or arthritis drug simultaneously.

Serious hyperhomocysteinemiainjury is because defective has appearred in the gene code of homocysteine metabolism aspect.In this situation, the defective of this kind of enzyme had both comprised that HCY also comprised the enzyme that changes sulfenyl in methylating again, thus cause in the blood and urine in Hcy be increased to 50 times.The most serious HCY metabolic disorder, geneogenous hyperhomocysteinemiainjury is owing to lack the autozygote of genetic coding cystathionine beta synzyme.Blood vessel embolism appears in these individualities when one's early years, thereby artery sclerosis, myocardial infarction, kidney blood vessel high pressure, Charcot's syndrome, mesenterium ischemic and pulmonary embolisms take place.Some patients also exist amentia and other to resemble organ dystopy and skeleton deformity (Perry T. unusually, Homocysteine:Selected aspects in Nyham W.L.ed.Hertable disordersof amino acid metabolism.New York, John Wiley ﹠amp; Sons, pp.419-451 (1974)).As everyone knows, the Hcy that pregnant woman's body contains high concentration can cause the baby nerviduct incompetence (Scott et al. to occur, " The etiology of neural tube defects " in Graham, I., Refsum, H., Rosenberg, I.H., andUreland P.M.ed. " Homocysteine metabolism:from basic science to clinical medicine " Kluwer Academic Publishers, Boston, pp.133-136 (1995)).Therefore, the diagnostic application of Hcy is worth much good document clinically.

Even raising, the level of slight or moderate Hcy that studies have shown that also can cause the danger of coronary heart disease, the increase of brain and peripheral arterial and angiocardiopathy danger.(Boushey，et?al.，JAMA，274：1049-1057(1995)).。The prevalence study of hyperhomocysteinemiainjury shows 42%, 28%, 30% cranial vascular disease, peripheral artery disease and angiocardiopathy respectively among high patient Hcy.(Moghadasian，et?al.，Arch.Intern.Med.，157：2299-2307(1997))。Wherein show the Hcy level that whenever increases 5mu.M in 27 clinical researches, the male sex's Incidence of CHD raises 60%, and the women raises 80%, with respect to plasma cholesterol rising 20mg.multidot.dl.sup.-1 (0.5mmol.multidot.dl.sup.-1).Therefore Hcy is as a risk factor, with the cholesterol levels danger equally among the ordinary people.Finding that from this research hyperhomocysteinemiainjury is the new independently risk factor of angiocardiopathy, may be those reasons of not having the cardiovascular patient of any vascular diseases hazards.(e.g.，hypertension，hypercholesterolemia，cigarette?smoking，diabetesmellitus，marked?obesity?and?physical?activity)。

Slight hyperhomocysteinemiainjury is that heterozygote is cured the disease mainly due to the enzyme gene.Thereby the polymorphism on the gene of tetrahydrofolate reductase causes the shortage of folic acid to influence the sensitivity (Boers, et al., J.Inher.Metab.Dis., 20:301-306 (1997)) of homocysteine level.And the Hcy level in the blood plasma is at patient (Ueland, the et al. of heart and kidney transplant, J.Lab.Clin.Med., 114:473-501 (1989)), (Jacobsen, et al. among the Parkinsonism patient, Clin.Chem., 44:2238-2239 (1998)) (Ducloux, et al. sharply raise and among the noninsulin dependent patient, Nephrol.Dial.Transplantl, 13:2890-2893 (1998)).More and more the research evidence about homocysteine level and angiocardiopathy relation has promoted to prevent that by the Hcy level that reduces in the blood plasma double blind random of angiocardiopathy from having the beginning (Diaz-Arrastia of the multicenter experiment of control, et al., Arch.Neurol, 55:1407-1408 (1998)).

The detection of Hcy can become a kind of clinical examination project of routine in the blood plasma in the near future.Now, the cardiologist has begun their patient of suggestion and has detected the Hcy level, especially for those patient of cardiovascular family history is arranged or suffer from the patient that but angiocardiopathy its cholesterol levels are normal and do not have other risk factor to exist, also have those to surpass patients of 60 years old.

Total Hcy in serum or the blood plasma exists with the form of complexity, Hcy in 70% the blood plasma is with the protein combination form, 20-30% exists with mixing disulfide form equilibrium or unbalanced, the Hcy of free form has only very a spot of (Stehouwer that exists, et al., Kidney International, 55308-314 (1999)).As the risk factor of angiocardiopathy, total Hcy in the suggestion clinical detection blood plasma (comprise free, oxidized form, the protein combination type) (Hornberger, et al., American J.of Public Health, 88:61-67 (1998)).Since nineteen eighty-two, the method for total Hcy in several detection blood plasma has appearred.(Mansoor，et?al.，Anal.BioChem.，200：218-229(1992)；Steir，et?al.，Arch.Intern.Med.，158：1301-1306(1998)；Ueland，etal.，Clin.Chem.，39：1764-177901993)；and?Ueland，et?al.，″Plasma?homocysteine?andcardiovascular?disease″in?Francis，R.B.Jr.eds.Atherosclerotic?Cardiovascular?Disease，Hemostasis，and?Endothelial?Function.New?York，Marcel?Dokker，pp.183-236(1992)；see，also，Ueland，et?al.，″Plasma?homocysteine?and?cardiovascular?disease″in?Francis，R.B.Jr.eds.Atherosclerotic?Cardiovascular?Disease，Hemostasis，and?EndothelialFunction.New?York，Marcel?Dokker，pp.183-236(1992))。Most methods needs for example high-pressure liquid phase technology of accurate chromatographic technique, and the capillary tube gas chromatographic technique is perhaps gathered directly or indirectly (for example making SAH hydrolytic enzyme hydrolysis Hcy by HPLC or TLC is SAH) detection Hcy of spectrometric techniques (GC/MS).Use also in addition that the radioactive Hcy of SAH hydrolytic enzyme hydrolysis is converted into radiolabeled SAH before thin-layer chromatography partition method TLC separates.The popular feature of all these detection methods comprises following 4 steps: (1) oxidized form Hcy is converted into the Hcy of reductibility; (2) advance before the chromatography post that Hcy induces or enzyme reaction is SAH; (3) chromatography; (4) detect Hcy derivant or SAH.Chromatography is the step of most critical in the analytical approach in these detect, and this method is lost time usually, operates loaded down with trivial details.More specifically be that these methods need highly-specialised and accurate instrument and the professional and technical personnel who was subjected to well trained.Common clinical department does not generally have this special instrument.

As everyone knows, immunization method detects Hcy and uses monoclonal anti SAH (Araki, et al., J.Chromatog., 422:43-52 (1987).This method is converted into SAH based on Hcy, uses monoclonal antibody to detect SAH then.

Thereby research monoclonal anti albumin bound type Hcy can detect the albumin bound type Hcy (Stabler, et al., J.Clin.Invest., 81:466-474 (1988)) that blood plasma exists with principal mode.Other immune response mode other immune substance too is suitable for (see, e.g., U.S.Pat.No.5,885,767 and U.S.Pat.No.5,631,127) too.Though immunologic detection method has been avoided the chromatography step of losing time and realized robotization, monoclonal antibody is very expensive, and often needed to be not easy two anti-or three anti-participation detections.

No matter how important immunologic detection method be the application of how wide range, present this method is faced with following several problem.The first, for many methods, the bad preparation of bond specifically, thereby and the specificity of shortage specificity influence detection.Though this defective can be by preparation polymer antibody, the preparation antibody especially monoclonal antibody of purifying homogeneous remedies, time that this process need is a large amount of and costing a lot of money.In addition, for the detected material of some small-molecular weights, the selection of preparation antibody becomes infeasible, because small-molecule substance has faint antigenicity.The preparation of antibody for small molecular substance needs macromolecular substances to combine with small-molecule substance usually, causes the expression of antibody more invalid like this, more.The second, many detection methods especially in the detection for small-molecule substance, comprise that chemical induction conversion and chromatography step all need a large amount of time.The 3rd, many suchlike detection methods need be used precision, expensive specialty analysis instrument for example high pressure liquid chromatograph (HPLC) and gas chromatograph (GC/MS).

Therefore, need a kind of quick, simple detection method to remedy this defective.The good method that needs Hcy in a kind of quick, simple detection by quantitative body fluid, the tissue equally.

Summary of the invention

This detection method is based on the reaction form of immunity, but is to use the detection thing desmoenzyme of variation to replace antibody, and this kind of enzyme fully keeps even strengthens its affinity to the product that detects thing or instant enzyme reaction and transform, but weakens its catalytic capability.This method is called the micromolecule capture technique, and this kind of enzyme is called the micromolecule trapped enzyme.We can provide the micromolecule trapped enzyme and prepare the method for micromolecule trapped enzyme.The micromolecule trapped enzyme is used to replace monoclonal, polyclone and any blended antibody, and antibody can be reactant in reaction.The substrate capture enzyme can also be played the part of the competitive inhibitor of detected material, removes binding entity for example acceptor, other anti-aglucon and other detected material.Therefore, the substrate capture enzyme can replace for example competitive acceptor or receptor active regulator to be used for competitive inhibitory reaction.

Especially in the immune analysis method, antibody is used to detect target analytes in testing process or method, resembles toply describedly to be replaced antibody by the substrate capture enzyme.The substrate capture enzyme can be by weakening or removing its catalytic reaction and do not influence or can not influence very much the technology preparation for the affinity of detected material of modification enzyme fully.

This method is particularly useful for detecting some and is used to indicate disease of metabolism, and the material of inborn errors of metabolism disease is as hypothyroidism, galactosemia, phenylketonuria, dark brown urine disease; And the label of detection some diseases is for example: blood sugar level, and cholesterol levels, Hcy level and other mammal comprise the material in human body fluid and the tissue.This method also can be used for detecting the pollution in the food, detects the nutritive value of food, detects blood.This method can realize robotization.

Therefore, in the method, antibody participates in reaction, wherein uses the substrate capture enzyme to replace antibody.This method depends on the competitive inhibitory reaction of modification enzyme and target detection thing.

More particularly, analyte in this method detection sample especially detects the step of small-molecule substance: a) Bian Yi detected desmoenzyme combines with sample, this enzyme fully keeps even strengthens its affinity to the direct product of detection thing or enzyme reaction conversion, but weakens its catalytic capability; B) check and analysis thing or enzyme reaction direct product knot that transforms and the detected material desmoenzyme bond that makes a variation.

The detection method of small-molecule substance can detect any material and comprise inorganics and organic molecule.As distinguishingly being, detect the small-molecule substance molecular weight approximately or less than 10,000 dalton, especially molecular weight is approximately or less than 5,000 dalton.

Inorganic molecules including, but not limited to inorganic ions for example; Sodium, potassium, magnesium, calcium, chlorine, iron, copper, zinc, manganese, cobalt, iodine, molybdenum, vanadium, nickel, chromium, fluorine, silicon, tin, boron, arsenic ion.The organic molecule thing includes, but are not limited to following items: amino acid, polypeptide, comprise and be lower than 10 amino acid whose polypeptide typically, nucleosides comprises the oligomeric nucleosides that is lower than 10 nucleosides, vitamin, and monose comprises the compound sugar or the lipid that are lower than 10 monose.

Amino acid includes, but are not limited to following items: D-type or L-type amino acid comprise the amino acid of forming nature polypeptide and protein: Ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P) Ser (S), Thr (T), Trp (W), Tyr (Y) and Val (V).

Nucleotide includes, but are not limited to following items: adenosine, guanosine, cytidine nucleosides, thymidine, uridine.Nucleosides includes, but are not limited to following items: AMP, GMP, CMP, UMP, ADP, GDP, CDP, UDP, ATP, GTP, CTP, UTP, dAMP, dGMP, dCMP, dTMP, dADP, dGDP, dCDP, dTDP, dATP, dGTP, dCTP and dTTP.

Vitamin includes, but are not limited to following items, water soluble vitamin for example, vitamin B1, lactochrome, niacin, pantothenic acid, vitamin B6, biotin, folic acid, Cobastab ₁₂And vitamin C; Liposoluble vitamin is vitamin A for example, vitamin D, vitamin E, vitamin K.

Monose includes, but are not limited to following items, D-type or L-type monose, and triose is glyceraldehyde for example, tetrose is erythrose and threose for example, and pentose is ribose for example, the latex aldose, wood sugar, lyxose, ribulose, hexose is allose for example, Ah table's sugar, glucose, idose, galactose, talose, fructose, seven carbon sugar are sedoheptulose for example.

Lipid includes, but are not limited to following items, and triacylglycerol is glyceryl tristearate for example, tripalmitin, triolein, wax; Phosphoglyceride is phosphatidyl-ethanolamine for example, lecithin, phosphatidylserine, phosphatidylinositols, cuorin; Sphingolipid is sphingomyelin for example, cerebroside, gangliosides; Sterol is cholesterol and stigmasterol for example, sterol acid fat; Fatty acid can be the fatty acid lauric acid for example of saturability, myristic acid, palmitic acid, stearic acid, arachidic acid, tetracosanoic acid; Perhaps can be the fatty acid palmitolic acid for example of unsaturation, oleic acid, linoleic acid, leukotrienes, arachidonic acid.

Statement more specifically, the SAH hydrolytic enzyme of variation, this enzyme fully keep even strengthen its affinity to Hcy or SAH, but weaken its catalytic capability.Also can provide method in addition, bond, the commercial prod of kit and detection of analytes, especially the test example of small-molecule substance is as inorganic ions, amino acid (Hcy), polypeptide, nucleotide, nucleosides, oligonucleotide, vitamin, monose (as glucose), compound sugar, lipid (as cholesterol), organic acid (as folic acid, bile acid, uric acid).

The another one statement, if the SAH hydrolytic enzyme of variability is purified, this enzyme of SAH hydrolytic enzyme of variation fully keeps even strengthens its affinity to Hcy or SAH, but weakens its catalytic capability.

For example, to weaken its catalytic action be owing to make a variation simultaneously in the variation of the catalytic site of the NAD of SAH hydrolytic enzyme binding site or SAH or at two places to the SAH hydrolytic enzyme of variation; The SAH hydrolytic enzyme of variation weakens the still abundant oxidation that keeps 3 '-end of hydrolytic action of 5 '-end SAH; Fixing in conjunction with SAH, the enzyme of SAH is cut speed approximately or be lower than 10.0.mu.M, approximately or be lower than 0.1S to the catalytic activity of SAH ^-1The SAH hydrolytic enzyme of variation has one or more the insertion, the site of disappearance or point mutation.More particularly, the SAH hydrolytic enzyme of variation derive from the amino acid sequence of SEQ ID No.1 statement or by the amino acid of the nucleic acid sequence encoding of SEQ ID No.2 statement but comprise a following place or the many places variation: Phe302 of Phe302K, K186S, H301N, H353T, R343F, D190R, F82R, T157K, N181A, twice variation of R431H and K426A, perhaps in minuent, the hybridization of moderate or height, it is that 10% of wild type maximum reaches 50% that its enzyme is cut speed, but has weakened its catalytic activity.

The encode SAH hydrolytic enzyme of variation recited above of independent nucleotide fragments, the expression of plasmid preferably and vector.The reorganization stem cell can be provided, recombinant bacterial cell especially, yeast cells, the fungal cell, vegetable cell, insect cell, zooblast comprise plasmid and vector.The method of utilizing reorganization stem cell vegetation variability SAH hydrolytic enzyme can be provided.

Detect the method for Hcy and associated metabolic thing thereof.

Hcy as mentioned above, is the risk factor of angiocardiopathy and other diseases, and we can provide detection method.

Homocysteine

Be specially, detected micromolecule is Hcy, and the detection thing desmoenzyme of variation is the Hcy desmoenzyme of variation, and but this enzyme fully even strengthened the affinity of the direct conversion product of Hcy or Hcy weakened its catalytic capability.

The variation of the Hcy desmoenzyme of the variation in the detection comprises its catalytic activity of weakening owing to variation has taken place or in the catalytic activity site of enzyme variation has taken place at the binding site inclusive NAND Hcy of enzyme and coenzyme substrate binding site.

Concrete statement, the enzyme of variation is the cystathionine beta synzyme of variation, the catalytic activity of weakening since mutagenesis the catalytic site that combines with pyridoxal 5 '-phosphoric acid or L-serine of cystathionine beta synzyme taken place to make a variation or variation has all taken place in two sites.

