CN101343666B - Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof - Google Patents
Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof Download PDFInfo
- Publication number
- CN101343666B CN101343666B CN2008100632260A CN200810063226A CN101343666B CN 101343666 B CN101343666 B CN 101343666B CN 2008100632260 A CN2008100632260 A CN 2008100632260A CN 200810063226 A CN200810063226 A CN 200810063226A CN 101343666 B CN101343666 B CN 101343666B
- Authority
- CN
- China
- Prior art keywords
- pcr
- nos
- primer
- camv
- pcr reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a multiple PCR detection reagent kit for insect-resistant transgene paddy rice and a detection method thereof. The multiple PCR detection reagent kit mainly comprises the following primer sequences: CaMV-F: GCTCCTACAAATGCCATCA, CaMV-R: GATAGTGGGATTGTGCGTCA, Nos-F: CATGACGTTATTTATGAGATGGG, Nos-R: GACACCGCGCGCGATAATTTATCC, Bt-F: GAAGGTTTGAGCAATCTCTAC, Bt-R: CGATCAGCCTAGTAAGGTCGT. The invention mainly has the advantages that the existing domestic insect-resistant transgene paddy rice can be quickly and accurately detected only through one-time PCR, and the sensitivity can reach 0.1 percent; moreover, the cost is low, the accuracy rate is high, and the false positive rate is low.
Description
(1) technical field
The present invention relates to a kind of transgenic rice multiple PCR detection reagent kit and detection method that can detect 3~4 kinds of pest-resistant foreign genes simultaneously.
(2) background technology
Paddy rice is one of most important food crop.From first paddy rice transfer-gen plant since coming out in 1988, countries such as China, Japan, Thailand, Germany, Philippines, Switzerland, Britain, the U.S., Canada have obtained a series of achievements in paddy rice transgenic research field, many transgenic paddy rice kinds have entered field experiment, and constantly develop to the practicability direction.China's transgenic technology development is very fast, wherein, the paddy rice transgenic technology be China a few have one of transgenic technology of international competitiveness, and receive much attention, existing many parts of transgenic paddy rice materials are got permission environment and are discharged, and wherein 4 parts of pest-resistant transgenic rices and 1 part of disease-resistant transgenic paddy rice have begun to apply for safety certificate.Yet incidents such as China's " the Hubei transgenic pest-resistant rice is illegally planted " of emerging in large numbers in succession, " heinz's nutritious instant rice cereal is sneaked into transgene component " have proposed very urgent requirement for the security control of China's transgenic paddy rice in recent years.For this reason, carrying out the detection method of the main transgenic paddy rice of China's independent development will be significant to China's transgenic paddy rice security control.
(Polymerase Chain Reaction is to utilize a pair of and target sequence complementary primer PCR) to polymerase chain reaction, is issued to the technology of amplification target sequence in the effect of archaeal dna polymerase, can be used for gene test.Have many pieces both at home and abroad about utilizing PCR method transgenic product to be carried out the bibliographical information of qualitative detection, but mostly be to increase at a foreign gene, promptly adopt target sequence of single a pair of Oligonucleolide primers amplification, this method is usually only at certain transgenosis or its product, can only satisfy a kind of detection needs of or a few transformed variety, detection method is loaded down with trivial details, working routine repeats and expends the plenty of time, be not suitable for the detection of batch samples, can not satisfy the requirement that speeds passage through customs in the work at present.(Multiplex Polymerase ChainReaction MPCR) also claims composite PCR to multiplex PCR, is a kind of special P CR technology, and is more faster, more economical than single PCR reaction, only needs 1 PCR reaction, just can detect a plurality of target genes simultaneously.This method has bigger reliability and adaptability, and can reduce and detect cost.This technology is used more in animal virus sexually transmitted disease and human diseases detection at present.Shao Biying application multiplex PCRs such as (2002) has been studied the detection of several transgene components in the transgenosis flowers (external source cauliflower mosaic virus CaMV35S promotor, rouge alkali synthetase Nos terminator, neomycin phosphotransferase gene Npt II); Wang Yuan (2004), Xu Jingsheng (2005), Zhang Ping flat (2007) etc. adopt composite PCR that transgene component in the genetically engineered soybean (CaMV35S promotor, Nos terminator, the EPSPS gene of resistance glyphosate) is studied; Wu Ying etc. (2006) also detect genetically engineered soybean (CaMV35S promotor, Nos terminator, lectin lectin gene).
