CN101348522B - Copper resistance binary signal conducting system regulation factor mutant, and construction and use thereof - Google Patents
Copper resistance binary signal conducting system regulation factor mutant, and construction and use thereof Download PDFInfo
- Publication number
- CN101348522B CN101348522B CN2008101388485A CN200810138848A CN101348522B CN 101348522 B CN101348522 B CN 101348522B CN 2008101388485 A CN2008101388485 A CN 2008101388485A CN 200810138848 A CN200810138848 A CN 200810138848A CN 101348522 B CN101348522 B CN 101348522B
- Authority
- CN
- China
- Prior art keywords
- plasmid
- fragment
- binary signal
- factor mutant
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention relates to the field of molecular microbiology, in particular to an anti-copper binary signal conduction-system regulating factor mutant, as well as a construction and application thereof. The anti-copper binary signal conduction-system regulating factor mutant is a base sequence in a sequence list SEQ ID No.1. The expression method comprises the following steps that pseuclomones fluorescens TSS1 is used as a template, and a product obtained by the PCR amplification of primers CRF19 and CRR9 is used to connect an expression plasmid pLC1 to obtain a plasmid pLC104, the latter undergoes a restriction digestion by SwaI and is then connected with a plasmid pJR20 to obtain a plasmid pJC104 which is transformed into the pseuclomones fluorescens TSS1 to obtain a strain of TSS1/Pjc104. The regulating protein obtained from the method provided by the invention is a pseuclomones fluorescens anti-copper systemic regulating factor mutant, the expression of which in the pathogenic pseuclomones fluorescens TSS1 can significantly decrease bacterial virulence.
Description
Technical field
The present invention relates to field of molecular microbiology, a kind of specifically copper resistance binary signal conducting system regulation factor mutant and structure and application.
Background technology
Trace element pollutes at present, comprises copper staining, has become a serious worldwide problem.Copper can catalysis produce harmful superoxide in vivo, cause the damage of microbial film and nucleic acid substances thus, thereby copper is used to the prevention and control of bacteriosis.At this, many bacteriums, especially pathogenic bacteria are all developed and one or more anti-copper mechanism.The anti-copper system that has found at present is made up of a plurality of albumen usually, comprises CopA, CopB, CopC, CopD, CopS, and CopR.Wherein CopR is a transcriptional regulation protein, and CopS is a histidine kinase, CopA, and B, C, D etc. participate in the transhipment and the eliminating of copper directly.CopR and CopS constitute one and united by the binary signal conducting system of copper regulation and control; When not having copper, CopR and CopS be the lifeless matter activity all; When copper existed, CopS was activated, and became activated kinases; CopS after the activation activates CopR by a target site of phosphorylation CopR 5 ' end; CopR after the activation then regulates and control copA, B, C, the isogenic expression of D.Because CopR regulates and control the expression of main anti-copper, is the key factor in the signal transduction pathway, thereby it is expressed and activity all is subjected to strict regulation and control.Destroy this regulation and control, make the active imbalance of CopR, the persistence of CopR of functionally active of especially having exists, and causes weakening of bacterial virulence, this mainly is because the active CopR of tool will activate copA, B, C, the expression of D etc., cause CopA, B, C, D etc. are proteic a large amount of synthetic; Because these albumen can form efflux pump on cytolemma, make intracellular organic matter run off and the mass consumption of energy, thereby slacken growth and the infection ability of bacterium.
Summary of the invention
The object of the invention is to provide a kind of copper resistance binary signal conducting system regulation factor mutant and structure and application.
For achieving the above object, the technical solution used in the present invention is:
A kind of copper resistance binary signal conducting system regulation factor mutant is the base sequence among the sequence table SEQ ID No.1.
