CN101353645A - Granulocyte-macrophage colony stimulating factor gene modified allogene tumour cell vaccine - Google Patents

Abstract

The invention relates to an allogenic tumor cell line which is modified by GM-CSF gene, and the application in the preparation of tumor vaccine; the invention discloses an allogenic tumor cell line which is modified by the GM-CSF gene, and the application in the preparation of the tumor vaccine.

Description

The recessive allele tumour-cell vaccine of grain-giant cells G CFS genetic modification

Invention field

The present invention relates to grain-giant cells G CFS (to call in the following text: GM-CSF) the recessive allele tumor cell line of genetic modification and the purposes in the preparation tumor vaccine thereof.

Background of invention

In recent years, along with the continuous development of technology such as immunology, molecular biology, we notice that delightedly tumor vaccine gone to the forward position of oncotherapy, and have brought hope to extensive patients.The tumour cell of using the deactivation of self treats as antigen that tumour is existing to go up one-hundred-year history, but unsatisfactory curative effect always.In recent years the tumour cell associational cells factor of deactivation of self was treated and obtained bigger progress, method roughly is by the genophore transitional cell factor with patient's autologous tumor cell, but become the tumour cell of secrete cytokines, with its intracutaneous or subcutaneous injection behind the radiation exposure of lethal dose, become tumor vaccine again.Because these vaccines make tumour cell can express some cytokine or costimulatory molecules by gene transfection, make the immunogenicity of tumour cell obtain significantly to improve.Wherein better with the transfection GM-CSF potency of gene again, to tumour cell, make its expression of GM-csf protein by the GM-CSF transfection, form the GM-CSF area with high mercury at injection site, thereby the function of the antigen presenting cell of injection site is strengthened significantly.

In view of present most of human tumor cell's antigenic types do not obtain clear and definite evaluation yet, still do not lose simply effectively with the active principle of full tumour cell as vaccine.Self tumour cell has been used for clinical trial as vaccine, but in large-scale clinical use, exist several problems: the autologous tumor vaccine need utilize patient's tumor tissues preparation, the restriction that case is selected and the treatment number of times is drawn materials, and spend higher; There is big difficulty in primary tumor cell in operating aspects such as vitro culture and gene transfections; The tumour cell in different patients source exists than big-difference at aspects such as inherited character, gene transfection efficient, is difficult to Quality Control or the like, these effects limit its be extensive use of.

Use the tumor cell line of having built strain and have special advantages: 1. can overcome problem with less cost from it is difficult that body/allogeneic tumor cell is drawn materials; 2. the technology of aspects such as its vitro culture and gene transfection is tending towards ripe, can provide to express stable antigen; 3. through the tumor cell line of therapeutic gene transfection, its treatment factor secretory volume is stable, is easy to Quality Control, therefore is more suitable in exploitation and widespread use.

Up to the present, prepare knurl seedling and Mechanism Study thereof and tumor vaccine and being reported in both at home and abroad of chemicotherapy combined treatment lung cancer and do not appear in the newspapers as yet about using GM-CSF gene transfection recessive allele tumor cell line, the inventor has carried out the research of this respect, proves its validity aspect tumour active immunity.

Summary of the invention

One aspect of the present invention provides a kind of recessive allele tumor cell line of GM-CSF genetic modification.

The recessive allele tumor cell line of GM-CSF genetic modification of the present invention.Wherein said tumour cell is that lung cancer cell line LA795 or A549, breast cancer cell line MCF-7, stomach cancer cell are 803, colon carcinoma cell line HCT-8 or ovarian cancer cell line SKOV3; Wherein GM-CSF by carrier for expression of eukaryon pIRES-EGFP transfection in described tumor cell line; Wherein GM-CSF by the virus vector transfection in described tumor cell line; Wherein virus vector is adenovirus or retrovirus.

Vaccine composition, its contain above-mentioned each the transgenosis tumor cell line and optional pharmaceutically acceptable carrier.

Above-mentioned vaccine composition prevents and/or treats purposes in the medicine of tumour in preparation.

The available tumor cell line can be selected from that lung cancer cell line LA795 or A549, breast cancer cell line MCF-7, stomach cancer cell are 803, colon carcinoma cell line HCT-8 or ovarian cancer cell line SKOV3 or the like.

The present invention mainly be utilize the GM-CSF genetic modification allogeneic tumor vaccine (being tumor cell line) as treatment means, therefore more meaningfully derive from people's tumor cell line.

