CN101357946A - Cholesterol metabolic regulation protein and use thereof - Google Patents
Cholesterol metabolic regulation protein and use thereof Download PDFInfo
- Publication number
- CN101357946A CN101357946A CNA2007100445433A CN200710044543A CN101357946A CN 101357946 A CN101357946 A CN 101357946A CN A2007100445433 A CNA2007100445433 A CN A2007100445433A CN 200710044543 A CN200710044543 A CN 200710044543A CN 101357946 A CN101357946 A CN 101357946A
- Authority
- CN
- China
- Prior art keywords
- ubiquitin
- ufd1
- protein degradation
- cell
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a ubiquitin fusion degradation protein 1 or the uses of an antagonist or an excitant thereof, which is a preparation used for preparing and regulating the metabolism of cholesterol. The invention further discloses a method for screening substance for regulating the metabolism of cholesterol by using the interaction of the ubiquitin fusion degradation protein 1 and a ubiquitin ligase gp78. The invention firstly reveals the mechanism that the ubiquitin fusion degradation protein 1 quickens the ubiquitination and the degradation of hydroxymethyl glutaryl coenzyme A reductases is involved in regulating the metabolism of cell cholesterol. Novel cholesterol reducing medicines can be screened out with the ubiquitin fusion degradation protein 1 as a target spot.
Description
Technical field
The invention belongs to biological technical field, specifically, the present invention relates to a kind of cholesterol metabolic regulation protein, described albumen can prepare the target spot of metabolic medicine of cholesterol regulating or conduct screening cholesterol regulating medicine.
Background technology
High-level cholesterol such as hypercholesterolemia can directly cause atherosclerosis in the body, are the main causes of apoplexy and coronary heart disease; The generation of senile dementia, obesity, diabetes etc. is also closely related with the cholesterol metabolic disorder.Along with people's dietary structure changes and social senilization, the generation of the cardiovascular diseases that the cholesterol metabolic disorder causes, senile dementia etc. is more and more, presses for the metabolic medicine of research and development cholesterol regulating.
Cholesterol is a kind of important sterols molecule, extensively is present in organic sphere, and it is biomembranous key ingredient, also is bile acide, sterols hormone and the unique precursor of some VITAMIN synthetic simultaneously, and has participated in many important signal transduction pathways.Cholesterol metabolism abnormity can directly cause the generation of serious disease, as: atherosclerosis (being the main cause of cardiovascular disorder, apoplexy), Alzheimer's disease and gallbladdergallstonecholetithiasis etc.Therefore the metabolic balance of studying cholesterol has important scientific meaning and medical value widely.
Synthesizing of cell inner cholesterol is to be raw material with the acetyl-CoA, through the final synthetic cholesterol of about 30 step successive enzymatic reactions.This process is subjected to strict regulation and control, wherein main rate-limiting reaction is to this step of mevalonic acid (Mevalonate) by hydroxy-methyl-glutaryl coenzyme A (HMG CoA), this reaction of catalysis be 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG CoA reductase, HMGCR).3-hydroxy-3-methylglutaryl coenzyme A reductase is subjected to the feedback regulation of cell inner cholesterol on multiple level, at transcriptional level, transcription factor cholesterol regulation sequence conjugated protein (Sterol regulation element binding protein, SREBP) promoter activity of regulation and control 3-hydroxy-3-methylglutaryl coenzyme A reductase gene; At protein level, sterol promotes the 3-hydroxy-3-methylglutaryl coenzyme A reductase degraded and reduces the synthetic of self cholesterol.Doctors Song Baoliang etc. discover that the 3-hydroxy-3-methylglutaryl coenzyme A reductase degraded of sterol regulation and control is to pass through Ubiquitin-Proteasome Pathway; Identifying cholesterol synthetic intermediate Lanosterol is the endogenous adjusting small molecules that specificity promotes the 3-hydroxy-3-methylglutaryl coenzyme A reductase proteolytic degradation; And found the special ubiquitin ligase gp78 of this degradation pathway and the key protein VCP that degrades.
As fully visible, the synthetic of cholesterol is the approach of a complexity, although this approach has been had certain understanding, yet also be necessary further to study, thus the good target spot that finds cholesterol metabolic to regulate.
Summary of the invention
The object of the present invention is to provide a kind of cholesterol metabolic regulation protein---ubiquitin merge protein degradation 1 (Ubiquitin fusion degradation 1, Ufd1) and use.
In a first aspect of the present invention, provide ubiquitin to merge the purposes of protein degradation 1 (Ufd1) or its antagonist or agonist, be used to prepare metabolic preparation of cholesterol regulating or composition.
In another preference, described ubiquitin merges protein degradation 1 and is selected from:
(1) albumen of the aminoacid sequence shown in the SEQ ID NO:1; Or
(2) aminoacid sequence shown in the SEQ ID NO:1 is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have regulate the cellular cholesterol metabolic function by (1) deutero-albumen.
In another preference, described ubiquitin merges protein degradation 1 and is: the gp78 shown in the 258-275 amino acids is in conjunction with the albumen in territory among (3) reservation SEQ ID NO:1; And/or keep the albumen of 81-85 amino acids among 92-93 amino acids among the SEQ ID NO:1 or the SEQ ID NO:1.
In a second aspect of the present invention, a kind of method of screening the metabolic material of cholesterol regulating is provided, described method comprises step:
(a) ubiquitin being merged protein degradation 1 contacts with candidate substances with the interactional system of ubiquitin ligase gp78;
(b) observe candidate substances and merge protein degradation 1 and the interactional influence of ubiquitin ligase gp78 for ubiquitin;
Wherein, interact with ubiquitin ligase gp78, show that then this candidate substances is to reduce the potential material of cellular cholesterol levels if described candidate substances can promote ubiquitin to merge protein degradation 1; Merge protein degradation 1 and ubiquitin ligase gp78 interaction if described candidate substances can suppress ubiquitin, show that then this candidate substances is to improve the potential material of cellular cholesterol levels.
In another preference, step (a) comprising: in test group, candidate substances is joined ubiquitin merge in protein degradation 1 and the interactional system of ubiquitin ligase gp78; And/or
Step (b) comprising: ubiquitin merges protein degradation 1 and ubiquitin ligase gp78 interaction in the system of detection test group, and with control group relatively, wherein said control group is that the ubiquitin that does not add described candidate substances merges protein degradation 1 and the interactional system of ubiquitin ligase gp78;
If ubiquitin fusion protein degradation 1 interacts to be better than statistically with ubiquitin ligase gp78 and (preferably significantly is better than, as strong by 20% in the test group; Preferred strong 40% or stronger) control group just shows that this material standed for is the potential material that reduces cellular cholesterol levels; If ubiquitin fusion protein degradation 1 interacts to be weaker than statistically with ubiquitin ligase gp78 and (preferably is significantly smaller than, as weak 20% in the test group; Preferred weak 40% or more weak) control group just shows that this material standed for is the potential material that improves cellular cholesterol levels.
In another preference, also contain 3-hydroxy-3-methylglutaryl coenzyme A reductase in the described system, and described method also comprises step: the ubiquitin situation of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded situation in the observation system;
If the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded are quickened, just show that this candidate substances is to reduce the potential material of cellular cholesterol levels; If the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded slow down, just show that this candidate substances is to improve the potential material of cellular cholesterol levels.
In another preference, it is to contain the cell that ubiquitin merges protein degradation 1 and ubiquitin ligase gp78 with the interactional system of ubiquitin ligase gp78 that described ubiquitin merges protein degradation 1; Or contain the solution that ubiquitin merges protein degradation 1 and ubiquitin ligase gp78.
In another preference, also comprise step:
The low-density lipoprotein of observation of cell (LDL) endocytosis situation;
If the low-density lipoprotein endocytosis of cell quickens, be to reduce the potential material of cellular cholesterol levels with regard to bright this candidate substances; If the low-density lipoprotein endocytosis of cell slows down, be to improve the potential material of cellular cholesterol levels with regard to bright this candidate substances.
In another preference, described method also comprises step: the potential material that obtains is carried out further cell experiment and/or animal experiment, to select for the metabolic material of cholesterol regulating.
In another preference, described ubiquitin ligase gp78 is selected from: (A) albumen of the aminoacid sequence shown in the SEQ ID NO:2; Or it is active by (A) deutero-albumen (B) replacement, disappearance or the interpolation of aminoacid sequence shown in the SEQ ID NO:2 through one or more amino-acid residues to be formed, and have ubiquitin ligase; Or (3) keep among the SEQ ID NO:2 Ufd1 shown in the 383-497 amino acids in conjunction with the albumen in territory.