The construction process of mutant:
1) plasmid pLC1 makes up: with plasmid pEGFP is template, and PF1 and PR4 are that primer carries out pcr amplification, and amplified production is connected with plasmid pBS-T, gets plasmid pBSL1; Plasmid pBSL1 and plasmid pBR322 reclaim 140bp and 3986bp fragment respectively after with the EcoRI/BamHI double digestion; These two sections fragments are connected with the T4DNA ligase enzyme, get plasmid pBL1; Plasmid pBL1 is cut back to close the 4.3kb fragment with the BamHI enzyme, reclaim fragment and be connected with Linker-1 and promptly get plasmid pLC1; Described primer PF1 is 5 '-ATAGAATTCATTTAAATGCAGCTGGCACGA-3 ', and PR4 is 5 '-GGATCCACACAACATACGAGC-3 ';
2) plasmid LC104 makes up: with Pseudomonas fluorescens TSS1 is template, CRF19 and CRR9 are that primer and Pfu archaeal dna polymerase carry out pcr amplification, cutting the fragment that reclaims the back with step 1) gained plasmid pLC1 with the SmaI enzyme behind the product purification is connected, connect and on the LB substratum that contains peace card penicillin, IPTG and Xga1, cultivate after liquid changes intestinal bacteria over to, the screening transformant extracts plasmid, is plasmid LC104; Wherein said primer CRF19 is 5 '-ATCATGAAATTGGCTGGTTTGG-3 ', and CRR 9 is 5 '-GATATCTTATTCCGACCCCGTC-3 ';
Described Pseudomonas fluorescens TSS1 is stored in the common micro-organisms center C GMCC of China Committee for Culture Collection of Microorganisms, and deposit number is: CGMCC No.2329, January 9 2008 preservation time.
3) structure of plasmid pJR20: plasmid pDN18 is cut with the EcoRI/BamHI enzyme, reclaiming the 7.8kb fragment is connected with the T4DNA ligase enzyme, connect liquid and be transformed into behind the bacillus coli DH 5 alpha containing on the LB solid medium of tsiklomitsin and cultivate, the screening transformant extracts plasmid, is pJR20;
4) structure of plasmid pJC104: with step 2) gained plasmid pLC104 cuts with the SwaI enzyme, reclaims the 650bp fragment; Step 3) gained plasmid pJR20 cuts with the SwaI enzyme, reclaims the 7.8kb fragment; Reclaiming fragment T4DNA ligase enzyme with two sections connects, connecting liquid is transformed into behind the bacillus coli DH 5 alpha containing on the LB solid medium of tsiklomitsin and cultivates, the screening transformant extracts plasmid, is the plasmid pJC104 that can express the copper resistance binary signal conducting system regulation factor mutant with the base sequence among the sequence table SEQ ID No.1.
The application of mutant: described copper resistance binary signal conducting system regulation factor mutant has the effect that reduces bacterial virulence.
The present invention has following advantage:
1. the anti-copper system regulation of non-regulation and control type of the present invention factor mutant tool constitutive activity is not subjected to the influence of copper.
2.CRC104 expression method stable effectively.Method of the present invention can make CRC104 at the medium-term and long-term stable existence of bacterium.
3. have a potential disease control applicability.The present invention expresses by CRC104 persistence in Pseudomonas fluorescens and significantly reduces bacterial virulence, thereby in disease control application potential is arranged.
4. the CRC104 among the present invention is a kind of CopR mutant of artificial screening, and tool functionally active but do not possess 5 ' end phosphorylation regulatory site is not so its activity relies on copper.CRC104 persistence in Pseudomonas fluorescens is expressed and can significantly be reduced bacterial virulence, thereby it has application potential in disease control.
Embodiment
The invention will be further described below in conjunction with embodiment.Embodiment is intended to the description of giving an example to the present invention, but not limits the invention in any form.
Involved in embodiments of the present invention experimental technique routinely all adopts following method:
1. plasmid extraction, DNA (PCR) product purification, dna fragmentation reclaim from gel, the bacterial genomes DNA extraction is all used the corresponding reagent box of " TIANGEN Biotech (Beijing) Co., Ltd. ".