This cytokine of genomic dna and stably express (as the experimental technique of the GM-CSF gene clone, transfection and the screening that provide later) can be provided GM-CSF expression vector transfection human tumor cell line equally.

Aspect the treatment effectiveness evaluation of this kind vaccine, because it is shorter to be applied to time of clinical treatment, only can monitor with regard to immune response (as the reaction of DTH, injection site etc.), and observation of curative effect is also underway.Therefore, short experimentation on animals of test period just provides a kind of method of estimating the allosome vaccine effect, we have made up the mice lung cancer cell line LA795 vaccine of GM-CSF genetic modification, and make up animal model with another mice lung cancer cell line LLC inoculation mouse simultaneously, thereby the situation of anthropomorphic dummy's allosome vaccine is estimated the result of treatment of this vaccine.

The subject matter of utilizing experimentation on animals to inquire in the experiment--whether can use the allogeneic tumor vaccine as treatment, so after adopting a kind of mouse cell lines LLC inoculation, prepare vaccine with LA795, the effect of checking its induction of immunity reaction and suppressing tumor growth, therefore zooperal meaning is not the effect of check LA795 vaccine, but inquires into the effect whether the allosome vaccine can be used and treat.

GM-CSF can be by carrier for expression of eukaryon or virus vector transfection in described tumor cell line.For example, include but not limited to carrier for expression of eukaryon pIRES-EGFP, adenovirus or retrovirus.

The present invention also provides vaccine composition on the other hand, and it contains aforesaid tumor cell line, and randomly contains pharmaceutically acceptable carrier.Wherein the appropriate vol of tumor cell line is 1 * 107/ time; The example of pharmaceutically acceptable carrier is as being used at present clinical Ad-P53 (being the wild-type P53 gene that adenovirus carrier carries) at home, the using dosage of its carrier is 1-2 * 1012VP/ week, totally 4 weeks (Peng Z.Current status of gendicinein China:recombinant human Ad-p53 agent for treatment of cancers.Hum Gene Ther2005; 16:1016-1027); Purpose, kinds of Diseases and patient's particular case that described vaccine composition used in amounts foundation prevents and/or treats such as age, sex, medical history, body weight etc. take the circumstances into consideration to use, and dosage range is 1 * 10 usually ⁶-1 * 10 ⁸(wherein, the dosage of pancellular tumor vaccine calculates with the tumor cell number of transfection and radiation treatment); Described composition can be mixed with injection liquid; Administering mode is the intradermal injection; Medicine frequency is generally weekly, totally 5 times.

Another aspect of the invention also provides described transgenosis tumor cell line or vaccine composition to prevent and/or treat purposes in the medicine of tumour in preparation.

The cutline of accompanying drawing

Fig. 1. the preparation flow figure of tumor vaccine.

Fig. 2. detect the security of tumor vaccine and the experimentation on animals schema of validity.

Fig. 3 .GM-CSF amplification, order-checking, clone's electrophorogram.The result who has shown GM-CSF amplification, order-checking and clone.Fig. 3 a is the cDNA electrophorogram that RT-PCR obtains GM-CSF, and Fig. 3 b is the dna sequence dna amplified production electrophorogram that PCR obtains GM-CSF; Fig. 3 c is for being connected with the segmental pIRES2-EGFP plasmid enzyme restriction of GM-CSF purpose evaluation figure; Fig. 3 d is the segmental sequencing result of GM-CSF-pMD18-T plasmid double digestion.

Fig. 4. the lifetime of immune mouse.

Fig. 5. immune serum is learned changes of cytokine.Fig. 5 a, 5b, 5c have shown that respectively the level of IL-4, IFN-γ, IFN-β changes.Among each figure, 1 is GM-CSF secretion property LA795 knurl seedling inoculation group; 2 are GM-CSF secretion property LLC knurl seedling inoculation group; 3 is LA795 knurl seedling inoculation group; 4 is LLC knurl seedling inoculation group; 5 is the PBS control group.

Fig. 6. the killing experiments of immune mouse spleen cell.Fig. 6 a has shown without the sorting splenocyte the kill rate as antigenic Lewis lung cancer clone; Fig. 6 b has shown that the positive splenocyte of the CD8+ of sorting is to described antigenic kill rate.Among each figure, 1 is GM-CSF secretion property LA795 knurl seedling inoculation group; 2 are GM-CSF secretion property LLC knurl seedling inoculation group; 3 is LA795 knurl seedling inoculation group; 4 is LLC knurl seedling inoculation group; 5 is the PBS control group.