Concrete statement, the enzyme of variation is a methionine synthase, the catalytic activity of weakening is because the methionine synthase catalytic site and the Cobastab of mutagenesis ₁₂Or variation taken place in the catalytic site of 5-methyl tetrahydrofolate combination, or variation has all taken place in two sites.It will be further appreciated that the methionine synthase of variation is a kind of Escherichia coli methionine synthase, this enzyme has following one or more variation: His759Gly, Asp757Glu, Asp757Asn, andSer801.

Concrete statement, the enzyme of variation is an egg ammonia enzyme, the catalytic activity that weakens is because the catalytic site of the methionine synthase of mutagenesis, the binding site of this catalytic site and R ' SH potpourri, R ' SH is meant mercaptan, R is that alkyl or alkynyl especially refer to low alkyl group or alkynyl (1-6 carbon atom, especially refer to 1-3 carbon atom, straight or branched), hetero-aromatic ring, here heteroatoms is meant oxygen atom O, sulphur atom S, and above-mentioned groups such as nitrogen-atoms N or aryl are replaced by following groups: alkyl or alkynyl, especially refer to low alkyl group or alkynyl, perhaps hal perhaps is not substituted and especially refers to aryl or contain a ring or two rings, contain the group of 4-7 atom in the outstanding finger ring of heterocyclic radical of three rings in each ring, perhaps variation occurs in the above moiety combinations.

Statement more expressly, the enzyme of variation is the SAH hydrolytic enzyme, the SAH hydrolytic enzyme of variation fully keeps even strengthens its affinity to Hcy or SAH, but weakens its catalytic capability.The application of SAH hydrolytic enzyme in detection architecture of variation comprises: weaken its catalytic activity since the SAH hydrolytic enzyme of mutagenesis and NAD ⁺Or variation has all taken place in the catalytic site of SAH hydrolytic enzyme or two sites; The hydrolysing activity that has weakened 5 ' end has still kept the oxidation activity of 3 ' end fully; Fixing in conjunction with SAH, the enzyme of SAH is cut speed approximately or be lower than 10.0.mu.M, approximately or be lower than 0.1S to the catalytic activity of SAH ^-1The SAH hydrolytic enzyme of variation has one or more the insertion, the site of disappearance or point mutation.More particularly, the SAH hydrolytic enzyme of variation derive from the amino acid sequence of SEQID No.1 statement or by the amino acid of the nucleic acid sequence encoding of SEQ ID No.2 statement but comprise a following place or the many places variation: Phe302 of Phe302K, K186S, H301N, H353T, R343F, D190R, F82R, T157K, N181A, twice variation of R431H and K426A, perhaps in minuent, the hybridization of moderate or height, it is that 10% of wild type maximum reaches 50% that its enzyme is cut speed, but has weakened its catalytic activity.

Use the statement of SAH hydrolytic enzyme, with before the SAH hydrolytic enzyme of variation combines, the Hcy of oxidized form will be converted into the Hcy of reduced form at sample, but oxidized form Hcy is converted into reductive agent that the Hcy of reduced form uses and can uses the reductive agent of listing below be not limited to and only use following reductive agent: tricresyl phosphate butanols (TBP), mercaptoethanol (β-ME), dithioerythritol (DTT), dithioerythritol, mercaptoacetic acid, glutathione, nitrile boron hydrogen sodium, NaBH, KBH, metallic ion.

The SAH hydrolytic enzyme is used in concrete statement, and with before the SAH hydrolytic enzyme of variation combines, the Hcy in the sample need be converted into SAH at sample.Hcy in the sample is converted into SAH needs the not SAH hydrolytic enzyme hydrolysis of variation.For example exist SAH hydrolytic enzyme catalytic inhibitor in the SAH hydrolytic enzyme cohesive process of SAH in the sample and variation, neplanocin A or thimersol, but be not limited to above-mentioned two kinds of materials.

The application of the SAH hydrolytic enzyme of concrete statement variation with before the SAH hydrolytic enzyme of variation combine, needs the adenosine removing or degrade and dissociate at SAH, and this degradation can be passed through adenosine deaminase, purine nucleoside phosphorylase, and xanthine oxidase is finished.

The application of the SAH hydrolytic enzyme of concrete statement variation, when SAH combines with the SAH hydrolytic enzyme of variation, SAH or derivatives thereof, the analog of the mark that exists combine with the SAH hydrolytic enzyme competitively, and the content of degree of contention and the SAH of mark is relevant with the content of the SAH in the sample.Must be pointed out that the SAH derivant of mark or analog are fluorescently-labeled adenosine halfcystines.

The application of the SAH hydrolytic enzyme of concrete statement variation, the SAH hydrolytic enzyme of variation is the SAH hydrolytic enzyme of mark, the SAH hydrolytic enzyme of mark is by fluorescence labeling.

Concrete statement, the enzyme of variation is the betaine-HcyMetase of variation, and weakening its catalytic activity is because variation has taken place simultaneously for the binding site of betaine-HcyMetase and betaine and its catalytic site or two sites.

Concrete statement, the detection of Hcy should combine detection and or Hcy related levels for example cholesterol or folic acid joint-detection with other cardiovascular test item.

Folic acid

Concrete statement, the enzyme of variation is the methionine synthase of variation.In this example, folic acid is the element in the 5-methyl tetrahydrofolate, the desmoenzyme that contains folic acid of variation is the methionine synthase of variation, the catalytic activity that weakens methionine synthase is because the mutagenesis of its catalytic site, and binding site is in conjunction with cobalamin, and variation has all taken place for the variation of Hcy or this two sites.

Concrete statement, folic acid wherein is tetrahydrofolic acid, the desmoenzyme that contains folic acid of variation is the tetrahydrofolic acid methylferase of variation, weakened tetrahydrofolic acid methylferase catalytic activity and be because the mutagenesis of its catalytic site, and variation has all taken place in the variation of this binding site zygomite propylhomoserin or two sites.

Concrete statement, the material that contains folic acid is 5, the 10-methylene tetrahydrofolate, the desmoenzyme that contains folic acid of variation is the MTHFR of variation, the weakening of its catalytic activity is because the variation of its catalytic site.

Concrete statement, the material that contains folic acid is 5, the 10-methylene tetrahydrofolate, the desmoenzyme that contains folic acid of variation is the folic acid poly glutathione synthetase of variation, the weakening of its catalytic activity is because the variation of its catalytic site, and in conjunction with ATP, L-glutamic acid, Mg ²⁺The variation of binding site or both variation has taken place simultaneously.More particularly, the material that contains folic acid is a dihydrofoilic acid, the desmoenzyme that contains folic acid of variation is the dihyrofolate reductase of variation, and the weakening of its catalytic activity is because the variation of its catalytic site, and in conjunction with the variation of the binding site of NAHPH or both variation has taken place simultaneously.Again specifically, the dihyrofolate reductase of variation is the caseic dihyrofolate reductase of a kind of lactic acid bacteria, and the variation (Basran et al., Protein Eng., 10 (7): 815-2691997)) of Arg43Ala to Trp21 taken place.

Other example, the material that contains folic acid is 5, the 10-methylene tetrahydrofolate (5,10-methylene FH ₄), the desmoenzyme that contains folic acid of variation is the thymidylate synthetase of variation, the weakening of its catalytic activity is because the variation of catalytic site, and in conjunction with the binding site variation of dUMP or both variation taken place all.More particularly, the thymidylate synthetase of variation is human thymidylate synthetase, variation has taken place in following site: Tyr6His, Glu214Ser, Ser216Ala, Ser216Leu, Asn229Ala and His199X, the X here is meant any amino acid (Schiffer et al., Biochemistry, 34 (50): 16279-87 (1995) except histidine; Steadman et al., Biochemistry, 37:7089-7095 (1998); Williams et al., Biochemistry, 37 (20): 7096-102 (1998); Finer-Moore et al., J.Mol.Biol., 276 (1): 113-29 (1998).Again specifically, the thymidylate synthetase of variation is the Escherichia coli thymidylate synthetase, variation (Strop et al. has taken place at Arg126Glu, Protein Sci., 6 (12): or a Lactobacillus casei thymidylate synthasehaving a V316Am mutation (Carreras et al. 2504-11 (1997)), Biochemistry, 31 (26): 6038-44 (1992)).

Cholesterol

Concrete statement, the cholesterol in the detection, the detected material desmoenzyme of variation are the cholesterol desmoenzymes of variation, and this enzyme keeps fully even strengthened affinity to cholesterol, but has weakened its catalytic capability.More particularly, the cholesterol desmoenzyme of variation is the cholesterol esterase of variation, and the weakening of its catalytic activity is because the variation of its catalytic site, and in conjunction with H ₂The variation in the site of O, perhaps both make a variation simultaneously.Again specifically, cholesterol esterase is the pancreas cholesterol esterase, and the site of morphing is Ser194Thr or Ser194Ala (DiPersio etal., J.Biol.Chem., 265 (28): 16801-6 (1990)).Another one specifically, the cholesterol desmoenzyme of variation is a cholesterol oxidase, the weakening of its catalytic activity is because the variation of its catalytic site, and in conjunction with O ₂The variation of binding site, perhaps both make a variation simultaneously, more particularly, cholesterol oxidase is a sterolicum brevibacterium cholesterol oxidase, the site of morphing is:

Bile acid (salt)

Statement particularly, it is bile acid (salt) that micromolecule detects thing, and the detected material desmoenzyme of variation is the bile acid desmoenzyme of variation, and this enzyme fully keeps even has strengthened binding ability with bile acid (salt), but has weakened its catalytic activity.More particularly, the bile acid of variation (salt) desmoenzyme is the 3-alpha-hydroxysteroid dehydrogenase of variation, and the weakening of its catalytic activity is because the variation of its catalytic site, and in conjunction with NAD ⁺The variation of binding site or both all morph.

The detection Assays for Disorders Associated with Glucose Metabolism of carbohydrate metabolism disturbance

Statement particularly, the micromolecule detected material is a glucose, and the detection thing desmoenzyme of variation is the glucose desmoenzyme of variation, and the enzyme of variation fully keeps even has strengthened and the combining of blood sugar, but has weakened catalytic activity.More particularly, the glucose desmoenzyme is a thermosulfurogenes clostridium glucose isomerase, its variant sites produces His101Phe from following, His101Glu, His101Gln, His101Asp and His101Asn (Lee et al., J.Biol.Chem., 265 (31): 19082-90 (1990)).Another concrete variant enzyme is the hexokinase or the glucokinase of variation, and the weakening of its catalytic activity is because the variation of its catalytic site, and in conjunction with ATP, Mg ²⁺Perhaps both all morph.The variant enzyme that another one is concrete is a glucose oxidase, and the weakening of its catalytic activity is the variation owing to its catalytic site, and in conjunction with H ₂O or O ₂Binding site variation has taken place, perhaps both all morph.Any metabolic disorder relevant with glucose metabolism all can be monitored.

Ethanol

Statement particularly, the micromolecule detected material is an ethanol, and the detection thing desmoenzyme of variation is the ethanol desmoenzyme of variation, and this enzyme fully keeps even the adhesion of enhancing and ethanol, has still weakened its catalytic activity.More particularly, the ethanol desmoenzyme of variation is the alcohol dehydrogenase of variation, and the weakening of its catalytic activity is because the variation of its catalytic site, and in conjunction with NAD ⁺Or Zn ²⁺The variation of binding site, perhaps variation has all taken place in both.Again specifically, the alcohol dehydrogenase of variation is people's L-AD, morphs in following site: His51Gln (Ehrig et al., Biochemistry, 30 (4): 1062-8 (1991)).Another one specifies, and the alcohol dehydrogenase of variation is the L-AD of horse, morphs in following site: Phe93Trp or Val203Ala (Bahnson et al., Proc.Natl.Acad.Sci., 94 (24): 12797-802 (1997); Colby et al., Biochemistry, 37 (26): 9295-304 (1998)).

Some metabolic disorders such as goat, relevant with uric acid metabolism.

Statement particularly, it is uric acid that micromolecule detects thing, and the detection thing desmoenzyme of variation is the uric acid desmoenzyme of variation, and this enzyme fully keeps even the adhesion of enhancing and uric acid, has still weakened its catalytic activity.More particularly, the uric acid desmoenzyme of variation is the urate oxidase of variation, and the weakening of its catalytic activity is because the variation of its catalytic site, and in conjunction with O ₂, H ₂O, the variation of the binding site of Cu or both all morph.Again specifically, the urate oxidase of variation is the rabbit urate oxidase, and its variant sites is following site: H127Y, H129Y and F131S (Chu et al., Ann.N.Y.Acad.Sci., 804:781-6 (1996)).

Above all described in, representational detection sample is that body fluid or tissue include, but are not limited to following items: blood, urine, cerebrospinal fluid, synovial membrane liquid, amniotic fluid, histocyte such as biopsy cell.Again specifically, body fluid refers to blood or urine.More particularly, blood should be isolated blood plasma or serum.

The bond of here mentioning comprises: but a) Bian Yi detection thing desmoenzyme, this variant enzyme fully keep even strengthen its affinity weaken its catalytic activity; B) the detection desmoenzyme of reagent or variation with detect thing or detect the method that the enzymatic conversion thing of thing combines.More particularly, detect thing or detect the enzymatic conversion thing of thing and the detection thing desmoenzyme usage flag detection thing of variation, direct conversion product or derivatives thereof of the detection thing of certification mark or analog, the detection thing desmoenzyme of the variation of certification mark.Again specifically, the bond in the detection is Hcy even comprises cholesterol detection and or the reagent of folic acid.

At last, can provide kit and detection explanation to comprise bond above-mentioned and and instructions.The program of producing comprises that the enzyme of the variation of mark can indicate the enzyme that uses in the detection system, also can indicate the enzyme that comprises in the detection system.

Special complex, bond, kit and detection instructions are especially for small-molecule substance segmentation introduction below.

A. explanation

Unless otherwise indicated, used here all technology, scientific terminology have identical implication with the understanding in ordinary skill field.All patents, application form, the form of announcement and other publications and sequence, other data are all provided by GenBank company.

Here used analyte refer to can specific bond molecule to the enzyme, it promptly can be used as coenzyme, also can be used as accessory factor or substrate.

Here used enzyme refers to a kind of special protein, and it can catalysis and the specific metabolic response of promotion.Usually, enzyme is as catalyzer, but, comprises that also enzyme is modified here in reaction.Its catalytic activity is removed or sizable removing.Some enzyme is not so modified.

Here used analyte desmoenzyme is meant uses analyte as its coenzyme, accessory factor, the enzyme of one of unique substrate or substrate.As: the homocysteine desmoenzyme refers to the coenzyme of homocysteine as it, accessory factor, the enzyme of one of unique substrate or substrate.The homocysteine desmoenzyme comprises the SAH hydrolytic enzyme, cystathionie, and the beta-synzyme, methionine synthase, betaine-homocysteine methyltransgerase, egg ammonia enzyme centers on the homocysteine desmoenzyme with the conserved amino acid substitution effect that does not change enzymatic activity.Suitable amino acid whose conservative substituting is well-known technology, the amino acid whose conservative biologically active that can not change the material after the variation that substitutes.This is that scientific and technological circle are approved.(see，e.g.，Watson?et?al.Molecular?Biology?of?theGene，4th?Edition，1987，The?Bejacmin/Cummings?Pub.co.，p.224)。

Amino acid replacement such as table 1

Table 1

Original residue is conservative to be substituted

Ala(A) Gly；Ser

Arg(R) Lys

Asn(N) Gln；His

Cys(C) Ser

Gln(Q) Asn

Glu(E) Asp

Gly(G) Ala；Pro

His(H) Asn；Gln

Ile(I) Leu；Val

Leu(L) Ile；Val

Lys(K) Arg；Gln；Glu

Met(M) Leu；Tyr；Ile

Phe(F) Met；Leu；Tyr

Ser(S) Thr

Thr(T) Ser

Trp(W) Tyr

Tyr(Y) Trp；Phe

Val(V) Ile；Leu

Other is also allowed by experience decision or known conservative substituting.

Here used amino acid is meant various amino acid sequences, can be according to routine known 3 letter abbreviations or the identification of 1 letter abbreviations, and the nucleosides in the different dna fragmentations can be specified according to general standard individual character mother law.