2. plasmid, the conversion of DNA connection liquid enter intestinal bacteria and all use Hanahan method (Sambrook and Russell:Molecular Cloning:A Laboratory Mannual.Cold Spring Harbor Laboratory Press 2001);
3. all restriction enzymes and ligase enzyme are all available from " Niu Yinglun Bioisystech Co., Ltd ", Beijing.
Embodiment 1
Copper resistance binary signal conducting system regulation factor mutant is the base sequence among the sequence table SEQ ID No.1.
The structure of copper resistance binary signal conducting system regulation factor mutant:
1) structure of plasmid pLC1:
With 100ng plasmid pEGFP (available from U.S. Clonetech company) is template, and (each 0.5uM) carries out PCR:PF1 (5 '-ATA with following primer
GAATTCATTTAAATGCAGCTGGCACGA-3 ', the line base is EcoRI and SwaI site), PR4 (5 '-
GGATCCACACAACATACGAGC-3 ', the line base is the BamHI site); The PCR condition is: at 94 ℃ of pre-sex change template DNAs of 60s, and 94 ℃ of 40s then, 54 ℃ of 60s, 72 ℃ of 60s change 94 ℃ of 40s into after 5 circulations, 60 ℃ of 60s, 72 ℃ of 60s carry out pcr amplification after 25 circulations again under 72 ℃ of extension 10min conditions.The PCR product with day root DNA product purification test kit purifying after with carrier pBS-T (available from " day root biochemical technology company limited ", Beijing) connect 2-3 hour in room temperature, on the LB solid medium that contains 100ug/ml peace card penicillin (Ap), 40ug/ml Xga1 (5-bromo-4-chloro-3-indoles-β-D-lactoside) and 24ug/ml isopropyl-(IPTG), cultivated 18-20 hour after connecting mixed solution transformed into escherichia coli DH5 α, filter out white transformant, be plasmid pBSL1.With pBSL1 and plasmid pBR322 (available from " Niu Yinglun Bioisystech Co., Ltd ", Beijing) with reclaiming 140bp and 3986bp fragment behind the EcoRI/BamHI double digestion respectively; This 2 fragment is connected 2-3 hour with the T4DNA ligase enzyme in room temperature, connect and containing peace card penicillin (Ap after liquid is transformed into bacillus coli DH 5 alpha, cultivated 18-20 hour on LB solid medium 50ug/ml), filter out white transformant, 1 transformant of picking, extract plasmid, sequence verification is correct recombinant plasmid.With this plasmid called after pBL1.PBL1 is cut back to close the 4.3kb fragment with the BamHI enzyme, with this fragment and Linker-1 (sequence: 5 '-GGATCCAAGTCATGTAGTAATGCTATATAGATGATAGATCAGGATCCCGGGATTTA AATGGATCC-3 ' (giving birth to worker's biotechnology service company) available from Shanghai, connect 2-3 hour with the T4DNA ligase enzyme in room temperature, connect and on the LB solid medium that contains Ap (50ug/ml), cultivated 18-20 hour after liquid is transformed into bacillus coli DH 5 alpha, filter out white transformant, 1 transformant of picking, extract plasmid, order-checking shows that it is correct recombinant plasmid.With this plasmid called after pLC1.Described LB moiety is by weight percentage: 1.0% peptone, 0.5% yeast powder, 1.0% sodium-chlor, 97.5% distilled water.