Fig. 7. immune mouse ELISOPT experimental result.

Fig. 8. the inoculation position immunohistochemical methods photo of immune mouse.

Embodiment

The present invention is further detailed explanation below in conjunction with specific embodiments and the drawings, and be not intended to limit by any way the present invention.

The clone of embodiment 1:GM-CSF gene

1.1GM-CSF the amplification of gene

At first, be taken at-80 ℃ of frozen people's spleens and organize 100mg, as " molecular clonings: lab guide " such as Sambrook, second edition, 1989, the described total tissue RNA of carrying out of editors' such as F.M.Ausubel " modern molecular biology experiment " (CurrentProtocols In Molecular Biology) (1987) is extracted.

Then, as template, the design primer carries out the RT-PCR experiment.At GenBank retrieval people GM CSF gene coded sequence, determine amplification region.GM-CSF gene coded sequence CDS (33-467, gi:27437029).Utilize Olig6 software to carry out design of primers:

Outer upstream primer P1 5 ' GGCTAAAGTTCTCTGGAGGATGTG 3 ' (SEQ ID NO:1)

Outer downstream primer P2 5 ' CTCATCTGGCCGGTCTCACTC 3 ' (SEQ ID NO:2)

Interior upstream primer P3 5 ' GAATTCATGTGGCTGCAGAGCCTG 3 ' (SEQ ID NO:3)

Interior downstream primer P4 5 ' GGATCCTCACTCCTGGACTGGCTC 3 ' (SEQ ID NO:4)

The pcr amplification primer is synthetic by the precious biotech firm in Dalian, and wherein P3 carries BamH I restriction enzyme site P4 and carries EcoR I restriction enzyme site, and the length of pcr amplification product is 447bp.

Be formulated as follows reaction system, place PE-9600 type PCR instrument, 72 ℃ of 5min place on ice then immediately.

In reaction system, add following reagent, place the PCR instrument, 42 ℃ of 1h.

Next, utilize nest-type PRC amplification purpose fragment.

Pcr amplification for the first time: according to 50 μ l system configurations PCR reaction solutions

Above-mentioned each component is mixed, carries out pcr amplification according to following reaction conditions: 60 ℃ of 94 ℃ of 94 ℃ of pre-sex change 3 minutes, sex change 40 seconds, annealing 1 minute, extend 72 ℃ 1 minute, through after 30 circulations again 72 ℃ 10 minutes.

Pcr amplification for the second time: according to 50 μ l system configurations PCR reaction solutions:

Above-mentioned each component mixed carry out pcr amplification reaction.Reaction conditions: 62 ℃ of 94 ℃ of 94 ℃ of pre-sex change 3 minutes, sex change 40 seconds, annealing 1 minute, extend 72 ℃ 1 minute, through after 30 circulations again 72 ℃ 10 minutes.

Capable 1% agarose gel electrophoresis of PCR product detects.Be chosen at and meet goal gene size place and have the PCR product of obvious band to carry out purifying and next step experiment.With P1 is primer, is template with total RNA, and the cDNA electrophorogram that obtains GM-CSF when carrying out RT is seen Fig. 3 a, and is primer with P3 and P4, and the dna sequence dna amplified production electrophorogram that obtains GM-CSF when carrying out pcr amplification is seen Fig. 3 b.

1.2 the GM-CSF gene verification of amplification

The PCR product of aforementioned purifying spent the night in 4 ℃ with the T4DAN ligase enzyme with pMD18-T carrier (Promega) be connected.Get recombinant plasmid, transform or Calcium Chloride Method transforms competence bacterial strain DH5 α (Japanese TaKaRa company) by electricity.The carrier that contains recombinant plasmid by means of blue hickie evaluation and screening.The picking white colony, inoculation, 37 ℃ of shaking table 250rpm shaking culture are spent the night.The alkaline lysis method of extracting plasmid, the EcoRI+BamHI double digestion carries out electrophoresis then and identifies, and send precious biotech firm to carry out sequence verification, and the segmental sequencing result of GM-CSF-pMD18-T plasmid double digestion is seen Fig. 3 d.

