CN101348512A

CN101348512A - Antineoplastic ad virus preparation

Info

Publication number: CN101348512A
Application number: CNA2007100440961A
Authority: CN
Inventors: 韩志强
Original assignee: ZHENGZHOU VIRI BIOTECHNOLOGY CO Ltd
Current assignee: ZHENGZHOU VIRI BIOTECHNOLOGY CO Ltd
Priority date: 2007-07-20
Filing date: 2007-07-20
Publication date: 2009-01-21
Anticipated expiration: 2027-07-20
Also published as: CN101348512B

Abstract

The invention discloses a siRNA which inhibits tumor through inhibiting the expression of PDX-1, and a recombinant adenovirus designed on the basis of the sequence of the siRNA. The invention also provides a drug composition containing the adenovirus. The adenovirus provided by the invention has the advantages of high titration, absence of integration into the genome of the host, and high safety.

Description

A kind of antineoplastic ad virus preparation

Technical field

The invention belongs to biotechnology and medical field; More particularly, the present invention relates to a kind of new preparation that can be used for oncotherapy.

Background technology

Malignant tumour is the major disease of a class serious harm human health, the major obstacle of pharmacological agent at present is special target and the effective drug disposition carrier that lacks oncotherapy, and promptly a lot of antitumor drugs also bring disaster to normal cell in the kill tumor cell; The biomacromolecule anti-tumor agent that some is special, such as antisense nucleic acid and siRNA etc. lack release vehicle in the effective body.Therefore, development biomacromolecule antitumor drug, most critical be to find TS target and development of effective pharmaceutical carrier.

(Pancreas duodenum homeobox-1 PDX-1) is a kind of transcription factor to pancreas duodenum hox genes-1, the pancreas in embryo period is grown and kept the normal beta cell function play crucial effects.Research previously thinks, except that beta Cell of islet, delta cell and the duodenum exocrine cell that is dispersed in, other organizes body and all do not have PDX-1 and express.Yet nearest discovers, the kinds of tumors tissue of human body is as also having the expression of PDX-1 in carcinoma of the pancreas, mammary cancer, colorectal carcinoma, prostate cancer and the kidney.Yet PDX-1 expresses in human tumor cells really that cutter system and actual property meaning it be unclear that.

It is the new efficient gene interrupter technique that development in recent years is got up that RNA disturbs (RNAi), is not only the effective means of research gene function and disease mechanisms, has the bright prospects of the siRNA medicine of clinical treatment and development gene specific simultaneously.Discharge the methods that adopt the cationic-liposome transfection in the siRNA of chemosynthesis at present or the plasmid born of the same parents more, is successful with cationic-liposome at in-vitro transfection, and in vivo because its transduction efficiency is low and the toxic side effect relevant with dosage limited its interior application of body.Virus is considered to the inside and outside than non-virus carrier transgene carrier efficiently, yet there is the problem of security during transfection in most of viruses in being used for body.

In the prior art, take place and developing effect remains the unknown in tumour for PDX-1, therefore, this area needs further research PDX-1 to participate in tumour generation and the mechanism that develops, and the active drug that needs exploitation to make new advances, thereby provide new approach for tumor treatment at the tumour target.

Summary of the invention

The object of the present invention is to provide a kind of antineoplastic ad virus preparation.

In a first aspect of the present invention, the construction that provides a kind of PDX-1 of inhibition to express, described construction has with the following formula I structure:

Seq _Forward-X-Seq _OppositelyFormula I,

Among the formula I, Seq _ForwardFor can be with arbitrary zone on the PDX-1 gene basic complementary and with the PDX-1 gene beyond the equal complementary nucleotide sequence not of people's gene, Seq _OppositelyFor with Seq _ForwardBasic complementary nucleotide sequence, perhaps,

Seq _OppositelyFor can be with arbitrary zone on the PDX-1 gene basic complementary and with the PDX-1 gene beyond the equal complementary nucleotide sequence not of people's gene, Seq _ForwardFor with Seq _OppositelyBasic complementary nucleotide sequence,

X is for being positioned at Seq _ForwardAnd Seq _OppositelyBetween intervening sequence, and described intervening sequence and Seq _ForwardAnd Seq _OppositelyIt is not complementary,

Structure shown in the formula I forms the secondary structure shown in the formula II after changing cell over to:

Formula II,

Among the formula II, Seq _Forward, Seq _OppositelyWith the definition of X such as above-mentioned,

|| be illustrated in Seq _ForwardAnd Seq _OppositelyBetween the hydrogen bond that forms.

In another preference, Seq _ForwardHas 14-30 Nucleotide; Seq _OppositelyHas 14-30 Nucleotide; Preferred, Seq _ForwardHas 16-25 Nucleotide; Seq _OppositelyHas 16-25 Nucleotide; Further preferred, Seq _ForwardHas 18-22 Nucleotide; Seq _OppositelyHas 18-22 Nucleotide.

In another preference, X has 4-20 Nucleotide, preferably has 5-15 Nucleotide, and preferred have 6-9 Nucleotide.

In another preference, described Seq _ForwardOr Seq _OppositelyBe selected from down group:

(a) have the nucleotide sequence shown in the SEQ ID No:3 or its complementary sequence;

(b) have the nucleotide sequence shown in the SEQ ID No:4 or its complementary sequence;

(c) have the nucleotide sequence shown in the SEQ ID No:5 or its complementary sequence; Or

(d) have the nucleotide sequence shown in the SEQ ID No:6 or its complementary sequence.

In a second aspect of the present invention, a kind of recombinant vectors is provided, contain described construction in the described carrier.

In a third aspect of the present invention, a kind of adenovirus of reorganization is provided, contain a recombinant expression cassettes in the genome of described adenovirus, described recombinant expression cassettes contains described construction.

In another preference, but described adenovirus infected tumor cell generates the siRNA that can suppress PDX-1 in cell.

In another preference, described recombinant expression cassettes from 5 ' to 3 ' contains following element successively:

The rna plymerase iii promotor;

Described construction; With

Terminator.

In another preference, described rna plymerase iii promotor is selected from (but being not limited to): U6 promotor, H1 promotor; Preferred, described rna plymerase iii promotor is U6 promotor (as a people source U6 promotor (hU6)).

In another preference, between rna plymerase iii promotor and described construction, also comprise a multiple clone site.Preferably, described multiple clone site is the BamHI restriction enzyme site.

In another preference, also comprise a multiple clone site between described construction and the described PolIII terminator.Preferably, described multiple clone site is the HindIII restriction enzyme site.

In another preference, described terminator is a Poly T terminator; For example, described terminator sequence is TTTTTT.

In another preference, described adenovirus is an Ad5 type adenovirus.Preferred, described Ad5 type adenovirus is a replication-defective virus, lacks gene E1 or the E3 relevant with virus replication.Further preferred, the described Ad5 type adenovirus disappearance gene E1 relevant with virus replication must provide E1 albumen by host cell (as 293 cells), just can copy the virus with infection ability.

In a fourth aspect of the present invention, the purposes of described adenovirus is provided, be used to prepare the medicine of treatment PDX-1 gene high expression relative disease.

In another preference, described PDX-1 gene high expression relative disease is a tumour.

In another preference, described tumour is selected from:

Squamous cell carcinoma; Rodent cancer; Transitional cell carcinoma; Gland cancer; Gastrinoma; Cholangiocellular carcinoma; Adenoma; Hepatocellular carcinoma; Renal cell carcinoma; Melanoma; Fibrosarcoma; Myxosarcoma; Liposarcoma; Leiomyosarcoma; Rhabdosarcoma; Teratoma; Angiosarcoma; The Kaposi sarcoma; Lymphangiosarcoma; Osteoma; Osteosarcoma; Osteogenic sarcoma; Chondrosarcoma; Meningioma; Non-Hodgkin lymphoma; Hodgkin lymphoma; Leukemia.

In a fifth aspect of the present invention, a kind of pharmaceutical composition is provided, described pharmaceutical composition comprises:

The described adenovirus of significant quantity; With

The carrier compatible with described adenovirus.

In another preference, the content of described adenovirus in pharmaceutical composition is 10 ³-10 ²⁰Pfu/ml; Preferably 10 ⁶-10 ¹⁵Pfu/ml; Be more preferably 10 ¹⁰-10 ¹¹Pfu/ml.