2) structure of plasmid pLC104:
With 1ul Pseudomonas fluorescens TSS1 is template, carries out pcr amplification with primer CRF19, CRR9 (being respectively 0.5uM) and Pfu archaeal dna polymerase (5U); The PCR condition is: 94 ℃ of pre-sex change template DNAs of 60s, 94 ℃ of 40s then, 52 ℃ of 60s, 72 ℃ of 60s change 94 ℃ of 40s into after 5 circulations, 56 ℃ of 60s, 72 ℃ of 60s, after 25 circulations again at 72 ℃ of extension 10min.A PCR product day root DNA product purification test kit purifying.PLC1 cuts with the SmaI enzyme with step 1) gained plasmid, reclaims the 4.3kb fragment; This fragment is connected 2-3 hour with the T4DNA ligase enzyme in room temperature with the PCR product of above-mentioned purifying, connect and on the LB solid medium that contains Ap (50ug/ml), cultivated 18-20 hour after liquid is transformed into bacillus coli DH 5 alpha, filter out white transformant, 1 transformant of picking extracts plasmid, and order-checking shows that it is correct recombinant plasmid.With this plasmid called after pLC104.
Described primer CRF19 is 5 '-ATCATGAAATTGGCTGGTTTGG-3 ', CRR9 is 5 '-
GATATCTTATTCCGACCCCGTC-3 ', the line base is the EcoRV site), described Pseudomonas fluorescens TSS1 is stored in the common micro-organisms center C GMCC of China Committee for Culture Collection of Microorganisms, deposit number is: CGMCC No.2329, January 9 2008 preservation time, classification name: Pseudomonas fluorescens Pseudomonas fluorescens.
3) structure of plasmid pJR20:
Plasmid pDN18 (Marx, C.J.﹠amp; Lidstrom.M.E. (2 001) .Development ofimproved versatile broad-host range vectors for use inmethylotrophs and other Gram-negative bacteria.Microbiology147,2,065 2075.) cut with the EcoRI/BamHI enzyme, reclaim the 7.8kb fragment; With this fragment and Linker-2 sequence is 5 '-GAATTCATTTAAATGTTTAAACGGATCC-3 ' (giving birth to worker's biotechnology service company available from Shanghai), connect 2-3 hour with the T4DNA ligase enzyme in room temperature, connect and on the LB solid medium that contains 15ug/ml tsiklomitsin (Tc), cultivated 18-20 hour after liquid is transformed into bacillus coli DH 5 alpha, filter out white transformant, 1 transformant of picking extracts plasmid, and order-checking shows that it is correct recombinant plasmid.With this plasmid called after pJR20.
4) structure of plasmid pJC104
With step 2) plasmid pLC104 cuts with the SwaI enzyme, reclaims the 650bp fragment; PJR20 cuts with the SwaI enzyme with the step 3) plasmid, reclaims the 7.8kb fragment.Two fragments are connected 2-3 hour with the T4DNA ligase enzyme in room temperature, connect and on the LB solid medium that contains Tc (15ug/ml), cultivated 18-20 hour after liquid is transformed into bacillus coli DH 5 alpha, filter out white transformant, 1 transformant of picking extracts plasmid, and order-checking shows that it is correct recombinant plasmid.Be copper resistance binary signal conducting system regulation factor mutant pJC104 with the base sequence among the sequence table SEQ ID No.1.