Use multiplex PCR and detect the genetically modified report that also has, but shortcoming is all arranged.Wu Ying etc. (2006) have studied the triple PCR analytical procedure of CaMV35S, NPT II and hygromycin phosphotransferase gene Hpt in the transgenic paddy rice.Only detected exogenous promoter and selection markers gene in this report, ignored detection target gene.Along with the development of transgenic technology, the transgenic paddy rice that has obtained safety certificate has at present all been rejected the selection markers gene.Therefore, this technology is equal to the amplification of single primer CaMV35s from the practical standpoint of transgenic paddy rice detection.Li Weifeng application such as (2007) multiple PCR technique has been set up the method that detects foreign gene compositions such as CaMV35S promotor, NoS terminator, Hpt, Bt toxoprotein gene Cry1Ab and GUS in the rice paddy seed.The used concentration difference of different primers in this method, span is from 0.2~1.5uM, PCR result utilizes 6% polyacrylamide gel electrophoresis and silver-colored dyeing technique to come analytical results, and actually operating is loaded down with trivial details and can only detect this a kind of external source anti insect gene of Cry 1 Ab in the Bt toxoprotein gene.
Progress at present transgenic paddy rice research and development, multiple Bt gene and other anti insect genes have been applied in the paddy rice transgenic research, trend in conjunction with China's transgenic paddy rice research and development and marketing development, developing a kind of method that can detect foreign gene compositions such as ubiquitous CaMV35S promotor in the transgenic paddy rice, Nos terminator, Hpt, Bt toxoprotein gene (Cry 1 Ab, Cry 1 Ac or both fusion genes) and cylinder beans trypsin inhibitor gene Cpti simultaneously just seems and is necessary very much.
(3) summary of the invention
The object of the invention provides a kind of accurate, quick, easy, time saving and energy saving pest-resistant transgenic rice detection method.
The technical solution used in the present invention is:
A kind of transgenic rice multiple PCR detection reagent kit mainly comprises following primer sequence:
CaMV-F: GCTCCTACAAATGCCATCA;
CaMV-R: GATAGTGGGATTGTGCGTCA;
Nos-F: CATGACGTTATTTATGAGATGGG;
Nos-R: GACACCGCGCGCGATAATTTATCC;
Bt-F: GAAGGTTTGAGCAATCTCTAC;
Bt-R: CGATCAGCCTAGTAAGGTCGT。
Further, described test kit is a quadruple PCR test kit, and primer sequence is as follows:
CaMV-F: GCTCCTACAAATGCCATCA;
CaMV-R: GATAGTGGGATTGTGCGTCA;
Nos-F: CATGACGTTATTTATGAGATGGG;
Nos-R: GACACCGCGCGCGATAATTTATCC;
Bt-F: GAAGGTTTGAGCAATCTCTAC;
Bt-R: CGATCAGCCTAGTAAGGTCGT;
Hpt-F:TAG?GAG?GGC?GTG?GAT?ATG?TC;
Hpt-R:TAC?ACA?GCC?ATC?GGT?CCA?GA。
Perhaps, primer sequence is:
CaMV-F: GCTCCTACAAATGCCATCA;
CaMV-R: GATAGTGGGATTGTGCGTCA;
Nos-F: CATGACGTTATTTATGAGATGGG;
Nos-R: GACACCGCGCGCGATAATTTATCC;
Bt-F: GAAGGTTTGAGCAATCTCTAC;
Bt-R: CGATCAGCCTAGTAAGGTCGT;
Cpti-F: AAA?ATG?AAG?AGC?ACC?ATC?TTC;
Cpti-R: TCT?AGA?GTT?CAT?CTT?TCT?CAT?CAT?C。
The present invention has enlarged the scope that detects external source goal gene in the pest-resistant transgenic rice by universal primer and the Cpti gene primer of selecting the Bt toxoprotein gene for use, and a PCR reaction can detect Cry 1Ab, Cry 1 Ac and 4 kinds of goal gene such as fusion gene and Cpti gene and transgenic paddy rice CaMV35s promotor and Nos terminator commonly used.The present invention simultaneously select for use primer be each primer concentration be 0.2uM etc. increase under the molar conditions, amplified production can effectively separate by once common agarose gel electrophoresis, method is simple.The method that the present invention set up only just can detect ubiquitous CaMV35S promotor, Nos terminator in the present pest-resistant transgenic rice simultaneously by a PCR reaction, Hpt gene, Bt toxoprotein gene (Cry 1 Ab, Cry 1 Ac or both fusion genes) or foreign gene composition such as Cpti gene, substantially comprised the external source transgene component that domestic pest-resistant transgenic rice is all, and sensitivity reaches 0.1% level, and superiority is very obvious.
The invention still further relates to a kind of transgenic rice multiple PCR detection method, comprising:
(1) choosing primer sequence mainly comprises:
CaMV-F: GCTCCTACAAATGCCATCA;
CaMV-R: GATAGTGGGATTGTGCGTCA;
Nos-F: CATGACGTTATTTATGAGATGGG;
Nos-R: GACACCGCGCGCGATAATTTATCC;
Bt-F: GAAGGTTTGAGCAATCTCTAC;
Bt-R: CGATCAGCCTAGTAAGGTCGT;
(2) extracting paddy DNA to be detected, is template with paddy DNA to be measured, carries out the PCR reaction in the PCR reaction system that comprises the described primer sequence of step (1);
Described PCR reaction system final concentration consists of:
PCR damping fluid final concentration is 1.5 * or 2 *
dNTPs 0.2mM
Each 0.2 μ M of primer sequence
Template DNA 1.0uL
Taq archaeal dna polymerase 0.02U/uL
Solvent is ddH
2O;
The PCR reaction conditions is:
94 ℃ of 5min; 94 ℃ of 30s, 58 ℃ of 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min;
(3) get the PCR reaction product and carry out agarose gel electrophoresis, specific band whether occurs, judge whether paddy rice to be measured contains corresponding foreign gene according to electrophoresis result.