In a sixth aspect of the present invention, a kind of method for the treatment of tumour is provided, described method comprises the described adenovirus that gives the tumour patient significant quantity.

On the other hand, the present invention also provides a kind of method that suppresses tumour cell, comprising: with anti-PDX-1 reagent contact tumour cell, described anti-PDX-1 suppresses the PDX-1 activity, thereby suppresses tumour cell.

In another preference, described anti-PDX-1 reagent suppresses the expression of PDX-1.

In another preference, described anti-PDX-1 reagent is a double-stranded RNA mixture, and it disturbs by RNA and suppresses the PDX-1 expression of gene.

In another preference, described double-stranded RNA mixture comprises about 28-60 Nucleotide, one sense strand and an antisense strand, sense strand and antisense strand all are made up of 14-30 Nucleotide, and antisense strand has about 12-26 Nucleotide and sense strand complementation at least, and sense strand has about 12-26 Nucleotide and antisense strand complementation at least simultaneously.

In another preference, in the double-stranded RNA mixture, antisense strand links to each other by a connector with sense strand.

In another preference, described connector is selected from: oligonucleotide, polynucleotide or non-nucleotide.

In another preference, described PDX-1 is selected from: antibody, and fit, part or inhibition compound.

In another preference, described positive-sense strand or antisense strand and be selected from SEQ ID No:3, SEQ ID No:4, SEQ ID No:5, or the nucleic acid of SEQ ID No:6 is complementary in fact.

In another preference, described anti-PDX-1 reagent is selected from: antisense oligonucleotide or ribozyme.

On the other hand, the present invention also provides a kind of method that tumour cell PDX-1 expresses that suppresses, comprise: with tumour cell and can contact with significant quantity with the anti-PDX-1 reagent of specific region complementary of RNA of coding PDX-1, the specific RNA molecular hybridization of described anti-PDX-1 reagent and coding PDX-1, and in tumour cell, block the PDX-1 expression of gene.

In another preference, block the PDX-1 expression of gene in RNA interferential mode as the anti-PDX-1 reagent of the mixture of double-stranded RNA.

On the other hand, the present invention also provides a kind of composition, and described composition comprises described anti-PDX-1 reagent and pharmaceutically acceptable carrier.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

Fig. 1 has shown the expression of PDX-1mRNA in the various cells, and described cell comprises PANC-1, UKPAN, BxBc3, MiaPaCa2, MCF-7, SK-BR-3, AU565, MDA-MB-231, H23, H460, H520, T24, Um-UC-3 and AG5229-hT.

Fig. 2 has shown that use PDX-1 siRNA 651 (being called for short 651 among the figure) handles the MiaPaCa-2 pancreatic cancer cell, and harvested cell also uses the situation of the expression of PDX-1 in the immunoblotting assay cell, with untreated cell (-) in contrast.Fig. 2 B is the immunoblotting result, and Fig. 2 A is a quantized result.

Fig. 3 has shown that expression inhibiting that flow cytometry is caused by PDX-1siRNA causes the apoptosis situation of cancerous cell line.

Fig. 4 has shown the quantized result that the PDX-1 of the MiaPaCa2 cell of RT-PCR analysis PDX-1 siRNA 590 transfections expresses.

Fig. 5 has shown the apoptosis of the tumour cell that PDX-1 siRNA handles under the inverted microscope.Wherein, left column is for contrasting the situation after siRNA handles, and the situation after PDX-1 siRNA 590 handles is classified on the right side as.

Fig. 6 has shown the collection of illustrative plates of the pRNAi-shuttle plasmid that the present invention is used, contains the hU6 promotor in this plasmid, BamHI restriction enzyme site, HindIII restriction enzyme site and terminator (TTTTTT) etc.This site of digitized representation after everybody roll-call of institute's mark is referred to as among the figure is in the position in the carrier, originates in the 1025th of carrier sequence as BamHI 1025 expression BamHI restriction enzyme sites.

Fig. 7 has shown pAd/BLOCK-iT ^TMThe collection of illustrative plates of-DEST carrier (available from American I nvi trogen company).

Fig. 8 has shown the structure of recombinant adenoviral expressing vector and clone's basic procedure.

Fig. 9 shown utilize PDX-1 shRNA adenovirus preparation to infect MiaPaCa2 cell, SKOV3 cell, Panc-1 cell after, the apoptosis situation of cell, simultaneously with the adenovirus of expressing insignificant shRNA ((-) siControl) as negative control.Wherein, A is the situation (being respectively the blank hole from left to right, negative control hole, the positive hole of infecting) that MiaPaCa2 infected the 7th; B is the situation (being respectively the blank hole from left to right, negative control hole, the positive hole of infecting) that SKOV3 infected the 10th; C is that Panc-1 infects the 10th situation (being respectively the blank hole from left to right, negative control hole, the positive hole of infecting).

Figure 10 has shown that microscopic examination utilizes the apoptosis situation after PDX-1shRNA adenovirus preparation infects MiaPaCa2 cell, Panc-1 cell, SKOV3 cell, simultaneously with the adenovirus of expressing insignificant shRNA ((-) siControl) as negative control.Wherein, A is negative situation of organizing (left side) and positive infected group (right side) on the 7th behind the MiaPaCa2 cell infection; B is negative situation of organizing (left side) and positive infected group (right side) on the 10th behind the Panc-1 cell infection; C is negative situation of organizing (left side) and positive infected group (right side) on the 10th behind the SKOV3 cell infection.

Figure 11 has shown that microscopic examination utilizes the apoptosis situation after PDX-1 shRNA adenovirus preparation infects SMMC 7721 human liver cancer cells, 435s human breast cancer cell, SGC 7901 gastric carcinoma cells, simultaneously with the adenovirus of expressing insignificant shRNA ((-) siControl) as negative control.Wherein, A is negative situation of organizing (left side) and positive infected group (right side) on the 10th behind SMMC 7721 cell infections; B is negative situation of organizing (left side) and positive infected group (right side) on the 10th behind the 435s cell infection; C is negative situation of organizing (left side) and positive infected group (right side) on the 10th behind SGC 7901 cell infections.

Figure 12 has shown that the adenovirus of employing 590 adenovirus preparations and expression shRNA ((-) siControl) infects mammary cancer MDA-MB-435S cell (A) respectively, prostate cancer pc-3 cell (B), mammary cancer MDA-MB-231 cell (C), lung cancer A549 cell (D), cervical cancer hela cell (E), behind liver cancer 7721 cells (F), inverted microscope is observed the growth-inhibiting situation of 590 adenovirus preparation's group cells down.

Embodiment

The inventor is through extensive and deep research, and disclosing PDX-1 first is for the factor that tumour takes place and development plays an important role, and blocks its genetic expression or suppress its protein-active to reach antineoplastic action.The inventor has found for suppressing PDX-1mRNA and has transcribed useful action target spot also based on the PDX-1 gene order.Thereby the present invention also provides a kind of to have by suppressing the siRNA (siRNA) that PDX-1 expresses the inhibition tumor growth.The present invention also provides a kind of antineoplastic ad virus preparation that designs based on this siRNA, and described adenovirus preparation produces titre height, unconformability to host genome, safe.Finished the present invention on this basis.

As used herein, " tumour " speech has comprised implication widely, includes but not limited to: squamous cell carcinoma; Rodent cancer; Transitional cell carcinoma; Gland cancer; Gastrinoma; Cholangiocellular carcinoma; Adenoma; Hepatocellular carcinoma; Renal cell carcinoma; Melanoma; Fibrosarcoma; Myxosarcoma; Liposarcoma; Leiomyosarcoma; Rhabdosarcoma; Teratoma; Angiosarcoma; The Kaposi sarcoma; Lymphangiosarcoma; Osteoma; Osteosarcoma; Osteogenic sarcoma; Chondrosarcoma; Brain [ridge] film knurl; Non-Hodgkin lymphoma; Hodgkin lymphoma; Leukemia.

As used herein, term " RNA disturb (RNA interference; RNAi) " is meant that some little double-stranded RNAs can block in the body specific gene efficiently, specifically and express, impel the mRNA degraded, lure that cell shows the phenotype of specific gene disappearance into, it is also referred to as, and RNA intervenes or RNA interferes.It is the gene silencing on the mRNA level of high special that RNA disturbs, and it is one of important protection mechanism of resisting in the body external infection.In brief, RNA disturbs and comprises a mechanism that is excited by small-sized RNA interfering (siRNA), causes the degraded of said target mrna.