In a third aspect of the present invention, provide a kind of ubiquitin to merge the purposes of protein degradation 1 (Ufd1), be used for:
(a) preparation strengthens the active composition of ubiquitin ligase gp78;
(b) preparation promotes the composition of 3-hydroxy-3-methylglutaryl coenzyme A reductase ubiquitinization;
(c) preparation promotes the composition of 3-hydroxy-3-methylglutaryl coenzyme A reductase degraded;
(d) preparation promotes the composition of low-density lipoprotein endocytosis; And/or
(e) preparation reduces the composition of cellular cholesterol levels.
In a fourth aspect of the present invention, provide in a kind of body or the metabolic method of external cholesterol regulating, described method comprises: regulate the interior ubiquitin of cell and merge the expression or the activity of protein degradation 1, or regulate the interaction that ubiquitin merges protein degradation 1 and ubiquitin ligase gp78 in the cell.
Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.
Description of drawings
Fig. 1 has shown the co-immunoprecipitation experiment of Ufd1 and gp78, has proved that gp78 and Ufd1 can mutually combine.
Fig. 2 has shown that crossing the Ufd1 albumen and the gp78 that express total length or disappearance partial sequence in cell carries out the co-immunoprecipitation result of experiment.
Fig. 3 had shown to cross and had expressed the ubiquitinization that Ufd1 significantly promotes 3-hydroxy-3-methylglutaryl coenzyme A reductase.
Fig. 4 had shown the degraded of expressing Ufd1 acceleration 3-hydroxy-3-methylglutaryl coenzyme A reductase excessively.
Fig. 5 has shown can obviously hinder the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase behind the Ufd1 transfectional cell that sequence is undergone mutation on the monomer ubiquitin binding site.
Fig. 6 has shown can obviously hinder the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase behind the Ufd1 transfectional cell that sequence is undergone mutation on the monomer ubiquitin binding site; Behind the Ufd1 transfectional cell that sequence is undergone mutation on the poly ubiquitin binding site, can obviously hinder the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase.
Fig. 7 has shown stably express Ufd1 in Chinese hamster ovary cell, causes the 3-hydroxy-3-methylglutaryl coenzyme A reductase protein content to descend the conjugated protein increase of adult form cholesterol regulation sequence.
Fig. 8 has shown stably express Ufd1 in Chinese hamster ovary cell, and cell obviously increases the absorption of LDL.
Embodiment
The inventor is through deep research, find that first ubiquitin merges protein degradation 1 (Ubiquitinfusion degradation 1, Ufd1) by strengthening the ubiquitin ligase activity of gp78, quicken the ubiquitinization and the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), participate in regulating the cellular cholesterol metabolism.With this albumen is target spot, can screen novel anticholesteremic agent.
The present invention has identified the common acting factor of Ufd1 as ubiquitin ligase gp78, Ufd1 and gp78 direct interaction have been proved, determined Ufd1 and the gp78 necessary aminoacid sequence that mutually combines, the degraded that ubiquitinization that proof Ufd1 and combining of gp78 can promote 3-hydroxy-3-methylglutaryl coenzyme A reductase and proteasome mediate, and it is synthetic to reduce the cell endogenous cholesterol, has determined that Ufd1 participates in promoting the aminoacid sequence of 3-hydroxy-3-methylglutaryl coenzyme A reductase ubiquitinization and degraded.Utilize achievement of the present invention, can be prevention or treating cholesterol related diseases (comprising hypercholesterolemia, atherosclerosis, coronary heart disease etc.) provides valid approach.
At first, the invention provides the purposes of a kind of Ufd1 albumen or its agonist or antagonist, be used to prepare the metabolic preparation of cholesterol regulating; Or the metabolic material of screening cholesterol regulating.
Ufd1 is a kind of ubiquitin degradation relative protein, is positioned on the human chromosome 22q11.In the present invention, used Ufd1 albumen can be naturally occurring, can be purified and separates from Mammals such as it.Preferably, the aminoacid sequence of described naturally occurring Ufd1 can be substantially the same with the sequence shown in the SEQ ID NO:1.In addition, described Ufd1 albumen also can be artificial preparation, such as producing the Ufd1 albumen of reorganization according to the gene recombination technology of routine.
The present invention also comprises the proteic fragment of Ufd1, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of Ufd1 albumen of the present invention or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue) are arranged, the polypeptide that in one or more amino-acid residues, has substituted radical, or additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms.
The present invention also can adopt Ufd1 albumen modified or improvement, such as, can adopt the Ufd1 albumen of being modified or improveing in order to promote its transformation period, validity, metabolism and/or proteic effectiveness.Also promptly, any proteic bioactive version of Ufd1 that do not influence all can be used among the present invention.
As a kind of mode of the present invention, the proteic active fragments of described Ufd1 is to keep among the SEQ ID NO:1 gp78 shown in the 258-275 amino acids in conjunction with the albumen in territory; Preferred, the proteic active fragments of described Ufd1 is to keep among 92-93 amino acids among the SEQ ID NO:1 or the SEQ ID NO:1 81-85 amino acids in conjunction with the albumen in territory, wherein, 92-93 amino acids site is relevant with the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase among the SEQ ID NO:1, and 81-85 amino acids site is relevant with the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase among the SEQ ID NO:1.
Described Ufd1 albumen can be in vivo or externally is applied to Mammals (such as the people) by direct or indirect mode, thereby by promoting the proteic activity of gp78, quicken the ubiquitinization and the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase, reduce cellular cholesterol levels.
Described Ufd1 is the common acting factor of ubiquitin ligase gp78.Ufd1 strengthens the ubiquitin ligase activity of gp78 by interacting with gp78, quickens the ubiquitinization or the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase, thereby reduces intracellular cholesterol levels.
Gp78 is a kind of glycoprotein.In the present invention, used gp78 albumen can be naturally occurring, can be purified and separates from Mammals such as it.Preferably, the aminoacid sequence of described naturally occurring gp78 can be substantially the same with the sequence shown in the SEQ ID NO:2.In addition, described gp78 albumen also can be artificial preparation, such as producing the gp78 albumen of reorganization according to the gene recombination technology of routine.
The present invention also comprises the proteic fragment of gp78, derivative and analogue.As used herein, term " fragment ", " derivative " are meant with " analogue " and keep identical biological function of total length gp78 albumen or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue) are arranged, the polypeptide that in one or more amino-acid residues, has substituted radical, or additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms.
The present invention also can adopt gp78 albumen modified or improvement, such as, can adopt the gp78 albumen of being modified or improveing in order to promote its transformation period, validity, metabolism and/or proteic effectiveness.Also promptly, any proteic bioactive version of gp78 that do not influence all can be used among the present invention.
As a kind of mode of the present invention, the proteic active fragments of described gp78 is to keep among the SEQ ID NO:2 Ufd1 shown in the 383-497 amino acids in conjunction with the albumen in territory.
Based on new discovery of the present invention, the research of Ufd1 albumen and gp78 protein-interacting has many-sided purposes, and described purposes includes, but is not limited to: the conditioning agent (promotor or inhibitor) of (promoting or inhibition) Ufd1 albumen and gp78 protein-interacting is regulated in screening thereby being used for preparation regulates the metabolic medicine of cellular cholesterol etc.
The present invention also provides a kind of method of screening the metabolic material of cholesterol regulating, and described method comprises: candidate substances is contacted with the system of Ufd1 albumen with the gp78 protein-interacting; Observe the influence of candidate substances for Ufd1 albumen and gp78 protein-interacting; Wherein, if described candidate substances can promote Ufd1 albumen and gp78 protein-interacting, show that then this candidate substances is to reduce the potential material of cellular cholesterol levels; If described candidate substances can suppress Ufd1 albumen and gp78 protein-interacting, show that then this candidate substances is to improve the potential material of cellular cholesterol levels.
In optimal way of the present invention, when screening, in order to be easier to observe the change of Ufd1 albumen and gp78 protein-interacting, also control group can be set, described control group can be the system of not adding the Ufd1 albumen and the gp78 protein-interacting of described candidate substances.