Here used analysis of variance thing desmoenzyme refers to modification enzyme and substrate capture enzyme, it can fully keep even strengthen the adhesion of analyte or the direct product of analyte enzyme in course of reaction, representative keeps 10% of adhesion at least with respect to the wild type part, aptly, kept and be less than 50% adhesion, kept 60% of the direct converted product adhesion of analyte or analyte enzyme preferablyly, 70%, 80%, 90%, even 100%, perhaps have higher adhesion than its wild type part.The analysis of variance thing desmoenzyme here is as " substrate for induction enzyme ", and particular combination is in selected analyte or target molecule, but can not promote their conversion.

The direct converted product of analyte enzyme obtains by specific analyte desmoenzyme catalytic analysis thing, for example the direct converted product of SAH hydrolytic enzyme is SAH, the direct converted product of Hcy enzyme of cystathionine is a cystathionie, and the direct converted product of methionine synthase and betaine-homocysteine methylferase is a methionine

Here the evaluation of indication comprises the quantitative of analyte concentration and quantity absolute value and judges qualitatively, the homocysteine substrate complex in the sample for example, can pass through its index number, shared ratio, number percent, and the level of analyte in vision or other numerical value index expression sample, evaluation can be direct or indirect.

Here the weakening catalytic activity of indication is meant that analysis of variance thing desmoenzyme only keeps low-down catalytic activity when rehearsing antibody, promptly replaces antibody with micromolecule in immunization experiment.The accuracy of required reduction catalytic activity can be by experience decision in the past in each test.Representational, enzyme can keep 50% of one of all catalytic activitys of its wild type or catalytic activity, perhaps less than 50%; Preferably, analysis of variance thing desmoenzyme only keeps less than 40%, 30%, 20% of one of the total catalytic activity of its wild type or catalytic activity, 10%, 1%, 0.1%, or 0.01%, preferably, analysis of variance thing desmoenzyme is lost one of its all catalytic activitys or its catalytic activity.For example need to keep its catalytic activity or the further catalytic activity that reduces, catalytic inhibitor can influence reactions steps, and these catalytic inhibitors comprise heavy metal, sequestrant or other material.

Here the big molecule of indication refers to and need not just can produce the antibody that combines with big molecule in conjunction with other molecules.

Here the micromolecule of indication refers to just can not produce the antibody that can combine with it without the height polymerization or in conjunction with macromolecule or through the effect of assisting a ruler in governing a country.Micromolecular molecular weight is about 10,000D or less than 10,000D, even some micromolecular molecular weight are 5,000D or be less than 5,000D.

Here the inorganic molecule of indication refers to the not family of molecule of hydrocarbon-containiproducts.Here the organic molecule of indication refers to the family of molecule of hydrocarbon-containiproducts.Here the vitamin of indication refers to the required organism of biosome, and most vitamin can be used as the constituent of some coenzyme.Here the biomolecule of indication is often referred to the organic compound that constitutes biosome.Here the lipid of indication refer to non-water-soluble, the material of oily, it dissolves in the non-polar organic solvent, as chloroform.

Here the homocysteine of indication refers to by molecular formula to be the molecule formation of HSCH2 CH2 CH (NH2) COOH..Hcy is generated by the methionine demethylation, is the intermediate product that methionine generates halfcystine, and Hcy comprises free Hcy and in conjunction with Hcy, and Hcy can conjugated protein, peptide, the mercaptan of self or disulfide bond.Here the SAH hydrolytic enzyme of indication refers to be prevalent in a kind of enzyme in the eucaryote, also can find in some prokaryotes.But its catalysis SAH is hydrolyzed to Hcy and Ado, and the SAH hydrolytic enzyme also promotes Hcy and the synthetic SAH of Ado simultaneously.The SAH hydrolytic enzyme has various catalytic activitys, its coenzyme is NAD+/NADH., and aspect hydrolytic action, the 3-hydroxyl family that at first comprises SAH is by NAD+ (E-NAD+) oxidation, then the β base of L-Hcy is passed to 3 '-ketone-4 ', 5 '-didehydro-5 '-deoxidation-Ado.The intermediate product of combining closely of the water base group of 5 '-end offers the hydrogen ion of 3 '-ketone-adenine, thereby makes 3 '-ketone-adenine be reduced to adenine by the enzyme of NADH combination.

Here the SAH hydrolytic enzyme catalytic inhibitor of indication is meant the agent that suppresses one of SAH hydrolytic enzyme or whole catalytic activity, for example, 3 '-oxidation activity, 5 '-hydrolysing activity or 3 '-reducing activity, but do not influence the affinity of SAH hydrolytic enzyme to Hcy and/or SAH.

Here cystathionie-the beta-synthetase of indication refers to the enzyme of irreversible catalysis Hcy and the synthetic cystathionie of serine, and the coenzyme of cystathionie-beta.-synzyme is a phosphopyridoxal pyridoxal phosphate, centers on cystathionie-beta.-synzyme with the conserved amino acid that does not change enzymatic activity.

Here the methionine synthase of indication is meant irreversible catalysis Hcy and 5-methyl tetrahydrochysene acid (5-CH ₃-THF) generating the enzyme of methionine, the coenzyme of cystathionie-β .-synzyme is a Cobastab ₁₂, center on methionine synthase with the conserved amino acid that does not change enzymatic activity.

Here betaine-the homocysteine of indication-methylferase refers to that irreversible catalysis Hcy and betaine generate the enzyme of methionine and dimethyl-aminoacetic acid.Center on betaine-homocysteine-methylferase with the conserved amino acid that does not change enzymatic activity.

The egg ammonia enzyme of indication is meant that but catalysis S-substitutes amino acid and generates α here., β .-and α .leftbrkt-top.-removes, but also the various β of catalysis-and. the enzyme of left end brkt-top-displacement reaction, according to column balancing RSCH down ₂CH (NH ₂) COOH+R ' SH balance R ' SCH ₂CH (NH ₂) COOH+RSH (β-conversion) and RSCH ₂CH ₂CH (NH ₂) COOH+R ' SH balance R ' SCH ₂CH ₂CH (NH ₂) COOH+RSH (.leftbrkt-top.-exchange), R ' SH represents alkane or substituted Thio.Independently R and R ' be from alkyl, aromatic radical, and alkynyl, naphthenic base, heteroaryl, alkenyl, amino acid, selected in protein or its potpourri.Typically, R and R ' bag replaced or that do not substitute are less than 50 atoms.Carbochain can be a straight chain, and side chain or ring-type are arranged.Heteroatom contains S, N, O.A ring can be contained, two rings or more rings in aromatic radical and heteroaryl or other ring family.

Here the adenosine deaminase of indication refers to that catalysis trophicardyl deaminizating generates the enzyme of adenosine, centers on adenosine deaminase with the conserved amino acid that does not change enzymatic activity.

The purine nucleoside phosphorylase of indication refers to that but catalysis water and trophicardyl generate the enzyme of hypoxanthine and D-ribose, center on purine nucleoside phosphorylase with the conserved amino acid substitution effect that does not change enzymatic activity here.

Here the xanthine oxidase of indication refers to that the catalysis hypoxanthine generates uric acid and xanthic enzyme, substitutes around xanthine oxidase with the conserved amino acid that does not change enzymatic activity.

Here the folic acid family of indication refers to folic acid or vitamin B family, and chemical formula is a N-[4-[[2-amino 1,4-dihydro-4-oxygen-6-pteridine) methyl] amino]-benzxoyl]-L-glutamic acid or its derivant.Folic acid derivatives comprises dihydrofolate dehydrogenase, tetrahydrofolate dehydrogenase, 5-methyl-tetrahydrofolic acid and 5,10-methylene-tetrahydrofolic acid.

The tetrahydrofolic acid methylferase of indication refers to that but a kind of catalysis tetrahydrofolic acid and serine generate 5, the enzyme of 10-methylene-tetrahydrofolic acid and aminoacetic acid here.Center on the tetrahydrofolic acid methylferase with the conserved amino acid that does not change enzymatic activity by substituting.

But the MTHFR of indication refers to catalysis 5 here, and 10-methylene-tetrahydrofolic acid generates the enzyme of 5-methyl-tetrahydrofolic acid, and the conserved amino acid that does not change enzymatic activity of usefulness surrounds MTHFR by substitution effect.

But the folic acid poly glutathione synthetase of indication refers to catalysis 5 here, the enzyme of the generation of 10-methylene tetrahydrofolate-two glutamate derivatives, and its catalysis 5, the 10-methylene tetrahydrofolate, L-glutamate and ATP reaction generate ADP and phosphoric acid.Its accessory factor is Mg.2+, centers on folic acid poly glutathione synthetase with the conserved amino acid that does not change enzymatic activity by substituting.

Here the dihyrofolate reductase of indication refers to the catalysis dihydrofoilic acid, and NADPH and H..+ generate the enzyme of tetrahydrofolic acid and NADP+, surrounds dihyrofolate reductase with the conserved amino acid that does not change enzymatic activity by displacement reaction.

Here the thymidylate synthetase of indication is meant catalysis 5, and 10-methylene-tetrahydrofolic acid and dUMP generate the enzyme of dihydrofoilic acid and dTMP, surrounds thymidylate synthetase with the conserved amino acid that does not change enzymatic activity by substitution effect.

Here the cholesterol esterase of indication is meant that catalysis cholesterol and water generate the enzyme of fatty acid and cholesteryl ester, surround cholesterol esterase with the conserved amino acid that does not change enzymatic activity by substitution effect.

Here the cholesterol oxidase of indication is meant that Catalytic Oxygen and cholesterol generate the enzyme of cholesterol-4-en-3-one and water, surround cholesterol oxidase with the conserved amino acid that does not change enzymatic activity by substitution effect.

Here the bile acid of indication is meant the acid sterone that cholesterol generates in liver; bile acid enters small intestine with bile; fat-soluble vitamin helps the absorption of lipid; bile acid content maximum is the salt that the cholic acid cholate refers to bile acid in the human body, and the human body cholate is most to be liver and gall hydrochlorate and Bile Salts.

3-. Alpha-hydroxy-the steroid dehydrogenase of indication is meant that but catalysis 3-.alpha-hydroxyl-steroids and NAD+ generate the enzyme of 3-oxygen-bile acid and H.+ and NADH, surround 3-.alpha-hydroxyl-steroid dehydrogenase with the conserved amino acid that does not change enzymatic activity by substitution effect here.

But the glucose isomerase of indication refers to the enzyme of the mutual conversion between a kind of catalysis D-glucose and the D-fructose here, surrounds glucose isomerase with conservative its active amino acid replacement effect that do not change.

The hexokinase of indication or glucose oxidase are meant that but catalysis α .-D-glucose and ATP generate the enzyme of D-G-6-P here, and hexokinase or glucose oxidase enzyme co-factor are Mg. ²⁺, substitute encirclement hexokinase or glucose oxidase with the conserved amino acid that does not change enzymatic activity.

But the glucose oxidase of indication is a kind of catalysis glucose here, and water and oxygen generate the enzyme of gluconic acid, substitutes with the conserved amino acid that does not change enzymatic activity and surrounds glucose oxidase.

Here the alcohol dehydrogenase catalysis ethanol and the NAD of indication ⁺Generate acetaldehyde, NADH and H ⁺Enzyme, substitute to surround alcohol dehydrogenase with the conserved amino acid that does not change enzymatic activity.

Here the urate oxidase of indication and uricase catalysis uric acid, oxygen and water generate the enzyme of the former element of urine, and accessory factor is a copper, surrounds urate oxidase and uricase with the conserved amino acid that does not change enzymatic activity by substituting.

Here the serum of indication refers to that blood removes blood cell and fibrinous liquid part.It is different from the blood plasma in the circulation blood.

Here the blood plasma of indication refers to a kind of liquid tissue, is acellular component liquids in the blood.It is different from centrifugal do serum.

Here the high-purity of indication " substantially pure " is meant highly similar, the height homogeneous detects the standard method of purity by some, inhale method as thin layer, gel electrophoresis and high performance liquid chromatogram layer are inhaled method can not detect impurity, perhaps can not detect the change of its physics and chemical property during the fingering single step purification, as its enzymatic activity and biologically active.。。。But the material that chemical purity is high can be a steric isomer, and therefore the mixing of isomers, is further purified the specificity that can strengthen complex.Here the biologically active of indication refers to compound, complex, potpourri.Biologically active also comprises compound, complex, the curative effect of potpourri and pharmaceutically active.Biologically active can be observed in external test, as utilizes the oxidation activity oxidation substrates of luciferase, can produce fluorescence.

Here refer to can be in conjunction with a kind of molecule of specific ligand for the acceptor of indication, acceptor can be nature or synthetic.Acceptor also can be used as anti--part, and acceptor and anti--part be co-conversion mutually.Acceptor can use separately or be combined into condensate with other kind and use.Acceptor can carry out directly/indirect covalently or non-covalently combining with its bond, or the physical property combination.Acceptor comprises antibody, after birth acceptor or intracellular receptor, monoclonal antibody, medicine, polynucleotide, nucleic acid, peptide, accessory factor, lectin, sugar, polysaccharide, cell, cell membrane, organelle.

The example of acceptor and application are as follows

A) enzyme: special transportation also can be used as the combining target of antibody (part) for the protein or the basal enzyme of microorganism existence.

B) antibody: by the site that combines with epitope on the identification antibody, determine to intend the epitope sequence, can develop the medicine of vaccine or other diagnostic products and treating autoimmune diseases.

C) nucleic acid: the evaluation of part, as protein, RNA, binding site.

D) have the polypeptide of catalytic action: condensate, polypeptide has the ability that promotes chemical reaction.Polypeptide has a specific bond point at least to a reactant or reaction intermediate and activity functional groups usually.[see，e.q.，U.S.Pat.No.5,215,899]。

E) hormone receptor: have the part of high affinity to can be used for the exploitation of HRT with acceptor, for example control the exploitation of blood pressure medicine.

F) anesthetic acceptor: the part of measuring in conjunction with the calm acceptor of brain can be used for developing morphine and relevant low dependence producing drug.

Antibody: comprise antibody fragment, as forming the Fab fragment of light chain and variable region of heavy chain.

Class humanized antibodies: modify and to comprise the antibody of " people " amino acid sequence so that make the immune response that it can not exciting human.For example the hybridoma of monoclonal antibody expression comes by the gene recombination technology gained, and the constant amino acid region of the antibody of this technological expression is the zone of human antibodies.

Recombinant product: the protein that utilizes molecular biological DNA gene recombination technology to generate

Very identical " substantially identical ": refer to that product is closely similar, characteristic is almost constant, thereby available closely similar product replaces this product.Identical, of equal value " equivalent; ": be used for the nucleic acid of two sequences, be meant that the nucleic acid of these two sequences can compile out the amino acid of identical sequence or identical protein, also comprise the strict or height stringent condition hybridization of coding desired protein down of moderate.Identical, " equivalent " of equal value: be used in reference to two kinds of protein or peptide class, this contains fully identical amino acid sequence and has only by conservative amino acid and replace to refer to two kinds of protein or peptide class, can not change the activity or the function [see of protein or peptide class fully, e.g., Table 1, above] identical, " equivalent " of equal value: refer to performance, during characteristics, the not necessarily appearance of same degree of characteristic (enzymatic activity of the same type of two peptide molecules may show different speed), but active closely similar.The hybridization ability that can refer in addition, two row nucleotide.Suitable can be less than 25% mispairing, suitable, be less than 15% mispairing, even can be less than 10%, optimum, under the height stringent condition, hybridize, there is not mispairing between two relative amino acid.

The severity of hybridization is by the decision of mispairing percent, and is as follows

1) highly strict: 0.1.times.SSPE, 0.1%SDS, 65 ℃.

2) moderate strictness: 0.2.times.SSPE, 0.1%SDS, 50 ℃.

3) low severity: 1.0.times.SSPE, 0.1%SDS, 50 ℃.

Strict degree equivalent stringencies can be by selecting damping fluid, and salt and temperature obtain.

Fully, " substantially " very: identical in the article, corresponding or similar the change is meant at least 70%, further refers at least 80%, further refers at least 90% again, refers to 95% at most.

Complex: referring to a kind of potpourri that two or more products or compound are formed, can be a kind of solution, suspended emulsion, pulvis, paste, aqua or their combination in any.

In conjunction with: refer to the combination between the two or more materials.