PCR Buffer final concentration is 1 *, be meant that each component concentration of PCR Buffer is identical with each concentration of component among 1 * PCR Buffer in the reaction system, PCR Buffer final concentration is 2 *, be meant that then each concentration of component of PCR Buffer in the reaction system is 2 times of each concentration of component among 1 * PCR Buffer, by that analogy; During practical application, 10 * PCR Buffer of desirable certain volume dilutes according to the concentration of each component in reaction system, such as require PCR Buffer final concentration be 2 *, then negate answers 10 * PCR Buffer of 1/5 volume of system cumulative volume to get final product.10 * PCR Buffer composition is: 100mM Tris-HCl pH8.3,500mM KCl, 15mM MgCl
2
When described PCR was quadruple PCR, described method was as follows:
(1) it is as follows to choose primer sequence:
CaMV-F: GCTCCTACAAATGCCATCA;
CaMV-R: GATAGTGGGATTGTGCGTCA;
Nos-F: CATGACGTTATTTATGAGATGGG;
Nos-R: GACACCGCGCGCGATAATTTATCC;
Bt-F: GAAGGTTTGAGCAATCTCTAC;
Bt-R: CGATCAGCCTAGTAAGGTCGT;
Hpt-F: TAG?GAG?GGC?GTG?GAT?ATG?TC;
Hpt-R: TAC?ACA?GCC?ATC?GGT?CCA?GA;
(2) extracting paddy DNA to be detected, is template with paddy DNA to be measured, carries out the PCR reaction in the PCR reaction system that comprises the described primer sequence of step (1);
Described PCR reaction system final concentration consists of:
PCR damping fluid final concentration is 1.5 *
dNTPs 0.2mM
Each 0.2 μ M of primer sequence
Template DNA 1.0uL
Taq archaeal dna polymerase 0.02 U/uL
Solvent is ddH
2O;
The PCR reaction conditions is:
94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min;
(3) get the PCR reaction product and carry out agarose gel electrophoresis, specific band whether occurs, judge whether paddy rice to be measured contains corresponding foreign gene according to electrophoresis result.
Perhaps, described method is as follows:
A) it is as follows to choose primer sequence:
CaMV-F: GCTCCTACAAATGCCATCA;
CaMV-R: GATAGTGGGATTGTGCGTCA;
Nos-F: CATGACGTTATTTATGAGATGGG;
Nos-R: GACACCGCGCGCGATAATTTATCC;
Bt-F: GAAGGTTTGAGCAATCTCTAC;
Bt-R: CGATCAGCCTAGTAAGGTCGT;
Cpti-F: AAA?ATG?AAG?AGC?ACC?ATC?TTC;
Cpti-R: TCT?AGA?GTT?CAT?CTT?TCT?CAT?CAT?C;
B) extracting paddy DNA to be detected, is template with paddy DNA to be measured, carries out the PCR reaction in the PCR reaction system that comprises the described primer sequence of step (1);
Described PCR reaction system final concentration consists of:
PCR damping fluid final concentration is 2 *
dNTPs 0.2mM
Each 0.2 μ M of primer sequence
Template DNA 8.0ng/uL
Taq archaeal dna polymerase 0.02 U/uL
Solvent is deionization H
2O;
The PCR reaction conditions is:
94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min;
C) get the PCR reaction product and carry out agarose gel electrophoresis, specific band whether occurs, judge whether paddy rice to be measured contains corresponding foreign gene according to electrophoresis result.
The PCR reaction system that conventional PCR selected for use during the transgenic pest-resistant rice qualitative PCR detected is generally 1 * PCR damping fluid, the single primer of 0.2mM dNTPs, 0.5uM, 0.1uL Taq archaeal dna polymerase (5U/uL), PCR reaction conditions: 94 ℃ of 5min; 94 ℃ of 30s, 55 ℃ of 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min.The multiple PCR technique system that the present invention set up and optimized the detection pest-resistant transgenic rice by the concentration and the primer concentration of the combination of selecting different primers for use, different PCR damping fluids on this basis.