In addition, because Ufd1 albumen and gp78 protein-interacting can have influence on the ubiquitinization or the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase, therefore, when screening, also the ubiquitin situation of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded situation in the further observation system; If the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded are quickened, just show that this candidate substances is to reduce the potential material of cellular cholesterol levels; If the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded slow down, just show that this candidate substances is to improve the potential material of cellular cholesterol levels.
In addition, because Ufd1 albumen and gp78 protein-interacting also can have influence on the low-density lipoprotein (LDL) of cell, therefore, and when screening, the further low-density lipoprotein of observation of cell (LDL) endocytosis situation also; If the low-density lipoprotein endocytosis of cell quickens, be to reduce the potential material of cellular cholesterol levels with regard to bright this candidate substances; If the low-density lipoprotein endocytosis of cell slows down, be to improve the potential material of cellular cholesterol levels with regard to bright this candidate substances.
When being used to screen, can adopt the Ufd1 albumen or the gp78 albumen of total length, also can adopt the proteic active fragments of Ufd1 albumen or gp78, for example, described Ufd1 albumen can be to keep among the SEQ ID NO:1 gp78 shown in the 258-275 amino acids in conjunction with the albumen in territory; Described gp78 albumen can be to keep among the SEQ ID NO:2 Ufd1 shown in the 383-497 amino acids in conjunction with the albumen in territory.
The material that these preliminary screening go out can constitute a screening storehouse, can carry out further cell experiment and/or animal experiment to these materials, can be for the real useful medicine of cholesterol regulating metabolism so that finally can therefrom filter out.
Therefore, the present invention also comprises the metabolic conditioning agent of cholesterol regulating (agonist of Ufd1 albumen and gp78 protein-interacting or antagonist) that a class obtains by screening method of the present invention.
At present, known dna sequence, it is routine techniques in this area that this target DNA sequence is incorporated in various known dna molecules (as carrier) and the cell, as long as general personnel can operate easily according to prompting of the present invention.In addition, various forms of sudden changes being incorporated in the various dna moleculars also is technology well known in the art.Persons skilled in the art all know how to select appropriate carriers, promotor, enhanser and host cell.
With the recombinant DNA transformed host cell also is routine techniques well known to those skilled in the art.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used CaCl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Alternative is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.The transformant that obtains can be cultivated with ordinary method, expresses desired polypeptides.
In the present invention, interaction and interactional power can adopt multiple technology well known to those skilled in the art between detection albumen and the albumen, such as GST sedimentation techniques, display technique of bacteriophage, yeast two-hybrid system, fluorescence resonance transfer techniques or co-immunoprecipitation technology.
In a kind of optimal way of the present invention, adopt the immunoprecipitation technology to verify that the specificity between albumen and the albumen interacts.The principle of described co-immunoprecipitation technology is: keeping under the condition of protein-protein interaction, and results and lysing cell, immunoprecipitation target protein specifically from cell extract is then by method separating immune throw outs such as electrophoresis.Proteic co-precipitation with known features can be adopted anti-this proteic antibody, by detecting such as the Western trace.In addition, if cell carried out mark with marker before cracking, then can observe the albumen of co-precipitation by radioautograph or other immunological technique.
Major advantage of the present invention is:
The present invention passes through the effect research in 3-hydroxy-3-methylglutaryl coenzyme A reductase ubiquitinization and degradation process to Ufd1, prove first Ufd1 by with the combining of gp78, promoted the ubiquitin ligase enzyme activity of gp78, quickened the ubiquitinization and the degraded of cholesterol route of synthesis rate-limiting enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase, thereby participated in the cholesterol metabolic equilibrated is regulated.Design and screening of medicaments for target spot at Ufd1, expression amount by regulating Ufd1 or Ufd1 and gp78 combine or the activity of Ufd1, can regulate the anabolic level of cellular cholesterol, reach the purpose for the treatment of atherosclerosis and coronary heart disease etc.
According to the present invention, can be at the combining of Ufd1 and gp78, or Ufd1 is target spot to the influence of 3-hydroxy-3-methylglutaryl coenzyme A reductase ubiquitinization and proteolytic degradation, screens novel anticholesteremic agent.Medicine at this target spot, the drug dose of avoiding his spit of fland medicine just to compete inhibitory enzyme activity and causing 3-hydroxy-3-methylglutaryl coenzyme A reductase albumen compensatory to increase increases and relies on and cause problem such as toxicity, thereby the serious disease (as atherosclerosis, coronary heart disease etc.) that causes for the treatment hypercholesterolemia provides better treatment means.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.
I. experiment material and method
Material:
Protein?A/G?beads：Santa?Cruz?Biotechnology。
Antibody:
Anti-gp78 antibody: by the preparation method of polyclonal antibody of routine, by GST-gp78 (362-643aa) the fusion protein immunization rabbit acquisition of ordinary method preparation.
Anti-Ufd1 antibody: available from Carnegie Institution of Washington and HowardHughes Medical Institute, Baltimore, MD.
Anti-HMGCR antibody: by the preparation method of polyclonal antibody of routine, by GST-HMGCR (347-888aa) the fusion protein immunization rabbit acquisition of ordinary method preparation.
Anti-Myc antibody: available from Roche and Upstate.
Anti-T7 antibody: available from Novagen.
Anti-Ub antibody: available from Santa Cruz.
Anti-HA antibody: available from Sigma.
Anti-Actin antibody: available from Sigma.
Anti-Flag antibody: available from Sigma.
Anti-SREBP-1 antibody: available from Santa Cruz.
Anti-SREBP-2 antibody: available from Santa Cruz.
Two is anti-: available from Jackson ImmunoResearch Laboratories.
MG-132: available from Calbiochem.
The 25-oxycholesterol: available from Steraloids, Inc. (Newport, Rhode Island).
Cell transfecting reagent FuGene6: available from Roche.
Cell transfecting reagent Oligofectamin: available from Invitogen.
DiI: available from Sigma.
Delipidized protein serum: conventional ultracentrifugation prepares from foetal calf serum.
LDL: conventional ultracentrifugation prepares from human blood.
DiI-LDL: ordinary method is obtained by DiI label L DL.
Cell: HEK293 is available from ATCC; CHO-K1 is available from ATCC; SV589 is available from ATCC; The CHO-7 cell is available from ATCC.
Method
1. cross expression HMGCR, Insig, Ubiquitin, Ufd1, the structure of the plasmid of gp78
With ACGGGATCCATGTTGTCAAGACTTTTTCG (SEQ ID NO:3) and ACGGAATTCGGCTGTCTTCTTGGTGCAAGC (SEQ ID NO:4) is primer, the people's gene group cDNA library that obtains with ordinary method is a template, pcr amplification obtains the gene order of HMGCR, connect into after cutting with the BamHI/EcoRI enzyme in pCMV-3 * T7 plasmid of cutting through same enzyme, obtain behind transfered cell, can express the expression plasmid PCMV-HMG-Red-T7 of goal gene HMGCR.
Wherein the construction process of pCMV-3 * T7 plasmid is: the DNA (SEQ ID NO:12) of full gene composite coding 3 * T7 sequence, 5 ' end is provided with the NotI site simultaneously, 3 ' end is provided with the XhoI restriction enzyme site, connect into after enzyme is cut in the pcDNA3 plasmid (available from Invitrogen) after process NotI/XhoI enzyme is cut, obtain pCMV-3 * T7 plasmid.
With ACGGGATCCATGCCCAGATTGCACGACCAC (SEQ ID NO:5) and ACGGAATTCATCACTATGGGGCTTTTCAGG (SEQ ID NO:6) is primer, the people's gene group cDNA library that obtains with ordinary method is a template, pcr amplification obtains the gene order of people Insig-1, connect into after cutting with the BamHI/EcoRI enzyme in pCMV-6 * Myc plasmid of cutting through same enzyme, obtain behind transfered cell, can express the expression plasmid PCMV-Insig-1-Myc of goal gene Insig.
Wherein the construction process of pCMV-6 * Myc plasmid is: the DNA (SEQ ID NO:13) of full gene composite coding 6 * Myc sequence, 5 ' end is provided with the NotI restriction enzyme site simultaneously, 3 ' end is provided with the XhoI restriction enzyme site, connect into after enzyme is cut in the pcDNA3 plasmid (available from Invitrogen) after process NotI/XhoI enzyme is cut, obtain pCMV-6 * Myc plasmid.