As used herein, term " siRNA (small interfering RNA; siRNA) " is meant a kind of short-movie section double stranded rna molecule, can be the specific mRNA of target degraded with the mRNA of homology complementary sequence, this process be exactly RNA interference channel (RNA interference pathway).

As used herein, and term " bobby pin RNA (Small hairpin RNA, shRNA) " be meant the non-coding small RNA molecular that can form hairpin structure, bobby pin RNA can come the expression of suppressor gene by the RNA interference channel.

As used herein, term " complementation " refers to the base pairing between the Nucleotide, refers in particular to the hydrogen bonded between the Nucleotide, and thymus pyrimidine or uridylic residue combine with VITAMIN B4 by 2 hydrogen bonds, and cytosine(Cyt) and guanine residue are by 3 hydrogen bonded.Generally speaking, nucleic acid contains the nucleotide sequence that a pair of and another specific nucleotide sequence have " complementary percentage ".For example, a nucleotide sequence has 80%, 90% or 100% complementarity for another specific nucleotide sequence, and pointing out in 10 Nucleotide of this nucleotide sequence has 8,9, or 10 with another specific nucleotide sequence complementation.Article two, the complementary nucleotide sequence contains a positive-sense strand (sense) and an antisense strand (antisense).Term " substantially complementary " or " complementary basically " refer to a nucleotide sequence and show at least 80% for another specific nucleotides sequence, and be preferable 90%, better 95%, best 100% complementarity.

PDX-1

(Pancreas duodenum homeobox-1 PDX-1) is a kind of transcription factor to pancreas duodenum hox genes-1.Although have the expression that PDX-1 is arranged in the kinds of tumor cells of discovering human body, cutter system it be unclear that prior art to expressing really in the PDX-1 human tumor cells.

The inventor's research finds that first PDX-1 is high expression level in many tumour cells, does not express and have obviously in normal cell (remove beta Cell of islet, delta cell and the duodenum exocrine cell that is dispersed in are outer).Further, the inventor studies the effect of PDX-1 in tumour cell by the expression of disturbing PDX-1, thereby has confirmed that PDX-1 is the importance factor that tumour takes place and develops, and suppresses the expression of PDX-1, but the apoptosis of inducing tumor cell.Therefore as seen, PDX-1 be a kind of promote cell proliferation dedifferente the factor or a kind of anti-apoptosis factor, its high expression level in tumour cell is the key point that causes tumour to take place and develop.Also can number be 60/889,808 patent application referring to U.S. Provisional Patent Application about above-mentioned research.

Because PDX-1 do not have obvious expression in normal cell, so it can be used as a kind of good specificity antineoplastic target, just reduce or blocking-up PDX-1 be expressed in antineoplastic while, to Normocellular not obviously influence.

The protein sequence of PDX-1 and nucleotide sequence thereof are that those skilled in the art are known.The protein sequence of PDX-1 is substantially the same or identical with the sequence shown in the SEQ ID NO:2; The proteic nucleotide sequence of a kind of PDX-1 that encodes for example can be substantially the same or identical with the sequence shown in the SEQ ID NO:1.

The siRNA that suppresses PDX-1

But the characteristics based on the apoptosis of the expression inducing tumor cell that suppresses PDX-1 can design the siRNA sequence at PDX-1, thereby be used to suppress the expression of PDX-1 in the cell.

The inventor according to the sequence of PDX-1, has found several to transcribe useful target spot for suppressing PDX-1mRNA through studying for a long period of time on this sequence, and the sequence of described target spot is respectively:

5 ' AGTTCCTATTCAACAAGTA 3 ' (SEQ ID No:3), i.e. people PDX-1 nucleotide sequence 590-608 position.

5 ' TTCCTATTCAACAAGTACA 3 ' (SEQ ID No:4), i.e. people PDX-1 nucleotide sequence 592-610 position.

5 ' CTTGACCGAGAGACACATC 3 ' (SEQ ID No:5), i.e. people PDX-1 nucleotide sequence 651-669 position.

5 ' TGACCGAGAGACACATCAA 3 ' (SEQ ID No:6), i.e. people PDX-1 nucleotide sequence 653-671 position.

When screening siRNA target sequence, also need compare, thereby get rid of any and PDX-1 anyone genoid homologous target sequence in addition, find out best effective fragment.Anyly belong to nonspecific target sequence through identification and be excluded outside the present invention.Other sequence contrast can be undertaken by present known multiple comparative approach in target sequence and the nucleic acid database.A kind of comparative approach commonly used such as BLAST (Basic LocalAlignment Search Tool, http://www.ncbi.nlm.nih.gov/BLAST/) analyze.

Through big quantitative analysis of the inventor and comparison, target sequence SEQ ID No:14, SEQ ID No:15, SEQ ID No:16 and SEQ ID No:17 are identical with the subregion of nucleic acid SEQ ID No:1 of the human PDX-1 of coding, do not have significant homology with other human nucleic acid sequence.And empirical tests, the siRNA of the nucleotide sequence design at SEQ ID NO:14-17 shown in arbitrary has the effect that good interference PDX-1 expresses.

The invention provides the siRNA that suppresses tumour based on above-mentioned target spot, described siRNA can disturb the PDX-1 gene transcription specifically.Described siRNA is for being template with people PDX-1 gene order, according to the siRNA of siRNA principle of design acquisition.

Described siRNA can be prepared to a kind of double-strandednucleic acid that comprises positive-sense strand and antisense strand, and positive-sense strand and antisense strand are complementary basically therein, and each bar positive-sense strand or antisense strand comprise 14-30 Nucleotide.Complementary positive-sense strand and antisense strand optionally comprise overhang 3 ' end on one or two chains of 1-2 Nucleotide.As a kind of optimal way, described siRNA comprises positive-sense strand and antisense strand, and every chain has 21-23 Nucleotide, and wherein 2 Nucleotide are overhang at 3 ' end of every chain, and 100% complementation of a remaining 19-21 Nucleotide.As mentioned above, the further details of siRNA mixture is at Engelke, D.R., and RNAInterference (RNAi): Nuts and Bolts of RNAi Technology, DNA Press LLC, Eagleville, PA has description in 2,003 one books.About the additional description of siRNA length and composition at Elbashir, the Genes and Devel. of S.M. etc., 15:188-200,2001; And O ' Toole, A.S.et al., RNA, 11:512-516 can find in 2,005 one books.

The present invention has no particular limits the preparation method of siRNA, includes but not limited to: chemical synthesis, in-vitro transcription method, Rnase III (as Silencer siRNA Construction Kit, Ambion company) or Dicer enzymic digestion dsRNA method etc.Should be understood that those skilled in the art after the sequence of cicada siRNA provided by the present invention, can prepare easily or express described siRNA with various approach.For example, in a kind of preference of the present invention, described siRNA is chemosynthesis.

SiRNA can be prepared into the form of double-strandednucleic acid, and it contains a positive-sense strand and an antisense strand, and these two chains only form double-stranded under the condition of hybridization, do not connect under other situation.A double-stranded RNA mixture can be prepared by positive-sense strand that is separated from each other and antisense strand.Therefore, by way of example, complementary positive-sense strand and antisense strand are chemosynthesis, can produce synthetic double-stranded RNA mixture by annealing hybridization thereafter.

In addition, the positive-sense strand and the antisense strand that comprise of siRNA can prepare by the expression cassette of one or more coding positive-sense strands and antisense strand.When positive-sense strand and antisense strand during by an independent expression cassette coding, they can break to form isolating positive-sense strand and antisense strand from the transcript that generates, and hybridization thereafter generates double-stranded siRNA.At Engelke, the RNA Interference (RNAi) that D.R. writes: in Nuts and Bolts of RNAiTechnology one book, the 5th and the 6th chapter particularly, DNA Press LLC, Eagleville, PA, 2003 can read the synthetic and recombination method of preparation siRNA.