The target fragment of the primer amplification all was the short-movie section less than 500bp during transgenic product detected, because the DNA major part that the transgenic product after processing is extracted is the fragment of having degraded.In multi-PRC reaction, under high salt concn amplification is better for the primer of short-movie section amplified production, and high salt concentration can make the long segment amplified production be difficult to sex change and unwind, and is difficult to effectively be increased.Triple PCR of the present invention detect use when CaMV35s, Nos and Bt and quadruple PCR detect CaMV35s, Nos, Bt and Cpti the PCR buffer concentration be 2.0 *, primer concentration 0.2Um, 60 ℃ of effective amplifications that promptly can guarantee each primer of annealing temperature have reduced the interference of primer dimer and the generation of non-special band again.Selecting buffer concentration when quadruple PCR detects CaMV35s, Nos, Bt and hpt is 1.5x, primer concentration 0.2uM, and 60 ℃ of effective amplifications that promptly can guarantee hpt and other primers of annealing temperature have reduced the generation of primer dimer again.
Several foreign genes of the paddy rice that the present invention detected are compositions that China uses always when the transgenic pest-resistant rice that advances into the security production phase, so the present invention has practicality; Secondly, method of the present invention can shorten detection time, and single sample detects the 1 day time that only needs from the specimen preparation to result; It is conventional qualitative PCR and plain agar sugar detected through gel electrophoresis that the present invention detects method therefor, only needs conventional at present molecular biology reagent, and cost is low; Detection sensitivity height of the present invention in addition, 0.1% level that can be up to state standards and formulate detects than single primer PCR simultaneously, accuracy rate height of the present invention, the false positive ratio is low.Operate comparison by different PCR instrument comparison and detection and different testing staff and all can obtain stable detected result.
Beneficial effect of the present invention is mainly reflected in: only a PCR can fast, accurately detect current domestic pest-resistant transgenic rice, and sensitivity can reach 0.1%, and cost is low, accuracy rate is high, and false positive rate is low.
(4) description of drawings
Fig. 1 is different PCR buffer concentrations and primer concentration triple PCR amplification contrast next time;
Fig. 2 is the quadruple pcr amplification result contrasts next time of different PCR buffer concentrations;
Fig. 3 be a quadruple PCR reaction detection transgenic paddy rice 4 foreign genes (CaMV35s, Nos, Bt, Cpti);
Fig. 4 is the multiplex PCR detected result of different templates concentration;
Fig. 5 is the multiplex PCR detected result of different gm contents;
Fig. 6 is the multiplex PCR detected result of different anti insect gene.
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1:
1, the PCR primer is synthetic:
The Nos primer sequence that CaMV 35s, Bt primer sequence, the GB GB/T19495.4-2004 that provides according to No. 953 bulletin-6-2007 of the Ministry of Agriculture provides, the sequences Design primer in 122~966 zones of hygromycin resistance Hpt gene of logining on Cpti primer sequence that He Longfei etc. (2007) provide and the ncbi database, and entrust the handsome company in Shanghai synthetic, primer sequence information sees Table 1:
Table 1
The primer title | Sequence (5 '-3 ') | Target segment size bp |
CaMV 35s | CaMV-F:GCTCCTACAAATGCCATCA CaMV-R:GATAGTGGGATTGTGCGTCA | 195 |
Nos | nos-F:CATGACGTTATTTATGAGATGGG nos-R:GACACCGCGCGCGATAATTTATCC | 118 |
Bt | Bt-F:GAAGGTTTGAGCAATCTCTAC Bt-R:CGATCAGCCTAGTAAGGTCGT | 301 |
Cpti | Cpti-F:AAA?ATG?AAG?AGC?ACC?ATC?TTC Cpti-R:TCTAGA?GTTCATCTTTCTCATCAT?C | 415 |
Hpt | Hpt-F:TAG?GAG?GGC?GTG?GATATG?TC Hpt-R:TAC?ACA?GCC?ATC?GGT?CCA?GA | 845 |
2, a small amount of of sample DNA is extracted:
The extraction of rice paddy seed DNA is specially according to No. 953 bulletin-6-2007 of the national Ministry of Agriculture:
Extract:
6.93% glucose, 2.0% polyvinylpyrrolidone (PVP-K30), 0.1%DIECA (diethyldithiocarbamic acid)
0.1mol/L Tris-HCl (pH7.5) 5mmol/L EDTA (pH8.0), the beta-mercaptoethanol of adding 0.2% (V/V) during use.
Lysate:
1.4M sodium-chlor, 2.0% cetyl trimethylammonium bromide (CTAB), 2.0% polyvinylpyrrolidone (PVP-K30), 0.1%gDIECA, 0.1mol/L Tris-HCl (pH7.5), the beta-mercaptoethanol of adding 0.2% (V/V) when 1mmol/LEDTA (pH8.0) uses.