Sequence table SEQ ID No.1 is:
ATGAAATTGGCTGGTTTGGAGGTGGACCTCCTCAAACGCAGGGTTATCCGCGCAGGCAAACGTATAGATCTAACGGCCAA
AGAGCTTGCGTTGCTCGAATTGCTGCTCCGTCGTCGAGGCGAGGTTCTGCCCAAGTCGCTTATTGCTTCCCAGGTCTGGG
ACATGAACTTTGACAGCGATACTAACGTCATCGAGGTTGCTGTCAGGAGGCTCAGAGCAAAGATTGATGATGATTTTGAG
GTCAAGCTTATCCACACCTCTCGAGGCATGGGGTACATGCTGGATGCGCCGGATTCGGGGACGGGGTCGGAATGA
(a) sequence signature:
● length: 315bp
● type: base sequence
● chain: strand
● topological framework: linearity
(b) molecule type: double-stranded DNA
(c) suppose: not
(d) antisense: not
(e) initial source: Pseudomonas fluorescens
(f) specificity title: CRC104
Embodiment 2
Difference from Example 1 is:
The structure of mutant: the 1) structure of plasmid pLC1: behind the pcr amplification product purifying with carrier pBS-T (available from " day root biochemical technology company limited ", Beijing) connect 3-4 hour in room temperature, on the LB solid medium that contains 100ug/ml peace card penicillin (Ap), 40ug/ml Xga1 (5-bromo-4-chloro-3-indoles-β-D-lactoside) and 24ug/ml isopropyl-(IPTG), cultivated 20-24 hour after connecting mixed solution transformed into escherichia coli DH5 α, filter out white transformant, be plasmid pBSL1.With pBSL1 and plasmid pBR322 (available from " Niu Yinglun Bioisystech Co., Ltd ", Beijing) with reclaiming 140bp and 3986bp fragment behind the EcoRI/BamHI double digestion respectively; This 2 fragment is connected 3-4 hour with the T4DNA ligase enzyme in room temperature, connect and containing peace card penicillin (Ap after liquid is transformed into bacillus coli DH 5 alpha, cultivated 20-24 hour on LB solid medium 50ug/ml), filter out white transformant and extract plasmid, this plasmid called after pBL1.PBL1 is cut back to close the 4.3kb fragment with the BamHI enzyme, with this fragment and Linker-1, connect 3-4 hour with the T4DNA ligase enzyme in room temperature, connect and on the LB solid medium that contains Ap (50ug/ml), cultivated 20-24 hour after liquid is transformed into bacillus coli DH 5 alpha, filter out white transformant and extract plasmid, with this plasmid called after pLC1.
2) structure of plasmid pLC104: pLC1 cuts with the SmaI enzyme with step 1) gained plasmid, reclaim the 4.3kb fragment and be connected 3-4 hour with the T4DNA ligase enzyme in room temperature with the PCR product of purifying, connect and on the LB solid medium that contains Ap (50ug/ml), cultivated 20-24 hour after liquid is transformed into bacillus coli DH 5 alpha, filter out white transformant and extract plasmid, with this plasmid called after pLC104.
3) structure of plasmid pJR20: plasmid pDN18 cuts with the EcoRI/BamHI enzyme, reclaims the 7.8kb fragment; This fragment is connected 3-4 hour with the T4DNA ligase enzyme in room temperature with Linker-2, connect and on the LB solid medium that contains 15ug/ml tsiklomitsin (Tc), cultivated 20-24 hour after liquid is transformed into bacillus coli DH 5 alpha, filter out white transformant and extract plasmid, with this plasmid called after pJR20.
4) structure of plasmid pJC104: two fragments are connected 3-4 hour with the T4DNA ligase enzyme in room temperature, connect and on the LB solid medium that contains Tc (15ug/ml), cultivated 20-24 hour after liquid is transformed into bacillus coli DH 5 alpha, filter out white transformant and extract plasmid, be copper resistance binary signal conducting system regulation factor mutant pJC104 with the base sequence among the sequence table SEQ ID No.1.
Embodiment 3
Copper resistance binary signal conducting system regulation factor mutant: described copper resistance binary signal conducting system regulation factor mutant has the effect that Pseudomonas fluorescens is reduced bacterial virulence.
The expression of regulatory factor mutant in Pseudomonas fluorescens TSS1:
1) structure of bacterial strain TSS1/pJC104 and TSS1/JR20: regulatory factor mutant plasmid pJC104 is transformed into intestinal bacteria S17 λ π (purchasing in Spain " Biomedal " company) back is containing on the LB solid medium of Tc (15ug/ml) and cultivated 18-24 hour, 1 transformant of picking, called after S17 λ π/pJC104.The incubated overnight in the LB liquid nutrient medium with TSS1 and S17 λ π/pJC104 is 1: 3 mixed (cumulative volume 1ml) with the two with volume ratio then, and centrifugal (5000g, 10min), collects thalline by 4 ℃ with mixed solution; Thalline is suspended in the 1ml LB liquid nutrient medium, getting 0.1ml places on the solid LB substratum in 30 ℃ of insulations 6-8 hour, then with bacterial suspension in 1ml liquid LB, getting 0.1ml cultivated 24-30 hour on the LB solid medium that contains Ap (50ug/ml) and Tc (15ug/ml), 1 transformant of picking, called after TSS1/pJC104.The structure of TSS1/JR20 is the same.