1.3GM-CSF the clone of gene is the structure of expression vector

The purpose plasmid that contains GM-CSF is after amplification is extracted, utilize restriction enzyme EcoR I+BamH I cutting, utilize the T4DNA ligase enzyme to spend the night in 4 ℃ with the carrier for expression of eukaryon pIRES-EGFP (available from Invitrogen) of the same double digestion of warp with about 4: 1 mol ratio and be connected, reaction system is as follows:

10×T4?Ligation?buffer 2μl

T4?ligase 2μl

Target gene fragment 8 μ l

PIRES2-EGFP carrier segments 8 μ l

Described with preamble, get the direct transformed competence colibacillus bacterium of connection product DH5 α, screening recombinant plasmid, restriction enzyme digestion and electrophoresis are identified, are connected with the segmental pIRES2-EGFP plasmid enzyme restriction of GM-CSF purpose and identify shown in Fig. 3 c.

For making up virus expression carrier, available from the AdEasy of Clontech company adenovirus system or retroviral vector pLNCX, follow-up connection and recycling step are the same with the similar approach cutting, and the gained recombinant vectors can be used for repeating implementing following each experiment equally.Carrier is a common carrier.

The preparation of the recessive allele tumor cell line of embodiment 2:GM-CSF genetic modification

Transfection method

With tumour cell in good condition with 1.5 * 10 ⁶/ hole is inoculated in 35mm six orifice plates, contains 37 ℃ of RPMI RPMI-1640s, the 5%CO of 10% foetal calf serum with 2ml ₂, cultivate 18～24h, make transfection cell on the same day reach 90～95% and contact with each other.

To each transfection hole, prepare liposome complex as follows:

DNA diluent preparation: will be dissolved in 250 μ l Opti-from the DNA 4 μ g of embodiment 1

In I antibiotic-free, the serum free medium, soft mixing; The preparation of liposome diluent: soft mixing Lipofectamine T M 2000 before using, get 10 μ l Opti-

I antibiotic-free, serum free medium are diluted to 250 μ l, soft mixing.Behind the incubated at room 5min, liposome diluent and DNA diluent are mixed, incubated at room 20min is to form DNA-LipofectamineTM 2000 mixtures.

These 500 μ l DNA-Lipofectamine T M, 2000 mixtures are joined in the hole that contains substratum and cell, gently shake culture plate so that its mixing.5%CO ₂37 ℃ of incubators in hatched 6 hours.Discard nutrient solution,, add perfect medium and hatch with serum free medium washing 3 times.

Screening strategy

The G418 screening

The screening of resistance clone:

Transfectional cell is gone down to posterity, behind the growth 24h, be replaced by selective medium (5% calf serum also contains 600ug/ml G418) and continue to cultivate.2～3d changes liquid once at interval, when treating that control cells is all dead, obtains the clone of G418 resistance LA795 cell substantially, and the clone of picking individual cells proceeds the screening amplification, is the LA795 cell of G418 resistance.

The evaluation of resistance clone: from the expression of gene and protein level detection GM-CSF.

The detection of gene level: prepare cell genomic dna with SDS/ protease K digesting, the extractive method of phenol/chloroform, PCR method amplification GM-CSF gene.The visible GM-CSF expression of gene of result.

The detection of protein level: the ELISA method detects the secretion of GM-CSF gene, and harvested cell culture supernatant, ELISA method are measured the GM-CSF secretory volume in the 106 cell 24h, GM-CSF secretion/106/24h＞400ng as a result.The ELISA experimental technique: every hole adds sample or standard substance 100 μ l except that blank well, and 37 ℃ of incubators are hatched 90min.Wash plate, add biotinylated antibody working fluid (100 μ l/ hole), 37 ℃ of incubators are hatched 60min.Wash plate, add enzyme conjugates working fluid (100l/ hole), 37 ℃ of incubators are hatched 30min.Wash plate, add developer 100 μ l/ holes, lucifuge is hatched 10-25min for 37 ℃.Add stop buffer 100 μ l/ holes, measure the OD450 value with microplate reader in the mixing, 5min.Drawing standard curve, and the concentration of GM-CSF in the calculation sample.

According to the method in the present embodiment, lung cancer cell line A549, breast cancer cell line MCF-7, the stomach cancer cell that successfully screens the GM-CSF genetic modification respectively is 803, colon carcinoma cell line HCT-8 or ovarian cancer cell line SKOV3.