The excellent section of transgenic paddy rice II of academy of agricultural sciences, Fujian research and development rich No. 6 and excellent bright 86 the paddy of receptor II are clayed into power respectively, (wherein transgenic paddy rice takes by weighing 2 parts as parallel sample to take by weighing 200mg in the 1.5mL centrifuge tube respectively, negative control takes by weighing 1 part) add 1mL and be chilled to 4 ℃ extract in advance, after acutely shaking mixing, leave standstill 5min on ice, the centrifugal 15min of 10000g abandons supernatant liquor under 4 ℃ of conditions.Add 600 μ L and be preheating to 65 ℃ lysate, abundant resuspended precipitation keeps 40min at 65 ℃ of constant temperature, during put upside down mixing 5 times.Under the room temperature condition, the centrifugal 10min of 10000g gets supernatant liquor and goes in another new centrifuge tube.Use equal-volume phenol respectively: chloroform: primary isoamyl alcohol solution and chloroform: each extracting of primary isoamyl alcohol solution once.Under the room temperature condition, the centrifugal 10min of 10000g gets supernatant liquor and goes in another new centrifuge tube.Add 2/3 volume Virahol, 1/10 volume 3mol/L sodium acetate solution (pH5.6), under 4 ℃ of conditions, the centrifugal 15min of 10000g abandons supernatant liquor, with 70% washing with alcohol precipitation once, pours out ethanol, dries precipitation.Add 50 μ L TE (pH8.0) dissolution precipitations, add 2.0 μ L RNase A, 37 ℃ of constant temperature keep 30min.Gained solution is sample DNA solution.
Measure and write down its uv absorption rate after dna solution suitably diluted, calculate DNA concentration according to the OD260 value at 260nm and 280nm.
3, multiplex PCR amplification
3.1 triple PCR:
Carrying DNA dilution is concentration 200ng/uL, the PCR reaction system consists of: PCR damping fluid final concentration is 0.4 *, 0.8 *, 1 *, 1.5 *, 2.0 * or 2.5 *, 0.2mM dNTPs, primer Camv35s, no, each 0.2uM of bt or 0.4uM, template DNA 1.0uL, 0.1uL Taq archaeal dna polymerase (5U/uL) replenishes ddH
2O is adjusted into 25ul to volume.
PCR reaction conditions: 94 ℃ of 5min; 94 ℃ of 30s, 58 ℃ of 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min.The results are shown in accompanying drawing 1.
Fig. 1 is different PCR buffer concentrations and primer concentration triple PCR amplification contrast next time; Can detect transgenic paddy rice 3 foreign genes (Camv35s, no, bt), swimming lane 1 negative contrast, 2,3 by repeat to be carried the transgenic paddy rice sample DNA 2 times on PTC-100 type PCR instrument; 4 and 5 by repeat to be carried the transgenic paddy rice sample DNA 2 times on PTC-200 type PCR instrument; Wherein primer concentration is 0.2uM among a and the b; Primer concentration is 0.4uM among the c.
3.2 quadruple PCR:
3.2.1 carrying DNA dilution is concentration 200ng/uL, the PCR reaction system is: PCR damping fluid final concentration is 1.0 *, 1.5 * or 2.0 *, 0.2mM dNTPs, primer Camv35s, Nos, Bt, each 0.2uM of Hpt primer, template DNA 1.0uL, 0.1uL Taq archaeal dna polymerase (5U/uL) replenishes ddH
2O is adjusted into 25ul to volume.
PCR reaction conditions: 94 ℃ of 5min; 94 ℃ of 30s, 55 ℃ or 60 ℃ 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min.The results are shown in accompanying drawing 2.
Fig. 2 is the quadruple pcr amplification result contrasts next time of different PCR buffer concentrations; Can detect 4 foreign gene (Camv35s of transgenic paddy rice, nos, bt, hpt), wherein scheme swimming lane 1 among a, 2 for rich No. 62 times DNA of the excellent section of I in Rice I are amplification on the PTC-100 in PCR instrument model, and swimming lane 3,4 is amplification on the PTC-200 for rich No. 62 times DNA of the excellent section of I in Rice I in PCR instrument model; Swimming lane 5 negative contrast II excellent bright 86; M is the DNA ladder of 100bp; Swimming lane 1 negative contrast II is excellent bright 86 among the figure b, and swimming lane 2,3 is amplification on the PTC-100 for rich No. 62 times DNA of the excellent section of I in Rice I in PCR instrument model, and swimming lane 4,5 is rich No. 62 times DNA of the excellent section of I in Rice I in PCR instrument model is amplification on the PTC-200; Swimming lane; M is the DNA ladder of 100bp; Swimming lane 1,2 is amplification on the PTC-100 for rich No. 62 times DNA of the excellent section of I in Rice I in PCR instrument model among the figure c, and swimming lane 3,4 is amplification on the PTC-200 for rich No. 62 times DNA of the excellent section of I in Rice I in PCR instrument model; Swimming lane 5 negative contrast II excellent bright 86; M is the DNA ladder of 100bp.
3.2.2 carrying DNA dilution is concentration 200ng/uL, and the PCR reaction system is: PCR damping fluid final concentration is 2 *, 0.2mMdNTPs, wherein Camv35s, nos, bt, each 0.2uM primer of cpti primer, template DNA 1.0uL, 0.1uL Taq archaeal dna polymerase (5U/uL) replenishes ddH
2O is adjusted into 25ul to volume.PCR reaction conditions: 94 ℃ of 5min; 94 ℃ of 30s, 55 ℃ or 60 ℃ 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min.