As optimal way of the present invention, a kind of two strands " bob folder " RNA mixture (being called " shRNA " or " hair clip siRNA ") comprises an antisense strand and a positive-sense strand, links to each other by an intervening sequence.ShRNA can chemosynthesis, is prepared after also can being transcribed into single stranded RNA by the expression cassette in the recombinant nucleic acid structure.ShRNA has the complementary structure district, forms " hair clip " conformation under hybridization conditions, and the complementary positive-sense strand is connected with antisense strand therein, for example, and by the nucleotide sequence connection of a 1-20 Nucleotide.Generally speaking, each complementary positive-sense strand and antisense strand have about 14-30 Nucleotide.

As above-mentioned, the double-stranded DNA template of the transcript that shRNA can need by encoding is expressed.The double-stranded DNA template of the transcript that coding needs is inserted into a carrier, and for example plasmid or virus vector are connected to a promotor then and express in external or body.Under the effect of shRNA DICER enzyme in eukaryotic cell, can be cut into siRNA molecule, thereby enter the RNAi approach.

" construction " reaches " expression cassette " and is meant recombinant DNA molecules here, and it comprises the nucleic acid coding sequence of expection, siRNA of this sequence encoding or shRNA; This dna molecular also comprises the controlling element that is fit to of transcribing the necessary or expection of in external or body exercisable connection encoding sequence." controlling element " here refers to and can control the nucleotide sequence that nucleotide sequence is expressed to a certain extent.The controlling element that can be used as the model comprises enhanser, internal ribosome entry site (IRES), replication orgin, polyadenylation signal, promotor, transcription termination sequence, and the upstream regulation district, these controlling elements help the duplicating of nucleic acid, transcribe, post transcriptional modificaiton etc.

Recombinant adenovirus

Behind the siRNA that can effectively suppress the PDX-1 expression that obtains, need by specific method with described siRNA specific delivery in tumour cell or described siRNA is generated in tumour cell, thereby tumour cell is contacted with described siRNA.This specific delivery can be finished by multiple different delivering method, for example directly injects described siRNA at part.Yet research also needs to consider the safety issue for human body delivering method the time.

The inventor has found a kind of especially effectively delivering method under study for action,, as carrier described siRNA or shRNA is delivered in the target cell with adenovirus.As follows as the advantage of delivery vector with adenovirus: at first, most tumour all is the epithelial cell source, and adenovirus has the epithelial cell of having a liking for, and therefore adopts adenovirus to have good selectivity; Secondly, the titre height that adenovirus produces, the adenovirus DNA unconformability has good security to the target cell genome for human body; Once more, the physico-chemical property of adenovirus is stable, is easy to preparation, purifying, concentrates.

Adenovirus (Ad) is a kind of nonencapsulated virus, double-stranded DNA is about 36Kb, genome is made up of nine districts, four expression are called district early morning (E1-E4), five expression later (L1-L5) are called late district, express to be subjected to cell transcription factor and the control of E1 district the main dna replication dna of regulating in E2 district, E3 district gene product is relevant with the removing that virus is escaped host immune system, and the product in E4 district participates in activities such as viral dna replication, district's genetic expression in evening and transcript splicing.Kind of adenoviral serotype surplus having found 100 at present, the people's that gene therapy is commonly used 2 types (Ad2 type) and 5 types (Ad5 type) adenovirus have 95% homology on dna sequence dna.As optimal way of the present invention, adopt replication defect type Ad5, lack the gene E1 relevant with virus replication, must provide E1 albumen by host cell (as 293 cells), just can copy virus with infection ability.

Adenovirus can enter cell by taking the photograph approach in the receptor-mediated cell, breaks after the endosome acidifying, and endochylema inner virus DNA disengaged before lysosome degraded, enters nucleus then and becomes the attachment state.

The invention provides a kind of adenovirus of reorganization, contain a recombinant expression cassettes in the genome of described adenovirus, described recombinant expression cassettes contains the construction suc as formula the I structure:

Seq _Forward-X-Seq _OppositelyFormula I,

Among the formula I, Seq _Forward, Seq _Oppositely, X definition ditto described.

In recombinant expression cassettes, except described construction, also comprise other element that links to each other with described construction operability, include but not limited to: promotor, terminator etc.As optimal way of the present invention, be connected with RNA polymkeric substance III promotor at 5 ' end of described construction, be connected with the PolIII terminator at 3 ' end of described construction.

After in entering into cell, described construction forms the secondary structure shown in the formula II under the effect of rna plymerase iii promotor (as U6):

Formula II.

After the secondary structure of formula II was processed such as the Dicer enzyme in cell, formation can suppress the siRNA that PDX-1 transcribes.

Preferably, described Seq _ForwardOr Seq _OppositelyBe selected from down group (or be selected from down the group the sequence complementation): (a) have the nucleotide sequence shown in the SEQ ID No:3; (b) has the nucleotide sequence shown in the SEQ ID No:4; (c) has the nucleotide sequence shown in the SEQ ID No:5; Or (d) has a nucleotide sequence shown in the SEQ ID No:6.

In addition, can also make the gland virus expression target element of reorganization or combine with the target element, the target element for example can be to strengthen described recombinant adenovirus to pass through the cytolemma barrier.Protein for example, peptide class, antibody, antigen binding antibody fragment, hormone, antigen, haptens, carbohydrate bound fraction such as lectin, enzyme, enzyme substrates, acceptor, receptors ligand, the substrate of vehicle etc., and other can with the interactional molecule of binding partners molecular specificity.More particularly, the enhancing adenovirus can be different organoid signal for locatings, for example nuclear localization signal to the target element of the effect of sending of the interior specific position of cell.Perhaps, the target element can interact with the marker of target cell.For example, specific tumour expression can indicate other tumor marker of tumour cell level.

The assessment adenovirus is known with the appropriate methodology of the usefulness of the significant quantity of siRNA or shRNA introducing cell, comprise in the following method of measuring PDX-1 albumen and/or PDX-1 coding mRNA one or more: RT-PCR, the RNA trace, immunoblotting, immunoprecipitation and ELISA (enzyme-linked immunosorbent assay).Comprise in addition: cell death inducing after contacting described inhibitory preparation is measured, for example specificity antiapoptotic indicator mensuration is comprised the genomic dna fragment, cell anchorin mark, or activation Caspase-3 level determination.

As optimal way of the present invention, the inventor has made up pdx-1 siRNA cloning vector " pRNAi-shuttle ", and and pAd/BLOCK-iT ^TM-DEST carrier (purchasing the company in American I nvitrogen) is implemented the LR recombining reaction, has finally prepared the PDX-1shRNA recombinant adenoviral vector.The extracorporeal anti-tumor screening experiment proves that it has extensively and intimate 100% high efficiency anti-tumor effect, shows may be effective drug disposition carrier.

As optimal way of the present invention, described adenovirus is an Ad5 type adenovirus.

Pharmaceutical composition

The present invention also provides a kind of pharmaceutical composition, and described pharmaceutical composition comprises the described recombinant adenovirus of significant quantity and the carrier compatible with described adenovirus.The described carrier compatible with adenovirus needs not have excessive bad side reaction (as toxicity, stimulation and transformation reactions) for people and/or animal in itself, the material that rational benefit/risk ratio is promptly arranged, and do not have effect with adenovirus preparation, any used target element and other composition in itself.

Described " significant quantity " is meant and can produces function or amount active and that can be accepted by people and/or animal to people and/or animal.

Described " carrier compatible with adenovirus " refers to be used for the treatment of the carrier of agent administration, comprises various vehicle and thinner.This term refers to some medicament carriers like this: they itself are not necessary activeconstituents, and do not have undue toxicity after using.Suitable carriers is well known to those of ordinary skill in the art.(Mack Pub.Co. can find discussing fully about pharmaceutically acceptable vehicle in N.J.1991) at Remington ' s Pharmaceutical Sciences.Acceptable carrier can contain liquid on combination of traditional Chinese medicine is learned, as water, salt solution, glycerine and ethanol.In addition, also may there be complementary material in these carriers, as weighting agent, lubricant, glidant, wetting agent or emulsifying agent, pH buffer substance etc.