Full gene composite coding HA-ubiquitin sequence (is HA and people's ubiquitin fusion protein, wherein the HA sequence is at 5 ' end of people's ubiquitin sequence, the middle catenation sequence that adds 6 amino acid lengths, concrete sequence is shown in SEQ ID NO:14) DNA, 5 ' end is provided with the NcoI restriction enzyme site simultaneously, 3 ' end is provided with the NotI restriction enzyme site, connects into after enzyme is cut in the pEF/myc/cyto plasmid (available from Invitrogen) after process NcoI/NotI enzyme is cut, and obtains pEF-HA-ubiquitin plasmid.
With ACGGGATCCATGGATTACAAGGATGACGACGATAAGTTCTCTTTCAACATGTTCGA C (SEQ ID NO:7) and ACGCTCGAGCCAATCAGCCAACAGTCCTCAC (SEQ ID NO:8) is primer, the people's gene group cDNA library that obtains with ordinary method is a template, pcr amplification obtains the gene order (wherein the Flag sequence derives from the sequence of the contained coding of 5 ' end primer Flag) of Flag-Ufd1, connect into after cutting with the BamHI/XhoI enzyme in the pCDNA3 carrier of cutting through same enzyme (Invitrogen), obtain behind transfered cell, can express the expression plasmid PCMV-FLAG-Ufd1 of goal gene Ufd1.
With ACGAAGCTTATGCCGCTGCTCTTCCTCGAG (SEQ ID NO:9) and ACGGGATCCGGAGGTCTGCTGCTTCTGAAGC (SEQ ID NO:10) is primer, the people's gene group cDNA library that obtains with ordinary method is a template, pcr amplification obtains the gene order of gp78, connect into after cutting with the HindIII/BamHI enzyme in pCMV-5 * Myc plasmid of cutting through same enzyme, obtain behind transfered cell, can express the expression plasmid pCMV-gp78-Myc of goal gene gp78.
Wherein the construction process of pCMV-5 * Myc plasmid is: the DNA of full gene composite coding 5 * Myc sequence (SEQID NO:15), at 5 ' end the NotI restriction enzyme site is set simultaneously, at 3 ' end the XhoI restriction enzyme site is set, connect into after enzyme is cut in the pcDNA3 plasmid (available from Invitrogen) after process NotI/XhoI enzyme is cut, obtain pCMV-5 * Myc plasmid.
The structure of the carrier of expression Ufd1 deletion mutant is as follows:
Adopt the QuickChange rite-directed mutagenesis test kit (StrataGeneQuickChange Site-directed Mutagenesis Kit) of StrataGene company, with the pCMV-FLAG-Ufd1 plasmid is that template prepares disappearance 8-119 position respectively, the 120-214 position, the 215-302 position, the 216-241 position, the 242-257 position, the 258-275 position, the Ufd1 deletion mutant of 276-307 amino acids (△ 8-119, △ 120-214, △ 215-302, △ 216-241, △ 242-257, △ 258-275, △ 276-307), obtain behind transfered cell, can express the carrier of corresponding deletion mutant.
The structure of the carrier of expression gp78 deletion mutant is as follows:
Adopt the QuickChange rite-directed mutagenesis test kit (StrataGeneQuickChange Site-directed Mutagenesis Kit) of StrataGene company, with pCMV-gp78-Myc is that template prepares disappearance 8-119 position, 7-308 position, 309-382 position respectively, the 383-578 position, the 579-638 position, 341-382 position, 383-455 position, the 456-497 position, the 498-578 position, the gp78 deletion mutant of 309-643 amino acids (△ 7-308, △ 309-382, △ 383-578, △ 579-638, △ 341-382, △ 383-455, △ 456-497, △ 498-578, △ 309-643), acquisition can be expressed the carrier of corresponding deletion mutant behind transfered cell.
The structure of PCMV-FLAG-Ufd1 (PB Mut) is as follows:
Adopt the QuickChange rite-directed mutagenesis test kit (StrataGeneQuickChange Site-directed Mutagenesis Kit) of StrataGene company, with the pCMV-FLAG-Ufd1 plasmid is that template prepares the 81st glycine, the 82nd Xie Ansuan, the 83rd leucine, the 84th L-glutamic acid, the 85th the Ufd1 mutant (PCMV-FLAG-Ufd1 (PB Mut)) that the phenylalanine simultaneous mutation is a L-Ala, acquisition can be expressed the carrier of corresponding deletion mutant (being poly ubiquitin binding site generation series jump) behind transfered cell.
The structure of PCMV-FLAG-Ufd1 (MB Mut) is as follows:
Adopt the QuickChange rite-directed mutagenesis test kit (StrataGeneQuickChange Site-directed Mutagenesis Kit) of StrataGene company, with the pCMV-FLAG-Ufd1 plasmid is that template prepares the 92nd halfcystine, the 93rd the Ufd1 mutant (PCMV-FLAG-Ufd1 (MB Mut)) that the tyrosine simultaneous mutation is a L-Ala, acquisition can be expressed the carrier of corresponding deletion mutant (being monomer ubiquitin binding site generation series jump) behind transfered cell.
2. co-immunoprecipitation experiment
Collected untreated cell or transfection and can express the cell of gp78, Ufd1 or their segmental plasmid and cracking in 0.5ml lysis buffer (PBS+0.1%NP-40+5mM EGTA+5mM EDTA+20 μ M leupeptin+25 μ g/ml ALLN+5 μ g/ml Pepstatin A+2 μ g/ml Trypsin inhibitor,Trasylols).100000g4 ℃ centrifugal 10 minutes, shift supernatant and add the antibody (Fig. 1) of crosslinked anti-gp78 or the agarose particle of the antibody (Fig. 2) of anti-Flag.Mixing was washed 5 times with lysis buffer after 4 hours in 4 ℃.Receive buffer solution elution with acetic acid-acetic acid of 0.1MpH2.9.Carry out electrophoresis with supernatant behind the immunoprecipitation (IP-sup.) and sour elutriant (IP-Pellet) respectively, with the antibody (Fig. 1) of anti-Ufd1 and anti-gp78, or the antibody of anti-Flag and anti-Myc (Fig. 2) carries out Western Blot detection respectively.
3. ubiquitin experiment
Cell cultures is in the substratum that contains degrease serum, and transfection can be expressed HMGCR respectively, Insig-1, ubiquitin, the plasmid of Ufd1 (pCMV-HMG-Red-T7, pCMV-Insig-1-Myc, pEF-HA-ubiquitin, pCMV-FLAG-Ufd1).Transfection is added to the Compactin (mevastatin is available from Sigma) of final concentration 10 μ M in the training base after 6 hours, and the mevalonic acid of 10 μ M.After 16 hours, cell changes liquid, adds proteasome inhibitor 10 μ M MG-132 and dehydrated alcohol (contrast) or 1 μ g/ml 25-oxycholesterol (25-HC) and handles.Collecting cell and cracking are in 0.5ml lysate (the PBS+1%NP-40+1% Deoxycholic Acid is received+5mM EGTA+5mM EDTA+20 μ M leupeptin+25 μ g/ml ALLN+5 μ g/ml Pepstatin A+2 μ g/ml Trypsin inhibitor,Trasylols) after 3 hours.Centrifugal 10 minutes of 4 ℃ of 100000g shift supernatant and add the agarose particle (Novagen) of crosslinked T7 antibody.Mixing is after 4 hours in 4 ℃, and centrifugal 5 minutes of 4 ℃ of 1000g take out 120 μ l supernatants, add 40 μ l, 4 * sample-loading buffer, promptly obtain the supernatant protein sample of immunoprecipitation.Abandon or adopt all the other supernatants, wash 5 times with lysis buffer.Add 1 * sample-loading buffer, 95 ℃ of temperature are bathed and were handled 10 minutes, and centrifugal taking-up supernatant promptly obtains the protein precipitation sample of immunoprecipitation.
The supernatant protein electrophoresis is also detected Flag-Ufd1 albumen with the antibody Western Blot of anti-Flag.The protein precipitation electrophoresis is also detected ubiquitin (HA-ubiquitin) albumen with the antibody Western Blot of anti-HA respectively, with antibody Western Blot detection 3-hydroxy-3-methylglutaryl coenzyme A reductase (3-hydroxy-3-methylglutaryl coenzyme A reductase-3 * T7) albumen of anti-T7.