When annealing temperature is 60 ℃, the results are shown in accompanying drawing 3, wherein swimming lane 1,2 is carried the transgenic paddy rice sample DNA by 2 repetitions on PTC-100; 3,4 by repeat to be carried the transgenic paddy rice sample DNA 2 times on PTC-200; Swimming lane 5 detects the result of positive transgenic paddy rice for another trier.More than experiment is repeated 2 times by different operator on different model PCR instrument.
4, detected result is judged
The PCR product is with 2.0% sepharose, and staining agent bromination ingot concentration is 0.5ug/mL, gets pcr amplification product 7.0uL, and electrophoresis 1h under the 4V/cm condition carries out interpretation of result with Gel Doc gel imaging system.Detected result is seen accompanying drawing.
By accompanying drawing as seen, the Hpt gene primer of amplification 845bp fails to detect amplified band among the present invention under 2.0 * PCR buffer concentration.The no primer extension product of short-movie section 118bp amplification efficiency under 1.5~2.0 * PCR buffer concentration is stable.The camv35s primer disappears at the non-specific band of 500bp under 2.0 * buffer concentration.3 primers are without any amplification when 0.4 * Buffer concentration, and the Bt primer does not obtain amplification under 0.8 times concentration.Three kinds of primer concentrations are 0.2 with during 0.5uM, the difference of not seeing tangible amplification efficiency, and just primer dimer is obvious when 0.5uM, has disturbed the analysis of short-movie section amplified production.
Embodiment 2: utilize multiple PCR technique to detect the transgenic pest-resistant rice of different templates concentration
1, according to described synthetic primer of embodiment 1 method and the extraction excellent section of transgenic paddy rice II rich No. 6 and excellent bright 86 the DNA of receptor II, measuring DNA concentration is 400ng/uL;
2, with the TE damping fluid carrying sample DNA is diluted in proportion be 200,100,50,25ng/uL;
3, carrying out 3 heavy PCR reactions by embodiment 1 step 3.1, the PCR buffer concentration is 2.0 *, primer concentration 0.2uM;
4,4 carry out electrophoresis and analysis set by step, electrophoresis result is seen Fig. 4.
Annotate: swimming lane 1~5 is respectively template DNA concentration 400,200,100,50,25ng/uL; Swimming lane 6 negative contrasts.
Conclusion: drawing triple PCR by picture 4 can detected minimum template concentrations be 1ng/uL.
Embodiment 3: utilize multiple PCR technique to detect different gm contents
1, according to the described synthetic primer of embodiment 1 method with to extract transgenosis content respectively be 1.0% and 0.1% the excellent section of transgenic paddy rice II rich No. 6 and excellent bright 86 the DNA of receptor II, measuring DNA concentration and with the TE damping fluid carrying sample DNA being diluted is 200ng/uL.
2, carrying out 3 heavy PCR reactions by embodiment 1 step 3.1, the PCR buffer concentration is 2.0 *, primer concentration 0.2uM, template DNA add 2.0uL and 5.0uL respectively;
3,4 carry out electrophoresis and analysis set by step, the results are shown in Figure 5.Annotate: swimming lane 12 is the sample of transgenic paddy rice content 1.0%, template add-on 2.0uL; Swimming lane 13 is 0.1% sample for transgenic paddy rice content, template add-on 2.0uL; Swimming lane 14 is the sample of transgenic paddy rice content 1.0%, template add-on 5.0uL; Swimming lane 15 is 0.1% sample for transgenic paddy rice content, template add-on 5.0uL.
Conclusion: drawing triple PCR by Fig. 5, can to detect transgenic paddy rice content be 0.1% biased sample.
Embodiment 4: utilize multiple PCR technique to detect different pest-resistant transgenic rices
1, according to the described synthetic primer of embodiment 1 method with to extract transgenic paddy rice China extensive No. 1 and acceptor respectively bright extensive 63, excellent No. 10 of transgenic paddy rice east dragon and acceptor Xian thereof, measuring DNA concentration and with the TE damping fluid carrying sample DNA being diluted is 200ng/uL.
2, carrying out 3 heavy PCR reactions by embodiment 1 step 3.1, the PCR buffer concentration is 2.0 *, primer concentration 0.2uM;
3,4 carry out electrophoresis and analysis set by step, the results are shown in Figure 6.
Fig. 6, swimming lane 1 are extensive No. 1 of transgenic paddy rice China; Swimming lane 2 is bright extensive 63; Swimming lane 3 is a transgenic paddy rice east dragon; Swimming lane 4 is excellent No. 10 of Xian; Swimming lane 5 is for extracting blank; M is 100bp DNALadder.