Above-mentioned A549 is the human lung cancer cell line, inoculation intact animal model can not form transplanted tumor, though and the inoculation nude mice can become knurl, nude mice is an immunodeficiency type, can not produce normal immune response after the vaccination, this is an insoluble problem in the experimentation on animals of tumor vaccine.At this, can replenish the situation of GM-CSF genetic modification allogeneic tumor cell vaccine inoculation human body.

After the inoculation of GM-CSF genetic modification allogeneic tumor cell vaccine, the inflammatory reactions such as redness in various degree of patient infusion position, the diameter of red and swollen scleroma can reach 2-3cm, and rubescent on every side regional diameter can reach 10-30cm; Heating, influenza-like symptom and other untoward reactions do not appear.The capable pathology detection of injection site skin, mononuclearcells such as visible big amount lymphocyte soak into around body of gland, blood vessel etc.; Visible CD3+ of immunohistochemical staining and CD8+ cell are more.And treatment back patient DTH reaction positive (DTH is the immunoreactive ordinary method of present detection bodies internal specific).

Embodiment 3: the preparation of mouse tumor vaccine and inoculation

Experiment mice is a cleaning level inbred lines C57BL/6 (H-2Kb, female), and 8-12 age in week, body weight 18-22g is available from Beijing dimension tonneau China animal center.

With the C57 mouse of inoculation Lewis Lung Cancer (LLC) as animal model, as method as described in the embodiment 2 respectively with LLC and LA795 cell preparation GM-CSF genetic modification from body and allogeneic tumor vaccine.

Vaccinated step: under aseptic condition, get clone tumor vaccine (mouse GM-CSF genetic modification LA795 cell vaccine) 0.1ml (10 ⁷) suspension, injection is subcutaneous with mouse left hind inboard, need not anaesthetize, and per 7 days repeat totally 3 times 1 time.The PBS of control mice injection equal volume, without the LLC or the LA795 knurl seedling of GM-CSF genetic modification.Assess every curative effect index according to the operation of following embodiment 4-8 respectively.

Embodiment 4: one-tenth knurl time, gross tumor volume and the survival time of tumor vaccine inoculation mouse

After the treatment beginning, by maximum diameter (A) and the vertical diameter (B) of special messenger, according to formula 1/6 π AB with vernier callipers measurement in per 3 days tumour ²The calculating gross tumor volume (A＞B), and one-tenth knurl time and the lifetime of record mouse.

Relevant survival time of mice result is referring to Fig. 4, and each is organized mouse and gave tumor inoculation on the 7th day giving three knurl seedlings inoculation backs, and dosage is 1 * 10 ⁷The postvaccinal survival time is observed in the inoculation back, with respect to the PBS control group, the mouse-borne tumor survival time of simple LA795 and LLC inoculation group there is no obvious prolongation (P＞0.05), and the lotus knurl survival time from body or allogeneic tumor vaccine group of GM-CSF secretion property obviously is extended (P＜0.01).By this preventive vaccination, discovery is compared with the LLC inoculation group with PBS control group and simple LA 795, behind the LLC and the inoculation of LA795 knurl seedling of GM-CSF genetic modification, become the knurl time obviously to postpone, tumor growth delays, be mainly reflected in inoculation back appearance and can measure the time retardation of tumour, and year-on-year gross tumor volume is less than control group.With become the knurl time similar be that have the trend of being longer than LA795 (allogeneic) knurl seedling inoculation group the lifetime of LLC (from body) the knurl seedling inoculation group of GM-CSF secretion property, but there was no significant difference (P＞0.05).

As can be seen from the above results, the recessive allele knurl seedling of GM-CSF genetic modification is the inducing antitumor immunity activity effectively, suppresses growth of tumor, prolongs lifetime.

Embodiment 5: mice serum is learned changes of cytokine

Each organize mouse respectively at before the tumor vaccine inoculation, inoculate before the knurl seedling and behind the last inoculation knurl seedling 7 days at every turn, put to death 3 of mouse, each gets the about 0.6-1ml of blood through eyeball, is used for serological index and detects, and utilizes the ELISA method to detect the secretion level of mice serum IFN-γ, IL-4.In brief, the variation of serum I FN-γ, IL-4 secretion level before and after the vaccine inoculation of monitoring mouse.

Above cytokines measurement ELISA test kit is available from Bender company (Austrian).