2) regulatory factor mutant plasmid pJC104 detection of expression: with TSS1/pJC104 and TSS1/JR20 respectively at 28 ℃ of wave and culture in the LB substratum to OD
6000.7, extract test kit (purchasing) with SV TotalRNA and extract total RNA in the U.S. " Promega " company.Carry out the PCR reaction with PCR kit for fluorescence quantitative (purchasing) and ABI 7300 real-time fluorescence quantitative PCR instrument (AppliedBiosystems), detect the expression of regulatory factor mutant plasmid pJC104 in TSS1/pJC104 and TSS1/JR20 in Takara.The result shows that the expression ratio of regulatory factor mutant plasmid pJC104 in TSS1/pJC104 raise 75 times in TSS1/pJR20.
3) regulatory factor mutant plasmid pJC104 expresses the influence to bacterial virulence: with TSS1/pJC104 and TSS1/JR20 respectively at 28 ℃ of wave and culture in the LB substratum to OD
6000.5 centrifugal (5000g, 10min) collects thalline by 4 ℃; With thalline be suspended among the PBS (pH7.4) to final concentration be 1 * 10
8Cfu/ml, called after TSS1/pJC104 suspension and TSS1/JR20 suspension respectively.44 lefteye flounders are divided into two groups of A and B, 22 every group at random.The above-mentioned TSS1/pJC104 suspension of A group every fish belly chamber injection 0.1ml, the above-mentioned TSS1/JR20 suspension of B group every fish belly chamber injection 0.1ml, the death toll of in 14 days, observing every group of fish.The result shows that the general mortality rate of A group is 31.2%, and the general mortality rate of B group is 68.2%, illustrates that regulatory factor mutant plasmid pJC104 expresses remarkable (P＜0.01) and reduced the virulence of bacterium.Wherein the PBS moiety is: 0.8g NaCl, 0.02g KCl, 0.358g Na
2HPO
4.12H
2O, 0.024g NaH
2PO
4(pH7.4).
Sequence table
SEQUENCE?LISTING
＜110〉Institute of Oceanology of the Chinese Academy of Sciences
＜120〉copper resistance binary signal conducting system regulation factor mutant and structure thereof and application
<130>
<160>1
<170>PatentIn?version?3.1
<210>1
<211>315
<212>DNA
＜213〉Pseudomonas fluorescens
<220>
<221>CRC104
<222>(1)..(315)
<223>
<400>1
atgaaattgg?ctggtttgga?ggtggacctc?ctcaaacgca?gggttatccg?cgcaggcaaa 60
cgtatagatc?taacggccaa?agagcttgcg?ttgctcgaat?tgctgctccg?tcgtcgaggc 120
gaggttctgc?ccaagtcgct?tattgcttcc?caggtctggg?acatgaactt?tgacagcgat 180
actaacgtca?tcgaggttgc?tgtcaggagg?ctcagagcaa?agattgatga?tgattttgag 240
gtcaagctta?tccacacctc?tcgaggcatg?gggtacatgc?tggatgcgcc?ggattcgggg 300
acggggtcgg?aatga 315
Claims (3)
1. a copper resistance binary signal conducting system regulation factor mutant is characterized in that being the base sequence among the sequence table SEQ ID No.1.