Conclusion: draw triple PCR by Fig. 6 and can detect different pest-resistant transgenic rice China extensive No. 1 (containing terminator Nos and goal gene Cry1Ac and Cry1Ab fusion gene) He Donglong (containing promotor Camv35s, terminator Nos, goal gene Cry1Ab).
Sequence table _ ST25
SEQUENCE?LISTING
<110〉China Paddy Rice Inst
<120〉a kind of pest-resistant transgenic rice multiple PCR detection reagent kit and detection method
<130>
<160>10
<170>PatentIn?version?3.4
<210>1
<211>19
<212>DNA
<213>Unknown
<220>
<223〉artificial sequence
<400>1
gctcctacaa?atgccatca 19
<210>2
<211>20
<212>DNA
<213>Unknown
<220>
<223〉artificial sequence
<400>2
gatagtggga?ttgtgcgtca 20
<210>3
<211>23
<212>DNA
<213>Unknown
<220>
<223〉artificial sequence
<400>3
catgacgtta?tttatgagat?ggg 23
<210>4
<211>24
<212>DNA
<213>Unknown
<220>
<223〉artificial sequence
<400>4
gacaccgcgc?gcgataattt?atcc 24
<210>5
<211>21
<212>DNA
<213>Unknown
<220>
<223〉artificial sequence
<400>5
gaaggtttga?gcaatctcta?c 21
<210>6
<211>21
<212>DNA
<213>Unknown
Sequence table _ ST25
<220>
<223〉artificial sequence
<400> 6
cgatcagcct?agtaaggtcg?t 21
<210> 7
<211> 21
<212> DNA
<213> Unknown
<220>
<223〉artificial sequence
<400> 7
aaaatgaaga?gcaccatctt?c 21
<2lO> 8
<2ll> 25
<212> DNA
<213> Unknown
<220>
<223〉artificial sequence
<400> 8
tctagagttc?atctttctca?tcatc 25
<2lO> 9
<211> 20
<212> DNA
<213> Unknown
<220>
<223〉artificial sequence
<400> 9
taggagggcg?tggatatgtc 20
<210> 10
<21l> 20
<212> DNA
<213> UnkDown
<220>
<223〉artificial sequence
<400> 10
tacacagcca?tcggtccaga 20
Claims (4)
1. pest-resistant transgenic rice multiple PCR detection reagent kit mainly comprises following primer:
CaMV-F:GCTCCTACAAATGCCATCA;
CaMV-R:GATAGTGGGATTGTGCGTCA;
Nos-F:CATGACGTTATTTATGAGATGGG;
Nos-R:GACACCGCGCGCGATAATTTATCC;
Bt-F:GAAGGTTTGAGCAATCTCTAC;
Bt-R:CGATCAGCCTAGTAAGGTCGT。
2. pest-resistant transgenic rice multiple PCR detection reagent kit is characterized in that primer is as follows in the described test kit:
CaMV-F:GCTCCTACAAATGCCATCA;
CaMV-R:GATAGTGGGATTGTGCGTCA;
Nos-F:CATGACGTTATTTATGAGATGGG;
Nos-R:GACACCGCGCGCGATAATTTATCC;
Bt-F:GAAGGTTTGAGCAATCTCTAC;
Bt-R:CGATCAGCCTAGTAAGGTCGT;
Hpt-F:TAG?GAG?GGC?GTG?GAT?ATG?TC;
Hpt-R:TAC?ACA?GCC?ATC?GGT?CCA?GA。
3. pest-resistant transgenic rice multiple PCR detection method comprises:
(1) choosing primer mainly comprises:
CaMV-F:GCTCCTACAAATGCCATCA;
CaMV-R:GATAGTGGGATTGTGCGTCA;
Nos-F:CATGACGTTATTTATGAGATGGG;
Nos-R:GACACCGCGCGCGATAATTTATCC;
Bt-F:GAAGGTTTGAGCAATCTCTAC;
Bt-R:CGATCAGCCTAGTAAGGTCGT;
(2) extracting paddy DNA to be detected, is template with paddy DNA to be measured, is comprising step (1)
Carry out the PCR reaction in the PCR reaction system of described primer;
Described PCR reaction system final concentration consists of:
The PCR reaction conditions is:
94 ℃ of 5min; 94 ℃ of 30s, 58 ℃ of 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min;
(3) get the PCR reaction product and carry out agarose gel electrophoresis, specific band whether occurs, judge whether paddy rice to be measured contains to deposit corresponding foreign gene according to electrophoresis result.