96 orifice plates at coated antibody in advance add standard substance and laboratory sample (every hole 100ul), hatch 90min for 37 ℃; Discard liquid and wash plate 5 times, add biotin labeling antibody, hatch 60min with Washing Buffer; Wash plate, add HRP and hatch 30min; Wash plate, add colour developing liquid and hatch 10min; Add stop buffer (2N HCl) termination reaction, detect absorbancy in 450nm.With the absorbancy drawing standard curve of standard substance, and according to the concentration of respective fine intracellular cytokine in the typical curve calculation sample.

The results are shown in Figure 5a-5b, among the figure, 1 is GM-CSF secretion property LA795 knurl seedling inoculation group, and 2 are GM-CSF secretion property LLC knurl seedling inoculation group, and 3 is LA795 knurl seedling inoculation group, and 4 is LLC knurl seedling inoculation group, and 5 is the PBS control group.As seen with the injection of tumor vaccine, its serum il-4 level there is no considerable change (P＞0.05) during each was organized, and serum il-4 level between each group is there was no significant difference (P＞0.05) also.As seen with the injection of tumor vaccine, its serum I FN-γ level changed obviously (P＞0.05) during each was organized; IFN-γ level is especially to increase obviously (wherein the autologous tumor vaccine group is than the IFN-γ height of allogeneic group, but there was no significant difference) after the 3rd injection; Wherein GM-CSF secretion property is obvious with the increase variation of frequency injection from the IFN-γ level of body and allogeneic knurl seedling group, far above other each group (P＜0.01), and it is obvious far away from the secretion group that GM-CSF is arranged not have the rising from the IFN-γ level of body or allogeneic knurl seedling group of GM-CSF secretion property; No considerable change before and after the PBS control group IFN-γ horizontal injection.

As can be seen from the above results, the same rising that can blood serum induced effectively Th1 type cytokines of the recessive allele knurl seedling of GM-CSF genetic modification with autologous tumor vaccine.

The helper T cell of Th1 significance of increased: CD4+ is the Th cell, and the Th cell can be to Th1 and the differentiation of Th2 both direction, the main secretion of gamma-IFN of Th1 class cell, and cytokines such as IL-2, Th2 class cell is then secreted IL-4, IL-10 etc.Occur the Th2 skew in the tumour patient body mostly, in the middle of the immunosuppression that the formation tumour causes, have important effect.Regulate this phenomenon by immunotherapy, make its Th1 direction drift, i.e. detected Th1 type cytokines raises in this research, and the Th2 type cytokines does not have noticeable change, and the phenomenon of this Th1 drift helps inducing effective immune response.

Embodiment 6: the killing experiments of immune mouse spleen cell

The distribution of mouse peripheral blood immunocyte subgroup

The prevention group respectively organize mouse respectively at before the tumor vaccine inoculation, inoculate before the knurl seedling and behind the last inoculation knurl seedling 7 days at every turn, put to death 3 of mouse, each extracting spleen cell is prepared into homogenate, utilizes the distribution of flow cytometer (BDPharmingen) by each cell subsets of Flow cytometry: CD ₄-FITC/CD ₃-PE, CD ₈-FITC/CD ₃-PE, CD ₄-FITC/CD ₂₅-PE.

Table 1. is respectively organized the lymphocyte subgroup ratio (%) that the mouse fluidic cell detects

The killing experiments result of immune mouse spleen cell

Use the LDH method to detect the killing activity (Program) of knurl seedling inoculation back mouse boosting cell then: to carry out repetitive stimulation with Lewis lung cancer clone as antigen, observe the effector cell and kill and wound ratio (Fig. 6 a) to antigenic to tumour cell.And then splenocyte carried out the positive sorting of CD8+, with this CD8+ cell action effect cell the tumour cell that contains specific antigens is carried out killing experiments (Fig. 6 b).Among the figure, 1 is GM-CSF secretion property LA795 knurl seedling inoculation group, and 2 are GM-CSF secretion property LLC knurl seedling inoculation group, and 3 is LA795 knurl seedling inoculation group, and 4 is LLC knurl seedling inoculation group, and 5 is the PBS control group.As seen in each group with the injection of tumor vaccine, its splenocyte (effector cell) constantly strengthens (P＜0.01) to antigenic kill capability, especially with the enhancing after the 3rd immunity the most obviously (P＜0.01); Wherein GM-CSF secretion property increases obviously from the effector cell's of body and allogeneic knurl seedling group the ability of killing and wounding specific antigen, far above other each groups (P＜0.01); And the rising from the effector cell's of body or allogeneic knurl seedling group kill capability of not having GM-CSF secretion property is obvious far away from the secretion group that GM-CSF is arranged; No considerable change before and after the injection of PBS control group; The effector cell's of each group killing experiments also confirms the effectively CD8+CTL cell of inducing antigen-specific of tumor vaccine after the CD8+ sorting, and the respective target cell is produced the specific killing effect.