The significant quantity of recombinant adenovirus of the present invention can change with severity of the pattern of administration and disease to be treated etc.The selection of preferred significant quantity can be determined (for example by clinical trial) according to various factors by those of ordinary skills.Described factor includes but not limited to: the pharmacokinetic parameter biological example utilization ratio of described siRNA, metabolism, transformation period etc.; The severity of the disease that the patient will treat, patient's body weight, patient's immune state, the approach of administration etc.Usually, when recombinant adenovirus toxin preparation of the present invention every day with about 10 ³-10 ¹⁵Pfu/kg (preferably 10 ⁴-10 ¹²Pfu/kg; Further preferably 10 ⁵-10 ¹⁰Pfu/kg) dosage of the weight of animals gives, and can obtain gratifying effect, preferably give with the dosage that separates for 2-4 time every day, or with the slowly-releasing form administration.Can regulate this dosage replys so that optimal treatment to be provided.For example, by an urgent demand of treatment situation, but give the dosage that several times separate every day, or dosage is reduced pari passu.

Any suitable route of administration all is fine, and includes but not limited to: intravenous injection, subcutaneous injection, intramuscular injection, transdermal administration, topical administration, implantation, slowly-releasing give, give etc. in the tumour; Preferably, described administering mode is that non-enteron aisle gives.

Major advantage of the present invention is:

(1) disclose first PDX-1 be a kind of in tumour generation and development in the key factor that plays a significant role, in the cell of non-tumour, does not then have obviously expression, it can be used as a kind of target of new oncotherapy.

(2) announcement first can be efficiently and is suppressed the siRNA fragment that PDX-1 expresses specifically, and adopts the RNA perturbation technique to verify generation and the developing vital role of PDX-1 in tumour.

(3) provide a kind of good tumour preparation that presses down, with adenovirus as described siRNA or shRNA are delivered to intracellular carrier.Because most tumour all is the epithelial cell source, and adenovirus has the epithelial cell of having a liking for, and therefore has good selectivity; And, the titre height that adenovirus produces, unconformability host genome, safe for human body; In addition, the physico-chemical property of adenovirus is stable, is easy to preparation, purifying, concentrates.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.

Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.

The segmental design of the effective PDX-1 siRNA of embodiment 1 people, synthetic

1. target sequence determines

People PDX-1 siRNA target spot is by Dharmacon siDesign instrument (U.S. Dharmacon company) design, based on sequence be people PDX-1mRNA sequence (the GenBank accession number is NM_000209).Select the several candidates' that have 30-50%GC content people PDX-1 siRNA target spot, and retrieve any and people PDX-1 other gene order complementary PDX-1 siRNA in addition with NCBI BLAST, get rid of other gene order complementary PDX-1 siRNA target spot in addition with people PDX-1.

Through test and screening repeatedly, the result determines 4 siRNA target sequences at people PDX-1, and is as follows respectively:

5 ' AGTTCCTATTCAACAAGTA 3 ' (SEQ ID No:3) is promptly corresponding to the 590-608 position of nucleotide sequence SEQ ID No:1.People PDX-1 nucleotide sequence is seen SEQ ID No:1, and the people PDX-1 protein sequence of coding is seen SEQ ID No:2.

5 ' TTCCTATTCAACAAGTACA 3 ' (SEQ ID No:4) is promptly corresponding to the 592-610 position of nucleotide sequence SEQ ID No:1.

5 ' CTTGACCGAGAGACACATC 3 ' (SEQ ID No:5) is promptly corresponding to the 651-669 position of nucleotide sequence SEQ ID No:1.

5 ' TGACCGAGAGACACATCAA 3 ' (SEQ ID No:6) is promptly corresponding to the 653-671 position of nucleotide sequence SEQ IDNo:1.

As negative control, this sequence has been proved and mouse (-) siControl (target sequence is ACTACCGTTGTATAGGTG (SEQ IDNo:7)) that provides with Dharmacon, and rat and people's gene group all lack sequence homology.

2.siRNA synthetic

According to the sequence of the target site of above-mentioned acquisition, synthesize siRNA.Each siRNA all can be synthetic by ordinary method:

5’AGUUCCUAUUCAACAAGUAUU?3’(SEQ?ID?No：14，PDX-1?siRNA?590)；

5’UUCCUAUUCAACAAGUACAUU?3’(SEQ?ID?No：15，PDX-1?siRNA?592)；

5’CUUGACCGAGAGACACAUCUU?3’(SEQ?ID?No：16，PDX-1?siRNA?651)；

5’UGACCGAGAGACACAUCAAUU?3’(SEQ?ID?No：17，PDX-1?siRNA?653)。

And the siRNA of negative control (-) siControl correspondence is:

5’ACUACCGUUGUAUAGGUGUU?3’(SEQ?ID?No：18)。

Embodiment 2Western trace

With the RIPA lysis buffer cracking of the cell of logarithmic phase (by 20mM Tris-HCl, pH 8.0,100mM NaCl, the 1%NP-40 composition of 1mM EDTA and the mixture that has the albumen supressor).Albumen concentrations in lysate BSA protein determination kit mensuration (available from Pierce, Rockford, IL).The 50mg protein dissolution thing of each sample mixes with 5 * sample loading buffer (by 0.25MTris-HCl, pH 6.8,50% glycerine, 5%SDS, %5 2-beta-mercaptoethanol and 2.5% tetrabromophenol sulfonphthalein).These samples were hatched 5 minutes down at 98 ℃, hatched on ice 5 minutes, after at room temperature on a little whizzer with maximum velocity centrifugation.Protein is in 10%SDS/ polyacrylamide gel dissolving and transfer on the pvdf membrane.Film blocked 1 hour in the TBST that contains 5% skim-milk (by 10mM Tris-HCL, pH 7.5, and 150mMNaCl and 0.1%Tween 20 form).Blocked film is surveyed two hours by the first antibody that dilutes in the TBST/5% skim-milk.Then, film was being hatched 1 hour by the second antibody of horseradish peroxidase-labeled with washing back among the TBST.Film washs 4 times with TBST afterwards, and antibody detects with chemical illuminating reagent, as the ECL Western blotting reagent of Amersham.

It is rabbit polyclonal anti-PDX-1 antibody that one of employing resists, and it can react with the PDX-1 that obtains from mouse, rat and philtrum, available from Chemicon (catalog number AB3243).

Embodiment 3 quantitative PCRs

Utilize conventional technology to extract whole RNA in the cell, as with the RNEASY test kit (Qiagen, Valencia, CA).Synthesize cDNA with routine techniques, as with High Capacity cDNA Archivekit (Biosystems, Foster City, CA).Use following primer: 5 '-AGCCGGAGGAGAACAAGC-3 ' (SEQ ID No:8) and 5 '-TTCAACATGACAGCCAGCTC-3 ' (SEQ ID No:9).Amplification condition is 95 ℃, and 10 minutes, (Stratagene, La Jolla carried out 60 ℃ of 40 times 30sec95 ℃/60 sec in CA) at a Mx3000P thermal cycler afterwards.Measure the expression of GAPDH under same amplification condition as internal contrast.

Embodiment 4 confirms apoptosis by measuring Annexin V

About 5 * 10 ⁵Cell is placed in the culture dish of 60mm diameter and cultivates an evening.Cell is then not processed, or with contrasting or the siRNA transfection of anti-PDX-1.After 72 or 96 hours, cell, was hatched 15 minutes with fluorescently-labeled Annexin V with the washing of 1 * binding buffer liquid then in the dark by the pancreatin enzymolysis.

Then, cell is used flow cytometry analysis rapidly.The inhibition inductive apoptosis degree of the degree of Annexin V picked-up and the expression of PDX-1 is proportional.

The mensuration of the PDX-1 mRNA level of embodiment 5 human tumor cells

The PDX-1 expression level of human tumor cells presents with PDX-1 mRNA level.Human tumor cells mRNA level can be quantized by quantitative PCR.Many human tumor cells are estimated, and comprise PANC-1, UKPAN (UK-PAN1), BxBc3, MiaPaCa2, MCF-7, SK-BR-3, AU565, MDA-MB-231, H23, H460, H520, T24, Um-UC-3 and AG5229-hT (all available from ATCC).These cells are with respect to people's healthy tissues (not comprising pancreas beta and delta cell) overexpression PDX-1 mRNA all.The results are shown in Figure 1.