4. pest-resistant transgenic rice multiple PCR detection method is characterized in that described method is as follows:
(1) it is as follows to choose primer:
CaMV-F:GCTCCTACAAATGCCATCA;
CaMV-R:GATAGTGGGATTGTGCGTCA;
Nos-F:CATGACGTTATTTATGAGATGGG;
Nos-R:GACACCGCGCGCGATAATTTATCC;
Bt-F:GAAGGTTTGAGCAATCTCTAC;
Bt-R:CGATCAGCCTAGTAAGGTCGT;
Hpt-F:TAG?GAG?GGC?GTG?GAT?ATG?TC;
Hpt-R:TAC?ACA?GCC?ATC?GGT?CCA?GA;
(2) extracting paddy DNA to be detected, is template with paddy DNA to be measured, is comprising step (1)
Carry out the PCR reaction in the PCR reaction system of described primer;
Described PCR reaction system final concentration consists of:
The PCR reaction conditions is:
94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s of annealing temperature, 72 ℃ of 30s, 35 circulations; 72 ℃ of 3min;
(3) get the PCR reaction product and carry out agarose gel electrophoresis, specific band whether occurs, judge whether paddy rice to be measured contains corresponding foreign gene according to electrophoresis result.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2008100632260A CN101343666B (en) | 2008-07-23 | 2008-07-23 | Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2008100632260A CN101343666B (en) | 2008-07-23 | 2008-07-23 | Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101343666A CN101343666A (en) | 2009-01-14 |
CN101343666B true CN101343666B (en) | 2011-08-24 |
Family
ID=40245778
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2008100632260A Expired - Fee Related CN101343666B (en) | 2008-07-23 | 2008-07-23 | Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101343666B (en) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101724698B (en) * | 2009-12-18 | 2012-04-18 | 中国检验检疫科学研究院 | Method and special kit for testing whether rice to be tested is CpTI transgenic rice |
CN103160533B (en) * | 2013-03-19 | 2015-01-07 | 中国检验检疫科学研究院 | Standard molecule for specifically detecting transgenic rice strain Kefeng No.6 and application thereof |
CN105586411A (en) * | 2016-01-29 | 2016-05-18 | 江汉大学 | Method for detecting paddy rice transgenic ingredients |
CN106868137B (en) * | 2017-03-01 | 2021-01-26 | 浙江省农业科学院 | Multiple digital PCR quantitative detection method for transgenic rice |
CN107130049A (en) * | 2017-06-23 | 2017-09-05 | 苏州蔻美新材料有限公司 | A kind of molecular labeling and its application for being used to detect resistance glyphosate genetically engineered soybean |
CN114774567B (en) * | 2022-03-04 | 2023-06-16 | 江汉大学 | Primer pair combination, kit and detection method for detecting transgenic components of rice |
-
2008
- 2008-07-23 CN CN2008100632260A patent/CN101343666B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN101343666A (en) | 2009-01-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101343666B (en) | Pest-resistant transgenic rice multiple PCR detection reagent kit and detection method thereof | |
CN101624636B (en) | LAMP-LFD detection method of infectious spleen and kidney necrosis virus (ISKNV) | |
CN102162012B (en) | Qualitative PCR detection method for transgenic rice kefeng No. 6 | |
CN101824411B (en) | Flanking sequence of transgenic rice Kefeng No. 6 and qualitative PCR detection method | |
CN102634593A (en) | LAMP (mop-mediated isothermal amplification) detection primer group, kit and method for transgenic maize EVENT98140 and derived varieties thereof | |
CN104480202A (en) | Towel gourd reference gene and application thereof | |
CN104846081B (en) | Collard red autumnal leaves gene Re SSR marker and application | |
CN101875983A (en) | Method for rapidly detecting various viruses of melons | |
CN102888398A (en) | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof | |
CN105274258A (en) | Primer composition for detecting pepper mottle potyvirus as well as application of primer composition, kit consisting of primer composition and application of kit | |
CN102559854B (en) | Standard plasmid molecular used for detecting transgenic soybean, corn and cotton and construction of the standard plasmid molecular | |
CN101760555B (en) | Method for identifying single-copy transgenic tobacco based on PCR technology | |
CN102952858B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified rice strain KMD | |
CN102952856A (en) | PCR-DHPLC detection primers for transgenic rice line Kefeng 6 and detection method | |
CN104046697A (en) | SSR (Simple Sequence repeats) primer group based on Fraxinus Velutina Torr. transcriptome sequencing information development and application of primer group in germplasm identification | |
CN102952863B (en) | Multiplex PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified cotton | |
CN101792814A (en) | PCR method for detecting specificity of transformant of transgenic pest-resistant cotton GK12 | |
CN102154284B (en) | Molecular marker SIsv0408 capable of being closely linked to Setaria italica pollen color gene | |
CN104894280A (en) | Primer, kit and method for detecting transgenic maize NOS terminator | |
CN103834645A (en) | Connecting region sequence of exogenous inserting gene and flanking rice sequence of transgenic rice kefeng No.2 and application thereof | |
CN103834737B (en) | Transgenic rice Kefeng No.2 line specific PCR detection primer as well as qualitative detection method and kit | |
CN102952864B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain BT176 | |
CN102952860B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain BT11 | |
Mengpei et al. | A new DNA band display technology of microsatellite DNA | |
CN102952862B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain MON89034 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110824 Termination date: 20120723 |