4. degradation experiment
Cell cultures is in the substratum that contains degrease serum, and transfection can be expressed HMGCR, Insig, and the plasmid of Ufd1 (pCMV-HMG-Red-T7, pCMV-Insig-1-Myc, pCMV-FLAG-Ufd1), or transfection can be expressed the plasmid of Ufd1 mutant.Transfection is added to the compactin of final concentration 10 μ M in the training base after 6 hours, and the mevalonic acid of 10 μ M.After 16 hours, cell changes liquid, adds dehydrated alcohol (contrast) or 1 μ g/ml 25-oxycholesterol and 10mM mevalonic acid and handles.(50mM TrisHCl pH8.0+150mM NaCl+0.1%SDS+1.5%NP-40+0.5% Deoxycholic Acid is received+2mM MgCl in 120 μ l lysates for collecting cell and cracking after 5 hours
2+ 20 μ M leupeptins+25 μ g/ml ALLN+5 μ g/ml Pepstatin A+2 μ g/ml Trypsin inhibitor,Trasylols).Utilizing corresponding antibody to carry out Western Blot detects.
5. fluorescence LDL absorption test
The CHO-7 cell cultures adds the DiI-LDL of final concentration 10 μ g/ml in the substratum that contains degrease serum.Cultivated 2 hours for 37 ℃.Discard the training base and wash 3 times with PBS, Paraformaldehyde 96 is fixed, and Hochest dyes nuclear, mounting.
6.RNA interference experiment
The SV587 cell cultures is in the substratum of DMEM+10% foetal calf serum.During the RNA interference test, substratum is discarded, add the DMEM substratum of 1.6ml serum-free in each 60mm culture dish.Get 24 μ l DMED, add 6 μ l Oligofectamin (Invitrogen), room temperature left standstill 10 minutes behind the mixing.Get 350 μ l DMEM, add the siRNA (target sequence be CAUUACCUAUCCCAUGCUG (SEQ ID NO:11)) of 20 μ l synthetic at Ufd1.With above two solution mixings, room temperature left standstill 20 minutes.Add in the cell.Cell cultures adds the substratum of 1ml DMEM+30% foetal calf serum after 6 hours.
7. transient transfection experiment
The CHO-K1 cell cultures is in the substratum of F12/DMEM+5% foetal calf serum.During the transient transfection experiment, get 194 μ l F12/DMEM, add 6 μ l FuGene6 (Roche), room temperature left standstill 5 minutes behind the mixing.Add the recombinant plasmid that needs transfection, room temperature left standstill 15 minutes behind the mixing.Add in the cell.
8. stably express Ufd1 in the Chinese hamster ovary cell
The CHO-K1 cell cultures is in the substratum of F12/DMEM+5% foetal calf serum.Transient transfection Flag-Ufd1 plasmid, transfection are after one day, and cell changes in the M19 substratum that contains 1mg/ml G418 and cultivates.Cell cultures 10 days was changed a subculture in every 2-3 days.The lasso method is chosen the cell of mono-clonalization, cultivates in containing the M19 substratum of 0.2mg/ml G418, is used for experiment.
II. specific embodiment
With the cracking in lysis buffer of HEK293 cell, add the crosslinked ProteinA/G agarose particle that anti-gp78 antibody is arranged, 4 hours endogenous gp78 of immunoprecipitation (IP) of 4 ℃ of rotation mixings, wash the agarose particle 5 times with lysis buffer, receive buffer solution elution with acetic acid-acetic acid of 0.1M pH2.9 again, acid promptly comprises and gp78 bonded albumen in the elutriant, and it is conjugated protein to identify several gp78 by mass spectroscopy, comprising Ufd1.The direct interaction that any report Ufd1 and ubiquitin ligase are not arranged at present as yet.
Cracking HEK293 cell obtains the HEK293 cell pyrolysis liquid, adds crosslinked agarose particle (organizing in contrast, available from Novagen) or the crosslinked agarose particle that anti-gp78 antibody is arranged that T7 antibody is arranged, and 4 ℃ were rotated mixing 4 hours, the endogenous gp78 of immunoprecipitation.With lysis buffer washing agarose particle 5 times, receive buffer solution elution with acetic acid-acetic acid of 0.1M pH2.9 again.Carry out electrophoresis with supernatant behind the immunoprecipitation (IP-Sup.) and sour elutriant (Ip-pellet) respectively, with the antibody WesternBlot detection respectively of anti-Ufd1 and anti-gp78.As shown in Figure 1, exist endogenous gp78 also to have Ufd1 simultaneously in the sour elutriant, and do not exist gp78 also not have Ufd1 simultaneously in the control group acid elutriant, therefore as seen, gp78 combines with Ufd1's.
Transient transfection binding immunoassay co-precipitation experiment is found: precipitation Ufd1, can detect gp78, another be positioned at endoplasmic reticulum stride film ubiquitin ligase Hrd1 then detect less than, show that the interaction of Ufd1 and gp78 has specificity.The gp78 of prokaryotic expression combines with Ufd1, proves it is direct interaction between the two.
Therefore as seen, direct interaction can take place with gp78 in Ufd1, is the acting in conjunction factor of gp78.
The site that embodiment 2 mutually combines
With the pCMV-gp78-Myc plasmid of coding total length or a series of deletion mutantions respectively with pCMV-FLAG-Ufd1 plasmid co-transfection CHO-K1 cell, utilize crosslinked have the agarose particle immunoprecipitation total length of anti-Myc antibody or gp78-5 * Myc Western Blot detection afterwards Flag-Ufd1 of deletion mutantion, the 383-497 amino acid section of finding gp78 is for being essential with combining of Ufd1, after this section disappearance, Ufd1 just no longer combines with gp78.And total length or the gp78 that lacks other parts still combine with Ufd1.
In addition, with the pCMV-FLAG-Ufd1 plasmid of coding total length or a series of deletion mutantions respectively with pCMV-gp78-Myc plasmid co-transfection CHO-K1 cell, utilize crosslinked Flag-Ufd1 Western Blot detection afterwards gp78-5 * Myc that the agarose particle immunoprecipitation total length deletion mutantion of anti-Flag antibody is arranged, the 258-275 amino acid section that found that Ufd1 is for being essential with combining of gp78, after this section disappearance, Ufd1 just no longer combines with gp78, and total length or the Ufd1 that lacks other parts still combine with gp78, sees Fig. 2.
Therefore as seen, 383-497 amino acid of gp78 is essential for Ufd1 with combining of gp78 with 258-275 the amino acid of Ufd1.
Utilize RNA to disturb the method for (RNAi), reduce endogenous Ufd1 protein expression, handle cell, utilize the antibody mediated immunity precipitation 3-hydroxy-3-methylglutaryl coenzyme A reductase of anti-3-hydroxy-3-methylglutaryl coenzyme A reductase, analyze its ubiquitin modification.Find that descend when Ufd1 expresses, the ubiquitinization of the 3-hydroxy-3-methylglutaryl coenzyme A reductase of sterol regulation and control obviously weakens.
Utilize the transient transfection experiment to find, cross and express the ubiquitinization that Ufd1 significantly promotes 3-hydroxy-3-methylglutaryl coenzyme A reductase, and be dose-dependence, see Fig. 3.
Therefore as seen, Ufd1 promotes the ubiquitinization and the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase.
Simultaneously, cross the degraded (Fig. 4) of expressing Ufd1 acceleration 3-hydroxy-3-methylglutaryl coenzyme A reductase.Transfection total length Ufd1 significantly strengthens the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase, and Ufd1 is combined the amino acid whose sequence deletion of necessary 268-275 with gp78, and Ufd1 has then lost the effect that strengthens the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase.Equally, total length Ufd1 quickens the 3-hydroxy-3-methylglutaryl coenzyme A reductase degraded; On the contrary, Ufd1 is combined the amino acid whose sequence of necessary 268-275 remove with gp78, Ufd1 has just lost the effect of quickening the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase.
The function of embodiment 4 Ufd1 protein binding monomer ubiquitin or poly ubiquitin
With carrying monomer ubiquitin binding site series jump (i.e. the 92nd halfcystine, the 93rd tyrosine simultaneous mutation is the Ufd1 mutant of L-Ala) Ufd1 expression vector (pCMV-FLAG-Ufd1 (MBMut) plasmid) transfectional cell, compare with contrast (Ufd1 of untransfected Ufd1 or transfection total length), obviously hinder the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase and the effect of degraded, see Fig. 5 and Fig. 6.With the Ufd1 that carries poly ubiquitin binding site series jump (i.e. the 81st glycine, the 82nd Xie Ansuan, the 83rd leucine, the 84th L-glutamic acid, the 85th phenylalanine simultaneous mutation is L-Ala) expression vector (pCMV-FLAG-Ufd1 (PB Mut)) transfectional cell, this Ufd1 mutant still promotes the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase, but hinders the degraded of 3-hydroxy-3-methylglutaryl coenzyme A reductase.