Total RNA by routine techniques from cell, prepare (RNAEASY, Qiagen, Valencia, CA) and synthesize cDNA (High Capacity cDNA Archive kit, Applied Biosystems, Foster City, CA).People PDX-1 mRNA is by using Brilliant SYBR Green detection reagent (Stratagene, La Jolla, CA), use primer 5 '-AGCCGGAGGAGAACAAGC-3 ' (SEQ ID No:10) and 5 '-TTCAACATGACAGCCAGCTC-3 ' (SEQ ID No:11).Amplification condition is 95 ℃, and 10 minutes, (Stratagene, La Jolla carried out 60 ℃ of 40 times 30 sec 95 ℃/60 sec in CA) at a Mx3000P thermal cycler afterwards.With the expression of GAPDH under same amplification condition as internal contrast.(Assays?onDemand ^TM，Applied?Biosystems，Foster?City，CA)。The level of PDX1 mRNA is according to normal people's fibroblast, and the PDX-1 expression levels is carried out stdn among the AG5229-hT.

Select different tumor cell lines to present the PDX-1 expression of the tumour of different tissue sources: carcinoma of the pancreas (Panc1, BxBC3, UKPAN, MiaPaCa-2), mammary cancer (MCF-7, SK-BR-3, AU565, MDA-MB-231), lung cancer (H23, H460, H520) and bladder cancer.All these cell strains can both form the heteroplastic graft tumour in nude mouse, thereby further study in vivo.

The inhibition that embodiment 6 siRNA express PDX-1

Use aforementioned synthetic siRNA to stop the apoptosis of PDX-1 expression and inducing culture.About 5 * 10 ⁵The MiaPaCa-2 pancreatic cancer cell is placed in the culture dish of 60mm diameter and overnight incubation under standard conditions.Then cell is hatched with the siRNA (PDX-1 siRNA 651) of SEQ ID No:16 or the siControl siRNA of SEQ ID No:18.Untreated cell is used as additional control group.After 72-96 hour, harvested cell also uses immunoblotting assay PDX-1 to express.

Fig. 2 has shown the immunoblotting result who obtains by above-mentioned steps, inhibition PDX-1 expression that demonstration PDX-1 siRNA 651 (being called for short 651) is remarkable.Cell is placed as: 5 * 10 ⁵Cell/60mm plate.Cell uses Dharmafect 2 siRNA transfecting formulations transfections after night incubation, and for reaching the ultimate density of 100nM, every plate uses the 2uM siRNA of 200 μ l.Harvested cell after 72 hours, and measure the proteic expression of PDX-1 by immuning hybridization.With the expression of Actin muscle (actin) as reference.

Embodiment 7 is by PDX-1 siRNA inductive kinds of tumor cells apoptosis and use flow cytometry to measure the combination of Annexin V

Adopt the relevant cell strain (MCF-7, T-47D (available from ATCC), SK-BR-3, MiaPaCa-2, SK-OV-3, PC3 (available from ATCC)) of mammary cancer, ovarian cancer, prostate cancer and use telomerase immortalized human embryonic fibroblast (BJ).Cell is placed as 5 * 10 ⁵Cell/60mm plate.Use Dharmafect 2 siRNA transfecting formulations transfections after the hatching an of night, for reaching the ultimate density of 100nM, every plate uses the 2uM siRNA of 200 μ l.72 hours harvested cells after transfection were hatched 15 minutes with the Annexin V of FITC-mark in dark surrounds, carried out flow cytometry then.Above-mentioned every kind of cell strain and pancreatic cancer cell (MiaPaCa-2) all are prepared to untransfected, siControl and PDX-1 siRNA590 (siPDX-1-590; SEQ ID No:14) group.

The result is presented among Fig. 3, and above-mentioned various tumour cells are owing to high expression level PDX-1, and siRNA disturbs PDX-1 to express the extensive apoptosis of back cell; Having only inoblast (BJ) to show resists the inhibition of PDX-1.

The death of the cell that embodiment 8 direct viewing siRNA handle

Use synthetic siRNA to suppress expression and the cell death inducing of PDX-1.About 5 * 10 ⁵UKPAN-1, PANC-1, MiaPaCa-2 or LN-CaP (Human Prostate Cancer Cells) are placed in the culture dish of 60mm diameter and under standard conditions and cultivate a night.Use Dharmafect siRNA transfection reagent, with 2 μ M siRNA, the 600 μ L of SEQ ID No:14 or the siControl transfectional cell of SEQ ID No:18.Final siRNA concentration is 100nM.Untreated cell cultures strain is as additional contrast.

The cell cultures of using synthetic siRNA to suppress the PDX-1 expression is carried out microscopy and directly range estimation, find almost completely death of cell.Opposite, the cell and the untreated cell of hatching with contrast siRNA but do not have or only have a small amount of death.If the same day of siRNA transfection as first day, about the 4th day (after the siRNA transfection 72 hours), begin to occur initial necrocytosis.Almost 100% necrocytosis in the 6th day.

Embodiment 9RT-PCR analyzes the expression of the MiaPaCa2 cell PDX-1 of PDX-1 siRNA 590 transfections

Aforementioned synthetic siRNA is used to stop the PDX-1 of culturing cell to express.About 5 * 10 ⁵The MiaPaCa2 cell is placed in the culture dish of 60mm diameter and under standard conditions and cultivates a night.Cell is then hatched transfection by the contrast siRNA of the PDX-1 siRNA of SEQ ID No:14 or SEQ ID No:18.24,48 and 96 hour cells dissolving after transfection, total RNA is separated, and use quantitative RT-PCR to analyze the validity that described PDX-1 siRNA reduces PDX-1 mRNA level, the result as shown in Figure 4, at the 2nd day and the 4th day, PDX-1 mRNA level had the decline of statistical significance.

Embodiment 10 observes the apoptosis of the tumour cell of PDX-1 siRNA processing

Aforementioned synthetic siRNA is used to stop the PDX-1 of culturing cell to express and cell death inducing.About 5 * 10 ⁵UK-PAN1 pancreatic cancer cell, LN-CAP prostate cancer cell or non-cancer cells 3T3 are placed in the culture dish of diameter of 60mm and cultivate a night under standard conditions.Next use PDX-1 siRNA 590 (SEQ ID No:14) or contrast siRNA (SEQ ID No:18) pair cell to carry out transfection.Untreated cell is as further contrast.

The result is shown in Fig. 5 A-C, and pancreatic cancer cell and prostate cancer cell are killed by described PDX-1 siRNA (see among the figure right row), but the do not contrasted siRNA infringement of (seeing left column among the figure), non-cancer cells is subjected to the influence of PDX-1 siRNA hardly.

The structure of embodiment 11 recombinant shuttle plasmids

1.pRNAi-shuttle-shRNA structure

Be positive-sense strand (Seq with 4 target sequences among the embodiment 1 respectively _Forward), be antisense strand (Seq with its complementary strand _Oppositely), between positive and negative adopted chain, add reverse complementary sequence Loop (TTCAAGAGA) respectively, form 5 '-Seq _Forward-Loop-Seq _Oppositely-3 ' structure, and introduce the BamHI restriction enzyme site at positive-sense strand 5 ' end respectively, introduce RNA pol III terminator (polyT terminator at antisense strand 3 ' end, TTTTTT) and the HindIII restriction enzyme site, thus be formed for the oligonucleotide templates (DNA oligo) of expressing human PDX-1 shRNA.

Above-mentioned template two strands is hybridized after annealing, form the shRNA structure, cutting rear clone with BamHI and HindIII enzyme goes into carrier pRNAi-shuttle and (sees Fig. 6 and Figure 13, original plasmid is available from American I nvitrogen company, adopt ordinary method to add hU6 (people source U6) promotor, BamHI and HindIII restriction enzyme site) BamHI and the HindIII restriction enzyme site in (between hU6 promotor and PolIII terminator), obtain to contain the cloning vector of goal gene.According to the difference in PDX-1 target gene site, the cloning vector of preparation is named as pRNAi-shuttle-shRNA 590, pRNAi-shuttle-shRNA 592, pRNAi-shuttle-shRNA 651, pRNAi-shuttle-shRNA 653, pRNAi-shuttle-shRNA (-) siControl respectively.

2. the structure of recombinant adenoviral expressing vector and clone

The structure of recombinant adenoviral expressing vector and clone's basic procedure are seen Fig. 8.

With the cloning vector pRNAi-shuttle-shRNA 590 that contains goal gene, pRNAi-shuttle-shRNA 592, pRNAi-shuttle-shRNA 651, pRNAi-shuttle-shRNA653, pRNAi-shuttle-shRNA (-) siControl of aforementioned structure, respectively with pAd/BLOCK-iT ^TM-DEST carrier (seeing Fig. 7, available from Invitrogen company) carries out the LR recombining reaction, obtains to carry the recombinant vectors of corresponding shRNA.