As can be seen from the above results, the recessive allele knurl seedling of GM-CSF genetic modification with autologous tumor vaccine the same can stimulate effectively the body lymphocyte particularly the CD8+CTL cell to the killing activity of " from body " tumour cell.

Embodiment 7: the ELISOPT experimental result of immune mouse

Immunodotting experiment (ELISOPT) detects splenocyte activation, the i.e. cell quantity of secretion of gamma-IFN (BDBioscience).In brief, use the ELISPOT method and detect mouse spleen lymphocyte through the post-stimulatory activation of LLC LuCA.

The experimental procedure of ELISPOT (at the experimentation on animals of LA795 knurl seedling):

Every hole adds 50 μ L Magi ^TMCoating Buffer dilutes good coated antibody, and 4 ℃ are spent the night.Topple over coating buffer,, on the thieving paper of sterilization, buckle and do with PBS washing 3 times.Add 200 μ L and dilute good confining liquid, behind 37 ℃ of sealing 1h, topple over confining liquid.Inoculating cell (100 μ L/well), experimental group: 1 * 106 cell/well, adding stimulator simultaneously is antigen (being the LLC cell behind the radioinactivation in this experiment); The negative control wells of background adds the Lympho-Spot of 100 μ L ^TMSerum free medium; Positive control wells 1 * 104 cell/well adds 10 μ L PHA (final concentration 1-4ug/mL) simultaneously.Cultivate 18-24h, topple over cell and substratum in the hole for 37 ℃.Every hole adds the ice-cold deionized water of 200 μ L, ice bath 10min.Every hole is buckled on thieving paper and is done with 200 μ LPBS washing 10 times.Every hole adds 100 μ L and dilutes good biotin labeling detection antibody, hatches 1h for 37 ℃.Every hole is buckled on thieving paper and is done with 200 μ LPBS washing 5 times.Every hole adds 100 μ L enzymes mark avidin working fluid, hatches 1 hour for 37 ℃.Every hole is buckled on thieving paper and is done with 200 μ L PBS washing 5 times.Every hole adds the AEC colour developing liquid of 100 μ L, and the room temperature lucifuge leaves standstill 15-45min, treats that spot is formed into after the suitable size, with deionized water wash 2 times, and the color development stopping process.Plate tipped upside down on take off protective layer after patting dry on the thieving paper, room temperature leaves standstill 10-30min in the ventilation, allows film dry naturally.Place Biosys Bioreader4000PRO to read plate instrument inner analysis automatically the ELISPOT plate.

Treatment group mouse before immunization and after the 3rd immunization 7 days is put to death mouse respectively, gets spleen and carries out the ELISPOT experiment.After adding antigen LLC lung carcinoma cell, as seen the mouse effector cell is organized respectively in the prevention group by specific antigens activation that immune postactivated cell quantity obviously increases (P＜0.01) in the mouse, and the activation of immunity back GM-CSF secretion property knurl seedling group is apparently higher than other groups (P＜0.01).

As can be seen from the above results, the recessive allele knurl seedling of GM-CSF genetic modification can stimulate the activation of splenic lymphocyte to " from body " tumor-cell antigen effectively with autologous tumor vaccine is the same, promptly can induce the specific immune response of generation at " from body " tumour cell.

Embodiment 8: immune mouse inoculation position lymphocytic infiltration situation

With conventional H E dyeing and immunohistochemical staining, in brief, detect the lymphocytic infiltration situation at vaccine inoculation position with the immunohistochemical methods method.