Therefore as seen, Ufd1 protein binding monomer ubiquitin promotes the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase, and Ufd1 protein binding poly ubiquitin promotes the 3-hydroxy-3-methylglutaryl coenzyme A reductase degraded of poly ubiquitinization.
Expressing Ufd1 can improve the endocytosis of cell to low-density lipoprotein to embodiment 5 excessively
Stably express Ufd1 in Chinese hamster ovary cell causes the 3-hydroxy-3-methylglutaryl coenzyme A reductase protein content to descend; And the transcription factor that the cholesterol regulating metabolizing enzyme is expressed-adult form cholesterol regulation sequence conjugated protein 1 and 2 (n-SREBP-1 and n-SREBP-2) increases, and sees Fig. 7.
After having served as expression Ufd1, cell obviously increases the absorption of LDL, thereby has reflected the increase of ldl receptor (LDLR), as shown in Figure 8.
Reduce endogenous Ufd1 by RNAi and express in the human fibroblasts, cell reduces the absorption of LDL.
Therefore as seen, cross expression Ufd1 and can improve the endocytosis of cell low-density lipoprotein (LDL).
With the HEK293 cell is study subject, detects the interaction situation of endogenous Ufd1 and gp78 in the HEK293 cell of candidate substances before and after stimulating, basic skills such as embodiment 1 respectively with the method for immunoprecipitation.
Test group: the HEK293 cell that adds candidate substances;
Control group: the HEK293 cell that does not add candidate substances.
Utilize the interior Ufd1 of HEK293 cell of co-immunoprecipitation method observation test group and control group and the interaction of gp78.If compare with control group, the interaction of Ufd1 and gp78 is strengthened in the HEK293 cell in the test group, illustrate that then this candidate substances is to strengthen the activity of gp78, promote 3-hydroxy-3-methylglutaryl coenzyme A reductase ubiquitinization or degradation, thus the material of reducing cholesterol.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉Shanghai Inst. of Life Science, CAS
＜120〉cholesterol metabolic regulation protein and uses thereof
<130>074450
<160>15
<170>PatentIn?version?3.3
<210>1
<211>307
<212>PRT
＜213〉homo sapiens (Homo Sapiens)
<400>1
Met?Phe?Ser?Phe?Asn?Met?Phe?Asp?His?Pro?Ile?Pro?Arg?Val?Phe?Gln
1 5 10 15
Asn?Arg?Phe?Ser?Thr?Gln?Tyr?Arg?Cys?Phe?Ser?Val?Ser?Met?Leu?Ala
20 25 30
Gly?Pro?Asn?Asp?Arg?Ser?Asp?Val?Glu?Lys?Gly?Gly?Lys?Ile?Ile?Met
35 40 45
Pro?Pro?Ser?Ala?Leu?Asp?Gln?Leu?Ser?Arg?Leu?Asn?Ile?Thr?Tyr?Pro
50 55 60
Met?Leu?Phe?Lys?Leu?Thr?Asn?Lys?Asn?Ser?Asp?Arg?Met?Thr?His?Cys
65 70 75 80
Gly?Val?Leu?Glu?Phe?Val?Ala?Asp?Glu?Gly?Ile?Cys?Tyr?Leu?Pro?His
85 90 95
Trp?Met?Met?Gln?Asn?Leu?Leu?Leu?Glu?Glu?Gly?Gly?Leu?Val?Gln?Val
100 105 110
Glu?Ser?Val?Asn?Leu?Gln?Val?Ala?Thr?Tyr?Ser?Lys?Phe?Gln?Pro?Gln
115 120 125
Ser?Pro?Asp?Phe?Leu?Asp?Ile?Thr?Asn?Pro?Lys?Ala?Val?Leu?Glu?Asn
130 135 140
Ala?Leu?Arg?Asn?Phe?Ala?Cys?Leu?Thr?Thr?Gly?Asp?Val?Ile?Ala?Ile
145 150 155 160
Asn?Tyr?Asn?Glu?Lys?Ile?Tyr?Glu?Leu?Arg?Val?Met?Glu?Thr?Lys?Pro
165 170 175
Asp?Lys?Ala?Val?Ser?Ile?Ile?Glu?Cys?Asp?Met?Asn?Val?Asp?Phe?Asp
180 185 190
Ala?Pro?Leu?Gly?Tyr?Lys?Glu?Pro?Glu?Arg?Gln?Val?Gln?His?Glu?Glu
195 200 205
Ser?Thr?Glu?Gly?Glu?Ala?Asp?His?Ser?Gly?Tyr?Ala?Gly?Glu?Leu?Gly
210 215 220
Phe?Arg?Ala?Phe?Ser?Gly?Ser?Gly?Asn?Arg?Leu?Asp?Gly?Lys?Lys?Lys
225 230 235 240
Gly?Val?Glu?Pro?Ser?Pro?Ser?Pro?Ile?Lys?Pro?Gly?Asp?Ile?Lys?Arg
245 250 255
Gly?Ile?Pro?Asn?Tyr?Glu?Phe?Lys?Leu?Gly?Lys?Ile?Thr?Phe?Ile?Arg
260 265 270
Asn?Ser?Arg?Pro?Leu?Val?Lys?Lys?Val?Glu?Glu?Asp?Glu?Ala?Gly?Gly
275 280 285
Arg?Phe?Val?Ala?Phe?Ser?Gly?Glu?Gly?Gln?Ser?Leu?Arg?Lys?Lys?Gly
290 295 300
Arg?Lys?Pro
305
<210>2
<211>643
<212>PRT
＜213〉homo sapiens (Homo Sapiens)
<400>2
Met?Pro?Leu?Leu?Phe?Leu?Glu?Arg?Phe?Pro?Trp?Pro?Ser?Leu?Arg?Thr
1 5 10 15
Tyr?Thr?Gly?Leu?Ser?Gly?Leu?Ala?Leu?Leu?Gly?Thr?Ile?Ile?Ser?Ala
20 25 30
Tyr?Arg?Ala?Leu?Ser?Gln?Pro?Glu?Ala?Gly?Pro?Gly?Glu?Pro?Asp?Gln
35 40 45
Leu?Thr?Ala?Ser?Leu?Gln?Pro?Glu?Pro?Pro?Ala?Pro?Ala?Arg?Pro?Ser
50 55 60
Ala?Gly?Gly?Pro?Arg?Ala?Arg?Asp?Val?Ala?Gln?Tyr?Leu?Leu?Ser?Asp
65 70 75 80
Ser?Leu?Phe?Val?Trp?Val?Leu?Val?Asn?Thr?Ala?Cys?Cys?Val?Leu?Met
85 90 95
Leu?Val?Ala?Lys?Leu?Ile?Gln?Cys?Ile?Val?Phe?Gly?Pro?Leu?Arg?Val
100 105 110
Ser?Glu?Arg?Gln?His?Leu?Lys?Asp?Lys?Phe?Trp?Asn?Phe?Ile?Phe?Tyr
115 120 125
Lys?Phe?Ile?Phe?Ile?Phe?Gly?Val?Leu?Asn?Val?Gln?Thr?Val?Glu?Glu
130 135 140
Val?Val?Met?Trp?Cys?Leu?Trp?Phe?Ala?Gly?Leu?Val?Phe?Leu?His?Leu
145 150 155 160
Met?Val?Gln?Leu?Cys?Lys?Asp?Arg?Phe?Glu?Tyr?Leu?Ser?Phe?Ser?Pro
165 170 175
Thr?Thr?Pro?Met?Ser?Ser?His?Gly?Arg?Val?Leu?Ser?Leu?Leu?Val?Ala
180 185 190
Met?Leu?Leu?Ser?Cys?Cys?Gly?Leu?Ala?Ala?Val?Cys?Ser?Ile?Thr?Gly
195 200 205
Tyr?Thr?His?Gly?Met?His?Thr?Leu?Ala?Phe?Met?Ala?Ala?Glu?Ser?Leu
210 215 220
Leu?Val?Thr?Val?Arg?Thr?Ala?His?Val?Ile?Leu?Arg?Tyr?Val?Ile?His
225 230 235 240
Leu?Trp?Asp?Leu?Asn?His?Glu?Gly?Thr?Trp?Glu?Gly?Lys?Gly?Thr?Tyr
245 250 255
Val?Tyr?Tyr?Thr?Asp?Phe?Val?Met?Glu?Leu?Thr?Leu?Leu?Ser?Leu?Asp
260 265 270
Leu?Met?His?His?Ile?His?Met?Leu?Leu?Phe?Gly?Asn?Ile?Trp?Leu?Ser
275 280 285
Met?Ala?Ser?Leu?Val?Ile?Phe?Met?Gln?Leu?Arg?Tyr?Leu?Phe?His?Glu
290 295 300
Val?Gln?Arg?Arg?Ile?Arg?Arg?His?Lys?Asn?Tyr?Leu?Arg?Val?Val?Gly
305 310 315 320
Asn?Met?Glu?Ala?Arg?Phe?Ala?Val?Ala?Thr?Pro?Glu?Glu?Leu?Ala?Val