2. construction process by the described copper resistance binary signal conducting system regulation factor mutant of claim 1 is characterized in that:
1) plasmid pLC1 makes up: with plasmid pEGFP is template, and PF1 and PR4 are that primer carries out pcr amplification, and amplified production is connected with plasmid pBS-T, gets plasmid pBSL1; Plasmid pBSL1 and plasmid pBR322 reclaim 140bp and 3986bp fragment respectively after with the EcoRI/BamHI double digestion; These two sections fragments are connected with the T4DNA ligase enzyme, get plasmid pBL1; Plasmid pBL1 is cut back to close the 4.3kb fragment with the BamHI enzyme, reclaim fragment and be connected with Li nker-1 and promptly get plasmid pLC1; Described primer PF1 is 5 '-ATAGAATTCATTTAAATGCAGCTGGCACGA-3 ', and PR4 is 5 '-GGATCCACACAACATACGAGC-3 ';
2) plasmid LC104 makes up: with Pseudomonas fluorescens TSS1 is template, CRF19 and CRR9 are that primer and Pfu archaeal dna polymerase carry out pcr amplification, cutting the fragment that reclaims the back with step 1) gained plasmid pLC1 with Sma I enzyme behind the product purification is connected, connect and on the LB substratum that contains peace card penicillin, IPTG and Xga1, cultivate after liquid changes intestinal bacteria over to, the screening transformant extracts plasmid, is plasmid LC104; Wherein said primer CRF19 is 5 '-ATCATGAAATTGGCTGGTTTGG-3 ', and CRR 9 is 5 '-GATATCTTATTCCGACCCCGTC-3 ';
3) structure of plasmid pJR20: plasmid pDN18 is cut with the EcoRI/BamHI enzyme, reclaiming the 7.8kb fragment is connected with the T4DNA ligase enzyme, connect liquid and be transformed into behind the bacillus coli DH 5 containing on the LB solid medium of tsiklomitsin and cultivate, the screening transformant extracts plasmid, is pJR20;
4) structure of plasmid pJC104: with step 2) gained plasmid pLC104 cuts with Swa I enzyme, reclaims the 650bp fragment; Step 3) gained plasmid pJR20 cuts with Swa I enzyme, reclaims the 7.8kb fragment; Reclaiming fragment T4DNA ligase enzyme with two sections connects, connecting liquid is transformed into behind the bacillus coli DH 5 alpha containing on the LB solid medium of tsiklomitsin and cultivates, the screening transformant extracts plasmid, is the plasmid pJC104 that can express the copper resistance binary signal conducting system regulation factor mutant with the base sequence among the sequence table SEQ ID No.1.
3. application by the described copper resistance binary signal conducting system regulation factor mutant of claim 1, it is characterized in that: described copper resistance binary signal conducting system regulation factor mutant has the effect that reduces bacterial virulence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101388485A CN101348522B (en) | 2008-08-01 | 2008-08-01 | Copper resistance binary signal conducting system regulation factor mutant, and construction and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008101388485A CN101348522B (en) | 2008-08-01 | 2008-08-01 | Copper resistance binary signal conducting system regulation factor mutant, and construction and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101348522A CN101348522A (en) | 2009-01-21 |
| CN101348522B true CN101348522B (en) | 2010-10-13 |
Family
ID=40267514
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008101388485A Expired - Fee Related CN101348522B (en) | 2008-08-01 | 2008-08-01 | Copper resistance binary signal conducting system regulation factor mutant, and construction and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101348522B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080037876A1 (en) * | 1999-08-09 | 2008-02-14 | Michael Galperin | Object based image retrieval |
-
2008
- 2008-08-01 CN CN2008101388485A patent/CN101348522B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080037876A1 (en) * | 1999-08-09 | 2008-02-14 | Michael Galperin | Object based image retrieval |
Non-Patent Citations (2)
| Title |
|---|