Fluid: refer to the composition that any energy flows, comprise, semisolid, paste, solution, aqua, gelinite, lotion, the form of lotion and other potpourris.

Carrier (plasmid): refer in cell, introduce different DNA and carry out gene transcription or expression.Plasmid for example, recombinant virus or other carriers can insert in the suitable host cell, cause the clone of DNA.The expression of vector gene is included in prokaryotic and/or eukaryotic is incorporated the gene of host cell into other residual free genes or those.

Promoter region or startup factor: refer to the DNA or the RNA fragment of may command DNA or rna transcription, the promoter region comprises and can be discerned by RNA polymerase, in conjunction with also starting the particular sequence of transcribing.The part of promoter region is as promoter.In addition, the promoter region also comprises regulates these RNA polymerases identification, in conjunction with and start the sequence of transcriptional activity.Acceptor is subjected to the regulation and control of natural law, imitates promoter and is used to prokaryotes, comprises antibiotic T7 and T3 promoter etc.

Effectively connect and effectively combination: refer to the nucleotide sequence influence and the function relationship of the DNA that regulates, nucleotide sequence as, promoter, enhancer, the termination site of transcribing and translating and other burst.The effective physics and functional relationship that is meant DNA and promoter that be connected of DNA and promoter for example, RNA polymerase by special identification and in conjunction with promoter, starts transcribing of DNA in conjunction with the DNA promoter region.In in-vitro transcription or in expressing in order to make it reach optimization, need remove, increase, thereby or change clone 5 '-end untranslated part remove extra, potentially, inappropriately have optionally translation initiation codon or other sequence, expression of gene be disturbed or be reduced to these sequences may, transcribes or translate.As selectable, ribosomes binding site (see, e.g., Kozak, J.Biol.Chem., 266:19867-19870 (1991)) directly insert 5 of initiation codon '-end can strengthen expression.Above-mentioned desirable modification also can rule of thumb change.

Analyte during sample refers to test can be a biological specimen, as the body fluid sample or the tissue samples of biology.Body fluid sample comprises urine, blood, blood plasma, saliva, seminal fluid, stool, phlegm, cerebrospinal fluid, tear, mucus, amniotic fluid etc.Biological tissue is the aggregate that is made of cell and cytoplasm, can constitute the mankind, animal, and plant, bacterium, the structure of fungi or virus comprises connecing and forms tissue, epithelial cell, muscle and nerve fiber also comprise knurl, organ, lymph node, artery etc.

For blocking group, the abbreviation of amino acid and other compounds if do not point out separately, is all organized about the biological chemical name method according to its general generally acknowledged abbreviation or IUPAC-IUB.

.B. the method for test item

The method that detects project in the sample is provided here.Any can be with method correct given here antibody as a kind of detection of reagent: replace this antibody with a kind of enzyme that has been modified, like this, it is kept in conjunction with the ability of detection, and catalysis activity reduces (as, substrate capture enzyme) greatly.

Here the detection step that provides comprises: a) sample contacts with variation that is incorporated into detection or modification enzyme; And b) surveys detection or the directly combination between detection enzymatic conversion product with variation detection desmoenzyme.Variation or revise enzyme and still kept adhesion, to detection or directly the adhesion of detection enzymatic conversion product more improve than archetype or unmodified enzyme, but catalytic activity is weakened.

1. detection

Any detection that can be incorporated into enzyme as coenzyme, accessory factor or substrate specificity can detect with this method of just having announced.Detection can be any molecule, comprises biomacromolecule and micromolecule, gamete, anti-gamete and other kinds.Micromolecule preferably.Such as, this micromolecule detection is an inorganic molecule, so preferably individual inorganic ions is as sodium, potassium, magnesium, calcium, chlorine, iron, copper, zinc, manganese, cobalt, iodine, molybdenum, vanadium, nickel, chromium, fluorine, silicon, tin, boron or arsenic ion.

Another special example is, the micromolecule detection is an organic molecule, so preferably amino acid, be less than 10 amino acid whose polypeptide, vitamin, monose, the compound sugar that is less than 10 monose or lipid.

This law can detect all amino acid.For example, can detect D-and L-amino acid.Exception also can detect all nature polypeptide and protein group, comprises Ala (A), Arg (R), Asn (N), Asp (D), Cys (C), Gln (Q), Glu (E), Gly (G), His (H), Ile (I), Leu (L), Lys (K), Met (M), Phe (F), Pro (P) Ser (S), Thr (T), Trp (W), Tyr (Y) and Val (V).And amino acid whose all derivants of nature, as the derivant Hcy of Cys.

This law can detect all nucleosides.As adenine, guanine, cytimidine, thymine and uracil.

This law can detect all nucleotide.Such example has, AMP, GMP, CMP, UMP, ADP, GDP, CDP, UDP, ATP, GTP, CTP, UTP, dAMP, dGMP, dCMP, dTMP, dADP, dGDP, dCDP, dTDP, dATP, dGTP, dCTP and dTTP.Exception also can detect all 10 oligonucleotides such or other nucleotide that are less than.This law can detect all vitamin.As water soluble vitamin B1, lactochrome (B2), nicotinic acid, pantothenic acid (B3), B6, biotin (H), folic acid, cobalamin and ascorbic acid (C) are arranged, detect equally liposoluble vitamin as, vitamin A, D, E and K.

This law can detect all monose, and no matter D-still is L-monose, aldose or ketose.The example of monose has triose such as glyceraldehyde, tetrose such as erythrose and threose, pentose such as ribose, arabinose, wood sugar, lyxose and ribulose, hexose such as allose, altrose, glucose, mannose, gulose, idose, galactose, talose and fructose, heptose such as sedoheptulose.

This law can detect all lipid.Comprise that triacylglycerol is as (three) tristerin, triglycerin palmitate, olein, cured, phosphatide such as phosphatidyl-ethanolamine, lecithin, the pure and mild cuorin of phosphatidyl-4, sphingolipid such as sphingomyelins, cerebroside, gangliosides, steroid such as cholesterol and stigmasterol and fatty acid ester sterone.Fatty acid can be saturated fatty acid as 12 (alkane) acid, myristic acid, palmitic acid, stearic acid, arachidic acid and lignoceric acid, maybe can be unsaturated fatty acid such as palmitoleic acid, oleic acid, linoleic acid, leukotrienes and arachidonic acid.

Also have in other special examples, detected micromolecular molecular weight is approximately or less than 10,000 dalton.It is better that molecular weight is equal to or less than 5,000 dalton.

(but being not limited thereto) project that this law can detect also comprises, Hcy, folic acid family, cholesterol, glucose, ethanol and uric acid.

2. detection desmoenzyme (" substrate capture enzyme ") makes a variation

Any variation detection desmoenzyme that can keep adhesion or reduction catalysis activity can be used in this law.For example, if Hcy as to be detected, can use variation Hcy desmoenzyme as variation cystathionie-β-synthase, variation methionine synthase, variation betaine-HcyMetase, variation methioninase and variation SAH hydrolytic enzyme.

Can prepare the variant enzyme of ideal behavior with conventional variation method.Variation remnants can be identified as different remaining by systematic variation remnants, and reduce catalytic activity desirable and special substrate is remained with identifying of affinity.In addition, variation also may comprise that the influence of predicting various variations (sees, as Turner et al. (1998) Nature Structural Biol.5:369-376 based on precognition or known enzyme 3D structure; Ault-Richie et al. (1994) J.Biol.Chem.269:31472-31478; Yuan et al. (1996) J.Biol.Chem.271:28009-28016; Williams et al. (1998) Biochemistry 37:7096; Steadman et al. (1998) Biochemistry37:7089-7095; Finer-Moore et al. (1998) J.Mol.Biol.276:113-129; Strop et al. (1997) Protein Sci.6:2504-2511; Finer-Moore et al. (1996) Biochemistry 35:5125-5136; Schiffer et al. (1995) Biochemistry 34:16279-16287; Costi et al. (1996) Biochemistry35:3944-3949; Graves et al. (1992) Biochemistry 31:15-21; Carreras et al. (1992) Biochemistry 31:6038-6044).These precognitions also can be by obtaining in the stoichiometric calculation skill.Therefore, to any selected enzyme, test decision variation needs to suppress catalysis activity and keeps adhesion again.

A. nucleic acid coding detection desmoenzyme

Nucleic acid coding detection desmoenzyme can be by obtaining in the known method.The known nucleic acid sequence of detection desmoenzyme can be used to from nature or other source isolating nucleic acid code detection item desmoenzymes.In addition, nucleic acid coding detection desmoenzyme complete or part can be by known array chemosynthesis or commercial and other approach acquisitions.

Eukaryotic and prokaryotic can be used as the nucleic acid source of nucleic acid coding detection desmoenzyme.Its DNA can be cloned, be obtained from the target cell purification by standard program, chemosynthesis, cDNA clone or chromosomal DNA or the segment of known cloned DNA (as DNA " storehouse ").(see, for example, Sambrook et al., 1989, MolecularCloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.; Glover, D.M. (ed.), 1985, DNA Cloning:A Practical Approach, MRL Press, Ltd., Oxford, U.K.Vol.I, II.).The clone extracts except the code area from chromosomal DNA, also can contain specific and interior DNA district; The clone extracts and only contains outside sequence from cDNA or RNA.No matter the source where, the gene molecular cloning of feeling the pulse with three fingers simulataneously is the suitable carrier of gene breeding.

Gene molecule clone from cDNA, cDNA can be produced by known total cell RNA or mRNA.Also can from chromosomal DNA, obtain gene, dna segment promptly by chromosome produce (as, with restriction enzyme or mechanical shear), some DNA can be encoded into ideal basis because of.Then, the linear DNA segment can be rearranged separation by standard technique, includes but not limited to agarose and polyacrylamide gel electrophoresis and column chromatographic resolution.

In case the generation dna segment, identification contains the specific DNA segment of the gene of all or part detection desmoenzyme, has a lot of methods to finish.

The better method of separating a detection desmoenzyme gene is with polymerase chain reaction (PCR), from chromosome or cDNA storehouse, or the chromosomal DNA of unified warehouse-in or the desirable detection desmoenzyme sequence of cDNA amplification, can be used as the primer of PCR behind Oligonucleolide primers and the detection desmoenzyme sequence hybridization.

In addition, a part (any species) detection desmoenzyme gene or specific RNA or its segment can be purified (or oligonucleotides is synthetic) and mark, and the dna segment available core acid hybridization of generation sieves to the probe of mark.(Benton，W.and?Davis，R.，1977，Science?196：180；Grunstein，M.And?Hogness，D.，1975，Proc.Natl.Acad.Sci.U.S.A.72：3961)。Those and probe dna segment of the same clan is then hybridized.Detection desmoenzyme nucleic acid also can be discerned by expression cloning and be separated, such as utilizing the anti-detection desmoenzyme of selectivity antibody.

Except obtaining detection in conjunction with enzyme dna with clone or amplification, include but are not limited to, by the chemosynthesis of known detection desmoenzyme nucleotide sequence, or cDNA is become have the mRNA of detection desmoenzyme coding.Any known suitable method can be used.

Obtain after the clone, its feature can relatively confirm by nucleotide sequence (using known method) and with known detection desmoenzyme sequence.Dna sequence analysis can include but not limited to known method, the method (1980 of Maxam and Gilbert, Meth.Enzymol.65:499-560), the Sanger dideoxy method (Sanger, F., etal., 1977, Proc.Natl.Acad.Sci.U.S.A.74:5463), use T7DNA polymerase (Tabor andRichardson, U.S.Pat.No.4,795,699), use automated DNA serial device (e.g., AppliedBiosystems, Foster City, Calif.).

With the nucleic acid of detection desmoenzyme nucleic acid or the hybridization of nucleic acid coding detection desmoenzyme derivant, can under low, high or medium stringent condition, separate with nucleic acid hybridization.(Shilo?and?Weinberg，1981，Proc.Natl.Acad.Sci.USA?78：6789-6792).

B. select and produce variation detection desmoenzyme

In case obtain nucleic acid coding detection desmoenzyme, these nucleic acid can according to the detection desmoenzyme by mutagenesis, sieve and/or select, require reservation of detection desmoenzyme or enhancing adhesion, and weakened catalysis activity detection or the direct converted product of detection enzyme.Insert, wipe out or point mutation can be used for making nucleic acid coding to go out the detection desmoenzyme.Can use known mutating technology, include but not limited to, external direct mutagenesis (Hutchinson et al., 1978, J.Biol.Chem 253:6551) uses TAB.RTM. joint (Pharmacia), contains the PCR primer of sudden change, or the like.Different gene outcome phenotypes detects and can carry out after sudden change takes place.

When needing, the direct mutagenesis program can be utilized the carrier that strand and double-stranded DNA are provided.In general, as follows with the sudden change program of such carrier: synthetic mutant primer changes the primer of sequence as additional desire, but comprises base one or several change, that add or that remove.Primer is expanded at the external archaeal dna polymerase that carries out, and through after some additional operations, double-stranded DNA is transferred in the bacterial cell.Then, the desirable mutant DNA of identification that ins all sorts of ways, desirable albumen purifying from the clone who contains mutant nucleotide sequence comes out.For long sequence, often need extra clone's step, be difficult for stable because on those carriers, insert long sequence (being longer than 2,000 bases).A lot of biotech companies provide known rite-directed mutagenesis program, the Life Science of the U.S. for example, Inc. (ArlingtonHeights, Ill.) and Stratagene Cloning Systems (La Jolla, Calif.).

Structure-function data about the detection desmoenzyme can be used for the sudden change and the selection of detection desmoenzyme, and this enzyme should keep or strengthen the adhesion of detection enzyme or the direct converted product of detection enzyme is weakened catalytic activity.For example, sudden change can be to forming on the enzyme binding site of its coenzyme, accessory factor, non-detection substrate or mutant enzyme catalytic site or its complex.

In case a sudden change detection desmoenzyme has ideal behavior, as keeping or having strengthened the adhesion of detection enzyme or the direct converted product of detection enzyme is weakened catalytic activity, identified, this sudden change detection desmoenzyme can be obtained by any known method, comprises that recombinant expressed, chemosynthesis or both are comprehensive.Sudden change detection desmoenzyme is preferably obtained by recombinant expressed.

For recombinant expressed, sudden change detection desmoenzyme gene or portion gene are inserted into suitable cloning vector, express on special host cell.A large amount of known carrier hosts can use.Possible carrier includes but not limited to, plastid or the virion that is modified, but carrier system must be compatible mutually with the host cell that uses.Such carrier includes but not limited to, bacteriophage such as λ derivant, or plastid such as pBR322 or pUC plastid derivant or Bluescript vector (Stratagene).The insertion of cloning vector, for example, can be by dna segment be tied up into the cloning vector with corresponding sticky point.But, if there is no corresponding D NA segment sticky point on the cloning vector, the dna molecular end can be changed by enzymolysis.In addition, tie up into nucleosides (joint) sequence and can produce desirable site to the DNA sticky point; These by tie up into joint can comprise the oligonucleotides of special coding limiting acid endo enzyme recognition sequence.Recombinant molecule can import host cell by methods such as conversion, transfection, infection, electroporations, has so just produced a lot of gene orders.

In the another kind method, desirable gene can be identified and separate after being inserted into suitable cloning vector with " air gun " method.Before being inserted into cloning vector, ideal basis be because of breeding earlier, for example size classification.

In some special cases, the conversion of the host cell of band recombinant DNA molecules and separated sudden change detection desmoenzyme gene, cDNA or synthetic DNA sequence is duplicated gene at double.Like this, transformant is grown up, recombinant DNA molecules is separated from transformant, and where necessary, gives the insertion gene for change from the recombinant DNA that separates, and can obtain a large amount of genes.

The nucleotide sequences of encoding mutant detection desmoenzyme or functional activity analog or segment or other extensions can be inserted into a suitable expression, as one contain insert albumen decoding sequence transcribe and translate the necessary factor.Necessary transcribing with translation signals also can be provided by this family sudden change detection desmoenzyme gene and/or its flanking region.Many host-vector systems can be used in albumen decoding sequence and express.These systems include but not limited to, have infected viral mammal cell line system (as vaccinia virus, adenovirus etc.); Infected viral insect cell system (as baculoviral); Microorganism is as the saccharomycete of band yeast vector, or transformed the bacterium of drug-resistant capability and characteristic.Host-vector system according to utilizing can use suitable transcribing and translation factor.