325 330 335
Asn?Asn?Asp?Asp?Cys?Ala?Ile?Cys?Trp?Asp?Ser?Met?Gln?Ala?Ala?Arg
340 345 350
Lys?Leu?Pro?Cys?Gly?His?Leu?Phe?His?Asn?Ser?Cys?Leu?Arg?Ser?Trp
355 360 365
Leu?Glu?Gln?Asp?Thr?Ser?Cys?Pro?Thr?Cys?Arg?Met?Ser?Leu?Asn?Ile
370 375 380
Ala?Asp?Asn?Asn?Arg?Val?Arg?Glu?Glu?His?Gln?Gly?Glu?Asn?Leu?Asp
385 390 395 400
Glu?Asn?Leu?Val?Pro?Val?Ala?Ala?Ala?Glu?Gly?Arg?Pro?Arg?Leu?Asn
405 410 415
Gln?His?Asn?His?Phe?Phe?His?Phe?Asp?Gly?Ser?Arg?Ile?Ala?Ser?Trp
420 425 430
Leu?Pro?Ser?Phe?Ser?Val?Glu?Val?Met?His?Thr?Thr?Asn?Ile?Leu?Gly
435 440 445
Ile?Thr?Gln?Ala?Ser?Asn?Ser?Gln?Leu?Asn?Ala?Met?Ala?His?Gln?Ile
450 455 460
Gln?Glu?Met?Phe?Pro?Gln?Val?Pro?Tyr?His?Leu?Val?Leu?Gln?Asp?Leu
465 470 475 480
Gln?Leu?Thr?Arg?Ser?Val?Glu?Ile?Thr?Thr?Asp?Asn?Ile?Leu?Glu?Gly
485 490 495
Arg?Ile?Gln?Val?Pro?Phe?Pro?Thr?Gln?Arg?Ser?Asp?Ser?Ile?Arg?Pro
500 505 510
Ala?Leu?Asn?Ser?Pro?Val?Glu?Arg?Pro?Ser?Ser?Asp?Gln?Glu?Glu?Gly
515 520 525
Glu?Thr?Ser?Ala?Gln?Thr?Glu?Arg?Val?Pro?Leu?Asp?Leu?Ser?Pro?Arg
530 535 540
Leu?Glu?Glu?Thr?Leu?Asp?Phe?Gly?Glu?Val?Glu?Val?Glu?Pro?Ser?Glu
545 550 555 560
Val?Glu?Asp?Phe?Glu?Ala?Arg?Gly?Ser?Arg?Phe?Ser?Lys?Ser?Ala?Asp
565 570 575
Glu?Arg?Gln?Arg?Met?Leu?Val?Gln?Arg?Lys?Asp?Glu?Leu?Leu?Gln?Gln
580 585 590
Ala?Arg?Lys?Arg?Phe?Leu?Asn?Lys?Ser?Ser?Glu?Asp?Asp?Ala?Ala?Ser
595 600 605
Glu?Ser?Phe?Leu?Pro?Ser?Glu?Gly?Ala?Ser?Ser?Asp?Pro?Val?Thr?Leu
610 615 620
Arg?Arg?Arg?Met?Leu?Ala?Ala?Ala?Ala?Glu?Arg?Arg?Leu?Gln?Lys?Gln
625 630 635 640
Gln?Thr?Ser
<210>3
<211>29
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>3
acgggatcca?tgttgtcaag?actttttcg 29
<210>4
<211>30
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>4
acggaattcg?gctgtcttct?tggtgcaagc 30
<210>5
<211>30
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>5
acgggatcca?tgcccagatt?gcacgaccac 30
<210>6
<211>30
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>6
acggaattca?tcactatggg?gcttttcagg 30
<210>7
<211>57
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>7
acgggatcca?tggattacaa?ggatgacgac?gataagttct?ctttcaacat?gttcgac 57
<210>8
<211>31
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>8
acgctcgagc?caatcagcca?acagtcctca?c 31
<210>9
<211>30
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>9
acgaagctta?tgccgctgct?cttcctcgag 30
<210>10
<211>31
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉primer
<400>10
acgggatccg?gaggtctgct?gcttctgaag?c 31
<210>11
<211>19
<212>RNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉siRNA
<400>11
cauuaccuau?cccaugcug 19
<210>12
<211>111
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉3 * T7DNA sequence
<400>12
atggctagca?tgactggtgg?acagcaaatg?ggtggtatgg?ctagcatgac?tggtggacag 60
caaatgggtg?gtatggctag?catgactggt?ggacagcaaa?tgggtggctg?a 111
<210>13
<211>219
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉6 * Myc dna sequence dna
<400>13
gagcaaaagc?tcatttctga?agaggacttg?aatgagcaaa?agctcatttc?tgaagaggac 60
ttgaatatcg?gcgaacaaaa?actcatctca?gaagaggatc?tgggtggtga?gcagaagttg 120
atttctgagg?aagacctggg?cccgcggttc?gaacaaaaac?tcatctcaga?agaggatctg 180
aatgagcaaa?agctcatttc?tgaagaggac?ttgaattga 219
<210>14
<211>276
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉HA-ubiquitin sequence
<400>14
tatccctatg?acgtccccga?ctatgcctcc?gctagcctcg?agcatatgca?gatcttcgtc 60
aagacgttaa?ccggtaaaac?cataactcta?gaagttgaat?cttccgatac?catcgacaac 120
gttaagtcga?aaattcaaga?caaggaaggc?attccacctg?atcaacaaag?attgatcttt 180
gccggtaggc?agctcgagga?cggtagaacg?ctgtctgatt?acaacattca?gagggagtcg 240
accttacatc?ttgtcttaag?actaagaggt?ggttga 276
<210>15
<211>186
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉5 * Myc dna sequence dna
<400>15
gagcaaaagc?tcatttctga?agaggacttg?aatgagcaaa?agctcatttc?tgaagaggac 60
ttgaatatcg?gcgaacaaaa?actcatctca?gaagaggatc?tgggtggtga?gcagaagttg 120
atttctgagg?aagacctggg?cccgcggttc?gaacaaaaac?tcatctcaga?agaggatctg 180
aattga 186
Claims (10)
1. ubiquitin merges the purposes of protein degradation 1 or its antagonist or agonist, it is characterized in that, is used to prepare metabolic preparation of cholesterol regulating or composition.
2. purposes as claimed in claim 1 is characterized in that, described ubiquitin merges protein degradation 1 and is selected from:
(1) albumen of the aminoacid sequence shown in the SEQ ID NO:1; Or
(2) aminoacid sequence shown in the SEQ ID NO:1 is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have regulate the cellular cholesterol metabolic function by (1) deutero-albumen.
3. a method of screening the metabolic material of cholesterol regulating is characterized in that, described method comprises step:
(a) ubiquitin being merged protein degradation 1 contacts with candidate substances with the interactional system of ubiquitin ligase gp78;
(b) observe candidate substances and merge protein degradation 1 and the interactional influence of ubiquitin ligase gp78 for ubiquitin;
Wherein, interact with ubiquitin ligase gp78, show that then this candidate substances is to reduce the potential material of cellular cholesterol levels if described candidate substances can promote ubiquitin to merge protein degradation 1;
Merge protein degradation 1 and ubiquitin ligase gp78 interaction if described candidate substances can suppress ubiquitin, show that then this candidate substances is to improve the potential material of cellular cholesterol levels.