| Donald A. Cooksey.Molecular mechanisms of copper resistance and accumulation in bacteria.《FEMS Microbiology Reviews》.1994,第14卷381-386. * |
| George W. Sundin et al.Resistance to ultraviolet light in Pseudomonas syringae: sequence and functional analysis of the plasmid-encoded ruIAB genes.《Gene》.1996,第177卷77-81. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101348522A (en) | 2009-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zeng et al. | Global small RNA chaperone Hfq and regulatory small RNAs are important virulence regulators in Erwinia amylovora | |
| Garcia et al. | B urkholderia BcpA mediates biofilm formation independently of interbacterial contact‐dependent growth inhibition | |
| Mitchell et al. | Treponema denticola biofilm-induced expression of a bacteriophage, toxin–antitoxin systems and transposases | |
| Moleleki et al. | A quorum sensing‐defective mutant of Pectobacterium carotovorum ssp. brasiliense 1692 is attenuated in virulence and unable to occlude xylem tissue of susceptible potato plant stems | |
| Zhang et al. | The HD-GYP domain protein RpfG of Xanthomonas oryzae pv. oryzicola regulates synthesis of extracellular polysaccharides that contribute to biofilm formation and virulence on rice | |
| Coquet et al. | Occurrence and phenotypic characterization of Yersinia ruckeri strains with biofilm-forming capacity in a rainbow trout farm | |
| Xu et al. | Bacillus velezensis wall teichoic acids are required for biofilm formation and root colonization | |
| CN112888305A (en) | RNA-based therapeutic methods for protecting animals against pathogenic bacteria and/or promoting beneficial effects of commensal and commensal bacteria | |
| Lee et al. | Effect of soybean coumestrol on Bradyrhizobium japonicum nodulation ability, biofilm formation, and transcriptional profile | |
| Zhou et al. | SlyA regulates phytotoxin production and virulence in Dickeya zeae EC1 | |
| Tancos et al. | Plant‐like bacterial expansins play contrasting roles in two tomato vascular pathogens | |
| Strano et al. | P seudomonas corrugata crpCDE is part of the cyclic lipopeptide corpeptin biosynthetic gene cluster and is involved in bacterial virulence in tomato and in hypersensitive response in N icotiana benthamiana | |
| Monticolo et al. | The role of DNA in the extracellular environment: a focus on NETs, RETs and biofilms | |
| Nagar et al. | Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus | |
| CN113498338A (en) | Non-chromosomal dynamic activity system | |
| Hung et al. | Association of a D-alanyl-D-alanine carboxypeptidase gene with the formation of aberrantly shaped cells during the induction of viable but nonculturable Vibrio parahaemolyticus | |
| Feng et al. | The xrvA gene of Xanthomonas oryzae pv. oryzae, encoding an H-NS-like protein, regulates virulence in rice | |
| Chalupowicz et al. | Bacterial outer membrane vesicles induce a transcriptional shift in arabidopsis towards immune system activation leading to suppression of pathogen growth in planta | |
| Xu et al. | Rugose small colony variant and its hyper-biofilm in Pseudomonas aeruginosa: Adaption, evolution, and biotechnological potential | |
| Bergeau et al. | Unusual extracellular appendages deployed by the model strain Pseudomonas fluorescens C7R12 | |
| US20220056457A1 (en) | Cis conjugative plasmid system | |
| Wang et al. | Dissemination and loss of a biofilm‐related genomic island in marine Pseudoalteromonas mediated by integrative and conjugative elements | |
| Jiang et al. | AcuC, a histone deacetylase, contributes to the pathogenicity of Aeromonas hydrophila | |
| Guan et al. | A LuxR‐type regulator, AcrR, regulates flagellar assembly and contributes to virulence, motility, biofilm formation, and growth ability of Acidovorax citrulli | |
| Yang et al. | Vibrio parahaemolyticus becomes highly virulent by producing Tc toxins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101013 Termination date: 20140801 |
|
| EXPY | Termination of patent right or utility model |