The recombinant vectors that is obtained is transformed into intestinal bacteria Top 10 (available from American I nvitrogen company), screening positive clone on the positive LB flat board of penbritin.Extracting recombinant adenoviral expressing vector from the positive colony that obtains.

Carry out PCR then and identify that the primer that is used to identify is:

Forward: 5 ' GGAACCAATTCAGTCGACGAATTC 3 ' (SEQ ID No:12);

Oppositely: 5 ' GCTGGGTCTAGACCAAGCTTTTCC 3 ' (SEQ ID No:13);

Identify through PCR and order-checking, obtained correct recombinant adenoviral expressing vector.

3. the generation of reorganization PDX-1 shRNA adenovirus and the mensuration of titre

1) recombinant adenoviral expressing vector is cut the plasmid DNA that adopts conventional DNA purification kit to utilize phenol chloroform extraction method purifying to digest, and extracting and purifying plasmid with the PacI enzyme.

2) adopt Lipofectamine ^TM2000 with postdigestive carrier transfection 293A cell (available from ATCC); Contain the cell and the nutrient solution of virus, centrifugal acquisition virus stock solution used behind the multigelation up to 80%CPE (cytopathic effect) when occurring (generally after transfection 10-13 days) results.

3) infect the 293A cell by virus stock solution used and carry out virus amplification, adopt the concentrated and purified virus of supercentrifugal process behind the results virus stock solution used, and adopt QuickTiter ^TMAdenovirus titer determination test kit (purchasing the Cell Biolabs company in the U.S.) is measured titre.

Utilize Lipofectamine ^TMThe 2000 transfection 293A cells PDX-1 shRNA adenovirus that obtains recombinating infects the 293A cell by virus stock solution used and carries out virus amplification, and the amplicon virus titre can reach 1 * 10 after measured ^8-9Phage formation unit (plaque-forming units, pfu)/ml, the high speed centrifugation method through routine can be purified to 1 * 10 again ^10-11Pfu/ml.Obtain to express the adenovirus of shRNA 590, shRNA 592, shRNA 651, shRNA 653 respectively, and contrast the adenovirus of carrying shRNA ((-) siControl).

Embodiment 12 reorganization PDX-1 shRNA adenovirus preparations

The preparation such as the table 1 of the described PDX-1 shRNA adenovirus preparation that recombinates.

Table 1

Embodiment 13 reorganization PDX-1 shRNA adenovirus extracorporeal anti-tumor effects are observed

Employing contains the DMEM nutrient solution of 10% foetal calf serum, cell culture method cultivator carcinoma of the pancreas Panc-1 cell and MiaPaca-2 cell in 5% CO2gas incubator routinely, employing contains the RPMI-1640 cultivator ovarian cancer SKOV3 cell of 10% foetal calf serum, people's liver cancer SMMC7721 cell, (human ovarian cancer SKOV3 cell, human pancreas cancer MiaPaca-2, Panc-1 cell are available from Chinese Academy of Sciences's Shanghai cell bank for human breast carcinoma MDA-MB-435s cell and people's cancer of the stomach SGC7901 cell; People's liver cancer SMMC 7721 cells, people's cancer of the stomach SGC 7901 cells are available from Chinese Academy of Sciences's Beijing cell centre; The high MDA-MB-435s cell that shifts of human breast carcinoma is available from Zhengzhou University.The sugared DMEM nutrient solution of the required height of cell cultures, high sugared RPMI-1640, non-essential amino acid, L-glutaminate, two anti-(cell cultures penicillin-Streptomycin sulphates) are all available from Invitrogen company).

Above-mentioned cultured cells is carried out following processing respectively:

A) utilize 590 adenovirus preparations to infect above-mentioned 6 kinds of cells respectively, simultaneously with the adenovirus preparation of the insignificant shRNA of the expression of equivalent ((-) siControl) as negative control, infect back observation of cell apoptosis situation, the results are shown in Figure 9, Figure 10 and Figure 11.

In Fig. 9, blank hole, negative control group are because growth of tumour cell is vigorous, the substratum color is acid change (being light yellow), and PDX-1 gene disruption group (positive infect hole) is because of the PDX-1 gene disruption causes apoptosis, thereby the substratum color is normal substratum color (being light red).

Figure 10 shows with Figure 11 microscopic examination: after giving identical titre virus infection, the growth of negative control group cell is vigorous, is paved with flat board.And the most of or intimate whole apoptosis of PDX-1 gene disruption group (positive infected group) tumour cell.

Above-mentioned experiment in vitro result shows that the tumour cell of positive group is close to 100% accent and dies, and very little to the tumour cell influence of feminine gender group and blank group.

B) RT-PCR and Western Blot analyze the expression blocking effect of PDX-1.

In addition, the contriver also cultivates mammary cancer MDA-MB-435S cell, prostate cancer pc-3 cell, mammary cancer MDA-MB-231 cell, lung cancer A549 cell, cervical cancer hela cell, liver cancer 7721 cells, comparative observation adopt 590 adenovirus preparations and shRNA ((-) siControl) adenovirus to handle the variation of back cell.The results are shown in Figure 12.As seen from Figure 12, contrast shRNA ((-) siControl) adenovirus treatment group is for mammary cancer MDA-MB-435S cell, prostate cancer pc-3 cell, mammary cancer MDA-MB-231 cell, lung cancer A549 cell, cervical cancer hela cell, the growth of liver cancer 7721 cells does not have obvious inhibition, and 590 adenovirus preparation's treatment group can significantly suppress mammary cancer MDA-MB-435S cell, prostate cancer pc-3 cell, mammary cancer MDA-MB-231 cell, lung cancer A549 cell, cervical cancer hela cell, the growth of liver cancer 7721 cells.

Embodiment 14 reorganization PDX-1 shRNA adenovirus anti-tumor in vivo effects are observed

6 the week ages female nude mice, available from experimentation on animals center, Henan Province.5 * 10 ⁶Individual human pancreatic cancer cell MiaPaCa-2, ovarian cancer cell line SKOV3 give nude mice in right side rib abdomen (flanking) subcutaneous injection in PBS.Tumour is at Nei Keda 100-500mm several weeks ³, representation model is set up successfully.

Divide three groups at random with mice with tumor, first group is the treatment group, and second group is the virus control group, and the 3rd group is the PBS control group, annotates 1 * 10 of 0.1ml in the tumor inoculation position respectively ⁹1 * 10 of pfu 590 adenovirus preparations, 0.1ml ⁹Pfu 651 adenovirus preparations, 1 * 10 ⁹Adenovirus and the PBS of pfu shRNA ((-) siControl) measure gross tumor volume, calculate the research of tumour inhibiting rate and related mechanism.

Found that after injection 590 adenovirus preparations and 651 adenovirus preparations, the gross tumor volume of treatment group mouse significantly reduces, and does not see toxic influence for mouse; And the gross tumor volume of virus (-) not only siControl control group and PBS control group mice does not reduce, and also has certain increase.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Zhengzhou Weirui Biotechnology Co., Ltd.