HE dyeing:

Section dewaxed in dimethylbenzene 5～10 minutes.Moved in dimethylbenzene and straight alcohol (1: the 1) mixed solution about 5 minutes.Put into 100%, 95%, 85%, 70% alcohol successively, at different levels being respectively 2～5 minutes is after distilled water changes dye liquor over to.Phenodin dye liquor dyeing 5～15 minutes.Unnecessary dye liquor on the washing slide, 0.5～1% hydrochloride alcohol (preparation of 70% alcohol) color separation are for a moment.Microscopy control, in nucleus and nuclear chromatin clear till, about 10 seconds.Flowing water flushing 15～30 minutes; Perhaps the short period of time alkalizes or oil blackeite in the Quilonum Retard saturated solution, and promptly nucleus is blue, and the distilled water weak point is washed.0.1～0.5% eosin stain dyeing 1～5 minute.Through 70%, 85%, 95%, 100% dehydration of alcohol, at different levels is 2～3 minutes successively.Dimethylbenzene transparent (secondary), about 10 minutes altogether.Mounting.

Immunohistochemical methods:

After tissue slice dewaxing, the aquation, PBS washed 2～3 times each 5 minutes.Drip 3%H2O2, room temperature left standstill 10 minutes; PBS washed 2～3 times each 5 minutes.Antigen retrieval, PBS washes.Drip normal goats serum confining liquid, room temperature 20 minutes is got rid of unnecessary liquid.Drip the anti-50 μ l of I, room temperature leave standstill spent the night in 1 hour or 4 ℃ or 37 ℃ 1 hour.PBS washed 3 times each 5 minutes; Drip anti-40～50 μ l of II, room temperature leaves standstill, or 37 ℃ of 1 hour (can add during II is anti-0.05% tween-20).PBS washed 3 times each 5 minutes; DAB colour developing 5～10 minutes is grasped dye levels at microscopically.PBS or tap water flushing 10 minutes; Haematoxylin redyeing 2 minutes, the hydrochloride alcohol differentiation; Tap water flushing 10～15 minutes.Dehydration, transparent, mounting, microscopy.

Inoculation position immunohistochemical methods photo is seen Fig. 8, and by more as can be known, the GM-CSF genetic modification is from the visible significantly CD8+T cellular infiltration of body or allogeneic tumor vaccination position, and control group is not seen the lymphocytic infiltration phenomenon.As can be seen from the above results, the recessive allele knurl seedling of GM-CSF genetic modification promptly stimulates the cell-mediated immune response of partial CTL with the same chemotactic and the infiltration that can induce the CD8+T cell effectively of autologous tumor vaccine.

Sequence table

＜110〉Tianjin tumour hospital

＜120〉the recessive allele tumour-cell vaccine of GM-CSF genetic modification

<130>tj002

<160>4

<170>PatentIn?version?3.3

<210>1

<211>24

<212>DNA

＜213〉artificial

<220>

<221>misc_feature

＜223〉outer upstream primer P1

<400>1

ggctaaagtt?ctctggagga?tgtg 24

<210>2

<211>21

<212>DNA

＜213〉artificial

<220>

<221>misc_feature

＜223〉outer downstream primer P2

<400>2

ctcatctggc?cggtctcact?c 21

<210>3

<211>24

<212>DNA

＜213〉artificial

<220>

<221>misc_feature

＜223〉interior upstream primer P3

<400>3

gaattcatgt?ggctgcagag?cctg 24

<210>4

<211>24

<212>DNA

＜213〉artificial

<220>

<221>misc_feature

＜223〉interior downstream primer P4

<400>4

ggatcctcac?tcctggactg?gctc 24

Claims (7)

1. the recessive allele tumor cell line of a GM-CSF genetic modification.

2. the tumor cell line of claim 1, wherein said tumour cell are that lung cancer cell line LA795 or A549, breast cancer cell line MCF-7, stomach cancer cell are 803, colon carcinoma cell line HCT-8 or ovarian cancer cell line SKOV3.

3. claim 1 or 2 tumor cell line, wherein GM-CSF by carrier for expression of eukaryon pIRES-EGFP transfection in described tumor cell line.

4. claim 1 or 2 tumor cell line, wherein GM-CSF by the virus vector transfection in described tumor cell line.

5. the tumor cell line of claim 4, wherein virus vector is adenovirus or retrovirus.

6. vaccine composition, it contains among the claim 1-5 each transgenosis tumor cell line and optional pharmaceutically acceptable carrier.

7. each tumor cell line or the vaccine composition in the claim 6 prevent and/or treat purposes in the medicine of tumour in preparation among the claim 1-5.

Images