The method that dna segment is inserted into carrier was described in the front, can be used to set up the carrier that contains the gene expression of transcribing/translating control signal and albumen decoding sequence containing suitably of the unknown.These methods can comprise reorganization (genetic recombination) in extracorporeal recombinant DNA and synthetic technology and the body.The encode expression of nucleic acid of sudden change detection desmoenzyme or a polypeptide, available second nucleotide sequence adjusted, and like this, sudden change detection desmoenzyme or polypeptide are just expressed in the host of recombinant DNA molecules.For example, the expression of a sudden change detection desmoenzyme is with being promoted the factor/enhancer to control.Can be used to control the promotion factor that sudden change detection desmoenzyme expresses includes but not limited to, SV40 promotes district (Bernoist and Chambon in early days, 1981, Nature 290:304-310), repetition 3 ' length the end that is contained in Rous sarcoma virus (RSV) promotes the factor (Yamamoto, et al., 1980, Cell 22:787-797), bleb gland pyrimidine kinases promotes the factor (Wagner et al., 1981, Proc.Natl.Acad.Sci.U.S.A.78:1441-1445), the adjustment sequence of metallothionein gene (Brinster et al., 1982, Nature 296:39-42); Prokaryotic expression carrier such as beta-lactamase promote the factor (Villa-Kamaroff, et al., 1978, Proc.Natl.Acad.Sci.U.S.A.75:3727-3731), or tac promote the factor (DeBoer, et al., 1983, Proc.Natl.Acad.Sci.U.S.A.80:21-25); Also see " Useful proteins from recombinant bacteria " in ScientificAmerican, 1980,242:74-94; The promotion factor of yeast or other fungies such as Gal 4 promote the factor, and ADC (alcohol dehydrogenase) promotes the factor, and PGK (phosphoglycerokinase) promotes the factor, and alkaline phosphatase promotes the transcripting controling area of the factor and some animal.

For example, can use carrier as containing with nucleic acid coding the available promotion factor that is connected to be arranged, have one or more origin of replications, also can be one or more optional marks (as antibiotics resistance genes).

Statement particularly, expressing a sudden change of the available subclone of structure detection desmoenzyme decoding sequence is the EcoRI restriction site, in three pGEX carriers any one.(Glutathione?S-Transferase?expression?vectors；Smith?and?Johnson，1988，Gene?7：31-40)。This makes the expression of sudden change detection desmoenzyme can be when correct read yard, by subclone production.

Containing expression vector that a sudden change detection desmoenzyme gene inserts can be by three kinds of common approaches identification: (a) nucleic acid hybridization, (b) existence of " mark " gene function or lack and (c) expression of insetion sequence.In first kind of approach, sudden change detection desmoenzyme gene is inserted into the existence of expression vector, available containing and the probe that inserts sudden change detection desmoenzyme homology, detects by nucleic acid hybridization.In second kind of approach, recombinant vector/host system can be identified and choose, based on the existence of some " mark " gene function or lack (as gland pyrimidine kinase activity, antibiotic resistance, transcribe phenotype, the sealing builds of baculoviral etc.), inserting sudden change detection desmoenzyme gene in carrier changes these functions.For example, if sudden change detection desmoenzyme gene is inserted in the marker gene sequence of carrier, the reorganization that contains the insertion of sudden change detection desmoenzyme can not be identified because of lacking the marker gene function.In the third approach, recombinant expression carrier can identify by recombinant expressed by analyzing sudden change detection desmoenzyme product.Illustrate, these analyses can be based in the analyzed in vitro system, the physics or the functional characteristic of sudden change detection desmoenzyme, as with anti-sudden change detection desmoenzyme antibodies.

In case a kind of specific recombinant DNA molecules is identified and separates, available multiple known method is bred it.In case set up suitable host system and growing environment, recombinant expression carrier just can quantitatively be bred and be prepared.As previously mentioned, available expression vector includes but not limited to carrier and its derivant: human body and animal virus such as vaccinia virus or adenovirus; Insect viruses such as baculoviral; Yeast vector; Phage vector (as λ), and plastid and cosmid DNA carrier and other.

In addition, host cell strain can be selected, adjusts the expression of insetion sequence according to the special requirement mode, or revise and handle gene outcome.Promote the expression that the factor is come from some, when some guidance exists, can be enhanced.Like this, the expression Be Controlled of detection desmoenzyme but genetic engineering is suddenlyd change.And different host cells has different characteristics and special mechanism to the translation of albumen and the processing of back translation with modification (as glycosylation, phosphorylation).Suitable cell line or host system can be selected to guarantee the ideal modification that foreign protein is expressed and to handle.For example, in bacterial system, express and to be used for production sugar based core protein product.In yeast, express and then produce glycation product.In suitable zooblast, express " this locality " glycosylation that can be used for guaranteeing foreign protein.And different carrier/host expression systems can influence reaction treatment and arrive in various degree.

3. sample collection

Above-described method can be used for analyzing any pattern detection item.In this example, sample to be measured is from mammal, and people's biological sample especially is as body fluid or tissue.Biology body fluid includes but not limited to, urine, blood, blood plasma, serum, saliva, seminal fluid, ight soil, phlegm, hair and other keratin sample, cerebrospinal fluid, tears, mucus and amniotic fluid.Biological organization may include but not limited to, cell aggregation, be generally a kind of special cell and its intercellular substance in order to the formation supporting structure, and the structure of the mankind that form, animal, plant, bacterium, fungi or virus comprises joint, epithelium, muscle and nerve fiber, organ, tumour, lymph node, artery and individual cells.In a special case, body fluid to be measured is urine.In another special case, body fluid to be measured is school work.Blood sample preferably is separated into blood plasma or serum composition again.

Serum or blood plasma can be obtained from the blood of gathering with any known method.In a special case, serum and blood plasma obtain by centrifugal collection blood.Carry out under the centrifugal condition that is preferably in sealer, sealer has than the heavy and gravity characteristic lighter than blood cell of serum and blood plasma, and blood cell can sink to the bottom like this, and through centrifugal, sealer is in barrier layer of formation under serum or the blood plasma, on the blood cell.Sealer can be used for but is not limited to following process, styrene powder (Japanese Patent Publication No.38841/1973), interlinkage polymeric hydrogel bead or dish (U.S.Pat.No.3,647,070), the polystyrene beads (U.S.Pat.No.3,464,890) and the silicone fluid (U.S.Pat.Nos.3 of surface band antithrombotic agent or wetting agent, 852,194 and 3,780,935).Best situation is, sealer is non-alternative alkyl acrylate and/or methacrylate alkane polymkeric substance, and its alkane chain should be no more than 18 carbon atoms, and polymer weight is about 1.03 to 1.08 and at the about 1s of shear velocity ^-1Viscosity is 5,000 to 1,000,000cps (25 ℃ of measurements) (U.S.Pat.No.4,140,631).

Statement particularly, the serum or the blood plasma in the blood district of sieving.The about 0.1-0.5g/cm of the about 0.2-5mu density of the most handy one deck mean diameter of blood ³Glass fibre filter, the blood plasma of separation or serum total amount are about 50% of glass fibre uptake at most; The serum and the blood plasma (U.S.Pat.No.4,477,575) of glass layer is passed in collection.With the glass fibre of the mean diameter 0.5-2.5mu that has poured into polypropylene ester derivant and polyethylene glycol also good (U.S.Pat.No.5,364,533).The polypropylene ester derivant is butylacrylic acid polymkeric substance, methacrylate polymer or ethyl group acrylate copolymer, and (a) butylacrylic acid polymkeric substance, (b) methacrylate polymer or ethyl group acrylate copolymer and (c) polyethylene glycol with (10-12): (1-4): ratio (1-4) mix use better.

Also has a better example, with the lignan frame (U.S.Pat.No.4 that contains oxygen side chain or side ring, 803,153) come processing blood to obtain serum or blood plasma, as use the d-sesamin, the l-sesamin, panlownin, d-asarinin, l-asarinin, 2 α-panlownin, 6 α-panlownin, pinoresinol, d-eudesmin, l-pinoresinol.beta.-D-glucoside, l-pinoresinol, l-pinoresinol monomethylether.beta.-D-glucoside, epimagnolin, lirioresinol-B, syringaresinol (dl), lirioresinonB-dimethyl ether, phillyrin, magnolin, lirioresinol-A, 2.alpha., 6.alpha.-d-sesamin, d-diaeudesmin, lirioresinol-C dimethyl ether (ddiayangambin) and sesamolin.The coagulant consumption is from about 0.01 to 50g/L blood.

C. homotype cysteine detecting method

It at present also is the method that detects the HCY in the sample.This method comprises following steps at least: a) use the HCY desmoenzyme of sudden change to combine with sample, the HCY desmoenzyme of this sudden change fully keeps or strengthens the affinity of itself and HCY, still weakens its catalytic activity.B) detect HCY that combines with the HCY desmoenzyme of sudden change or the product that transforms immediately by the HCY invertase

1. the metabolism of homocysteine

Homocysteine is that the methionine metabolism is the middle amino acid product of halfcystine.Two homocysteine tachymetabolism approach are arranged in the human body: (1) is condensed into cystathionie with serine, and (2) are converted into methionine again.

As mentioned above, the homocysteine level in the sample has the important clinical meaning.Homocysteine is being played the part of important role in containing the sulfhydryl amino acid metabolic; Metabolic product is pointed out different problems in metabolic pathway, comprise special inborn metabolic problems.Therefore, for example homocystinuria (abnormal HCY in the urine) is to impel the HCY generation methionine that methylates owing to lack cystathionase beta-synthetase or transmethylase tetrahydrofolic acid transmethylase, the second path has illustration: ##STR1##In the second pathway, which isillustrated as follows:##STR1##

The 1st, the methylene synthase; The 2nd, tetrahydrofolic acid (FH ₄) methylferase; The 3rd, the methyl tetrahydrofolate reductase; The 4th, dihyrofolate reductase; The 5th, thymine synthetase; Tetrahydrofolic acid is relevant with dihydrofoilic acid with the HCY level, also is relevant with the level of cobalamin in addition, and different enzymes can influence the level of HCY in this paths.

Sulfhydryl amino acid metabolic and cobalamin and folic acid have confidential relation, in a lot of biochemical reactions as substrate or accessory factor, HCY piles up the enzyme disorder that indication relies on cobalamin and folic acid metabolism, or other dysfunction, or with cobalamin and folic acid diseases associated.

The HCY metabolism also may be subjected to other antifolic drug influence, as medicine ninopterin anticancer and treatment asthma, needs the S-methyl tetrahydrofolate that methyl is provided because HCY changes into methionine.HCY also can be used to the used antifolic thing of monitor therapy malignant disease.Homocysteine level atherosclerotic in the blood relevant (seeing Clarke et al., New Eng.J.Med.324:1149-1155 (1991)), the moderate hyperhomocysteinemiainjury is the risks and assumptions of artery and heart disease.Therefore the HCY that detects in the blood is very important for detecting and treating angiocardiopathy.

2.Mutant the HCY desmoenzyme of Hcy-binding Enzymes sudden change

In HCY experiment, the HCY desmoenzyme of any sudden change fully keep or strengthen itself and HCY or HCY enzyme direct converted product affinity but slackened catalytic activity.For example saltant HCY desmoenzyme comprises cystathionine, sudden change methionine synthase, sudden change betaine HCY methylferase, sudden change egg ammonia enzyme and the synthetic hydrolytic enzyme of sudden change SAH.

In case a. select and produce HCY desmoenzyme Selecting and Producing Hcy-binding Enzymes HCY desmoenzyme nucleic acid coding to be decrypted, but these nucleic acid can or cover acquisition by mutagenesis, or are directly screened by HCY or HCY enzymatic conversion and keep high-affinity or improve the sudden change HCY desmoenzyme of affinity weaken catalytic activity.Utilize technology commonly used and method insertion, disappearance or the point mutation in C2c, narrated may be introduced in HCY desmoenzyme relevant in the HCY desmoenzyme of nucleic acid coding and be used for sudden change with structure function, the Hcy variant enzyme of selecting fully keeps even has strengthened its affinity in conjunction with Hcy or the direct product of Hcy enzymatic conversion, but has weakened its catalytic activity.For example, the variant sites of enzyme is the site that combines with following material: coenzyme, accessory factor, non-Hcy substrate, the enzymatic site of variation, or above-mentioned associating site.Statement particularly, the mutagenesis cystathionine, sudden change may occur in the vitamin B6 5 of cystathionine '-phosphoric acid or L serine or both make a variation simultaneously (Kim et al., Proc.Nat.Acad.Sci., 71 (2): 4821-4825 (1974)).For example, the Lys119 of human cystathionine possibility is deleted or mutagenesis becomes neutrality or acid amino acid residue (Kery et al., Biochemistry, 38 (9): 2716-24 (1999)).In the additionally concrete statement, methionine synthase may be occurred in the VB12 or the 5 methyl tetrahydrofolate (5-CH of methionine synthase by sudden change by mutagenesis ₃-THF) or both make a variation simultaneously, the Asp946 of human methionine synthase for example, Glu1097, Arg1134, Ala1136, Gly1138, Tyr1139 and Tyr1189 may be deleted or be mutated into different amino acid residues, Asp and Glu are mutated into neutrality or base residue i.e, Arg is mutated into neutrality or acidic residues, and Ala and Glu are mutated into the neutral residue of bulky side chain, and Tyr is mutated into residue (the Dixon etal. that does not have the aromatic series side chain, Structure, 4 (11): 1263-75 (1996)).The Escherichia coli methionine synthase that includes following amino acid sequences (in SEQ ID No.3 statement being arranged) is used for the detection of Hcy: His759Gly, Asp757Glu, Asp757Asn, or Ser810Ala (Amaratunga et al., Biochemistry, 35 (7): 2453-63 (1996)).Concrete statement in addition, SAH hydrolytic enzyme are by mutagenesis, and sudden change may be created on the NAD of the synthetic hydrolytic enzyme of SAH ⁺Or SAH hydrolyzation catalysis enzyme, as 5 '-the hydrolysing activity site, or both make a variation simultaneously.

Specifically statement in addition, betaine Hcy transmethylase is by mutagenesis, and sudden change may occur in the Zn. of betaine Hcy transmethylase ⁺On the betaine site.The Cys299 of for example human betaine Hcy transmethylase and Cys300 may lack or be mutated into the amino acid residue that does not have the SH-side chain, as serine (Millian andGarrow, Arch.Biochem.Biophys., 356 (1): 93-8 (1998))..

Concrete statement in addition, egg ammonia enzyme are by mutagenesis, and sudden change may occur on the R ' SH site of egg ammonia synthesis enzyme, increase a mercaptan alkyl or replace a thiol (Ito et al., J.Biochem., (Tokyo) 80 (6): 1327-34 (1976)).

In case predefined sudden change takes place in the HCY desmoenzyme, then reservation or enhancing are to the affinity of Hcy and the direct converted product of Hcy enzyme, and weaken its catalytic activity, the HCY desmoenzyme of sudden change just can comprise genetic recombination with what the B chapters and sections were narrated, chemosynthesis, or two kinds of methods preparations of dual-purpose, the method for usefulness genetic recombination obtains the Hcy desmoenzyme of sudden change.

B. Bian Yi SAH hydrolytic enzyme and nucleic acid coding the variation the SAH hydrolytic enzyme

The SAH hydrolytic enzyme is present in mammal, and the about 180-190KD of molecular weight includes the NAD that combines closely as coenzyme of 4 molecules ⁺, the catalytic process of enzyme comprises 2 continuous reactions, is accompanied by NAD ⁺Be transformed into NADH, substrate is transformed into 3 ' ketone by 3 ' oxygen; Then 5 '-hydrolysis generates Hcy and gland pyrimidine Ado (Refsum, et al., Clin.Chem., 31:624-628 (1985)).SAH hydrolytic enzyme C end is very easy to be saved, and includes the necessary amino acid residue of hydrolytic enzyme catalytic action.The crystal structure of the human SAH hydrolytic enzyme of nearest detection and substrate analogue inhibitor mixed.The X-line structure of SAH hydrolytic enzyme shows direct or indirect relevant with the substrate analogue inhibitor of minimum 20 amino acid residues, the coenzyme NAD of amino acid residue ⁺Variation can be the direct variation in site, and what this residue was direct or indirect combines with substrate, directly influences its catalytic activity, the gene order of the enzyme of variation can with the sequence of the enzyme of wild type relatively, thereby prove conclusively the enzyme that this enzyme is desirable variation.