＜120〉a kind of antineoplastic ad virus preparation

<130>056423

<160>18

<170>PatentIn?version?3.3

<210>1

<211>1527

<212>DNA

＜213〉homo sapiens (Homo Sapies)

<400>1

aaagcgagca?ggggtggcgc?cgggagtggg?aacgccacac?agtgccaaat?ccccggctcc 60

agctcccgac?tcccggctcc?cggctcccgg?ctcccggtgc?ccaatcccgg?gccgcagcca 120

tgaacggcga?ggagcagtac?tacgcggcca?cgcagcttta?caaggaccca?tgcgcgttcc 180

agcgaggccc?ggcgccggag?ttcagcgcca?gcccccctgc?gtgcctgtac?atgggccgcc 240

agcccccgcc?gccgccgccg?cacccgttcc?ctggcgccct?gggcgcgctg?gagcagggca 300

gccccccgga?catctccccg?tacgaggtgc?cccccctcgc?cgacgacccc?gcggtggcgc 360

accttcacca?ccacctcccg?gctcagctcg?cgctccccca?cccgcccgcc?gggcccttcc 420

cggagggagc?cgagccgggc?gtcctggagg?agcccaaccg?cgtccagctg?cctttcccat 480

ggatgaagtc?taccaaagct?cacgcgtgga?aaggccagtg?ggcaggcggc?gcctacgctg 540

cggagccgga?ggagaacaag?cggacgcgca?cggcctacac?gcgcgcacag?ctgctagagc 600

tggagaagga?gttcctattc?aacaagtaca?tctcacggcc?gcgccgggtg?gagctggctg 660

tcatgttgaa?cttgaccgag?agacacatca?agatctggtt?ccaaaaccgc?cgcatgaagt 720

ggaaaaagga?ggaggacaag?aagcgcggcg?gcgggacagc?tgtcgggggt?ggcggggtcg 780

cggagcctga?gcaggactgc?gccgtgacct?ccggcgagga?gcttctggcg?ctgccgccgc 840

cgccgccccc?cggaggtgct?gtgccgcccg?ctgcccccgt?tgccgcccga?gagggccgcc 900

tgccgcctgg?ccttagcgcg?tcgccacagc?cctccagcgt?cgcgcctcgg?cggccgcagg 960

aaccacgatg?agaggcagga?gctgctcctg?gctgaggggc?ttcaaccact?cgccgaggag 1020

gagcagaggg?cctaggagga?ccccgggcgt?ggaccacccg?ccctggcagt?tgaatggggc 1080

ggcaattgcg?gggcccacct?tagaccgaag?gggaaaaccc?gctctctcag?gcgcatgtgc 1140

cagttggggc?cccgcgggta?gatgccggca?ggccttccgg?aagaaaaaga?gccattggtt 1200

tttgtagtat?tggggccctc?ttttagtgat?actggattgg?cgttgtttgt?ggctgttgcg 1260

cacatccctg?ccctcctaca?gcactccacc?ttgggacctg?tttagagaag?ccggctcttc 1320

aaagacaatg?gaaactgtac?catacacatt?ggaaggctcc?ctaacacaca?cagcggggaa 1380

gctgggccga?gtaccttaat?ctgccataaa?gccattctta?ctcgggcgac?ccctttaagt 1440

ttagaaataa?ttgaaaggaa?atgtttgagt?tttcaaagat?cccgtgaaat?tgatgccagt 1500

ggaatacagt?gagtcctcct?cttcctc 1527

<210>2

<211>283

<212>PRT

＜213〉homo sapiens (Homo Sapies)

<400>2

Met?Asn?Gly?Glu?Glu?Gln?Tyr?Tyr?Ala?Ala?Thr?Gln?Leu?Tyr?Lys?Asp

1 5 10 15

Pro?Cys?Ala?Phe?Gln?Arg?Gly?Pro?Ala?Pro?Glu?Phe?Ser?Ala?Ser?Pro

20 25 30

Pro?Ala?Cys?Leu?Tyr?Met?Gly?Arg?Gln?Pro?Pro?Pro?Pro?Pro?Pro?His

35 40 45

Pro?Phe?Pro?Gly?Ala?Leu?Gly?Ala?Leu?Glu?Gln?Gly?Ser?Pro?Pro?Asp

50 55 60

Ile?Ser?Pro?Tyr?Glu?Val?Pro?Pro?Leu?Ala?Asp?Asp?Pro?Ala?Val?Ala

65 70 75 80

His?Leu?His?His?His?Leu?Pro?Ala?Gln?Leu?Ala?Leu?Pro?His?Pro?Pro

85 90 95

Ala?Gly?Pro?Phe?Pro?Glu?Gly?Ala?Glu?Pro?Gly?Val?Leu?Glu?Glu?Pro

100 105 110

Asn?Arg?Val?Gln?Leu?Pro?Phc?Pro?Trp?Met?Lys?Ser?Thr?Lys?Ala?His

115 120 125

Ala?Trp?Lys?Gly?Gln?Trp?Ala?Gly?Gly?Ala?Tyr?Ala?Ala?Glu?Pro?Glu

130 135 140

Glu?Asn?Lys?Arg?Thr?Arg?Thr?Ala?Tyr?Thr?Arg?Ala?Gln?Leu?Leu?Glu

145 150 155 160

Leu?Glu?Lys?Glu?Phe?Leu?Phe?Asn?Lys?Tyr?Ile?Ser?Arg?Pro?Arg?Arg

165 170 175

Val?Glu?Leu?Ala?Val?Met?Leu?Asn?Leu?Thr?Glu?Arg?His?Ile?Lys?Ile

180 185 190

Trp?Phe?Gln?Asn?Arg?Arg?Met?Lys?Trp?Lys?Lys?Glu?Glu?Asp?Lys?Lys

195 200 205

Arg?Gly?Gly?Gly?Thr?Ala?Val?Gly?Gly?Gly?Gly?Val?Ala?Glu?Pro?Glu

210 215 220

Gln?Asp?Cys?Ala?Val?Thr?Ser?Gly?Glu?Glu?Leu?Leu?Ala?Leu?Pro?Pro

225 230 235 240

Pro?Pro?Pro?Pro?Gly?Gly?Ala?Val?Pro?Pro?Ala?Ala?Pro?Val?Ala?Ala

245 250 255

Arg?Glu?Gly?Arg?Leu?Pro?Pro?Gly?Leu?Ser?Ala?Ser?Pro?Gln?Pro?Ser

260 265 270

Ser?Val?Ala?Pro?Arg?Arg?Pro?Gln?Glu?Pro?Arg

275 280

<210>3

<211>19

<212>DNA

＜213〉homo sapiens (Homo Sapies)

<400>3

agttcctatt?caacaagta 19

<210>4

<211>19

<212>DNA

＜213〉homo sapiens (Homo Sapies)

<400>4

agttcctatt?caacaagta 19

<210>5

<211>19

<212>DNA

＜213〉homo sapiens (Homo Sapies)

<400>5

cttgaccgag?agacacatc 19

<210>6

<211>19

<212>DNA

＜213〉homo sapiens (Homo Sapies)

<400>6

tgaccgagag?acacatcaa 19

<210>7

<211>18

<212>DNA

＜213〉artificial sequence

<400>7

actaccgttg?tataggtg 18

<210>8

<211>18

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>8

agccggagga?gaacaagc 18

<210>9

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>9

ttcaacatga?cagccagctc 20

<210>10

<211>18

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>10

agccggagga?gaacaagc 18

<210>11

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>11

ttcaacatga?cagccagctc 20

<210>12

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>12

ggaaccaatt?cagtcgacga?attc 24

<210>13

<211>24

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>13

gctgggtcta?gaccaagctt?ttcc 24

<210>14

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>14

aguuccuauu?caacaaguau?u 21

<210>15

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>15

uuccuauuca?acaaguacau?u 21

<210>16

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>16

cuugaccgag?agacacaucu?u 21

<210>17

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>17

ugaccgagag?acacaucaau?u 21

<210>18

<211>20

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>18

acuaccguug?uauagguguu 20

Claims

1. one kind can be suppressed the construction that PDX-1 expresses, and it is characterized in that described construction has with the following formula I structure:

Seq _Forward-X-Seq _OppositelyFormula I,

2. construction as claimed in claim 1 is characterized in that, described Seq _ForwardOr Seq _OppositelyBe selected from down group:

3. a recombinant vectors is characterized in that, contains the described construction of claim 1 in the described carrier.

4. the adenovirus of a reorganization is characterized in that, contains a recombinant expression cassettes in the genome of described adenovirus, and described recombinant expression cassettes contains the described construction of claim 1.

5. adenovirus as claimed in claim 4 is characterized in that, described recombinant expression cassettes from 5 ' to 3 ' contains following element successively:

The rna plymerase iii promotor;

The described construction of claim 1; With

Terminator.

6. the purposes of the described adenovirus of claim 4 is characterized in that, is used to prepare the medicine of treatment PDX-1 gene high expression relative disease.

7. purposes as claimed in claim 6 is characterized in that, described PDX-1 gene high expression relative disease is a tumour.

8. purposes as claimed in claim 7 is characterized in that, described tumour is selected from:

9. a pharmaceutical composition is characterized in that, described pharmaceutical composition comprises:

The described adenovirus of the claim 4 of significant quantity; With

The carrier compatible with described adenovirus.

10. a method for the treatment of tumour is characterized in that, described method comprises the described adenovirus of the claim 4 that gives the tumour patient significant quantity.