4. method as claimed in claim 3 is characterized in that,
Step (a) comprising: in test group, candidate substances is joined ubiquitin merge in protein degradation 1 and the interactional system of ubiquitin ligase gp78; And/or
Step (b) comprising: ubiquitin merges protein degradation 1 and ubiquitin ligase gp78 interaction in the system of detection test group, and with control group relatively, wherein said control group is that the ubiquitin that does not add described candidate substances merges protein degradation 1 and the interactional system of ubiquitin ligase gp78;
Wherein, if ubiquitin fusion protein degradation 1 is better than control group statistically with ubiquitin ligase gp78 interaction in the test group, just show that this material standed for is the potential material that reduces cellular cholesterol levels;
If ubiquitin fusion protein degradation 1 interacts with ubiquitin ligase gp78 and is weaker than control group statistically in the test group, just show that this material standed for is the potential material that improves cellular cholesterol levels.
5. method as claimed in claim 3 is characterized in that, also contain 3-hydroxy-3-methylglutaryl coenzyme A reductase in the described system, and described method also comprises step:
The ubiquitin situation of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded situation in the observation system;
If the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded are quickened, just show that this candidate substances is to reduce the potential material of cellular cholesterol levels;
If the ubiquitinization of 3-hydroxy-3-methylglutaryl coenzyme A reductase or degraded slow down, just show that this candidate substances is to improve the potential material of cellular cholesterol levels.
6. method as claimed in claim 3 is characterized in that, described ubiquitin merges protein degradation 1 and is selected from the interactional system of ubiquitin ligase gp78:
Contain the cell that ubiquitin merges protein degradation 1 and ubiquitin ligase gp78; Or
Contain the solution that ubiquitin merges protein degradation 1 and ubiquitin ligase gp78.
7. method as claimed in claim 6 is characterized in that, also comprises step:
The low-density lipoprotein endocytosis situation of observation of cell;
If the low-density lipoprotein endocytosis of cell quickens, be to reduce the potential material of cellular cholesterol levels with regard to bright this candidate substances;
If the low-density lipoprotein endocytosis of cell slows down, be to improve the potential material of cellular cholesterol levels with regard to bright this candidate substances.
8. method as claimed in claim 3 is characterized in that, described method also comprises step: the potential material that obtains is carried out further cell experiment and/or animal experiment, to select for the metabolic material of cholesterol regulating.
9. the purposes of a ubiquitin fusion protein degradation 1 is characterized in that, is used for:
(a) preparation strengthens the active composition of ubiquitin ligase gp78;
(b) preparation promotes the composition of 3-hydroxy-3-methylglutaryl coenzyme A reductase ubiquitinization;
(c) preparation promotes the composition of 3-hydroxy-3-methylglutaryl coenzyme A reductase degraded;
(d) preparation promotes the composition of low-density lipoprotein endocytosis; And/or
(e) preparation reduces the composition of cellular cholesterol levels.
10. in the body or the metabolic method of external cholesterol regulating, it is characterized in that, described method comprises: regulate the interior ubiquitin of cell and merge the expression or the activity of protein degradation 1, or regulate the interaction that ubiquitin merges protein degradation 1 and ubiquitin ligase gp78 in the cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100445433A CN101357946B (en) | 2007-08-03 | 2007-08-03 | Cholesterol metabolic regulation protein and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2007100445433A CN101357946B (en) | 2007-08-03 | 2007-08-03 | Cholesterol metabolic regulation protein and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101357946A true CN101357946A (en) | 2009-02-04 |
| CN101357946B CN101357946B (en) | 2012-11-07 |
Family
ID=40330558
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007100445433A Active CN101357946B (en) | 2007-08-03 | 2007-08-03 | Cholesterol metabolic regulation protein and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101357946B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111100932A (en) * | 2018-10-26 | 2020-05-05 | 上海中翊日化有限公司 | Application and method of substance related to cholesterol metabolism in evaluation of influence of particles on skin |
| CN112870358A (en) * | 2019-11-29 | 2021-06-01 | 武汉大学 | Use of deubiquitinase USP20 for reducing cholesterol synthesis and improving metabolic syndrome |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108070029A (en) * | 2016-11-17 | 2018-05-25 | 中国科学院上海生命科学研究院 | For the drug target and medicine of cholesterol metabolic relevant disease |
-
2007
- 2007-08-03 CN CN2007100445433A patent/CN101357946B/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111100932A (en) * | 2018-10-26 | 2020-05-05 | 上海中翊日化有限公司 | Application and method of substance related to cholesterol metabolism in evaluation of influence of particles on skin |
| CN112870358A (en) * | 2019-11-29 | 2021-06-01 | 武汉大学 | Use of deubiquitinase USP20 for reducing cholesterol synthesis and improving metabolic syndrome |
| CN112870358B (en) * | 2019-11-29 | 2022-04-12 | 武汉大学 | Use of deubiquitinase USP20 for reducing cholesterol synthesis and improving metabolic syndrome |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101357946B (en) | 2012-11-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Migeotte et al. | Identification and characterization of an endogenous chemotactic ligand specific for FPRL2 | |
| Rossi et al. | Itch/AIP4 associates with and promotes p63 protein degradation | |
| O'Neill et al. | Proteolysis of the docking protein HEF1 and implications for focal adhesion dynamics | |
| Behnke et al. | Signal-peptide-peptidase-like 2a (SPPL2a) is targeted to lysosomes/late endosomes by a tyrosine motif in its C-terminal tail | |
| CN103819564A (en) | Fusion proteins for delivery of GDNF and BDNF to the central nervous system | |
| KR20150031413A (en) | Anti-inflammatory Peptides and Composition comprising the same | |
| John et al. | Identification and characterization of novel endogenous proteolytic forms of the human angiogenesis inhibitors restin and endostatin | |
| Evstafieva et al. | Apoptosis-related fragmentation, translocation, and properties of human prothymosin alpha | |
| Zhou et al. | The interaction between progranulin and prosaposin is mediated by granulins and the linker region between saposin B and C | |
| US20020156236A1 (en) | Binding sites for phosphotyrosine binding domains | |
| Kinoshita et al. | Identification of human endomucin-1 and-2 as membrane-bound O-sialoglycoproteins with anti-adhesive activity | |
| JP2018524290A (en) | Novel peptide and composition containing the same | |
| Devosse et al. | Processing of HEBP1 by cathepsin D gives rise to F2L, the agonist of formyl peptide receptor 3 | |
| Hasebe et al. | The C-terminal region of NELL1 mediates osteoblastic cell adhesion through integrin α3β1 | |
| CN101357946B (en) | Cholesterol metabolic regulation protein and use thereof | |
| CN101773668A (en) | Antivirus associated protein and application thereof | |
| Lee et al. | Identification of cell‐penetrating osteogenic peptide from copine‐7 protein and its delivery system for enhanced bone formation | |
| Islam et al. | Nerve growth factor from Indian Russell’s viper venom (RVV-NGFa) shows high affinity binding to TrkA receptor expressed in breast cancer cells: Application of fluorescence labeled RVV-NGFa in the clinical diagnosis of breast cancer | |
| HOUBEN et al. | Osteocalcin binds tightly to the γ-glutamylcarboxylase at a site distinct from that of the other known vitamin K-dependent proteins | |
| Choi et al. | CPNE1-mediated neuronal differentiation can be inhibited by HAX1 expression in HiB5 cells | |
| Zhou et al. | The HIV-1 p6/EIAV p9 docking site in Alix is autoinhibited as revealed by a conformation-sensitive anti-Alix monoclonal antibody | |
| Collombet et al. | Eukaryotic DING proteins are endogenous: an immunohistological study in mouse tissues | |
| Hata et al. | Production of the entire extracellular domain of BP180 (type XVII collagen) by baculovirus expression | |
| Dejournett et al. | Phosphorylation of the proline-rich domain of Xp95 modulates Xp95 interaction with partner proteins | |
| Okumura et al. | Mammalian ESCRT-III-related protein IST1 has a distinctive met-pro repeat sequence that is essential for interaction with ALG-2 in the presence of Ca2+ |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200706 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211122 Address after: 201203 a3012, No. 1077, zhangheng Road, Pudong New Area, Shanghai Patentee after: Kelan (Shanghai) Pharmaceutical Technology Co.,Ltd. Address before: Building 35, NO.320, Yueyang Road, Xuhui District, Shanghai, 200031 Patentee before: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences |
|
| TR01 | Transfer of patent right |