Suppose it is the SAH hydrolytic enzyme of variation of purifying here, fully keep even strengthen its affinity, but weaken its catalytic activity Hcy or SAH.

Statement particularly, the SAH hydrolytic enzyme of variation is in conjunction with NAD ⁺Binding site or catalytic site variation has taken place, or variation all taken place in both, can cause fully keeping even strengthens its affinity to Hcy or SAH, but weaken its catalytic activity.

Statement particularly in addition, anomaly SAH hydrolytic enzyme has weakened the hydrolysing activity of 5 ' end, but has kept the oxidation activity of 3 ' end.

In other special phenotype, the SAH hydrolytic enzyme of variation fixing in conjunction with SAH.

Concrete statement, the enzyme of the SAH hydrolytic enzyme of variation are cut speed approximately or be lower than 10.0mu.M, and the SAH hydrolytic enzyme of variation is cut speed to the enzyme of SAH and is approximately or is lower than 1.0mu.M.Concrete statement, the SAH hydrolytic enzyme of variation are to the enzymatic activity of SAH approximately or be lower than 0.1S ^-Concrete statement, the SAH hydrolytic enzyme of variation has one or more the insertion, the site of disappearance or point mutation.More particularly, the SAH hydrolytic enzyme of variation derive from the amino acid sequence of SEQ ID No.1 statement or by the amino acid of the nucleic acid sequence encoding of SEQ ID No.2 statement but comprise a following place or the many places variation: Phe302 of Phe302K, K186S, H301N, H353T, R343F, D190R, F82R, T157K, N181A, twice variation of R431H and K426A.Independent nucleic acid fragment or DNA is provided, and perhaps RNA comprising the nucleotide sequence of the SAH hydrolytic enzyme of coding variation, and the SAH hydrolytic enzyme of variation fully keeps even strengthens its affinity to Hcy or SAH, but weakens its catalytic activity.

Statement particularly, the SAH hydrolytic enzyme of nucleic acid fragment coding variation independently, the weakening of its catalytic activity is because in conjunction with NAD ⁺Binding site or its catalytic site taken place the variation or both morph simultaneously.

Statement particularly, anomaly SAH hydrolytic enzyme, the SAH hydrolytic enzyme of variation has weakened 5 ' hydrolysis, activity; But still keep 3 ' oxidation activity of end

Statement particularly, nucleic acid fragment coding anomaly SAH hydrolytic enzyme independently, it is fixing in conjunction with SAH.Statement particularly, nucleic acid fragment coding anomaly SAH hydrolytic enzyme independently, the enzyme of the SAH hydrolytic enzyme of variation are cut speed approximately or be lower than 10.0mu.M, and the SAH hydrolytic enzyme of variation is cut speed to the enzyme of SAH and is approximately or is lower than 1.0mu.M.Statement particularly, nucleic acid fragment coding anomaly SAH hydrolytic enzyme independently, the SAH hydrolytic enzyme of variation are to the enzymatic activity of SAH approximately or be lower than 0.1S ^-

Statement particularly, nucleic acid fragment coding anomaly SAH hydrolytic enzyme independently, the SAH hydrolytic enzyme of variation has one or more the insertion, the site of disappearance or point mutation.More particularly, the SAH hydrolytic enzyme of variation derive from the amino acid sequence of SEQ ID No.1 statement or by the amino acid of the nucleic acid sequence encoding of SEQ ID No.2 statement but comprise a following place or the many places variation: Phe302 of Phe302K, K186S, H301N, H353T, R343F, D190R, F82R, T157K, N181A, twice variation of R431H and K426A.Plasmid further also is provided, comprises the nucleic acid fragment of the above-mentioned variation hydrolytic enzyme of encoding.More particularly, this plasmid is the sequence that a kind of expression vector includes following nucleic acid coding: a) promoter region, and b) Bian Yi SAH hydrolytic enzyme, it fully keeps even strengthens its affinity to Hcy or SAH, but weakens its catalytic activity.The sequence of the SAH hydrolytic enzyme of nucleic acid coding variation is relevant with promoter, expresses the SAH hydrolytic enzyme.More particularly, this plasmid comprises selectable mark.

The invention provides the recombinant host cell that comprises above-mentioned plasmid.To live cell can be following host cell in the place of reorganization but be not limited to: bacterial cell, yeast cells, fungal cell, vegetable cell, insect cell, zooblast.

The invention provides the SAH hydrolytic enzyme method of preparation variation.The host cell of reorganization can be grown in certain environment, and the SAH of variation passes through cellular expression therein.Separated or the recovery of the SAH hydrolytic enzyme of the variation of expressing.

Bian Yi SAH hydrolytic enzyme in addition, according to known technology preparation, comprise the B part for example in.This enzyme of SAH hydrolytic enzyme of above-mentioned variation fully keeps even strengthens its affinity to Hcy or SAH, but weakens the detection that its catalytic activity can be used for Hcy in the sample.

3. use the SAH hydrolytic enzyme of variation to detect Hcy

Explain particularly, what the Hcy desmoenzyme of variation used in the Hcy experiment is the SAH hydrolytic enzyme of variation, and its reservation or enhancing are to the affinity of Hcy and SAH, but catalytic activity is weakened.This experiment is the mask body statement down.The Hcy detection system Hcy that can degrade can utilize combining quantitatively or detecting of the SAH hydrolytic enzyme of variation and Hcy, and the SAH hydrolytic enzyme of wild type makes Hcy be converted into SAH.As described above, use the substrate capture technology to replace using monoclonal antibody to come detection by quantitative (seeing e.g., U.S.Pat.No.5,885,767 andU.S.Pat.No.5,631,127).Use the fluorescently-labeled target S-adenosine half Guang ammonia of catching with the combination of competition form, the SAH of variation is used for catching substrate.The suitable detection by quantitative of any suitable label can be used the substrate capture method.Reaction with the microwell plate form is arranged for example below; And use the mark of fluorescence labeling adenosine halfcystine to give an example.Particularly the statement, the catalytic activity of SAH hydrolytic enzyme since the variation the SAH hydrolytic enzyme in conjunction with NAD ⁺The site or its catalytic site taken place the variation or both morph simultaneously.Statement particularly, the SAH hydrolytic enzyme of variation weakens 5 ' hydrolysing activity, but still keeps 3 ' oxidation activity.Statement particularly, the SAH hydrolytic enzyme of variation can secure bond SAH.Statement particularly, the enzyme of the SAH hydrolytic enzyme of variation are cut speed Km and are less than or equal to and are 10.0.mu.M., and more particularly, the SAH hydrolytic enzyme of variation is cut speed approximately or less than 1.0.mu. to the enzyme of SAH.Statement particularly, the SAH hydrolytic enzyme of variation are to the enzymatic activity of SAH approximately or be lower than 0.1S ^-1Statement particularly, the SAH hydrolytic enzyme of variation has one or more the insertion, the site of disappearance or point mutation.More particularly, the SAH hydrolytic enzyme of variation derive from the amino acid sequence of SEQ ID No.1 statement or by the amino acid of the nucleic acid sequence encoding of SEQ IDNo.2 statement but comprise a following place or the many places variation: Phe302, Phe302K, K186S, H301N, H353T, R343F, D190R, F82R, T157K, N181A, twice variation of R431H and K426A.

Before the SAH hydrolytic enzyme reaction of sample and variation, must with reductive agent oxidized form Hcy be changed into reduced form Hcy in advance, reductive agent such as tributyl phosphate (TBP), β-ME (mercaptoethanol), the red bright alcohol of two sulphur (DTT), two sulphur erythrose alcohol, mercaptoacetic acid, glutathione, Tris phosphoric acid, nitrile boron hydrogen sodium, NaBH ⁴, KBH ⁴And metallic ion.

Statement particularly before the SAH hydrolytic enzyme contact reaction of sample and variation, needs removal or degraded to dissociate

Adenosine, adenosine is by adenosine deaminase, and purine nucleoside phosphatase and xanthine oxidase are degraded.

Embodiment

But illustrate below and not only be confined to following scope of invention.

Example one

Prepare the SAH hydrolytic enzyme code nucleic acid of variation

Human SAH hydrolase gene coding (SEQ ID No.1) EcoR I effect recombinant replication expression plasmid PKK223-3 (Pharmacia Biotech, Piscataway, N.J.).Plasmid PKK223-3 comprises strong TAC promoter, and this promoter is positioned at the upstream of multiple clone site, also comprises strong rrnB nuclear candy body terminal, and this terminal is positioned at the downstream, the control protein expression.The expression plasmid that comprises the SAH hydrolase gene transcribe E.coli strand JM109 go up (Invitrogen, Carlsbad, Calif.).The direct variation in SAH hydrolytic enzyme site is by following two kinds of forms: 1) variation of M13 method single stranded DNA 2) variation of PCP method double-stranded DNA.

The single stranded DNA variation

The single stranded DNA variation is Taylor et al, Nucleic Acids Res., and the method that 13:8765-8785 (1985) creates uses the Ncil of non-activity to untie the DNA chain that contains sulfenyl.Used the external variation RPN1526 of system of Sculptor.TM. (Amersham Life science, UK).The pKK223-3 plasmid comprises and includes SAH hydrolytic enzyme wild gene, and this plasmid prepares to be used for weakening the method for alkalescence, the method Promega ' s DNA purification kit plasmid purification (Wizard plus Minipreps, Promega, Madison Wis.).The plasmid of purifying was hatched 2 hours for 37 ℃ by the restriction enzyme enzyme hydrolysis, and making Promega DNA get EcoR I with Promega DNA purification kit by agarose gel electrophoresis, to cut partition disconnected.It is disconnected by T that the EcoR I of purifying cuts partition ₄Dna ligase be cloned among M13mp 19 DNA (Pharmacia Biotech Piscataway, N.J.).Ligase the One-phor-All damping fluid (10mM tris-Ac, pH 7.5,10mM Mg (Ac) 2,50mM KAc; Pharmacia LKBBiotechnology AB, Uppsala, Sweden) in 4 ℃ spend the night.90.mu.l the TG1 cell and the M13 of 10.mu.l hatched 30 minutes at 0 ℃, hatched 75 seconds for 42 ℃, connect product transcribe in the TG1 cell (Stratagene, La Jolla, Calif.).Be cooled to 0 ℃ 2 minutes, the 2XYT of 500.mu.l joins in the cell, hatches 10 minutes for 37 ℃.200.mu.l the TG1 cell of not transcribing in the TG1 mixing with cells of transcribing, adds in 42 ℃ the soft agar of 2.5ml.The cell that mixes adds in the LB agar disks of preheating 37 ℃ of overnight incubation immediately.The phage clone strain is used to detect the insertion of SAH hydrolytic enzyme, the sequence of location DNA, thereby the analysis activity of restriction enzyme.The phage clone strain of selecting is used to prepare the preparation of the masterplate of single stranded DNA.

The M13 bacteriophage TG1 cell overnight incubation in 2XYT circle of 3ml matter that includes the SAH hydrolase gene.In the 2XYT of 30ml, add the TG1 cell that a logarithm is grown up.Cell was hatched 8 hours and constantly jolting.Centrifugal, collect supernatant, promptly be the strand masterplate DNA of purifying.Running program according to the Amersham life science is carried out purifying.

Point mutation draw body

(order of low polynucleic acid estimates to be used for replenishing the order in the zone that comprises variant sites for Sterling, Va.) synthesis of oligonucleotides nucleic acid (15-30 base), and for example, the Lys variation is glu426 by CruaChem.The low polynucleic acid that is used for introduction comprises following order: GGCCCCTTCGAGCCGGATCACTACCGC (SEQ ID No.63), and GAG coding glu wherein, thus replace original AAG coding lys.Oligonucleotides(15-30bases)were?synthesized?by?CruaChem(Sterling，Va.)。

The substrate binding site and the coenzyme binding site (Turner et al., Nature Structural Biology, 5:369-376 (1998)) of the roentgen radiation x of the human SAH hydrolytic enzyme of the selection gene of variant sites.Amino acid residue is Thr157 for example, Asp131, His301, Lys186, Asn191, Glul56, Asp190, Phe362, Phe302, Asn181, His353, Glu59, Ser83, His55, Leu54, Cys79, His301, Arg343, Asp303, Leu344, the target (the special variation that please see following Table2 is shown) that Asn80, Asn346, Asp107 and complete C end residue can become variation comprises residue from Tyr193 to Asn346 in conjunction with the zone of coenzyme.

Low polynucleic acid dissolved concentration in water is 5ng/ml.Oligomeric nucleic acid solution under the kinase whose catalysis of Polynucleotide 5 ' end by phosphorylation, phosphorylation mixes with following material: the low polynucleic acid (5ng/ml) of 2.5ml, the kinase buffer liquid of the One-phor-all10 of 3ml times concentration (Pharmacia Biotech), 21.5ml water, the ATP of the 10mM of 2ml, 1ml Polynucleotide kinases (100000U/ml) (Pharmacia Biotech).Reaction mixture was hatched 30 minutes for 37 ℃, be heated to 70 ℃ 10 minutes, the activity of inactivator.

Table 2

The nucleic acid variant sites of people SAH hydrolytic enzyme

Codon

Mutant Mutagenic oligonucleotide changes SEQ ID

K186A GACTTCGTCACCGCCAGCAAGTTTGGG AAG.fwdarw. GCC?64

F302S AACATTGGACACTCTGACGTGGAGATC TTT.fwdarw. TCT?65

H301D TGTAACATTGGAGACTTTGACGTGGAG CAC.fwdarw. GAC?66

H353S TGTGCCATGGGCTCCCCCAGCTTCGTG CAC.fwdarw. TCC?67

R343A CTGGCCGAGGGTGCGCTGGTCAACCTG CGG.fwdarw. GCG?68

D190A AAGAGCAAGTTTGCCAACCTCTATGGC GAC.fwdarw. GCC?69

F82A AGCTGCAACATCGCCTCCACCCAGGAC TTC.fwdarw. GCC?70

N181D AACCTCTATGGCGACCGGGAGTCCCTC AAT.fwdarw. GAC?71

R431A CCGGATCACTACGCCTACTGAGAATTC CGC.fwdarw. GCC?72

K426R TGTGATGGCTTCCGCCCGGATCACTAC AAG.fwdarw. CGC?73

C195S AACCTCTATGGCTCCCGGGAGTCCCTC TGC.fwdarw. TCC?74

.sub..DELTA.432GATCACTACCGCTGATGAGAATTCGAG ATC.fwdarw.TGA?75

At low polynucleic acid: masterplate is in the annealing buffer in 2: 1 the ratio, oligomeric nucleic acid DNA of 5 '-phosphorylation and single stranded DNA (the M13 bacteriophage includes wild SAH hydrolase gene) annealing, annealing reaction is hatched 3min for 70 ℃, 37 ℃ of 30min then, forward to then in 55 ℃ of microcentrifugation test tubes and smash cool to room temperature.Annealing mixed liquor 17ml, (α-S) mix adds 1.5mlT to 19mldNTPA ₇DNA, room temperature 10 minutes, 37 ℃ 30 minutes, heat 70 ℃ 15 minutes, make its loss of activity stop the reaction, in reactant liquor, add T ₅37 ℃ of exonuclease (2000 unit) and exonuclease damping fluids, thus removed the unmanifest DNA of strand in 30 minutes.Add 15min among 70 ℃ the Ncil then, then at 37 ℃, the strand that the 90min assortment of genes is unmanifest.Unmanifest strand is added into the 16 excision enzyme III of unit digestion, hatches 30min, loses activity for 37 ℃.The DNA of poly otch, dNTP mixing B, the T of the dna polymerase i of 3.5 units and 2.5 units ₄Dna ligase adds in the reaction, hatches 1 hour for 37 ℃.

M ₁₃Bacteriophage includes the SAH hydrolase gene, changes in the purpose TG1 host cell by hot jolting method.The M of the variation of 10ml ₁₃Bacteriophage adds in the 90ml water, and with purpose TG1 cell mixing 40min in ice, 42 ℃ of even hatching 45 seconds of shaking of TG1 cell are cooled to 0 ℃, 5min immediately.The TG1 cell of transcribing is raised to room temperature, with 200ml just at the non-transcribed TG1 in growth period cell (cutting off) as the bacterium fetus cells, add the hot agar of 3ml fusing, mixing is poured into immediately in the cell of L-type plate, 37 ℃ are spent the night.Provoke the test tube that bacterium colony is put into the 2XYT of 3ml with toothpick, mixing spends the night, centrifugal collecting cell.Double-stranded DNA M ₁₃Bacteriophage is used Promega DNA purification kit purifying (Wizard plus Minipreps).

The centrifugal supernatant that obtains is used for purification of single stranded M ₁₃DNA.Use the strand M of SEQ 2.0 (Unites StatesBiochemical) ₁₃DNA morphs.Select double-stranded M ₁₃DNA comprises correct variation order, uses the EcorI digestion with restriction enzyme.The EcorI restriction enzyme includes the SAH hydrolase gene, utilizes agarose electrophoresis to use Qlaquick Gel Extraction kit to remove the method purifying.The EcoR I fragment of purifying is used T ₄Ligase clonal expression Pkk223-3 carrier inserts among the DNA in the variation of 10ml purifying, and the EcoR I of the 2ml that handled and 5 '-dephosphorylation Pkk223-3 carrier were hatched 10 minutes, inserts with 2: 1 ratios in carrier.Ligase is reflected in the One-phore-All damping fluid of the ATP that comprises 0.01M, and 16 ℃ are spent the night.The connection carrier that includes the SAH hydrolase gene changes in the target E.Coli JM109 cell by the method for hot jolting.Select the cell of transcribing of anti-ampicillin.The picking bacterial strain of anti-the ampicillin contains in the 2XYT circle matter of ampicillin of 35ml/mi at 10ml, 37 ℃ of growths 2 hours, mutagenesis among the IPTG of 1mM, 37 ℃ of overnight growth.Centrifugal collecting cell adds 0.8ml, and the Tris-Hcl of 50mM in the damping fluid of PH7.5, contains in the damping fluid of EDTA of 2mM.Cell is owing to fast freeze-thaw dissolves.4 ℃, 13500 left the heart 1 hour, collected supernatant; Analyze expression SAH hydrolytic enzyme variant protein by SDS-PAGE.Approximately molecular weight encloses the expression that 47000 daltonian heavy protein bands are SAH hydrolase protein matter.

Utilize the round pcr variation method

(Stratagene, La Jolla Calif.) utilize the round pcr variation to use the direct site variation of ExSitePCR kit.The ExSite method is used the template concentrations that increases, and carries out less than 10 round-robin pcr amplifications.Use Dpn I and Pfu archaeal dna polymerase processing template DNA, He Cheng DNA again, heterozygosis parental generation or the DNA potpourri that synthesizes again.The DNA of outside methylated parental generation template of digestion of Dpn I and hybridization, Pfu archaeal dna polymerase modify the terminal blunt end PCR product that produces.Connect in the end modified PCR product molecule and transcribe in the E.coli cell.The following description of concrete experimental product:

The dna profiling that in microcentrifugal tube, adds 0.5pmol, the variation damping fluid of 10 times of concentration of 2.5ml, the dNTP of the 25mM of 1ml mixes, and each promoter 15pml adds water and makes capacity reach 24ml.The Exsite archaeal dna polymerase potpourri (5U/ml) that in reaction mixture, adds 1ml then.Reactant liquor covers with the oil of 20ml, then through 7012 thermal cycles amplification DAN.The amplification parameter sees Table 3.

Table 3

The loop parameter (Mutagenesis Cycling Parameters) that sudden change generates

The fragment circulating temperature (degree centigrade) time

1 1 94 4min.

50 2min.

72 2min.

2 8 94 1min.

56 2min.

72 1min.

72 5min.

3 72 5min.

After the amplification, reaction tube was put in the ice 2 minutes, and the cooling reaction drops to and is lower than 37 ℃, in reaction tube, add the Dpn I restriction enzyme (10IU/ml) of 1ml and the clone Pfu archaeal dna polymerase (2.5U/ml) of 0.5ml, hatched 30 minutes for 37 ℃, be heated to 72 ℃, stopped increasing in 30 minutes.Connect product, in reaction tube, add 100ml redistilled water, the variation damping fluid of 10ml10 times of concentration, the rATP of 5ml 10mM.The above-mentioned reactant liquor of 10ml is transferred in the new centrifuge tube, adds the T4DNA ligase (4U/ml) of 1ml, connects liquid and hatches 1 hour for 37 ℃.The connection DNA of 2ml adds in the supernatant cell of Epicurian Coli XL1-Blue ice of 80ml, hatches 30 minutes, hatches 45 seconds in the ice 2 minutes then for 42 ℃.Transitional cell changes in the LB ampicillin agar medium immediately, and this nutrient culture media wherein has in the water of IOTG of 20ml10%X-gal DMF and 20ml 100M, and 37 ℃ are spent the night, and choose blue look bacterium colony, and this bacterium colony contains the bacteriophage of variation.The bacterium colony of choosing contains dna sequence dna, and the screening of protein expression and substrate capture as mentioned above.

Double-stranded PKK233-3 Promega DNA purification kit (Wizard plusMinipreps) purifying from the E.coli JM109 nutrient culture media of 50ml that contains the SAH hydrolytic enzyme.The involved PCP promoter annealing that is hopeful series of variation of the plasmid of purifying.

Use the direct site variation of ExSite PCR kit to lack and insert variation.Two kinds of variations or mixovariation use masterplate variation or disappearance DNA to carry out, and use M for variation for the second time or disappearance ₁₃Sudden change or PCP mutation method.

Differentiate substrate capture SAH hydrolytic enzyme

But the cell that extracts from the bacterial strain of abduction delivering SAH hydrolase protein utilizes the FPLC system to carry out chromatograph.Use the 0 sodium phosphate washing of arriving the 10mM of 1M.In the same or close time, the major protein peak of washing is that the SAH hydrolytic enzyme of wild type is collected.Collected most SAH hydrolytic enzyme (1-10.mu.g) and SAH (10mCi/mmole, 200.mu.M), the DTNB incubated at room of 30mM 5-30 minute.

Reactant liquor is by a kind of boundary 30000; Filtration membrane centrifugal filtration, filtered fluid is measured HCY (enzymatic activity), on the film through the phosphate buffer washing of the PH7.0 of 1ml50mM at the 412nm place ³The detection of the radioactivity of H had both had high radioactivity on film, with wild type enzyme filtered fluid in have the sex change hydrolytic enzyme of low absorbance to be chosen as candidate.Can desmoenzyme under the detection of active of enzyme speed because its characteristic has.

Anomaly SAH hydrolytic enzyme is lower than (10mCi/mmole in the SAH reaction, 200.mu.M) enzyme cut speed, enzymatic activity is lower than 0.1kat/s, and such enzyme can have the purifying of expression (the Escherichia coli nutrient culture media of the 1-2L) zymoprotein of a large amount to judge in conjunction with SDA-PAGE.

Example 2

The SAH hydrolytic enzyme of expression in enormous quantities and purifying wild type and anomaly

Purifying

IPTG mutagenesis E.Coli JM109 nutrient culture media is at the cell extraction liquid and the DEAE-cellulose (Sigma of (in the PKK-223-3 carrier in conjunction with the SAH hydrolase gene), St.Louis, Mo.) mix, with 0.1M sodium phosphoric acid, PH7.2, comprise the damping fluid statocyte extract of EDTA of 1mM and the mixed liquor vacuum filtration of DEAE-cellulose, with the Buffer A flushing of 3 volumes.With amino-acid salt sedimentation and filtration liquid.Filter albumen and leave heart collection, be dissolved in again in the phosphate buffer that 50mM PH7.2 contains 1mM EDTA with 13000.This albumen is by DEAE-sephrose ion exchange column (2.5times, 100cm) (Pharmacial Biotech, Piscataway, N.J.) layer dyes, use Nacl DEAE-Sepharose ion exchange column (2.5.times.30cm) flushing of obstructed gradient concentration then, detect by SDS-PAGE from the main protein peak of DEAE-Sepharose ion-exchange wash-out, in most cases the reactant liquor behind the purifying should obtain single protein band by the SDS-PAGE detection, can analyze other little protein bands in some cases, if this occurs, should dye by DEAE-sephrose ion exchange column layer again, thereby assurance obtains the protein of purifying.SAH hydrolytic enzyme activities or 3HSAH determine by protein peak in conjunction with activity.

The preservation of SAH hydrolytic enzyme behind the purifying

The wild type of purifying and anomaly SAH hydrolytic enzyme were dialysed 6 hours for 4 ℃ in the PB of the PH7.2 of 5mM.Freezing in liquid nitrogen then, vacuum or freeze-dried powder are preserved.Freeze-dried powder can be stablized 2 years-70 ℃ of preservations.Albumen behind the purifying also can-20 ℃ of preservations in 20% glycerine.For the wild type enzyme, add 20% the glycerine contain the 5mol adenine, enzymatic activity can be more stable.

The detection of enzymatic activity

Directly detect hydrolysis reaction and detect SAH hydrolytic enzyme activities (Yuan et al., J.Biol Chem., 271:28008-28016,1996). detect the ability of SAH hydrolysis adenine and Hcy.Coloured variation takes place by the DTNB of sulfo-in reaction product Hcy, detects at the 412nm place.The SAH hydrolytic enzyme can utilize HPLC to detect (see, Yuan et al., J.Biol.Chem., 268:17030-17037 (1993).The enzymatic activity of a unit is defined as the min/mg SAH enzyme amount of hydrolysis or synthetic 1 μ mol.

The detection of affinity activity

For mutated enzyme, enzymatic activity completely loses, and affinity is used filter membrane to analyze balancing technique and detected, and the SAH of this detection use 3H mark and Spectrum 5-cell Equilibrium analyser (Spectrum, Houston, Tex.).Filtering membrane is 25000.

Example 3

Reagent is prepared

Prepare fluorescently-labeled adenine and SAH analog

Method 1

ADO-5 '-carboxylic acid (Sigma, St.Louis, Mo.) derive from 9-methylol anthracene (HMA) (Fluka, Buchs, Switzerland), add 50mg HOBT, in nitrogen, carry out dry chemical dyeing, add 300mgN-ethyl-N ' (3-dimethylaminopropyl) carbodiimide hydrochloride in the 300ml chloroform, at the triethylamine that adds 5ml.Aforesaid liquid adds 200mgHMA, 100ml chloroform 0 ℃ of placement 30 minutes, and the mixed liquor room temperature was placed 10 minutes, and is dry in nitrogen stream, and residue is dissolved in (methyl alcohol: water=90: 10) in the mobile liquid phase of 10ml HPLC.The aforesaid liquid of 1ml injects one and half-prepative post (Econosphere, C18,7.times.300mm, Alltech, Dearfield, Ill.), use the balance filtration method, flow velocity is 2m/min, and 260nm is a detected peaks, fluorescence analysis is at 415nm and 365nm, and the material at 260nm and place, fluorescent absorption peak is the Ado-5 '-ester of HMA mark.

Method 2

Ado-5 ' caroboxylic acid and 4-bromomethyl-7-methoxycoumarin (Br-Mmc) (Sigma, St.Louis, Mo.) be dissolved in the acetoacetate (ethyl acetate) with 1: 3 ratio, add 2g K2CO3 in the 25ml reactant liquor, cooling then, join (Econosphere in the C18 post in the reactant liquor, C18,7.times.300mm, Alltech, Dearfield, Ill.) HPLC separates, and filters, and uses obstructed gradient methanol-eluted fractions: the concentration of 20-100%, wash-out 30 minutes, flow velocity 2ml/min.

Method 3

Adenosine-L-halfcystine and 4-bromomethyl-7-methyl oxidation cumarin is dissolved in the acetoacetate with 1: 3 ratio, and last solution is 25ml (ca, 1mg Ado-Cys), the K2CO3 that adds 200mg, this solution refluxed 1 hour at 80 ℃, cooling, join (Econosphere, C18,7.times.300mm in the C18 post in the reactant liquor, Alltech, Dearfield, Ill.) HPLC separates, filter, use obstructed gradient methanol-eluted fractions: the concentration of 20-100%, wash-out 30 minutes, flow velocity 2ml/min.

Method 4

Ado-Cys solution PH 9.0, among the CB of 1mmol/l, fluorescein isothiocynate (FITC) is dissolved among the DMSO of 5ml, uses PH9.0, and the CB of 1M dilutes isopyknic Ado-Cys and FITC, mixing, room temperature incubation 1 hour.Ado-Cys-FITC bond C18 mark, with HPLC separate (Econsphere, C18, Alltech, Dearfield, Ill.), filtered fluid is in the detection of 260nm place, 484nm, 520nm fluoroscopic examination.Moving phase is the different gradient concentration solution of water and cresols, from 0 to 80%, 35 minute wash-out.

The SAH hydrolytic enzyme that bag is made a variation on the microwell plate

SAH hydrolytic enzyme (F302S) bag of variation is by (Dynex Technologies on 96 microwell plates, Chantilly, Va.), every hole 200 μ l, F302S hydrolytic enzyme 20 μ g/ml, phosphate buffer 50mmol/l, PH7.6,4 ℃ are spent the night, turned letter, PBS (NaCL0.05%, 0.05% T-20) with 10mM washs 3 times, drains.4 ℃ of preservations are standby.

The preparation of standard and chemical reagent

1. production standard curve

(Fraction V powder Sigma) is dissolved among the PBS human albumin, and the concentration of albuminous concentration in blood plasma is identical.The albumin of 10ml adds 1% the TBP of 4ml, incubated at room 15 minutes, through a certain size (albumin concentration uses albumin concentration to adjust instrument and adjusts in the human plasma similar concentrations for Sephacryl-S100,2.times.90cm) gel filtration.The series concentration of L-Hcy is known, and the ultimate density that L-Hcy adds in the TBP handler plasma albumin is 0-50 μ M, after 37 degree are hatched 1h, and 70ml in the every pipe of the albumin of L-Hcy combination, as standard items ,-20 ℃ of preservations before using.

2. wild type SAH hydrolytic enzyme solution

Wild type SAH hydrolytic enzyme solution (20mU/50.mu.l) is dissolved in the 50mM phosphate buffer, PH7.2,1mM EDTA, 0.25mM Ado and 1mg/ml BSA.

3.TBP solution

TBP (Sigma) is dissolved among 1% the DMF.

4. fluorescein isothiocynate solution (FLAC)

The adenosine halfcystine of Br-Mmc-labeled Ado-Cys or FITC mark is dissolved in the 50mM phosphate buffer, PH7.2, and concentration is 0.5mM.

5.SAH hydrolase inhibitor dilution

Neplanocin A, a kind of SAH hydrolase inhibitor, the substrate of adenosine deaminase is dissolved in that inhibitor solution (50.mu.M) used with 1: 1.5 among the PB of 50mM PH7.2.

6. multienzyme solution

Adenosine (0.2U/.mu.l), Phosphatase, nucleotide (0.2U/l), xanthine oxidase (0.2U/.mu.l) is dissolved in the 50mM phosphate buffer, PH7.2, all enzymes all derive from Sigma.

7. washing lotion

Wash plate liquid composition: 10mM PBS, pH 7.2,0.1M NaCl and 0.05%Tween 20.

Example 4

Use the SAH enzyme of variation to detect

HCY trace routine in the blood plasma

Step 1.HCY is converted into SAH

Microcentrifugal tube or do not wrap in 96 orifice plates of quilt, the plasma sample of 50ul adds 20ulTBP and 50ul dilution, hatches 15 minutes for 25 ℃, adds the 20ul enzyme inhibitor, hatches to add non-activity SAH hydrolytic enzyme after 10 minutes.Step 2 is removed residual A DO and enzyme inhibitor.The multienzyme dilution that in the solution of step 1, adds 30ul, incubated at room 15 minutes.Step 3 is used the SAH hydrolytic enzyme trapping SAH of variation.The solution of 150ul step 2 is transferred in the microwell plate of the SAH hydrolytic enzyme that is coated with variation, and incubated at room 30 minutes is outwelled liquid.Step 4, cleaning fluid washing 3 times pats dry.The fluorescently-labeled Ado-Cys of step 5 combines the fluorescently-labeled Ado-Cys of 100ul or fluorescently-labeled Ado-5 ' ester and joins in the microwell plate of step 4 with the enzyme of variation, incubated at room 20 minutes, and cleaning fluid cleans 3 times.Step 6 detects the enzyme conjugates of fluorescently-labeled Ado-Cys and variation.

With 200ul PH7.2, the phosphate buffer of 50mM joins in the microwell plate of step 4, uses luminoscope to read that (Molecular Devices fmax), according to the concentration of Hcy in the absorbance blood plasma, can search in the establishing criteria curve.

The Hcy that selects detects

Selectively, Hcy detects and can be used for wrapping in advance by SAH in microwell plate, uses the SAH hydrolytic enzyme of fluorescence labeling variation, goes competitively in conjunction with detecting, and elaborates below:

1. wrap in advance by SAH on microwell plate.

2. in PCL3 under 50 ℃ of environment, by activating the SAH3 carboxylic group, SAH combines with poly-D-lysine, and SAH-poly-D-lysine bond is dissolved in the carbonic acid buffer of 0.1M PH9.6 then by the HPLC purifying, every hole adds the SAH Polynucleotide solution of 300ul 100g/ml, hatched 6 hours for 37 ℃, 10mMPBS, 0.1M NaCL wash plate 3 times, pat dry then, be stored in 4 ℃ before the use.SAH hydrolytic enzyme (the e.g. of fluorescently-labeled variation SAH hydrolytic enzyme Fluorophore-labeled Mutant SAH Hydrolase variation, F302S) specific marker is at the nonessential cysteine residues of Cys421, he is positioned at the protein top layer, is not included in the combination and the catalytic site of substrate.The Cys421 residue is the sulfo-activated group, does not influence enzyme in conjunction with being modified under the situation of activity.The thio reaction probe for example 7-diethylamino-3 (4 '-maleimidylphenyl)-4-methylcoumarin (CPM) can labelled protein.The SAH hydrolytic enzyme (F302S) of variation (0.5mg/ml); the adenosine 2ml that adds the sulfenyl that is used to protect other substrate binding sites in the PB damping fluid of PH7.250mM; hatching jointly and making its final concentration is 50mM; reactant liquor incubated at room 30 minutes; add and carry out separating gel in a certain size the separating column and filter (Sephacryl S-300; 4.5mm.times.60cm), remove adenine and unnecessary CPM.The SAH hydrolytic enzyme (2mg/ml) of the F302S variation of CPM mark is put into ℃ preservation of 50mM PB damping fluid-20, wherein contains 20% glycerine.The F302S enzyme of the SAH of wild type and variation cuts speed and catalytic activity is compared as follows table 4:

Table 4

The F302S enzyme of the SAH of wild type and variation cuts speed and catalytic activity compares

Type SAH hydrolytic enzyme

Enzyme Km (SAH) Kcat (SAH)

Wild type 7.9.mu.M 3.8S.sup.-1

F302S 1.0.mu.M 0.1S.sup.-1

The trace routine 2 of Hcy in the blood plasma

Step 1, Hcy is converted into SAH

Microcentrifugal tube or do not wrap in 96 orifice plates of quilt, the plasma sample of 50ul adds 20ulTBP and 50ul dilution, hatches 15 minutes for 25 ℃, adds the 20ul enzyme inhibitor, hatches to add non-activity SAH hydrolytic enzyme after 10 minutes.Step 2 is removed residual A DO and enzyme inhibitor.The multienzyme dilution that in the solution of step 1, adds 30ul, incubated at room 15 minutes.Step 3, the SAH hydrolytic enzyme of SAH and variation competitively.

The solution of 100ul step 2 changes over to and wraps in advance by in the microwell plate of poly-D-lysine-SAH bond, adds the SAH hydrolytic enzyme of the fluorescently-labeled variation of 150ul.Incubated at room 30 minutes is cleaned 3 times with cleaning fluid, pats dry.Step 4 detects the combination of fluorescently-labeled SAH hydrolytic enzyme in the microwell plate.In the microwell plate in the phosphate buffer adding step 3 of the 10nM of 200ul, at 390nm and 460nm place plate reading machine (MolecularDevices, fmax) reading.The concentration secundum legem curve of Hcy in the blood plasma is tried to achieve.

Sequence table

＜110〉Beijing Jiuqiang Biotechnology Co., Ltd.

＜120〉a kind of homotype cysteine detecting method

<130>

<160>2

<170>PatentIn?version?3.1

<210>1

<211>432

<212>PRT

＜213〉people

<400>1

Met?Ser?Asp?Lys?Leu?Pro?Tyr?Lys?Val?Ala?Asp?Ile?Gly?Leu?Ala?Ala

1 5 10 15

Trp?Gly?Arg?Lys?Ala?Leu?Asp?Ile?Ala?Glu?Asn?Glu?Met?Pro?Gly?Leu

20 25 30

Met?Arg?Met?Arg?Glu?Arg?Tyr?Ser?Ala?Ser?Lys?Pro?Leu?Lys?Gly?Ala

35 40 45

Arg?Ile?Ala?Gly?Cys?Leu?His?Met?Thr?Val?Glu?Thr?Ala?Val?Leu?Ile

50 55 60

Glu?Thr?Leu?Val?Thr?Leu?Gly?Ala?Glu?Val?Gln?Trp?Ser?Ser?Cys?Asn

65 70 75 80

Ile?Phe?Ser?Thr?Gln?Asn?His?Ala?Ala?Ala?Ala?Ile?Ala?Lys?Ala?Gly

85 90 95

Ile?Pro?Val?Tyr?Ala?Trp?Lys?Gly?Glu?Thr?Asp?Glu?Glu?Tyr?Leu?Trp

100 105 110

Cys?Ile?Glu?Gln?Thr?Leu?Tyr?Phe?Lys?Asp?Gly?Pro?Leu?Asn?Met?Ile

115 120 125

Leu?Asp?Asp?Gly?Gly?Asp?Leu?Thr?Asn?Leu?Ile?His?Thr?Lys?Tyr?Pro

130 135 140

Gln?Leu?Leu?Pro?Gly?Ile?Arg?Gly?Ile?Ser?Glu?Glu?Thr?Thr?Thr?Gly

145 150 155 160

Val?His?Asn?Leu?Tyr?Lys?Met?Met?Ala?Asn?Gly?Ile?Leu?Lys?Val?Pro

165 170 175

Ala?Ile?Asn?Val?Asn?Asp?Ser?Val?Thr?Lys?Ser?Lys?Phe?Asp?Asn?Leu

180 185 190

Tyr?Gly?Cys?Arg?Glu?Ser?Leu?Ile?Asp?Gly?Ile?Lys?Arg?Ala?Thr?Asp

195 200 205

Val?Met?Ile?Ala?Gly?Lys?Val?Ala?Val?Val?Ala?Gly?Tyr?Gly?Asp?Val

210 215 220

Gly?Lys?Gly?Cys?Ala?Gln?Ala?Leu?Arg?Gly?Phe?Gly?Ala?Arg?Val?Ile

225 230 235 240

Ile?Thr?Glu?Ile?Asp?Pro?Ile?Asn?Ala?Leu?Gln?Ala?Ala?Met?Glu?Gly

245 250 255

Tyr?Glu?Val?Thr?Thr?Met?Asp?Glu?Ala?Cys?Gln?Glu?Gly?Asn?Ile?Phe

260 265 270

Val?Thr?Thr?Thr?Gly?Cys?Ile?Asp?Ile?Ile?Leu?Gly?Arg?His?Phe?Glu

275 280 285

Gln?Met?Lys?Asp?Asp?Ala?Ile?Val?Cys?Asn?Ile?Gly?His?Phe?Asp?Val

290 295 300

Glu?Ile?Asp?Val?Lys?Trp?Leu?Asn?Glu?Asn?Ala?Val?Glu?Lys?Val?Asn

305 310 315 320

Ile?Lys?Pro?Gln?Val?Asp?Arg?Tyr?Arg?Leu?Lys?Asn?Gly?Arg?Arg?Ile

325 330 335

Ile?Leu?Leu?Ala?Glu?Gly?Arg?Leu?Val?Asn?Leu?Gly?Cys?Ala?Met?Gly

340 345 350

His?Pro?Ser?Phe?Val?Met?Ser?Asn?Ser?Phe?Thr?Asn?Gln?Val?Met?Ala

355 360 365

Gln?Ile?Glu?Leu?Trp?Thr?His?Pro?Asp?Lys?Tyr?Pro?Val?Gly?Val?His

370 375 380

Phe?Leu?Pro?Lys?Lys?Leu?Asp?Glu?Ala?Val?Ala?Glu?Ala?His?Leu?Gly

385 390 395 400

Lys?Leu?Asn?Val?Lys?Leu?Thr?Lys?Leu?Thr?Glu?Lys?Gln?Ala?Gln?Tyr

405 410 415

Leu?Gly?Met?Ser?Cys?Asp?Gly?Pro?Phe?Lys?Pro?Asp?His?Tyr?Arg?Tyr

420 425 430

<210>2

<211>2211

<212>DNA

＜213〉people

<400>2

ctgaggccca?gcccccttcg?cccgtttcca?tcacgagtgc?cgccagcatg?tctgacaaac 60

tgccctacaa?agtcgccgac?atcggcctgg?ctgcctgggg?acgcaaggcc?ctggacattg 120

ctgagaacga?gatgccgggc?ctgatgcgta?tgcgggagcg?gtactcggcc?tccaagccac 180

tgaagggcgc?ccgcatcgct?ggctgcctgc?acatgaccgt?ggagacggcc?gtcctcattg 240

agaccctcgt?caccctgggt?gctgaggtgc?agtggtccag?ctgcaacatc?ttctccaccc 300

agaaccatgc?ggcggctgcc?attgccaagg?ctggcattcc?ggtgtatgcc?tggaagggcg 360

aaacggacga?ggagtacctg?tggtgcattg?agcagaccct?gtacttcaag?gacgggcccc 420

tcaacatgat?tctggacgac?gggggcgacc?tcaccaacct?catccacacc?aagtacccgc 480

agcttctgcc?aggcatccga?ggcatctctg?aggagaccac?gactggggtc?cacaacctct 540

acaagatgat?ggccaatggg?atcctcaagg?tgcctgccat?caatgtcaat?gactccgtca 600

ccaagagcaa?gtttgacaac?ctctatggct?gccgggagtc?cctcatagat?ggcatcaagc 660

gggccacaga?tgtgatgatt?gccggcaagg?tagcggtggt?agcaggctat?ggtgatgtgg 720

gcaagggctg?tgcccaggcc?ctgcggggtt?tcggagcccg?cgtcatcatc?accgagattg 780

accccatcaa?cgcactgcag?gctgccatgg?agggctatga?ggtgaccacc?atggatgagg 840

cctgtcagga?gggcaacatc?tttgtcacca?ccacaggctg?tattgacatc?atccttggcc 900

ggtaggtgcc?agatgggggg?tcccggggag?tgagggagga?gggcagagtt?gggacagctt 960

tctgtccctg?acaatctccc?acggtcttgg?gctgcctgac?aggcactttg?agcagatgaa 1020

ggatgatgcc?attgtgtgta?acattggaca?ctttgacgtg?gagatcgatg?tcaagtggct 1080

caacgagaac?gccgtggaga?aggtgaacat?caagccgcag?gtggaccggt?atcggttgaa 1140

gaatgggcgc?cgcatcatcc?tgctggccga?gggtcggctg?gtcaacctgg?gttgtgccat 1200

gggccacccc?agcttcgtga?tgagtaactc?cttcaccaac?caggtgatgg?cgcagatcga 1260

gctgtggacc?catccagaca?agtaccccgt?tggggttcat?ttcctgccca?agaagctgga 1320

tgaggcagtg?gctgaagccc?acctgggcaa?gctgaatgtg?aagttgacca?agctaactga 1380

gaagcaagcc?cagtacctgg?gcatgtcctg?tgatggcccc?ttcaagccgg?atcactaccg 1440

ctactgagag?ccaggtctgc?gtttcaccct?ccagctgctg?tccttgccca?ggccccacct 1500

ctcctcccta?agagctaatg?gcaccaactt?tgtgattggt?ttgtcagtgt?cccccatcga 1560

ctctctgggg?ctgatcactt?agtttttggc?ctctgctgca?gccgtcatac?tgttccaaat 1620

gtggcagcgg?gaacagagta?ccctcttcaa?gccccggtca?tgatggaggt?cccagccaca 1680

gggaaccatg?agctcagtgg?tcttggaaca?gctcactaag?tcagtccttc?cttagcctgg 1740

aagtcagtag?tggagtcaca?aagcccatgt?gttttgccat?ctaggccttc?acctggtctg 1800

tggacttata?cctgtgtgct?tggtttacag?gtccagtggt?tcttcagccc?atgacagatg 1860

agaaggggct?atattgaagg?gcaaagagga?actgttgttt?gaattttcct?gagagcctgg 1920

cttagtgctg?ggccttctct?taaacctcat?tacaatgagg?ttagtacttttagtccctgt 1980

tttacagggg?ttagaataga?ctgttaaggg?gcaactgaga?aagaacagag?aagtgacagc 2040

taggggttga?gaggggccag?aaaaacatga?atgcaggcag?atttcgtgaa?atctgccacc 2100

actttataac?cagatggttc?ctttcacaac?cctgggtcaa?aaagagaata?atttggccta 2160

taatgttaaa?agaaagcagg?aaggtgggta?aataaaaatc?ttggtgcctg?g 2211

Claims (16)

1. the method for homocysteine (Hcy) in the detection sample comprising:

A) sample combines with S-adenosyl homocysteine (SAH) hydrolytic enzyme of variation, the SAH hydrolytic enzyme is clearly described its amino acid sequence in nucleotide sequence NO.1, comprising one or many optionally makes a variation, Phe302 sports Lys (F302K), Lys186 sports Ser (K186S), His301 sports Asn (H301N), His353 sports Thr (H353T), Arg343 sports Phe (R343F), Asp190 sports Arg (D190R), Phe82 sports Arg (F82R), Thr157 sports Lys (T157K), Asn181 sports Ala (N181A) and twice sudden change: Arg431 and sports His (R431H) and Lys426 and sport Ala (K426A);

B) detect the HCY that combines with the SAH hydrolytic enzyme of variation, SAH;

Thereby the content of the Hcy in the detection sample.

2. the method for claim 1, wherein at sample with before the SAH hydrolytic enzyme of variation combines, the oxidized form in the sample or the Hcy of mating type need change into the Hcy of free type.

3. the method for claim 1, wherein at sample with before the SAH hydrolytic enzyme of variation combines, the Hcy of the free type in the sample need change into SAH.

4. the method for claim 1, wherein the Hcy in the sample is changed into SAH by the SAH hydrolytic enzyme of wild type.

5. the method for claim 1 exists SAH hydrolytic enzyme catalytic inhibitor in the SAH hydrolytic enzyme cohesive process of SAH wherein and variation.

6. the method for claim 1, wherein mark SAH or its growth or analog in the SAH hydrolytic enzyme cohesive process of SAH and variation, so the SAH quantity of mark suppresses the effect of the SAH quantity in variability SAH hydrolytic enzyme and the sample competitively.

7. the method for claim 1, mark SAH derivant wherein or analog are a kind of fluorescence labelings.

8. the method for claim 1, wherein Bian Yi SAH hydrolytic enzyme is a kind of SAH hydrolytic enzyme of mark variation.

9. the method for claim 1, wherein the variability SAH hydrolytic enzyme of mark is the SAH hydrolytic enzyme of the variation of a kind of fluorescence labeling or enzyme labeling.

10. the method for claim 1, sample wherein is body fluid or biological tissue.

11. the method for claim 1, wherein body fluid should be selected from following: urine, blood, blood plasma, serum, saliva, seminal fluid, ight soil, saliva, cerebrospinal fluid, tear, mucus and amniotic fluid.

12. method as claimed in claim 11, body fluid wherein is blood.

13. method as claimed in claim 12, blood sample wherein need further be isolated blood plasma or serum.

14. method as claimed in claim 13, biological tissue wherein should select from following tissue: joint tissue, epithelial tissue, musculature, nerve fiber, organ, tumour, lymph node, artery and independent cell.

15. method as claimed in claim 14, wherein mark SAH or derivatives thereof or analog are fixed.

16. the method for claim 1, the SAH hydrolytic enzyme of variation is wherein fixed.